COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..1413020 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 172..753 product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098133.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS 1029..1811 product lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098132.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene argT CDS 2040..2822 product histidine ABC transporter substrate-binding protein HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731871.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene hisJ CDS 2901..3587 product histidine ABC transporter permease HisQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965518.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene hisQ CDS 3584..4300 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502590.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 4308..5081 product histidine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293612.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene hisP CDS complement(5201..5740) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446135.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(5811..6704) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028341.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(6723..7085) product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098127.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene folX CDS complement(7146..7775) product GSH-dependent disulfide bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566559.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene yfcG CDS 7910..8548 product glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365572.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene yfcF CDS 8745..9290 product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098123.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene yfcD CDS complement(9292..10311) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098122.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 10562..11005 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901818.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 11086..11358 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699818.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 11381..12772 product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681684.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 12769..13602 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098118.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 13595..14548 product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098117.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(14636..16777) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098116.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene pta CDS complement(16853..18055) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095707.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene ackA CDS 18395..18850 product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365578.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene yfbV CDS 18932..19426 product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098113.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 19437..20096 product sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013205.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 20171..22006 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098111.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(22106..22705) product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813857.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene yfbR CDS complement(22786..24000) product alanine transaminase AlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074527.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene alaA CDS 24930..25868 product transcriptional regulator LrhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029881734.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene lrhA CDS 26496..26939 product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062993.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene nuoA CDS 26955..27629 product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002913178.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene nuoB CDS 27717..29519 product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247855.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene nuoC CDS 29522..30022 product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545038.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene nuoE CDS 30019..31356 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800046.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene nuoF CDS 31515..34241 product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518099.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene nuoG CDS 34238..35215 product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098104.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene nuoH CDS 35230..35772 product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861491.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene nuoI CDS 35784..36335 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393511.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene nuoJ CDS 36332..36634 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612644.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene nuoK CDS 36631..38472 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832758.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene nuoL CDS 38581..40110 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098102.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene nuoM CDS 40117..41574 product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098101.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene nuoN CDS complement(41668..42675) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368546.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(42751..43668) product ribonuclease BN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817396.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene rbn CDS 43742..44203 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420256.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 44257..44559 product stress response protein ElaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070621.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene elaB CDS 44668..45963 product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191386.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene menF CDS 46052..47722 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116387.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene menD CDS 47719..48498 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600540.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene menH CDS 48495..49352 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640013.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene menB CDS 49352..50317 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706154.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene menC CDS 50314..51684 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098091.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene menE CDS 51785..52318 product YfaZ family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098023.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 52423..53622 product nicotinamide mononucleotide deamidase-related protein YfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098022.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(53732..54922) product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000358.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene glpC CDS complement(54919..56175) product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706148.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene glpB CDS complement(56165..57787) product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857281.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene glpA CDS 58282..58704 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705537.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(58897..59151) product ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533921.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene yfaE CDS complement(59151..60281) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098012.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene nrdB CDS complement(60392..62677) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076502.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene nrdA CDS complement(63012..63740) product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365620.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene ubiG CDS 63887..66523 product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706144.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene gyrA CDS complement(66596..68182) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986061.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 68353..69051 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094792.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 69237..70571 product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098287.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 70586..71566 product aldo/keto reductase AkrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245422.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene akrN CDS 71754..74600 product two-component system sensor histidine kinase RcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098008.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene rcsC CDS complement(74647..75300) product response regulator transcription factor RcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859405.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene rcsB CDS complement(75318..77966) product phosphotransferase RcsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619743.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene rcsD CDS 78804..79931 product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865526.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 80038..81090 product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706140.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene apbE CDS 81163..82227 product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786384.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene ada CDS 82227..82868 product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884975.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene alkB CDS 83115..84758 product multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098002.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 84843..86279 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098001.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene mgtE CDS complement(86242..87432) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098000.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 87869..89407 product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097999.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene mqo tRNA complement(89468..89544) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(89621..91381) product LPS biosynthesis-modulating metalloenzyme YejM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097996.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene yejM CDS complement(91400..91663) product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135586.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 91771..92778 product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097995.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene yejK CDS complement(92823..93107) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494192.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene rplY CDS complement(93232..94992) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578056.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 95276..95983 product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234850.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene rsuA CDS 95999..97195 product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097989.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 97516..97860 product YejG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094639.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(97864..99453) product microcin C ABC transporter ATP-binding protein YejF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097987.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene yejF CDS complement(99455..100480) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088916.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(100480..101574) product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501583.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(101584..103392) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602410.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(103599..104063) product bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619753.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene mepS CDS complement(104582..105298) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178088.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(105333..106319) product zinc-binding GTPase YeiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198816.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene yeiR CDS complement(106450..107916) product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091919.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 108124..109314 product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097978.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene uxuA CDS complement(109469..110041) product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365690.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene yeiP CDS 110130..110453 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365691.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(110450..111631) product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097970.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene setB CDS 111999..113129 product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097968.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene fruB CDS 113129..114067 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365695.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene fruK CDS 114084..115772 product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854408.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene fruA CDS complement(115822..116670) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873890.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene nfo CDS complement(116742..117785) product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097963.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 117878..118771 product DNA-binding transcriptional regulator YeiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548316.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene yieE CDS 119031..120431 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097961.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 120814..122691 product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420204.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene cirA CDS complement(122740..123576) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425456.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene yeiG CDS 123718..124866 product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097958.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 124971..125636 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097957.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene folE CDS 125652..126809 product DUF418 domain-containing protein YeiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440902.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene yeiB CDS 126965..127990 product HTH-type transcriptional regulator GalS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097955.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene galS CDS 128319..129275 product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036964.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene mglB CDS 129357..130877 product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255039.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene mglA CDS 130893..131903 product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097952.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene mglC CDS complement(131961..132200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(132416..132862) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096670.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(132872..133324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096671.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 133774..135000 product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097093.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(135003..135740) product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097950.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene sanA CDS complement(135871..136755) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097949.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene cdd CDS complement(136885..137580) product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097948.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(137577..137975) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045719.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 138207..139145 product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706102.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene dusC CDS 139424..140194 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097944.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(140312..140896) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365433.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 141037..141624 product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097942.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 141798..142748 product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295432.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene pbpG CDS complement(142749..143303) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097939.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(143409..145136) product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097938.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene dld CDS 145349..147616 product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097937.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene bglX CDS 147787..149031 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246197.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 149096..150013 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097936.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 150026..151180 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278105.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 151177..152124 product glycine betaine ABC transporter ATP binding protein YehX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569352.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene yehX CDS 152108..152839 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097933.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(152988..153719) product HTH-type transcriptional regulator MlrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240415.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene mlrA CDS 153943..155631 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097931.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 155625..156344 product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097930.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene btsR CDS 156357..156875 product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295430.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(156918..157376) product YehR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703137.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(157459..159501) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097928.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene metG CDS 159625..160734 product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005448.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene apbC CDS complement(160831..163263) product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209345.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(163268..164167) product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097441.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 164302..164964 product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420897.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene fsa CDS complement(165069..165824) product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097439.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene moeB CDS complement(165824..167059) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097438.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene moeA CDS 167261..168208 product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513761.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene iaaA CDS 168219..170090 product glutathione ABC transporter ATP-binding protein GsiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097436.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene gsiA CDS 170134..171672 product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097435.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene gsiB CDS 171914..172834 product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936066.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene gsiC CDS 172837..173748 product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704838.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene gsiD CDS complement(173859..175178) product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073304.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene rimO CDS 175376..175756 product biofilm formation regulator BssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259651.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene bssR CDS 175865..176980 product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097429.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(177005..178297) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210835.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(178301..179404) product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095405.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 179562..180572 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095404.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(180612..181238) product glutathione S-transferase GstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061831.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene gstB CDS 181613..182683 product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831210.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene dacC CDS complement(182690..183448) product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367546.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene deoR CDS complement(183517..184125) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520197.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene ybjG CDS 184422..185651 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097422.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(185686..186888) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217437.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(187039..187308) product DUF1471 family periplasmic protein YahO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848026.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene yahO CDS complement(187433..188569) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369193.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(188574..188897) product DUF3302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478193.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(189037..189705) product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261034.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 189906..190118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(190218..191894) product DUF4041 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195116.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(192546..194231) product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024851.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 194431..194880 product inner membrane protein YbjM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680848.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 195005..195727 product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097374.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene nfsA CDS 195802..196704 product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684361.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene rimK CDS 196781..197257 product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624817.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 197605..198714 product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097372.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene potF CDS 198810..199943 product putrescine ABC transporter ATP-binding subunit PotG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097371.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene potG CDS 199953..200906 product putrescine ABC transporter permease PotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097370.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene potH CDS 200903..201748 product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061634.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene potI CDS 201836..202291 product DUF2593 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763976.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 202334..203467 product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149762.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene rlmC CDS complement(203504..204235) product ABC transporter substrate-binding protein ArtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097364.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene artJ CDS complement(204498..205166) product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097363.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene artM CDS complement(205166..205882) product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001697.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene artQ CDS complement(205889..206620) product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756586.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene artJ CDS complement(206640..207368) product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367515.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene artP CDS complement(207591..208133) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097359.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 208214..209041 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097358.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 209041..209220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(209199..210212) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866904.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(210311..211738) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097337.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(211748..212749) product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097336.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene ltaE CDS complement(212787..214505) product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097335.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene poxB CDS 214747..215091 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704866.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(215129..216097) product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178665.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene hcr CDS complement(216110..217795) product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458773.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene hcp CDS complement(217905..218804) product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491116.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 219005..220663 product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704871.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(220660..221478) product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097328.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 221772..222887 product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097327.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene macA CDS 222884..224830 product macrolide ABC transporter ATP-binding protein/permease MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097326.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene macB CDS complement(224907..225140) product cold shock-like protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447499.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene cspD CDS 225469..225789 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006174393.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene clpS CDS 225818..228094 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934041.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene clpA CDS complement(228217..228435) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040187.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene infA CDS complement(228720..229424) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097324.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene aat CDS complement(229460..231181) product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704874.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene cydC CDS complement(231182..232948) product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097322.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene cydD CDS complement(233067..234035) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097321.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene trxB CDS 234271..234489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 234587..235081 product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228469.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene lrp CDS 235203..239042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 239171..239785 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976047.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene lolA CDS 239794..241137 product replication-associated recombination protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067785.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene rarA CDS 241230..242522 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886697.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene serS CDS 242719..245151 product dimethylsulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850303.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene dmsA CDS 245162..245779 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096798.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene dmsB CDS 245781..246644 product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097315.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 246908..248056 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097314.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(248144..248884) product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111043.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene pflA CDS complement(249076..251358) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097311.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene pflB CDS complement(251410..252267) product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097310.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene focA CDS complement(252671..254431) product 30S ribosomal protein S12 methylthiotransferase accessory factor YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420898.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene ycaO CDS 254569..255261 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642849.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 255424..256512 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882989.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene serC CDS 256585..257868 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097306.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene aroA CDS 258122..259543 product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096164.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 259518..261278 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644028.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 261424..262323 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262519.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 262453..263220 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792300.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 263394..264077 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125016.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene cmk CDS 264194..265867 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499966.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene rpsA CDS 266037..266324 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004100704.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene ihfB CDS 266582..268846 product ComEC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705734.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 268883..270631 product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097303.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene msbA CDS 270628..271611 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561698.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene lpxK CDS 271647..272876 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097301.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 272931..273113 product protein YcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097300.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene ycaR CDS 273110..273856 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011613.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene kdsB CDS 273985..274890 product YcbJ family phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097298.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(274855..275634) product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097297.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene elyC CDS 275753..276532 product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097296.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene cmoM CDS 276536..277858 product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097295.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene mukF CDS 277839..278543 product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295931.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene mukE CDS 278543..282997 product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704893.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene mukB CDS 283212..285044 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925899.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene ldtD CDS 285184..285777 product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097290.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 285799..286446 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097289.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(286527..287717) product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462680.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene aspC CDS complement(287903..289036) product porin OmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977709.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene ompF CDS complement(289636..291036) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117867.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene asnS CDS complement(291203..292405) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097285.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene pncB CDS 292669..295281 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097275.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene pepN CDS complement(295444..296211) product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097274.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene ssuB CDS complement(296208..296996) product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097273.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene ssuC CDS complement(297007..298152) product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055996.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene ssuD CDS complement(298149..299123) product aliphatic sulfonate ABC transporter substrate-binding protein SsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244308.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene ssuA CDS complement(299116..299691) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097270.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene ssuE CDS 299939..300949 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295352.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene pyrD CDS 301118..301660 product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220671.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene zapC CDS complement(301657..302766) product YcbX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097267.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 302866..304974 product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086472.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene rlmKL CDS 304985..306892 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704904.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 306923..308176 product membrane integrity-associated transporter subunit PqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027912.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene pqiA CDS 308181..309818 product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433416.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene pqiB CDS 309818..310384 product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097262.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene pqiC CDS 310642..310809 product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704906.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene rmf CDS complement(310864..311445) product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018747.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene fabA CDS complement(311452..313212) product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097259.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 313399..313851 product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877174.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene matP CDS complement(313918..314976) product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989142.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene ompA CDS complement(315331..315846) product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288692.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene sulA CDS complement(315861..316001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 316059..316688 product TfoX/Sxy family DNA transformation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097255.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(316673..318799) product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950867.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene yccS CDS complement(318817..319263) product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261222.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 319386..321440 product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420536.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene helD CDS complement(321484..321942) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424187.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene mgsA CDS complement(322054..322716) product DUF2057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097250.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 322886..323299 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301418.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(323468..323785) product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561983.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene hspQ CDS complement(323846..325036) product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097247.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene rlmI CDS 325130..325411 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097246.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene yccX CDS complement(325408..325737) product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904446.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene tusE CDS complement(325825..326484) product FtsH protease modulator YccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704916.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene yccA CDS complement(326774..330997) product autotransporter adhesin EhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386603.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene ehaA CDS 331499..333127 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097243.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 tRNA 333257..333344 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(333455..334675) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420953.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(334685..335449) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098479.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(335449..336486) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098478.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(336486..337484) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098477.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(337608..338609) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033652390.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(338606..339418) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705828.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(339582..340388) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040904057.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(340621..341568) product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797363.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(341568..342647) product cysteine protease StiP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182415.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(342649..343422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040057.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(343415..344548) product phosphoribosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280118.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(344566..345621) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035169.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(345699..345857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 345924..346505 product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254140.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 346505..347659 product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054787.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 347682..348137 product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007449.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 348159..349199 product tellurium resistance membrane protein TerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255079.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene terC CDS 349243..349821 product tellurium resistance membrane protein TerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116677.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene terD CDS 349892..350467 product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301248.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(350546..350722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 350679..350882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(351114..352724) product FAD-NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096935.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(352901..353140) product DinI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096351.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 353316..354557 product bifunctional glucose-1-phosphatase/inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012132910.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene agp CDS complement(354594..354821) product YccJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499832.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(354840..355457) product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170081.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene wrbA CDS complement(355548..356741) product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646142.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(356854..357750) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096673.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 358023..358541 product 2-oxo-tetronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235351.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 358770..358988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(359076..359339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(359361..360863) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003805.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene lysS CDS complement(360979..361524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 361718..361984 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433427.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 362076..363401 product putrescine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042659.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene potE CDS 363405..365543 product lysine decarboxylase CadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367858.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene cadA CDS 365690..366616 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097200.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(366613..367113) product pyrimidine utilization flavin reductase protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097198.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene rutF CDS complement(367123..367713) product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367246.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(367710..368525) product pyrimidine utilization protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001337722.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene rutD CDS complement(368530..368916) product pyrimidine utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097195.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene rutC CDS complement(368920..369618) product peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307708.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene rutB CDS complement(369618..370709) product pyrimidine utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326839.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene rutA CDS 370987..371625 product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097192.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene rutR CDS complement(371622..372017) product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882762.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(372104..376051) product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001356407.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene putA CDS 376469..377977 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018485.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene putP CDS 378207..379040 product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097186.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 379096..380223 product iron uptake system protein EfeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097185.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 380228..381511 product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097184.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene efeB CDS 382054..382842 product phosphate starvation-inducible protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097183.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene phoH CDS complement(382913..384325) product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096552.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(384396..385811) product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108116.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(385798..386907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 387692..388621 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262519.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 assembly_gap 388965..389053 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 389369..389701 product SMR family multidrug efflux protein EmrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070449.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene emrE CDS 390035..390514 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251083.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 assembly_gap 390680..390697 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 391100..392038 product glyoxylate/hydroxypyruvate reductase GhrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097178.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene ghrA CDS 392109..392846 product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367224.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 392866..393420 product molecular chaperone YcdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001921.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene ycdY CDS 393513..394004 product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337814.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(394052..394885) product curli production assembly/transport protein CsgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137620.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene csgG CDS complement(394916..395332) product curli production assembly/transport protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264088.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene csgF CDS complement(395360..395749) product curli production assembly/transport protein CsgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833288.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene csgE CDS complement(395754..396404) product biofilm master transcriptional regulator CsgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097171.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene csgD CDS 397148..397603 product curli minor subunit CsgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001360656.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene csgB CDS 397646..398095 product curli major subunit CsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771416.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene csgA CDS 398152..398481 product curli assembly chaperone CsgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992821.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene csgC CDS 398560..399102 product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857405.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene ymdB CDS 399086..400522 product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976323.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(400558..401688) product glucans biosynthesis protein MdoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097165.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene mdoC CDS 401931..403496 product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001562609.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene mdoG CDS 403489..406017 product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097163.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene mdoH CDS 406110..406337 product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237207.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(406338..406712) product MysB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180068.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(406806..408026) product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075040.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene mdtG CDS complement(408168..409088) product kdo(2)-lipid IV(A) lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062003.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene lpxL CDS 409309..410358 product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705028.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(410399..410974) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739886.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(410976..411542) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419093.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(411987..413108) product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872833.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene solA CDS complement(413228..413482) product biofilm formation regulator BssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500827.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene bssS CDS complement(413749..413994) product DNA damage-inducible protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217754.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene dinI CDS complement(414069..415115) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097150.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene pyrC CDS complement(415449..416009) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713057.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(416134..416781) product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780893.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene grxB CDS complement(416847..418055) product multidrug efflux MFS transporter MdtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097148.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene mdtH CDS 418267..418851 product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468182.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene rimJ CDS 418861..419502 product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877137.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 419504..420427 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097144.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 420536..422071 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419099.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene murJ CDS complement(422108..422530) product flagella biosynthesis chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197547.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene flgN CDS complement(422535..422831) product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097141.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene flgM CDS complement(422925..423584) product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194076.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene flgA CDS 423746..424162 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097139.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene flgB CDS 424166..424570 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097138.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene flgC CDS 424582..425259 product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097137.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene flgD CDS 425285..426559 product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885860.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene flgE CDS 426580..427335 product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097135.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 427351..428133 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625837.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene flgG CDS 428191..428889 product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857987.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene flgH CDS 428902..429999 product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518955.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 429999..430976 product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578683.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene flgJ CDS 431053..432699 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096470.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene flgK CDS 432713..433669 product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212768.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene flgL CDS complement(433742..434956) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097130.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 435056..435994 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165457189.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(436040..439255) product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705034.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene rne CDS 439853..440779 product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705035.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene rluC CDS complement(440824..441861) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815394.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(442052..442636) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028074.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 442778..443299 product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097124.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene yceD CDS 443349..443522 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857964.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene rpmF CDS 443548..444618 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197585.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene plsX CDS 444625..445578 product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288138.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene fabH CDS 445596..446525 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191346.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene fabD CDS 446544..447278 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008535.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene fabG CDS 447457..447693 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103754.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene acpP CDS 447782..449023 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705037.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene fabF CDS 449147..449962 product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705038.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene pabC CDS 449959..450981 product cell division protein YceG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097117.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene yceG CDS 450971..451612 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535399.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene tmk CDS 451609..452610 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097115.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene holB CDS 452621..453415 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705042.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 453713..455146 product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475719.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene ptsG CDS complement(455363..457579) product ferric-rhodotorulic acid/ferric-coprogen receptor FhuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097112.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene fhuE CDS 457880..458236 product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532068.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene hinT CDS 458242..458616 product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589560.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 458629..459276 product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097109.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene lpoB CDS 459257..460078 product thiamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116570.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene thiK CDS 460090..461112 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529284.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene nagZ CDS 461152..461694 product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587943.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene ycfP CDS 461929..463233 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097105.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 463431..463970 product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043449.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(464469..465107) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097103.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 465351..465608 product multiple stress resistance protein BhsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097102.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene bhsA CDS complement(465686..466648) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097101.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(466782..470228) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114340.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene mfd CDS complement(470336..471409) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097099.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 471689..472888 product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097098.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene lolC CDS 472881..473582 product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033714.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene lolD CDS 473582..474826 product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097096.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene lolE CDS 474843..475754 product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291303.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene nagK CDS 475770..476591 product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097094.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene cobB CDS complement(476603..477112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(477355..478221) product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646942.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(478356..479399) product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759329.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene potD CDS complement(479396..480187) product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097091.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene potC CDS complement(480184..481041) product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097090.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene potB CDS complement(481025..482143) product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097089.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene potA CDS 482437..483666 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097087.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene pepT CDS complement(483749..484870) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097085.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(484974..486437) product two-component system sensor histidine kinase PhoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029881973.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene phoQ CDS complement(486434..487108) product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097083.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene phoP CDS complement(487222..488592) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423737.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene purB CDS complement(488611..489240) product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097081.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene hflD CDS complement(489276..490382) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004540.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene mnmA CDS complement(490438..490896) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367142.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(490907..491452) product 23S rRNA pseudouridine(2457) synthase RluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097078.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene rluE CDS 491678..492928 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097077.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene icd CDS complement(492978..493655) product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334583.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(493985..494524) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383136.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 494593..495213 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096586.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(495231..496814) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196212.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(497048..498862) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268903.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(499223..500251) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097070.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(500519..501019) product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705161.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 501183..501890 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097066.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(501894..503084) product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097065.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 503396..504220 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182015315.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 504222..505058 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704527.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 505042..505815 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704526.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 505805..506497 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704525.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(506480..506926) product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460698.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(507221..508504) product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097061.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(508616..510550) product protein kinase YeaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019882.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene yeaG CDS 510981..511727 product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163762.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 511806..512660 product methylglyoxal reductase YeaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186359.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene yeaE CDS complement(512917..513801) product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366147.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(513886..514890) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203784.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene gapA CDS 515222..515635 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097052.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene msrB CDS 515678..515950 product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366149.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(516106..516747) product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097049.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene pncA CDS complement(516758..517774) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170162.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene ansA CDS complement(517824..519680) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259835.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene sppA CDS 519844..520395 product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097046.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 520513..521556 product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097045.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene selD CDS 521561..523489 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235800.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene topB CDS complement(523613..524956) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097043.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene gdhA CDS 525193..525477 product YnjH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097042.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(525481..526287) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673924.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene xthA CDS 526718..527938 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097032.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 527935..528966 product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097031.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene astA CDS 528966..530441 product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097030.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene astD CDS 530441..531766 product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994955.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene astB CDS 531776..532741 product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368452.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene astE CDS 533087..533569 product ATP-independent periplasmic protein-refolding chaperone Spy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097027.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene spy CDS complement(533496..533675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 533876..534433 product environmental stress-induced protein Ves inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097026.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene ves CDS complement(534427..535302) product excinuclease Cho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705763.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene cho CDS complement(535423..536250) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097024.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene nadE CDS 536504..536845 product osmotically-inducible lipoprotein OsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039301.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene osmE CDS 537096..537413 product PTS N,N'-diacetylchitobiose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366183.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene chbB CDS 537493..538851 product PTS N,N'-diacetylchitobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097022.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene chbC CDS 538873..539223 product PTS N,N'-diacetylchitobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968919.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene chbA CDS 539238..540077 product transcriptional regulator ChbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366186.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene chbR CDS 540115..541461 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097019.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 541473..542231 product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705760.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene chbG CDS complement(542289..544547) product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077825.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene katE CDS 544752..545000 product cell division activator CedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366190.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene cedA CDS complement(545060..546451) product cystine/sulfocysteine:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097015.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene tcyP CDS complement(546583..547173) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097014.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(547271..548032) product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene kduD CDS complement(548176..548844) product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097012.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene hxpB CDS 548990..549526 product YniB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097011.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(549566..550426) product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097010.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(550532..550822) product type V toxin-antitoxin system endoribonuclease antitoxin GhoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146133.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene ghoS CDS complement(550936..551868) product 6-phosphofructokinase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251728.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene pfkB CDS 552160..552918 product YdiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097007.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 553188..553418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097006.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 553784..553999 product fumarate hydratase FumD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096944.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene fumD CDS 554257..556185 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097005.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene thrS CDS 556297..556731 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058403.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene infC CDS 556826..557023 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124225.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene rpmI CDS 557073..557429 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004102963.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene rplT CDS 557735..558718 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018588.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene pheS CDS 558733..561120 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672328.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene pheT CDS 561125..561424 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229266.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene ihfA CDS 561527..562507 product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956528.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene btuC CDS 562544..563095 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096998.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 563095..563844 product vitamin B12 ABC transporter ATP-binding protein BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029466.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene btuD CDS 563915..564379 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213259.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(564729..564923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 564831..565400 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096995.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 565465..566907 product protein adenylyltransferase SelO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175592.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene selO CDS complement(567013..568059) product 3-deoxy-7-phosphoheptulonate synthase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419178.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene aroH CDS complement(568226..569059) product posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620693.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene ppsR CDS 569388..571763 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096979.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene ppsA CDS complement(572115..573188) product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248612.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene ydiK CDS 573435..576491 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419180.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 576488..576898 product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637930.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene menI CDS 577085..578002 product kdo(2)-lipid IV(A) palmitoleoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645259.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene lpxP CDS 578349..578717 product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367169.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene sufA CDS 578726..580210 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089364.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene sufB CDS 580228..580974 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096955.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene sufC CDS 580949..582220 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096954.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene sufD CDS 582217..583437 product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096953.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene sufS CDS 583450..583866 product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096952.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene sufE CDS 583964..584977 product L,D-transpeptidase LdtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817109.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene ldtE CDS complement(585047..585283) product major outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002908860.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(585593..587005) product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751448.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene pykF CDS complement(587415..588584) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403811.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(588607..589398) product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606663.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene hisN tRNA complement(589670..589746) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA complement(589762..589838) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(590124..590897) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706486.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 591464..593122 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817182.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 593188..594420 product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097093.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 594656..594958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 595002..595235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(595354..596727) product multidrug efflux MATE transporter MdtK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175077.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 596955..597587 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096933.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(597622..598770) product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098879.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene cfa CDS complement(599072..600253) product purine nucleoside transporter PunC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096931.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene punC CDS 600363..601274 product DNA-binding transcriptional activator PunR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269501.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene punR CDS complement(601320..602345) product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096929.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene purR CDS 602898..604070 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096927.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(604109..604948) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096925.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 605289..605627 product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366878.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(605697..606236) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808672.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(606296..607039) product YciC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096283.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 607369..608004 product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096285.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene ompW CDS complement(608056..608865) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443081.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene trpA CDS complement(608865..610058) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096356.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene trpB CDS complement(610070..611434) product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096357.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene trpCF CDS complement(611435..613030) product bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763524.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene trpD CDS complement(613030..614592) product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883574.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 614873..615754 product RNase AM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096361.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene rnm CDS 615751..616371 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096362.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 616603..617499 product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291216.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene rluB CDS complement(617575..618165) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278906.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene cobO CDS complement(618162..618920) product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366220.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 619142..620224 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096366.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene sohB CDS complement(620264..620515) product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548616.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 620912..623509 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513593.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene topA CDS 623692..624666 product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006175683.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene cysB CDS 625716..628391 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099530.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene acnA CDS complement(628434..629021) product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096372.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene ribA CDS 629217..629990 product phosphatidylglycerophosphatase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948651.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene pgpB CDS 630158..630466 product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096374.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 630473..631642 product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096375.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene lapB CDS 631828..632565 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705735.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene pyrF CDS 632565..632891 product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295580.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene yciH CDS complement(633008..633229) product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498253.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene osmB CDS complement(633488..634246) product DNA-binding transcriptional regulator YciT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096378.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(634463..634645) product protein YciZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069350.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene yciZ CDS complement(634722..636713) product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096381.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene pdeR CDS complement(636997..638931) product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000485046.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(639013..640167) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705732.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(640337..641125) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506501.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene fabI CDS complement(641320..642126) product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573407.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene sapF CDS complement(642128..643120) product peptide ABC transporter ATP-binding protein SapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096394.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene sapD CDS complement(643120..644010) product peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096395.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene sapC CDS complement(643997..644962) product peptide ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583298.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene sapB CDS complement(644959..646572) product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096397.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene sapA CDS complement(646690..648081) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096576.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 648217..649140 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096577.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 649178..649522 product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006808895.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene yajD CDS complement(649524..650513) product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273326.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene pspF CDS 650666..651334 product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511000.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene pspA CDS 651392..651616 product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274953.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene pspB CDS 651616..651975 product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096405.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene pspC CDS 652002..652229 product phage shock protein PspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097607.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene pspD CDS 652426..654111 product sugar phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096407.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 654126..655418 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597458.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 655437..656318 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096409.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 656305..657150 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096410.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 657182..658231 product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096411.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 658237..659040 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690229.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 659055..660098 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833563.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 660092..662347 product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096414.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 662344..663018 product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775779.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene pgmB CDS 663034..664113 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057977.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 664183..665085 product monomeric porin OmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735246.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene ompG CDS complement(665127..666125) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075386.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 666303..667700 product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825858.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 667697..668752 product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138728.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 668909..670450 product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235493.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene tyrR CDS complement(670516..671022) product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096423.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene tpx CDS 671140..672105 product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602338.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene ycjG CDS complement(672096..672809) product murein tripeptide amidase MpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296042.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene mpaA CDS 672971..674587 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096426.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 674986..676152 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062729484.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 676788..677771 product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387372.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene zntB CDS 678048..678197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 678261..679634 product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096453.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene dbpA CDS complement(679677..680612) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081419.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene ttcA CDS complement(680662..681900) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040852.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(681902..682114) product excisionase XisR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079604.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene xisR CDS complement(682179..682421) product DUF4060 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096292.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(682418..682597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(682630..683679) product recombinase RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001539618.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(683694..686900) product PD-(D/E)XK nuclease-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705727.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(687211..687489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 687403..687582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(688241..689848) product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009229.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(690040..690432) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170276.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 690535..690753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 690765..691316 product toxin YdaT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182881.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 691497..692402 product replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705905.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 692399..693088 product replication protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070133977.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 693085..693456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 693453..693818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 693815..694288 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445792.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 694616..695098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 695373..695783 product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096735.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 696049..696306 product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168435353.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 696558..696887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 697218..697457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 697492..698088 product DUF1367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929790.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 698093..698293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 698296..698715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 698700..698993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 698990..699352 product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096306.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 699355..699930 product DUF1133 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640149.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(700013..700402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(700511..700690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 tRNA 701400..701476 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 701600..701788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 702348..702587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 702580..703092 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816484.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 703082..703543 product lysis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001390466.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 703531..703755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(703827..704147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 704833..704970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(705090..705359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 706387..706614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010434226.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 706748..707383 product putative metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095975.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 707415..707894 product DUF2280 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211724.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 707881..709365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 709386..710735 product DUF1073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095979.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 710689..711648 product phage minor head protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095980.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 711664..712929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095981.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 712972..713427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095982.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 713445..714548 product DUF6260 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095983.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 714558..714860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095984.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 714927..715331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097717.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 715307..715504 product DUF551 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126356113.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 715501..715887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705872.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 715905..716300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705871.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 716297..716683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 716697..717431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 717462..718103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 718207..718506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 718762..718962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 719024..722233 product tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097710.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(722260..722490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 722547..722894 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440566.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(723257..723478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 723645..724349 product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816463.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 724349..725068 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140761.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 725065..725538 product tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246289.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 725548..729270 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515491.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 729270..729581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 729581..730249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 730311..731207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 731218..731457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(731705..731848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(733071..733349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 733578..733958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(734192..734596) product cell envelope integrity TolA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001453090.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 734821..735045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(735540..736283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 736757..737122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(737581..738357) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104931.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 738533..739447 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062802403.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene gcvA CDS 739692..739925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 740163..740582 product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394197.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 740585..741856 product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705848.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 741921..742373 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383469.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 742363..743253 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383468.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 743717..744211 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365842.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 744230..746158 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706014.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(746239..746820) product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039271.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(747018..748049) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704695.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(748077..749060) product DUF1852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704696.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(749302..750213) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107014379.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 750339..751223 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530571.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(751240..751452) product KTSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161573.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(751612..755136) product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096463.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene nifJ CDS complement(755485..756513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(756525..757709) product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 759075..759725 product metal-binding protein ZinT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234684.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene zinT CDS complement(760171..760593) product heat shock protein HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309480.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene hslJ CDS complement(760680..761669) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096773.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 761879..764518 product YdbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900912.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 764515..764697 product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020688201.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 764851..765717 product pyridoxine 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097801.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene pdxI CDS complement(765767..766372) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096706.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene azoR CDS 766575..770477 product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420907.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene hrpA CDS complement(770662..772041) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705601.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(772038..773120) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096702.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(773167..774822) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096701.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 775123..775926 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098505.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 776126..777565 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115947.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene aldA CDS complement(777653..778579) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103676442.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 778680..779210 product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096695.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene cybB CDS 779406..780731 product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028291.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene proP CDS 780918..781214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434330.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 781354..781887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963497.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(782032..783108) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036137.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(783226..783606) product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315823.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 783706..784437 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315822.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 784687..785160 product DUF4126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275228.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 785250..785525 product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096678.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 785557..786675 product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366371.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 787071..788522 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419375.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(788688..791057) product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096675.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(791516..793816) product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816272.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(793943..794866) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096674.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 795170..796513 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096660.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 796550..798055 product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366380.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(798042..798893) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446327.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 799006..800175 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096656.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 800188..800967 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096655.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 801198..802853 product glucan biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096654.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 802965..803507 product 50S ribosomal protein L7/L12-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366387.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene rimL CDS complement(803499..804479) product YdcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096652.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene ydcK CDS 804592..805596 product dicarboxylate transporter/tellurite-resistance protein TehA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096651.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene tehA CDS 805593..806189 product tellurite resistance methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218282.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene tehB CDS complement(806186..807415) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096649.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene pepT CDS 807530..809125 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419397.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 809259..809927 product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096647.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(809928..810854) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705569.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 811038..811910 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096645.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(811890..813056) product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096644.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 813148..813684 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705566.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 813758..815722 product 23S rRNA 5-hydroxycytidine C2501 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313806.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene rlhA CDS complement(815814..815942) product DUF2474 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096467.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(815942..816952) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096468.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene cydB CDS complement(816952..818337) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096469.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 818599..818931 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513548.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 818933..819217 product NadS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007436.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene nadS CDS 819298..820707 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096471.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 820860..822005 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047447.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 822009..823022 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220396.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 823024..823965 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251315.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 823955..824749 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555471.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 824772..826196 product aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096477.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene patD CDS 826482..826655 product GhoT/OrtT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096478.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(826652..827326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 827420..827593 product GhoT/OrtT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096478.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 827694..828926 product putative acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091577.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(829020..831194) product virulence factor SrfC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419532.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(831191..834169) product virulence factor SrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096481.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(834173..835549) product SrfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096482.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 835830..837428 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705554.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 837438..837671 product YdcY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096483.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(837673..838122) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096484.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(838119..838637) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096485.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(838701..838874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 838792..839250 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096486.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 839315..840352 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096487.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 840606..841265 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096488.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 841460..843100 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817438.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(843226..845244) product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096489.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene pqqU CDS 845604..846665 product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705546.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(846780..848273) product L-asparagine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020684770.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene ansP CDS 848699..849688 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209763.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(849760..850089) product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280945.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(850089..850466) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000539519.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(850555..851442) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209764.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 851595..852635 product MsnO8 family LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705544.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 852632..853750 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705543.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 853770..855089 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096495.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 855100..856032 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096496.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 856043..856549 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096497.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 856559..857485 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705541.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 857469..858242 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366435.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 858252..859142 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096500.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(859149..860345) product L-talarate/galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218254.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 860733..861668 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981551.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 861671..862204 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020684771.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 862261..862491 product tautomerase PptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096502.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene pptA CDS complement(862539..863108) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096509.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 863337..864038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 864035..865003 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385516.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 865045..866700 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385517.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 866755..867606 product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096510.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene nhoA CDS complement(867614..868192) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121044.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 868307..869794 product methyl viologen efflux MFS transporter SmvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489748.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene smvA CDS complement(869803..870684) product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419505.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene yddG CDS complement(870804..871220) product type II toxin-antitoxin system antitoxin HigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560253.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene higA CDS complement(871367..871534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 note possible pseudo, internal stop codon CDS complement(871694..873391) product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450511.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(873559..873693) product stationary-phase-induced ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096533.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene sra CDS complement(874058..875770) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096531.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(876102..877436) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(877667..878161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 878483..878761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 878762..879202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 879382..879630 product biofilm/acid-resistance regulator YmgB/AriR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208085.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(880061..880348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 880617..882401 product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095550.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene treZ CDS 882398..884932 product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613170.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene treY CDS 884992..887067 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096571.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene glgX CDS complement(887081..887299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(887256..888200) product mannuronate-specific alginate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103481.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(888253..889803) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189772.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(890174..891241) product DNA-binding transcriptional regulator AscG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001394680.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene ascG CDS complement(891316..893205) product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721858.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 893441..893878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704919.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 893875..895173 product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704918.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(895304..895540) product biofilm development regulator YmgB/AriR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096961.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(895620..895931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(896009..896248) product regulatory protein YcgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367637.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene ycgZ CDS 896457..897659 product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704783.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 897808..898539 product DNA-binding transcriptional repressor BluR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332303.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene bluR CDS complement(898527..899876) product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419480.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(899960..900562) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705172.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 900702..901103 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705171.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 901772..902653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096464.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 902865..903392 product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168624.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(903437..903712) product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063445805.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(903816..905093) product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263029.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(905428..906987) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038812.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 907359..908927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(909052..909531) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095424.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 909623..911011 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095423.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(911196..912110) product bestrophin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001670736.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(912345..913796) product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854633.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene uxaB CDS complement(913913..914440) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705327.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(914515..915492) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096606.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(915546..916538) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096607.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(916684..918156) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096608.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(918291..919211) product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096610.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene glsB CDS complement(919266..920690) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096611.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(920955..922337) product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096612.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene sad CDS 922442..923311 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705323.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 923401..924345 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732587.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(924390..925187) product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096623.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 925384..926577 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419406.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(926729..927400) product MarC family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968968.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 927629..928063 product multiple antibiotic resistance transcriptional regulator MarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843414.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene marR CDS 928083..928457 product MDR efflux pump AcrAB transcriptional activator MarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091194.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene marA CDS 928617..928832 product multiple antibiotic resistance protein MarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096628.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene marB CDS complement(928864..929760) product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096629.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene eamA CDS 929951..931144 product efflux MFS transporter YdeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068053.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene ydeE CDS 931155..931289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(931295..932395) product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096637.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(932547..932963) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096638.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 933058..934038 product transcriptional regulator FtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420910.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene ftrA CDS 934912..935067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(935085..937127) product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640153.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene dcp CDS 937322..938068 product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636564.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene ydfG CDS 938158..938844 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096780.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(938897..940180) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382183.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(940255..941355) product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706283.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene rspA CDS complement(941581..943044) product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096786.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(943216..944760) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096787.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(944782..946191) product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096788.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene uxaC CDS complement(946242..947339) product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706283.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene rspA CDS complement(947542..947913) product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096792.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(947950..949137) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931022.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(949354..950472) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456065.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 950589..950930 product DUF1283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096793.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(950937..951647) product YnfC family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096795.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 951918..953711 product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206338.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene atzF CDS 953704..957318 product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140960.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene uca CDS 957323..958018 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267779.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 958081..959355 product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096636.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene urtA CDS 959416..960990 product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210793.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene urtB CDS 960990..962066 product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210794.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene urtC CDS 962059..962850 product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096633.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene urtD CDS 962852..963550 product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096632.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene urtE CDS 963617..963916 product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059218804.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 tRNA complement(963889..963978) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 964229..966667 product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096797.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 966678..967295 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213069.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene dmsB CDS 967297..968154 product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526492.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 968167..968778 product Tat proofreading chaperone DmsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206559.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene dmsD CDS 969088..969795 product osmoprotectant ABC transporter permease OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096821.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene osmY CDS 969814..970716 product osmoprotectant ABC transporter substrate-binding protein OsmX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096822.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene osmX CDS 970726..971373 product osmoprotectant ABC transporter permease OsmW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006808875.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene osmW CDS 971373..972521 product osmoprotectant ABC transporter ATP-binding protein OsmV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096823.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene osmV CDS complement(972659..973354) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096826.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene bioD CDS complement(973480..974700) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096827.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(974848..975738) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705289.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 975858..977117 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091796.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 977427..978911 product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096839.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 979248..979568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 979830..980651 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096841.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(980694..980837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(980876..981325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(981503..981742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 982203..983087 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096673.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 983133..984971 product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036278.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 985355..985621 product ParD-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209417.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 985618..986403 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209416.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene map CDS complement(986679..987242) product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046820.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene smrA CDS 987852..988367 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096864.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene ogt CDS 988457..989314 product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006174991.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene fnr CDS 989459..990406 product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366817.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene uspE CDS complement(990462..991850) product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096868.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene pntB CDS complement(991861..993390) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096869.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene pntA CDS 993915..994859 product DUF1471 family protein YdgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769298.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene ydgH CDS 995039..996421 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096871.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 996460..997182 product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096872.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene folM CDS complement(997179..997514) product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096873.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 997585..998355 product two-component system response regulator RstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096874.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene rstA CDS 998589..998957 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118257.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 998957..999460 product YbjP/YqhG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847532.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 999621..1000916 product two-component system sensor histidine kinase RstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705253.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene rstB CDS 1001032..1001817 product DNA replication terminus site-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096877.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene tus note possible pseudo, frameshifted CDS 1001808..1001960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 note possible pseudo, frameshifted CDS complement(1001957..1003360) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096878.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene fumC CDS complement(1003492..1005138) product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096879.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene fumA CDS 1005333..1006511 product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096880.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene manA CDS 1006605..1008140 product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753325.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 1008581..1012285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 1012602..1013771 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096892.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 1013878..1014882 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096893.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene add CDS complement(1014926..1015966) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300538.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 1016195..1016332 product division septum protein Blr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168112406.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene blr CDS 1016484..1016924 product DUF2569 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096897.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 1017000..1017581 product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366851.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene rsxA CDS 1017581..1018159 product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096899.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene rsxB CDS 1018152..1020326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 1020327..1021376 product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419218.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene rsxD CDS 1021386..1022006 product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920811.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene rsxG CDS 1022009..1022710 product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366856.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 1022710..1023345 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705230.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene nth CDS 1023932..1025437 product dipeptide/tripeptide permease DtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366858.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene dtpA CDS 1025555..1026157 product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765742.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene gstA CDS complement(1026244..1027518) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366861.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene tyrS CDS complement(1027643..1028299) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282834.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene pdxH CDS complement(1028357..1028680) product C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178044.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene mliC CDS complement(1028773..1029897) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096911.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene anmK CDS 1030071..1030538 product outer membrane lipoprotein SlyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597179.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene slyB CDS complement(1030628..1031062) product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445639.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene slyA CDS 1031252..1031485 product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670998.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 1031491..1032348 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096915.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 1032351..1034354 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096916.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(1034347..1034868) product superoxide dismutase [Cu-Zn] SodC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096917.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene sodC CDS complement(1034948..1035844) product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250656.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(1035894..1036133) product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096919.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 1036214..1036831 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419211.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 1036888..1037982 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092935.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 1038071..1038478 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096923.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene gloA CDS 1038578..1039234 product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282267.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene rnt CDS 1039306..1039704 product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096281.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene yciA CDS complement(1039779..1040213) product glutaredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065782.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene arsC CDS complement(1040226..1041515) product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706112.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(1041560..1041880) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706111.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(1042083..1042742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 1043033..1043329 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967595.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 1043686..1045146 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206886.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene cls CDS 1045180..1045509 product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367064.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(1045581..1046585) product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367066.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene oppF CDS complement(1046582..1047595) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096273.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(1047607..1048515) product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096272.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene oppC CDS complement(1048530..1049450) product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911094.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene oppB CDS complement(1049557..1051191) product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182039.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene oppA CDS complement(1051251..1051430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(1051959..1052606) product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419826.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 1053077..1055755 product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096268.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene adhE CDS complement(1055841..1056365) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068076.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene tdk CDS 1057003..1057416 product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502781.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene hns CDS complement(1057686..1058531) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718995.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene galU CDS complement(1058794..1059807) product two-component system response regulator RssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193432.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene rssB CDS 1060447..1060806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 1060855..1061697 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096262.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene purU assembly_gap 1061858..1061907 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1062487..1063164) product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367083.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene narI CDS complement(1063164..1063874) product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096258.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene narJ CDS complement(1063871..1065406) product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702629.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene narH CDS complement(1065403..1069146) product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096256.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(1069532..1071025) product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019848.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene narK CDS 1071235..1073031 product nitrate/nitrite two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476239.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene narX CDS 1073024..1073674 product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064595.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene narL CDS complement(1073675..1075081) product YchO/YchP family invasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419841.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 1075254..1075805 product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444179.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(1075782..1078370) product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705092.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(1078367..1082431) product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186277852.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene nirB CDS complement(1082441..1083229) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096250.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(1083240..1084121) product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096249.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene ntrB CDS complement(1084123..1085382) product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882726.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(1085722..1086888) product nitrate regulatory protein NasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096246.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene nasR CDS 1086956..1087306 product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179794.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 1087414..1089198 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096244.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 1089411..1089656 product DUF1883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705086.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(1089659..1090354) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096242.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(1090555..1090785) product putative cation transport regulator ChaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096240.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene chaB CDS 1091059..1092159 product sodium-potassium/proton antiporter ChaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096238.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene chaA CDS complement(1092195..1092602) product type II toxin-antitoxin system MqsA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809516.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(1092599..1092901) product type II toxin-antitoxin system MqsR family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809515.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(1093066..1093920) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811046.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene kdsA CDS complement(1093957..1094757) product invasion regulator SirB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096236.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene sirB1 CDS complement(1094770..1095162) product invasion regulator SirB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096235.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene sirB2 CDS complement(1095168..1096007) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705084.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene prmC CDS complement(1096007..1097089) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096233.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene prfA CDS complement(1097131..1098387) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299679.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene hemA CDS 1098589..1099212 product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130692.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene lolB CDS 1099209..1100078 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367112.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene ispE CDS 1100202..1101149 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518537.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene prs CDS 1101274..1102953 product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705081.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene dauA CDS complement(1103024..1103302) product stress-induced protein YchH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823874.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene ychH CDS 1103573..1104157 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096226.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene pth CDS 1104285..1105376 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505850.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene ychF CDS complement(1105447..1106193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 1106390..1106914 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527976.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 1107250..1107432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 1107537..1108040 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022822.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(1108210..1109793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(1109805..1111016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(1111159..1112385) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094912.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 1112553..1113533 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096169.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 1113612..1114622 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096168.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene gap CDS complement(1114671..1116191) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118247.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 1116463..1118217 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703227.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 1118288..1119184 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852073.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(1119222..1119650) product poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212041.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene pgaD CDS complement(1119650..1120981) product poly-beta-1,6-N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368679.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene pgaC CDS complement(1120978..1122948) product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368678.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene pgaB CDS complement(1123003..1125309) product poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063447004.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene pgaA CDS complement(1125973..1129572) product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096802.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene uca CDS complement(1129731..1130366) product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(1130378..1131106) product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420904.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(1131106..1131888) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096805.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(1131885..1132700) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096806.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(1132725..1133663) product putative urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096807.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 1134383..1134877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096174.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 1134995..1135954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096186.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 1135995..1137368 product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096192.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 1137562..1139259 product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096163.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 1139493..1141601 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045360620.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(1141743..1141997) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511323.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 1142208..1142939 product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096160.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(1142946..1143560) product membrane-bound lytic murein transglycosylase EmtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096159.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene emtA CDS 1143660..1144568 product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051613.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene ldcA CDS 1144700..1146433 product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096157.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(1146459..1147532) product catabolic alanine racemase DadX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197840.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene dadX CDS complement(1147545..1148843) product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266934.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 1149165..1150697 product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096153.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(1150807..1151568) product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234823.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene fadR CDS 1151977..1152456 product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028084.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene dsbB CDS complement(1152551..1152997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(1153220..1153666) product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306825.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(1153761..1154420) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096147.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(1154541..1154816) product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250286.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 1154938..1155639 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072527.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene minC CDS 1155662..1156474 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096144.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene minD CDS 1156478..1156744 product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185666.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene minE CDS complement(1156856..1157983) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109156.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene rnd CDS complement(1158053..1159738) product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705923.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene fadD CDS complement(1159944..1160534) product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096141.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(1160571..1161266) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705925.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene tsaB CDS complement(1161334..1163259) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128847.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 1163383..1163727 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295493.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(1163733..1163915) product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500497.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 1163998..1165374 product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978456.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene pabB CDS 1165361..1165939 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705928.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 assembly_gap 1166014..1166191 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1166431..1167627) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541054.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 1167778..1168686 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268187.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 assembly_gap 1168796..1169058 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1169197..1169745) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223560.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(1169773..1170534) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113396.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(1171502..1172116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(1172318..1173277) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247693.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(1173377..1174153) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094851.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 1174466..1175242 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928911.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 1175603..1176568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 1176707..1177954 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095494537.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(1177920..1178816) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967782.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(1179091..1179597) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406573.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(1179795..1180187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(1180191..1181111) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064501.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 1181204..1181779 product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931294.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 1182052..1182621 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196513.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 1182679..1183155 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096727.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 1183421..1183786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 1183797..1185893 product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337648.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(1186012..1188948) product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705231.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(1189150..1190274) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182976012.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(1190315..1191673) product methyl viologen efflux MFS transporter SmvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489748.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene smvA CDS 1191919..1192512 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207043.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 1192923..1193345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 1194269..1194730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(1194843..1195985) product glycoside hydrolase family 105 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096071.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(1196091..1197182) product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043445520.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(1197427..1198419) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210220.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(1198555..1199454) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687183.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 1199553..1200275 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361969.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(1200366..1200944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 1201181..1202545 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419892.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene sdaA CDS 1202683..1204284 product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096134.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(1204287..1205846) product CNNM family cation transport protein YoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096133.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene yoaE CDS 1206294..1207253 product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150523.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene manX CDS 1207308..1208108 product PTS mannose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859914.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene manY CDS 1208121..1208972 product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006175979.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 1209029..1209499 product DUF986 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096131.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 1209868..1210431 product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096130.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene mntP CDS complement(1210428..1211210) product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096129.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene rlmA CDS 1211233..1211397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(1211424..1211633) product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062678.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene cspE CDS complement(1212305..1213309) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096126.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(1213330..1213614) product YebO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000660.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 1213994..1214233 product YobH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096123.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(1214285..1215076) product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262197.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene kdgR CDS complement(1215249..1216130) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096120.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene htpX CDS complement(1216322..1218370) product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096119.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene prc CDS complement(1218390..1219082) product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096118.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene proQ CDS complement(1219180..1219677) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096117.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 1220045..1221091 product membrane integrity lipid transport subunit YebS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419906.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene yebS CDS 1221060..1223693 product PqiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419908.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 1223819..1225213 product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096114.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene rsmF CDS 1225327..1225566 product YebV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096113.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 1225671..1225862 product YebW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296140.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(1225863..1226507) product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705940.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene pphA CDS 1226631..1227614 product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096111.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 1227705..1228145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(1228561..1228899) product YebY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096105.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(1228916..1229785) product copper homeostasis membrane protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096104.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene copD CDS complement(1229789..1230163) product CopC domain-containing protein YobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168393.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene yobA CDS 1230300..1230530 product DNA polymerase III subunit theta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096102.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 1230557..1231219 product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944256.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene exoX CDS complement(1231216..1233273) product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096099.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene ptrB CDS complement(1233361..1234020) product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024713.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(1234116..1234463) product protein YebF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042123.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene yebF CDS complement(1234528..1234830) product YebG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705951.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 1235007..1236140 product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173484.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene purT CDS complement(1236195..1236836) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800512.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene kdgA CDS complement(1236875..1238686) product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366000.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene edd CDS 1238631..1238867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(1238911..1240386) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301712.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene zwf CDS 1240729..1241604 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882312.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 1241724..1243166 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365996.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene pyk CDS complement(1243219..1244190) product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296141.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene lpxM CDS complement(1244301..1245623) product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096090.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene mepM CDS complement(1245639..1246523) product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625584.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene znuA CDS 1246662..1247417 product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832401.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene znuC CDS 1247414..1248199 product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096087.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene znuB CDS complement(1248306..1249316) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096086.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene ruvB CDS complement(1249325..1249936) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580323.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene ruvA CDS 1250233..1250865 product YebB family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069412.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(1250868..1251389) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022509.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene ruvC CDS complement(1251423..1252166) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096082.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(1252193..1252636) product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323632.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene nudB CDS complement(1252638..1254416) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096080.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene aspS CDS 1254670..1255236 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096079.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 1255233..1256051 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639226.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 1256106..1256501 product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096077.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 1256541..1257284 product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019609.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene cmoA CDS 1257281..1258252 product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569029.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene cmoB CDS complement(1258362..1259105) product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419924.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene cutC CDS complement(1259178..1259744) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096073.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 1259981..1261714 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705961.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene argS CDS complement(1261965..1263104) product glycoside hydrolase family 105 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989908.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(1263105..1264691) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096070.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(1264965..1265357) product flagellar protein FlhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259587.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene flhe CDS complement(1265357..1267435) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096067.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene flhA CDS complement(1267428..1268576) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096066.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene flhB CDS 1268820..1270352 product dNTP triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003513.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene dgt CDS 1270315..1271073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 1271435..1272010 product type 1 fimbrial major subunit FimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095930.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene fimA CDS 1272196..1272888 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044779.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 1272974..1275430 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136472.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 1275411..1276571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(1276618..1277265) product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096065.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene cheZ CDS complement(1277274..1277663) product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500431.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene cheY CDS complement(1277681..1278730) product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096064.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(1278727..1279593) product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500429.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene cheR CDS complement(1279613..1281211) product methyl-accepting chemotaxis protein IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096062.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene tap CDS complement(1281252..1282883) product methyl-accepting chemotaxis protein II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096061.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene tar CDS complement(1283020..1283988) product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096060.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(1283988..1286348) product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096059.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(1286360..1287115) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096058.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(1287132..1287557) product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027938.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(1287699..1288268) product spore coat protein U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096056.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(1288875..1289378) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096054.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene cheW CDS complement(1289400..1291433) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096053.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene cheA CDS complement(1291444..1292373) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795656.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene motB CDS complement(1292370..1293257) product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906317.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene motA CDS complement(1293381..1293959) product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096051.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene flhC CDS complement(1293962..1294315) product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096050.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene flhD CDS 1295105..1295533 product universal stress protein UspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705964.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene uspC CDS complement(1295561..1296985) product alpha,alpha-trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096048.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene otsA CDS complement(1296960..1297763) product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096047.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene otsB CDS complement(1297948..1298928) product L-arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096046.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene araH CDS complement(1298943..1300457) product arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187828.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene araG CDS complement(1300533..1301522) product arabinose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705967.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(1301582..1301785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(1301852..1302409) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754799.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 1302932..1303435 product non-heme ferritin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741707.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 1303629..1304972 product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096042.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(1305186..1305437) product DUF2766 family protein YecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082127.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene yecJ CDS 1305851..1307272 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705969.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(1307319..1307957) product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096040.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 1308058..1308309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 1308275..1310389 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063517.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 1310463..1310831 product YecR-like lipofamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803230.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 1311039..1311536 product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365960.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene ftnA CDS 1311784..1312962 product tyrosine transporter TyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797566.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene tyrP CDS complement(1313007..1313672) product UPF0149 family protein YecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847882.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene yecA tRNA complement(1313810..1313896) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA complement(1313909..1313982) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA complement(1314033..1314108) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(1314260..1314808) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096028.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene pgsA CDS complement(1314866..1316698) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096027.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene uvrC CDS complement(1316695..1317351) product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096026.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene uvrY CDS 1317809..1318033 product DUF2594 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365908.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(1318088..1318810) product transcriptional regulator SdiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157173.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene sdiA CDS complement(1319098..1319325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(1319348..1319944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(1320196..1320948) product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096023.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene yecC CDS complement(1320945..1321613) product cystine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096022.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene tcyL CDS complement(1321634..1322620) product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128215.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene dcyD CDS complement(1322727..1323527) product cystine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096020.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene tcyJ CDS complement(1323614..1324165) product flagella biosynthesis regulatory protein FliZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096019.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene fliZ CDS complement(1324224..1324913) product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096018.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(1325105..1325848) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096017.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(1325860..1326300) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096016.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(1326297..1327268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096015.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(1327265..1328227) product glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028148.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(1328230..1328928) product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096013.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(1328943..1330106) product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096012.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(1330207..1333668) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096011.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(1333979..1335562) product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079784.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 1335819..1337231 product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146805.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene fliD CDS 1337243..1337647 product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287765.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene fliS CDS 1337647..1338018 product flagella biosynthesis regulatory protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204899.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene fliT CDS 1338074..1339558 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245709.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene amyA CDS complement(1339598..1340014) product lipoprotein YedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096004.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene yedD CDS 1340203..1341408 product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580669.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene yedE CDS 1341405..1341638 product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096288.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene yedF CDS complement(1341877..1342245) product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125351949.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(1342248..1342487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096002.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 1342936..1344114 product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 1344126..1345148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(1345160..1347058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(1347115..1349592) product host specificity factor TipJ family phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026094292.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(1349579..1349995) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097707.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(1349958..1350428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095995.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(1350428..1350925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097709.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(1350925..1353564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(1353595..1353966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(1354057..1354731) product DUF6246 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097711.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(1354791..1355534) product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097712.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(1355554..1355946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705870.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(1355943..1356311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705871.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(1356314..1356664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095987.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(1356664..1356837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006820518.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(1356837..1357217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705874.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(1357220..1357585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(1357595..1358680) product DUF6260 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705876.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(1358691..1359125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705877.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(1359129..1360526) product DUF2213 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705878.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(1360596..1361099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816502.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(1361134..1362024) product phage minor head protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705880.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(1362056..1363513) product DUF1073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188035104.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(1363525..1365072) product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816477.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(1365069..1365719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705883.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(1365723..1365929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(1365926..1366144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(1366260..1366769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024699234.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(1366847..1367119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(1367240..1367413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(1367410..1367637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(1367561..1367830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096313.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(1367827..1368081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(1368081..1368620) product putative peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166765.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(1368617..1368907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(1368897..1369277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 tRNA complement(1369417..1369492) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA complement(1369498..1369572) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(1369671..1370360) product bacteriophage antitermination protein Q inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705893.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(1370357..1370518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(1370515..1371114) product recombination protein NinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211735.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(1371107..1371277) product NinE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095967.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(1371277..1371858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(1371851..1372282) product DNA base-flipping protein YbcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053016.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene ybcN CDS complement(1372715..1372966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(1373024..1373263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(1373260..1374090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(1374094..1374576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(1374573..1374851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(1374848..1375282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(1375279..1375557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(1375554..1375874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(1375878..1376726) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988183.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(1376729..1377625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(1377625..1378362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(1378399..1378683) product lambda phage CII family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251072.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(1378821..1379051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072342.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 1379131..1379838 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858975.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 1380104..1380406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 1380494..1380757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 1380901..1381143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 1381140..1381301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095950.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 1381585..1382589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005791.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 1382597..1382875 product host nuclease inhibitor GamL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995345.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene gamL CDS 1382895..1383812 product recombinase RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459721.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 1383809..1384492 product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095946.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 1384492..1384950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095945.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 1385048..1385266 product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032665755.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 1385266..1385646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 1385621..1385860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 1386327..1386527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 1386537..1387091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 1387129..1387374 product excisionase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097283.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 1387420..1388718 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120816036.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(1388742..1389053) product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097729.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene fliE CDS 1389282..1391000 product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097730.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene fliF CDS 1390993..1391988 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067950.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene fliG CDS 1391981..1392688 product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097731.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene fliH CDS 1392688..1394058 product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097732.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene fliI CDS 1394074..1394520 product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097733.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene fliJ CDS 1394517..1395782 product flagellar hook length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631663.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene fliK CDS 1395932..1396402 product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832480.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene fliL CDS 1396407..1397411 product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502815.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene fliM CDS 1397408..1397821 product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500318.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene fliN CDS 1397824..1398198 product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097737.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene fliO CDS 1398198..1398935 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253411.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene fliP CDS 1398947..1399216 product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187355.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene fliQ CDS 1399225..1400010 product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983976.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene fliR CDS 1400448..1400924 product transcriptional regulator RcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097740.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene rcsA CDS complement(1400979..1401167) product protein DsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097741.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene dsrB CDS 1401298..1401528 product YodD family peroxide/acid resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705984.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene yodD CDS 1401832..1402671 product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948794.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(1402626..1404338) product cellulose biosynthesis regulator diguanylate cyclase DgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001513322.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene dgcQ CDS complement(1404454..1404636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 note possible pseudo, frameshifted CDS complement(1404715..1405626) product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097746.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 1405805..1406716 product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097747.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene yedA CDS complement(1406719..1407189) product VSPR family DNA mismatch endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785988.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene vsr CDS complement(1407207..1407905) product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365890.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 1408387..1409562 product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097752.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene ompC CDS 1409938..1410378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(1410537..1411805) product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705848.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(1411789..1412226) product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882790.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene umuD CDS complement(1412388..1412792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 sequence02 source 1..459126 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 28..103 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(368..1126) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099005.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(1135..2238) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001351330.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(2248..3429) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019643.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(3511..4536) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738579.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(4921..5148) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099001.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(5269..5949) product acrEF/envCD operon transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446923.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene envR CDS 6315..7478 product multidrug efflux RND transporter periplasmic adaptor subunit AcrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160348.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene acrE CDS 7505..10615 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703631.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(10663..12720) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098998.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(13211..13507) product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210061.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene fis CDS complement(13533..14405) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369451.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene dusB CDS complement(14822..15703) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145849.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene prmA CDS complement(15715..17166) product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098994.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene panF CDS complement(17156..17398) product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098993.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(17505..18854) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369455.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene accC CDS complement(18866..19336) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354622.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene accB CDS complement(19358..19810) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369457.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene aroQ CDS complement(20045..20644) product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098990.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene msrQ CDS complement(20645..21646) product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098989.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene msrP CDS 21923..23863 product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098987.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene csrD CDS 24169..25212 product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918653.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene mreB CDS 25280..26275 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098986.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene mreC CDS 26275..26763 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098985.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene mreD CDS 26773..27366 product nucleoside triphosphate pyrophosphatase YhdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203096.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene yhdE CDS 27356..28825 product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123188.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene rng CDS 28872..32672 product AsmA2 domain-containing protein YhdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098981.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene yhdP CDS 32787..34235 product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055913.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene tldD CDS complement(34358..35287) product HTH-type transcriptional activator AaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098979.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene aaeR CDS 35467..35670 product p-hydroxybenzoic acid efflux pump operon protein AaeX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051840.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene aaeX CDS 35678..36610 product p-hydroxybenzoic acid efflux pump subunit AaeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855134.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene aaeA CDS 36616..38583 product p-hydroxybenzoic acid efflux pump subunit AaeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098977.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene aaeB CDS 38665..40119 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098976.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 40152..40424 product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029005.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(40482..40745) product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098973.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene yhcN CDS complement(41123..41563) product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257847.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene argR CDS 42016..42954 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098971.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene mdh CDS complement(43009..44076) product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098970.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene degS CDS complement(44164..45531) product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098969.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene degQ CDS complement(45701..46105) product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481183.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene zapG CDS 46293..47417 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192314.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene zapE CDS 47727..48155 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847559.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene rplM CDS 48170..48562 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829815.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene rpsI CDS 48874..49512 product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257300.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene sspA CDS 49518..50015 product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366112.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene sspB CDS complement(50044..50679) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001317442.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 50846..51634 product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005053961.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 51650..52801 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257480.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 52811..53644 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067536.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 53723..54940 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368095.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 54950..57019 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080381.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 57119..57904 product transcriptional regulator NanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382926.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene nanR CDS 58065..58934 product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029662.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene nanA CDS 59093..60583 product sialic acid transporter NanT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108474.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene nanT CDS 60643..61518 product N-acetylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208982.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene nanK CDS 61515..61991 product N-acetylneuraminate anomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979896.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene nanQ CDS complement(62093..63511) product glutamate synthase subunit GltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098959.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene gltD CDS complement(63521..67981) product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098958.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene gltB CDS 68653..69582 product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296449.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(69707..73030) product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236760.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene mscM CDS complement(73052..74014) product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934927.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene asd CDS complement(74102..75154) product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041970.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene rsgA CDS 75262..75807 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704162.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene orn assembly_gap 76126..76284 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(76568..77707) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095281.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene queG CDS 77706..79232 product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418520.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene nnr CDS 79225..79686 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095283.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene tsaE CDS 79703..81040 product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619489.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene amiB CDS 81050..82906 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122547.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene mutL CDS 82899..83849 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280339.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene miaA CDS 83946..84254 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095287.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene hfq CDS 84330..85610 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095288.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene hflX CDS 85680..86936 product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095289.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene hflK CDS 86939..87943 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232412.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene hflC CDS 88024..88221 product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095291.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 88324..89622 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002885665.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 89777..90202 product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095292.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene nsrR CDS 90241..92721 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704173.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene rnr CDS 92787..93518 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095294.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene rlmB CDS 93803..95422 product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095296.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(95419..97344) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095297.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(97510..97785) product DUF1471 family protease activator YjfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139152684.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene yjfN CDS complement(97939..98241) product biofilm peroxide resistance protein BsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586831.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene bsmA CDS 98421..99173 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095300.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene yjfP CDS complement(99253..99528) product DUF1471 family protein YjfY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095308.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene yjfY CDS 99873..100268 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004098001.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene rpsF CDS 100275..100589 product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856035.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene priB CDS 100594..100821 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135199.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene rpsR CDS 100863..101312 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196065.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene rplI CDS 101473..102402 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095309.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(102442..103059) product OapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095310.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 103292..103912 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001663320.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene fklB CDS 104228..105640 product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228366.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene cycA CDS complement(105770..106432) product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331457.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene ytfE CDS 106692..108341 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095313.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(108373..109314) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095314.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(109388..110218) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095315.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(110294..111142) product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560561.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene qorB CDS 111226..111618 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084623.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(111651..113591) product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589381.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 113783..114529 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886909.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene cysQ CDS complement(114519..115076) product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095323.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 115403..115609 product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501430.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(115697..117664) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269419.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(117805..119139) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095324.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 119541..120317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(120361..121383) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095327.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(121383..122459) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095328.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(122480..123634) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 123841..124875 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882373.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(124889..125032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(125029..126279) product low affinity tryptophan permease TnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131925.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene tnaB CDS complement(126389..127804) product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302010.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene tnaA CDS complement(128323..128853) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830428.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene msrA CDS 129172..130905 product autotransporter assembly complex protein TamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095333.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene tamA CDS 130902..134678 product autotransporter assembly complex protein TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095334.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene tamB CDS 134681..135025 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704194.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(135113..135643) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055079.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene ppa CDS complement(135719..135886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 136043..136999 product galactofuranose ABC transporter substrate-binding protein YtfQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265942.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene ytfQ CDS 137197..138690 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205813.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 138704..139726 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161799150.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 139713..140714 product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830436.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene yjfF CDS 140947..142512 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095343.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(142603..143601) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095345.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene fbp CDS 143777..145159 product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219792.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene mpl CDS complement(145272..145823) product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501414.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene yjgA CDS 145918..147270 product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020079799.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene pmbA CDS 147301..147684 product cytochrome b562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232245.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene cybC CDS complement(147804..148268) product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106233.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene nrdG CDS complement(148456..150594) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368566.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene nrdD CDS complement(151094..152749) product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298928.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene treC CDS complement(152797..154215) product PTS trehalose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420863.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene treB CDS complement(154354..155364) product trehalose operon repressor TreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181306.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene treR CDS 155781..156758 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051196.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 156821..157330 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168610.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 157360..158646 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213124.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(158713..159348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(159492..159878) product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047544.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene ridA CDS complement(159959..160420) product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368555.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene pyrI CDS complement(160434..161369) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704213.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 gene pyrB CDS complement(161607..162083) product ArgR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095367.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(162167..163570) product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095368.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(163621..164625) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095369.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene argF CDS complement(164805..165716) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095370.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(165728..166948) product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095371.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene arcA CDS 167623..168075 product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095372.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(168239..169243) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012907.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene argF CDS 169407..169832 product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006810300.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene rraB CDS 169890..170648 product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095379.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene miaE CDS 170665..171399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095380.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(171553..172065) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368548.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 172283..173446 product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209177.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 173433..174455 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209176.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(174511..177366) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368547.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(177366..177809) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368546.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene holC CDS complement(177950..179461) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098951.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene pepA CDS 179727..180836 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420700.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene lptF CDS 180836..181918 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182241.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene lptG CDS 181949..182185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 182188..183831 product glycerone kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098955.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(183869..184888) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098954.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(185047..185625) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109982.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(185625..186647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15160 tRNA 186885..186969 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 187156..187614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 note possible pseudo, internal stop codon CDS 187615..188430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 note possible pseudo, internal stop codon, frameshifted CDS 188755..188973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 188995..189297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(189333..192188) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968623.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(192296..195220) product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(195234..195683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(195680..199222) product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968627.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(199279..199518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141034.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(200032..200361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(200385..201221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 note possible pseudo, frameshifted CDS complement(201254..201517) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745635.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(201649..201858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 202133..203254 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816845.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(203304..203777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15310 note possible pseudo, internal stop codon CDS complement(203784..204089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15320 note possible pseudo, internal stop codon CDS 204177..205082 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523537.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(205087..206559) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095421.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 206679..206843 product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704272.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 207073..208140 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095433.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 208143..209213 product DUF2955 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095434.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(209247..209567) product ubiquinone biosynthesis accessory factor UbiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098757.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene ubiK CDS 209946..210599 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703517.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene ribB CDS 210762..210944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469259.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(210954..211727) product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115874.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene zupT CDS 211925..212713 product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098747.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene ygiD CDS complement(212801..213961) product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442833.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(213967..214635) product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831528.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(214795..216285) product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735274.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene tolC CDS 216489..217121 product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098743.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene nudF CDS 217118..217540 product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862516.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 217565..218392 product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098742.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene cpdA CDS 218392..218967 product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105725.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene yqiA CDS 219007..220899 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195318.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene parE CDS complement(220940..221791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(221963..222829) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098733.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 223062..224834 product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098732.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 224888..226156 product oligosaccharide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098731.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 226187..227377 product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098730.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(227533..227847) product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098728.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(227878..228459) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098727.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(228561..229913) product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098726.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene qseC CDS complement(229910..230569) product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369657.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene qseB CDS 230718..231122 product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020689494.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 231262..233520 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281881.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene parC CDS 233701..234441 product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965712.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene plsC CDS 234498..235910 product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059395.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene ftsP CDS 236191..238263 product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274469.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(238423..239250) product 2,5-didehydrogluconate reductase DkgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098717.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene dkgA CDS complement(239356..240519) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098716.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene yqhD CDS 240697..241596 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703501.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 241596..241733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(241708..242367) product DedA family general envelope maintenance protein YghB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268419.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene yghB CDS complement(242505..243692) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703500.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene metC CDS 243957..244676 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527844.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene exbB CDS 244683..245108 product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240712.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene exbD CDS complement(245205..245654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098710.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(245656..246060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098709.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 246163..246681 product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098708.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(246710..247750) product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262193.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene gpr CDS 248635..250275 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098705.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(250272..250997) product L-fucose operon activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642330.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene fucR CDS complement(250994..251974) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704684.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(252083..252949) product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309762.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene yghU CDS complement(252985..253548) product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703498.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(253706..254962) product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049802.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(255170..255403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 255500..256240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(256280..256897) product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198772.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 tRNA complement(257044..257119) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(257225..257944) product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098689.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 258351..260480 product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098688.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(260654..261739) product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369719.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene mltC CDS complement(261793..262065) product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091700.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(262091..263143) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645253.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene mutY CDS 263286..264005 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786887.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene trmB CDS 264005..264331 product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107569.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 264388..265107 product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984827.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 265221..266219 product DUF1202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252198.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(266344..266997) product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095545.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene rluA CDS complement(267016..269922) product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704377.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene rapA CDS complement(270100..272391) product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095547.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene polB CDS complement(272637..273236) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035634.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(273362..274057) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888666.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene araD CDS complement(274186..275688) product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095549.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene araA CDS complement(275700..277394) product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095550.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene araB CDS 277734..278579 product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368277.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene araC CDS 278662..279432 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095552.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(279544..280245) product thiamine ABC transporter ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095553.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene thiQ CDS complement(280229..281830) product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235674.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene thiP CDS complement(281806..282789) product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915326.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene thiB CDS 283238..283687 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116491597.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 283806..284123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(284320..286914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 287714..288229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 note possible pseudo, internal stop codon CDS complement(288407..290554) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097826.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(290882..291655) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035567.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 291897..292655 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035566.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(292684..293166) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090910.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(293343..294218) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104615281.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 294888..295310 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061029547.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 295682..297154 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102149.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 297252..297896 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819270.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(297941..299140) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816438.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(299274..300260) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968596.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 300418..301353 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086503.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(301421..302176) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966801.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 302425..303201 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975807.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(303273..305270) product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097075.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene betT CDS 305488..306723 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105667.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(306781..308256) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098720.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 308445..309755 product biofilm dispersion protein BdlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082971.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene bdlA CDS complement(309846..310076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(310290..311951) product HTH-type transcriptional regulator SgrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095556.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene sgrR CDS 312153..313331 product sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095558.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(313377..313982) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818229.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene leuD CDS complement(313993..315393) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095560.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene leuC CDS complement(315396..316487) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042356.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene leuB CDS complement(316487..318058) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082846.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene leuA CDS 318328..318543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 318856..319818 product transcriptional regulator LeuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095563.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene leuO CDS 320193..321917 product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095564.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene ilvI CDS 321920..322411 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252744.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene ilvN CDS 322592..323596 product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095565.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene cra CDS 324202..324660 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488291.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene mraZ CDS 324663..325604 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368254.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene rsmH CDS 325601..325966 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625651.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene ftsL CDS 325982..327748 product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095569.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 327807..329222 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095570.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene murE CDS 329219..330577 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626670.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene murF CDS 330571..331653 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964122.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene mraY CDS 331656..332972 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704401.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene murD CDS 332972..334213 product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239803.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene ftsW CDS 334213..335280 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016559.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene murG CDS 335336..336811 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096048.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene murC CDS 336804..337724 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130059.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene ddlB CDS 337726..338559 product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095577.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene ftsQ CDS 338556..339812 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006173845.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene ftsA CDS 339929..341080 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004857884.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene ftsZ CDS 341181..342098 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095578.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene lpxC CDS 342382..342882 product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704404.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene secM CDS 342941..345646 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905780.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene secA CDS 345705..346097 product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368238.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene mutT CDS complement(346094..346288) product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856332.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene yacG CDS complement(346312..347055) product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095583.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene zapD CDS complement(347055..347675) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095584.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene coaE CDS 347940..348983 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217337.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene guaC CDS complement(349025..350221) product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157287.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene hofC CDS complement(350211..351596) product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095587.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene gspE CDS complement(351606..352043) product prepilin peptidase-dependent pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704409.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene ppdD CDS complement(352287..353180) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135134.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene nadC CDS 353268..353831 product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936326.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene ampD CDS 353828..354682 product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095591.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene ampE CDS complement(354723..355673) product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704412.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(355673..357079) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095593.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(357055..357366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(357417..358793) product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969915.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene aroP CDS 359331..360095 product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095596.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene pdhR CDS 360215..362878 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368222.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene aceE CDS 362893..364791 product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095598.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene aceF CDS 364989..366413 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519338.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene lpdA CDS complement(366464..367261) product DUF2950 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757452.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(367271..368827) product DUF3300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174529.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 369217..371814 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888954.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene acnB CDS 372055..372417 product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095603.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene yacL CDS complement(372450..373244) product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734287.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene speD CDS complement(373265..374125) product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095610.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene speE CDS complement(374277..374600) product YacC family pilotin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830675.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 374770..376323 product multicopper oxidase CueO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095612.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene cueO CDS complement(376450..378840) product pyrroloquinoline quinone-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095613.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 379047..379583 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683335.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene hpt CDS complement(379676..380290) product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651600.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene can CDS 380446..381372 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368204.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 381369..382139 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368203.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 382325..383572 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420882.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(383574..383954) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621526.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene panD CDS complement(384108..384959) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368199.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene panC CDS complement(384971..385762) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095628.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene panB CDS complement(385851..386342) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095629.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene folK CDS complement(386399..387673) product fimbrial-like adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846620.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(387666..388274) product fimbrial-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553755.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(388287..388895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(388896..391379) product Yad fimbria usher protein HtrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153166.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene htrE CDS complement(391535..392341) product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967611.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(392364..392969) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709193.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(393472..394815) product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174643.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene pcnB CDS complement(394925..395821) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937424.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene gluQRS CDS complement(395890..396345) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007373199.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene dksA CDS complement(396522..397226) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095633.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene sfsA CDS complement(397237..397767) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095634.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene thpR CDS 397845..400274 product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095635.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene hrpB CDS 400525..403038 product bifunctional glycosyl transferase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095636.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene mrcB CDS 403376..405565 product ferrichrome porin FhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704432.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene fhuA CDS 405613..406410 product Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620747.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene fhuC CDS 406410..407300 product Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095639.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene fhuD CDS 407297..409279 product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095640.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene fhuB CDS complement(409426..410706) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095641.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene hemL CDS complement(410703..410882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 410881..412299 product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368182.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene clcA CDS 412380..412724 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095643.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene erpA CDS complement(412776..413399) product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095644.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(413401..414201) product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118833.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene btuF CDS complement(414194..414892) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095646.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene mtnN CDS 414998..416512 product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057086.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene dgt CDS 416650..418083 product serine endoprotease DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095648.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene degP CDS 418189..419400 product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929458.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene cdaR CDS complement(419534..419923) product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501916.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(420041..420778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(420887..421711) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186656.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene dapD CDS complement(421746..424418) product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095651.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene glnD CDS complement(424485..425279) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095652.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene map CDS 425600..426325 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246886.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene rpsB CDS 426464..427315 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501911.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene tsf CDS 427465..428190 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224567.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene pyrH CDS 428353..428910 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622418.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene frr CDS 429006..430205 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811924.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene ispC CDS 430461..431150 product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028110.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene ispU CDS 431163..432020 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922446.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene cdsA CDS 432032..433384 product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095658.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene rseP CDS 433414..435822 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095659.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene bamA CDS 435846..436415 product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758966.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene skp CDS 436419..437444 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139282.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene lpxD CDS 437547..438002 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010426706.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene fabZ CDS 438006..438794 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566033.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene lpxA CDS 438794..439939 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095663.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene lpxB tRNA 438970..439047 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 439936..440532 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095664.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene rnhB CDS 440567..444049 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095665.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene dnaE CDS 444062..445021 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055753.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene accA CDS 445211..446977 product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524168.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 447058..449196 product lysine decarboxylase LdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095667.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 449256..449645 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901082.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 449708..451003 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704454.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene tilS CDS complement(451039..451299) product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830722.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene rof CDS complement(451286..451486) product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417058.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 451684..452226 product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185319.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 452223..452642 product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095673.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene arfB CDS complement(452702..454420) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260712.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene proS CDS complement(454532..455236) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095676.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene tsaA CDS complement(455233..455637) product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202329.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene rcsF CDS complement(455745..456560) product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095678.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene metQ CDS complement(456605..457258) product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856130.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(457251..458282) product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095679.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene metN CDS 458471..459037 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704459.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene gmhB sequence03 source 1..451320 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 99..275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(298..1065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(1084..3600) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181816997.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(3646..4593) product lysine-N-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191775953.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(4617..5054) product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027804.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(5058..5357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(5477..6250) product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309268.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene flgA CDS 6343..6690 product flagellar biosynthesis protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512950.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 6693..7124 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010941.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene flgC CDS 7121..7840 product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093678.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 7878..9071 product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119538.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene flgE CDS 9086..9823 product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375450.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 9848..10633 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990540.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene flgG CDS 10713..11357 product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800864.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene flgH CDS 11370..12485 product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059224973.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 12485..12790 product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867281.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 12881..14254 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367245.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene flgK CDS 14276..15205 product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266799.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene flgL CDS 15242..16252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195938.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(16249..16713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(16691..17629) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181672479.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 18075..18977 product lateral flagellin LafA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949083.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene lafA CDS complement(19103..20191) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815639.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(20193..21719) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209436.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(21719..22327) product DUF2291 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167399.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(22340..23281) product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209434.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(23399..24034) product enterobactin synthase subunit EntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681620.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene entD CDS 23915..24136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(24155..26404) product siderophore enterobactin receptor FepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704704.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene fepA CDS 26589..27791 product enterochelin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097642.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene fes CDS 27808..28017 product enterobactin biosynthesis protein YbdZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885783.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene ybdZ CDS 28019..31900 product enterobactin non-ribosomal peptide synthetase EntF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077749.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 gene entF CDS 32138..33271 product LPS O-antigen length regulator Wzz(fepE) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096767.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene wzz(fepE) CDS complement(33308..34105) product iron-enterobactin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367776.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene fepC CDS complement(34102..35094) product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640923.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene fepG CDS complement(35091..36098) product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704708.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene fepD CDS 36210..37454 product enterobactin transporter EntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097636.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene entS CDS 37433..37612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(37584..38543) product Fe2+-enterobactin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234314.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 gene fepB CDS 38727..39902 product isochorismate synthase EntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381303.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene entC CDS 39912..41522 product (2,3-dihydroxybenzoyl)adenylate synthase EntE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222445.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene entE CDS 41536..42390 product enterobactin biosynthesis bifunctional isochorismatase/aryl carrier protein EntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007142.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene entB CDS 42390..43145 product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase EntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347636.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene entA CDS 43145..43558 product proofreading thioesterase EntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637953.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene entH assembly_gap 43644..43715 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 43877..45982 product pyruvate/proton symporter CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043134.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene cstA CDS 46114..46311 product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097627.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(46312..47055) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097624.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(47129..48283) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097623.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 48380..49882 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097622.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 49879..50874 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367760.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 50898..51956 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097620.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 52077..53321 product LVIVD repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097619.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(53440..54639) product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097617.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene mtnK CDS 54745..55743 product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097616.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene mtnA CDS complement(55887..56429) product 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097614.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(56426..57115) product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097613.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene mtnC CDS complement(57112..57723) product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097612.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS 57839..58999 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164518318.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(59000..59626) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097610.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(59611..60831) product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882127.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(61029..61931) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097608.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(62146..62889) product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597117.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene dsbG CDS 63151..63714 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501015.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene ahpC CDS 63953..65515 product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887645.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene ahpF CDS complement(65611..66273) product DUF2931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387039.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(66386..67042) product DUF2931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387039.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(67039..69039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(69203..69631) product universal stress protein UspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278499.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene uspG CDS complement(69771..70181) product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089748.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene rnk CDS 70432..71262 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021030.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 71396..72250 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646835.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(72252..74747) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955825.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene ptsP CDS complement(74772..75800) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366033.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene ypdE CDS complement(75790..76878) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173284.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene ypdF CDS complement(76889..78136) product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985322.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(78160..78483) product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038456.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(78786..79532) product ribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097602.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene rna CDS complement(79703..81073) product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958619.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene dcuC CDS 81435..81842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817189.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 81895..82215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 82228..83484 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817191.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 83481..84716 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817192.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 84713..87832 product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817193.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 88099..88548 product lipid IV(A) palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103088.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 gene pagP CDS 88742..88951 product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012542460.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 gene cspE CDS complement(89009..89377) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939753.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene crcB CDS 89480..90274 product deaminated glutathione amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350194.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 90402..90605 product twin-arginine translocase subunit TatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503931.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene tatE CDS complement(90674..91639) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042632.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene lipA CDS complement(91851..92795) product YbeF family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097594.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(93050..93685) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704733.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene lipB CDS complement(93773..94036) product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858718.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene ybeD CDS complement(94139..95350) product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097592.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene dacA CDS complement(95492..96640) product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097591.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene rlpA CDS complement(96651..97769) product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131713.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene mrdB CDS complement(97766..99667) product peptidoglycan DD-transpeptidase MrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097589.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene mrdA CDS complement(99698..100165) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776104.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene rlmH CDS complement(100169..100486) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161670.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene rsfS CDS complement(100757..101368) product adenosylcobalamin/alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241920.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 101466..102560 product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173241.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene cobD CDS complement(102535..103185) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989126.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene nadD CDS complement(103178..104209) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620539.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene holA CDS complement(104209..104781) product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097585.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene lptE CDS complement(104796..107378) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011378592.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene leuS CDS 107614..108096 product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831082.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(108137..108862) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097581.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(108862..109536) product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272799.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene gltK CDS complement(109536..110276) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097579.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(110440..111354) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588823.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 111560..111985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(111892..113430) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367717.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene lnt CDS complement(113450..114328) product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278615.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene corC CDS complement(114418..114885) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858677.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene ybeY CDS complement(114882..115928) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493272.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(116085..117509) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162748.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene miaB CDS 117649..118830 product 3-demethoxyubiquinol 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184606.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene ubiF tRNA complement(118918..118992) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA complement(119012..119086) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA complement(119131..119207) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(119222..119296) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA complement(119334..119408) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA complement(119431..119515) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA complement(119526..119602) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 119646..119846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(119832..121496) product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704746.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene asnB CDS complement(121749..122501) product ribonucleotide monophosphatase NagD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097571.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene nagD CDS complement(122545..123765) product N-acetylglucosamine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097570.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(123774..124922) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097569.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 gene nagA CDS complement(124989..125789) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097568.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene nagB CDS 126123..128153 product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816827.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene nagE CDS 128294..129961 product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287188.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene glnS CDS complement(130011..131303) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597466.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(131322..133430) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537441.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 133895..135292 product chitoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097565.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene chiP CDS 135405..136040 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145474.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 136191..137177 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267940.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(137248..137697) product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428651.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene fur CDS complement(137988..138518) product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018618.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene fldA CDS complement(138669..138962) product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040939.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene ybfE CDS complement(139096..139869) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773280.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene ybfF CDS 140055..140588 product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848387.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene seqA CDS 140613..142253 product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097560.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene pgm CDS complement(142314..144476) product ornithine decarboxylase SpeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297242.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene speF CDS complement(144742..145419) product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097557.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene kdpE CDS complement(145416..148103) product two-component system sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097556.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene kdpD CDS complement(148104..148682) product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097555.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene kdpC CDS complement(148696..150744) product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883015.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene kdpB CDS complement(150755..152434) product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097553.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene kdpA CDS 152830..153036 product YbfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097552.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 153299..154255 product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418304.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 154268..155686 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207142.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene phrB CDS 155699..156442 product type 2 GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023621132.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 156457..157113 product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188343.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene pxpB CDS 157107..158039 product 5-oxoprolinase subunit PxpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912700.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene pxpC CDS 158029..158763 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687174.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene pxpA CDS 158816..159538 product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704763.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 159538..160545 product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704764.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 160554..161198 product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209662.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene pcp CDS 161213..162004 product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097546.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene nei CDS complement(162157..163134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(163141..165567) product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129197795.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(165571..166266) product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095932.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene fimC CDS complement(166345..166869) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097473.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(167065..168351) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097545.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 168988..169389 product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263355.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene sdhC CDS 169383..169730 product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254356.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene sdhD CDS 169787..171496 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775540.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene sdhA CDS 171512..172228 product succinate dehydrogenase iron-sulfur subunit SdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501090.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene sdhB CDS 172496..175303 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023622290.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene sucA CDS 175318..176547 product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097540.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene odhB CDS 176632..177798 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367670.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene sucC CDS 177798..178667 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501094.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene sucD CDS complement(178739..179455) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097539.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 179625..181541 product PTS 2-O-a-mannosyl-D-glycerate transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097538.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene mngA CDS 181558..184176 product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097537.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene mngB CDS 184848..186452 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884372.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene cydA CDS 186468..187607 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568258.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene cydB CDS 187735..188028 product cyd operon protein YbgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097534.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene ybgE CDS 188177..188581 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004859689.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene ybgC CDS 188587..189270 product Tol-Pal system protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097532.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene tolQ CDS 189274..189702 product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858589.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene tolR CDS 189742..191091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 191178..192473 product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989131.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene tolB CDS 192508..193026 product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295883.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene pal CDS 193036..193821 product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097528.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene cpoB assembly_gap 194006..194134 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA 194187..194262 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS 194611..195654 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097527.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene nadA CDS 195692..196411 product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367656.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene pnuC CDS complement(196408..197355) product CDF family zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097525.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene zitB CDS complement(197471..197887) product YbgS-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784348.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 198206..199258 product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097523.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene aroG CDS complement(199320..200072) product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367652.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 gene gpmA CDS complement(200287..201327) product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097522.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene galM CDS complement(201321..202469) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097521.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene galK CDS complement(202472..203518) product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191517.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene galT CDS complement(203528..204544) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023622345.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene galE CDS complement(204758..206230) product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097518.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene modF CDS complement(206297..207085) product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147439.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene modE CDS 207214..207363 product AcrZ family multidrug efflux pump-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045380498.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 207520..208296 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097515.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene modA CDS 208293..208982 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604026.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene modB CDS 208985..210043 product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891667.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene modC CDS complement(210044..210862) product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097512.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 211014..212009 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097511.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene pgl CDS complement(212131..213414) product putative acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097510.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(213529..214005) product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097504.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(214069..215358) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052123603.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene bioA CDS 215445..216485 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097502.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene bioB CDS 216482..217630 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118805.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene bioF CDS 217614..218369 product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704796.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene bioC CDS 218356..219084 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097499.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene bioD CDS complement(219026..219748) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097498.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 220513..222534 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097496.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene uvrB CDS 222959..224140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 224143..228525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 228525..229022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 229278..229562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 229559..230062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 230216..230434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 230466..230969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(231410..232504) product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704800.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene pmrB CDS complement(232501..233175) product two-component system response regulator PmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704801.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene pmrA CDS complement(233180..234784) product phosphoethanolamine transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704802.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene eptA CDS complement(235041..235949) product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097495.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene yvcK CDS 236252..237274 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704804.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene moaA CDS 237295..237807 product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084604.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 gene moaB CDS 237811..238296 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097492.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene moaC CDS 238289..238534 product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705488.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene moaD CDS 238536..238988 product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852287.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene moaE CDS 239047..239751 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367602.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(239863..240825) product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129824.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(240825..242072) product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649638.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene clsB CDS complement(242069..242830) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113348.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 243016..243372 product YbhQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014883088.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(243334..244440) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469048.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(244450..245583) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045765.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(245573..247312) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287626.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(247305..248300) product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097481.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene hlyD CDS complement(248297..248974) product DNA-binding transcriptional regulator CecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296991.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene cecR CDS 249204..250541 product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007058.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 gene rhlE CDS complement(250474..250680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 250763..251497 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014894892.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 251664..253268 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861179.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 253277..254605 product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038001995.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 254734..256878 product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704815.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene dinG CDS 256908..257870 product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097472.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene ybiB CDS complement(258000..258260) product DUF1471 family protein YbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367588.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene ybiJ CDS complement(258546..258812) product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097470.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(259112..261778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258489.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(261794..262423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(262427..263284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(263295..263936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(263970..266948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 267280..268215 product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097467.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene rlmF CDS complement(268205..270436) product mechanosensitive channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267252.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene ybiO CDS complement(270616..271338) product glutamine ABC transporter ATP-binding protein GlnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569083.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene glnQ CDS complement(271335..271994) product glutamine ABC transporter permease GlnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159076.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene glnP CDS complement(272076..272819) product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843866.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene glnH CDS complement(273182..273685) product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100805.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene dps CDS complement(273983..274870) product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119538.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene rhtA CDS 275388..275855 product outer membrane protein OmpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097460.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene ompX CDS complement(275909..277492) product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097459.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(277770..277898) product manganase accumulation protein MntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097458.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene mntS CDS 278061..278534 product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097457.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene mntR CDS 278531..279640 product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056450.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 279742..280839 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097455.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 280836..282407 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097454.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 282409..283935 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149366214.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS 284044..285090 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097452.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(285112..285303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 285406..286782 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097451.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 286830..288149 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097450.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 288168..288884 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704828.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 289041..290099 product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705546.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 290110..292107 product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208782.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(292260..293108) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367569.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene ldtB CDS 293399..294991 product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097447.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(295190..297559) product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097446.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(297577..298878) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097445.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 299156..300247 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065355593.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(300244..301509) product DUF1479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097444.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(301659..302474) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097443.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(302712..303152) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017899343.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(303152..303469) product RcnB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365753.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(303686..304693) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703848.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(304879..305262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073493.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(305189..305380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(305425..305946) product Ail/Lom family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605048.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(305998..306597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20390 assembly_gap 306656..306735 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 307582..308370 product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097913.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene thiM CDS 308367..309167 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822268.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene thiD CDS 309204..309950 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434062.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(309924..310883) product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097910.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(310880..311884) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846192.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(311881..313173) product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858523.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 313384..314436 product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129551.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene fbaB CDS 314783..315937 product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010210634.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 315971..317596 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104458.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 317593..318633 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010220797.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 318630..319535 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245922.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 319507..320370 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104459.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 320381..321154 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104460.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(321199..322098) product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273393.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene yegS CDS 322260..322850 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706131.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(323034..324389) product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706069.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene yegQ CDS complement(324628..325350) product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137875.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 gene baeR CDS complement(325347..326750) product two-component system sensor histidine kinase BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097903.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene baeS CDS complement(326747..328162) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130817.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(328163..331240) product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667528.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 gene mdtC CDS complement(331241..334363) product multidrug efflux RND transporter permease subunit MdtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197875.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene mdtB CDS complement(334363..335604) product multidrug efflux RND transporter subunit MdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678969.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene mdtA CDS complement(335894..337246) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469740.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene yegD CDS 337366..338244 product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097889.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene alkA CDS complement(338203..341532) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420943.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 341889..342530 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500855.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene udk CDS 342632..343213 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097886.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene dcd CDS 343239..345095 product outer membrane assembly protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252360.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 gene asmA CDS complement(345411..346994) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097884.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 347773..348822 product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978074.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 348826..349269 product low molecular weight protein-tyrosine-phosphatase Wzb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482225.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene wzb CDS 349272..351434 product tyrosine-protein kinase Wzc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137123.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene wzc CDS 351549..352400 product colanic acid biosynthesis glycosyltransferase WcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097880.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene wcaA CDS 352400..352891 product colanic acid biosynthesis acetyltransferase WcaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097879.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene wcaB CDS 352888..354105 product colanic acid biosynthesis glycosyltransferase WcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097878.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene wcaC CDS 354080..355300 product colanic acid polymerase WcaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107842.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene wcaD CDS 355314..356060 product colanic acid biosynthesis glycosyltransferase WcaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097876.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene wcaE CDS 356076..356636 product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097875.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene wcaF CDS 356752..357873 product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863514.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene gmd CDS 357876..358841 product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097874.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS 358844..359320 product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309580.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene gmm CDS 359317..360540 product colanic acid biosynthesis fucosyltransferase WcaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097872.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 gene wcaI CDS 360546..361982 product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084309.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene cpsB CDS 362082..363452 product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097871.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene cpsG CDS 363563..364957 product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183160.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene wcaJ CDS 364969..366447 product colanic acid undecaprenyl disphosphate flippase WzxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097869.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 gene wzxC CDS 366591..367868 product colanic acid biosynthesis pyruvyl transferase WcaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097868.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene wcaK CDS 367865..369085 product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097867.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene wcaL CDS 369097..370494 product colanic acid biosynthesis protein WcaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097866.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene wcaM CDS 370667..371557 product GalU regulator GalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981469.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene galF CDS 371904..373211 product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939580.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS 373216..375567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 375569..376786 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058221.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 376773..377951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 377948..378694 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125497.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 378681..379529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS 379533..380651 product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167740.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene gmd CDS 380656..381621 product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097874.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 381630..382085 product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393539.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene gmm CDS 382091..383497 product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208590.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 383497..384243 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208589.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 384249..385667 product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107284302.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 385884..386882 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699404.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene rfbB CDS 386950..387828 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857508.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene rfbA CDS 388011..389417 product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043484.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene gndA CDS 389678..390844 product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097850.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene ugd CDS complement(390892..391896) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097849.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS 392097..393077 product LPS O-antigen chain length determinant protein WzzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097848.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene wzzB CDS complement(393118..393729) product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954830.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene hisIE CDS complement(393723..394499) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097847.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene hisF CDS complement(394481..395218) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586453.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene hisA CDS complement(395218..395808) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103580.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 gene hisH CDS complement(395808..396875) product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080040.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene hisB CDS complement(396872..397933) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108967.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene hisC CDS complement(397930..399234) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009596.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene hisD CDS complement(399239..400138) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886595.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene hisG CDS 400498..401322 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754712.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 401368..402297 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097841.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 402564..403925 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097840.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(404095..405519) product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645258.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene sbcB CDS 405727..406890 product serine-type D-Ala-D-Ala carboxypeptidase DacD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097838.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene dacD CDS 406968..407441 product DNA gyrase inhibitor SbmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097837.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 gene sbmC CDS 407588..408646 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706020.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 408814..409149 product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010432067.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(409175..410041) product L-threonine kinase PduX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201312.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 410629..412002 product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741259.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 411999..412964 product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153666.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene cbiB CDS 412970..413602 product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816687.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS 413599..414738 product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292925.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene cbiD CDS 414732..415337 product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958833.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 415327..415905 product decarboxylating cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650991.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 415889..416662 product cobalt-precorrin-4 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004870.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 416643..417698 product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098913.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene cbiG CDS 417698..418423 product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953643.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS 418420..419205 product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816684.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 419217..420011 product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168485.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 420008..420718 product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013551.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 420715..421458 product cobalt ECF transporter S component CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816682.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene cbiM CDS 421455..421736 product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753216.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 421717..422400 product energy-coupling factor ABC transporter transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147138.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 422409..423224 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881535.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 423221..424741 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189676.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 424738..425283 product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973185.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene cobU CDS 425280..426029 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039987.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene cobS CDS 426045..427106 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706018.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene cobT CDS 427306..427659 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222856.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 427664..427966 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213446.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(427975..428280) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365828.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 428483..430585 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706026.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene fusA CDS 430716..430895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS 431090..432121 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366474.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 432198..433112 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705514.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS 433123..434409 product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705513.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene livM CDS 434406..435281 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366477.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 435278..435994 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366478.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 436381..437703 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143830281.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 437703..439217 product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170951.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(439224..440318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(440361..442847) product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129197795.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(442879..443589) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815806.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(443652..444077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 444931..446349 product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989199.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 tRNA 446486..446561 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(446659..448113) product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428186.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 448377..449405 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096845.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(449463..450161) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168627.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 450353..450835 product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705072.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS 450881..451126 product YmjA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368794.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 tRNA complement(451229..451304) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 sequence04 source 1..326330 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(160..1056) product DNA-binding transcriptional regulator YafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095682.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene yafC CDS 1138..2007 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230964.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 2083..2853 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368130.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(2897..4051) product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644706.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene mltD CDS complement(4337..5092) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052766.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene gloB CDS 5126..5842 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095688.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(5843..6310) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917872.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene rnhA CDS 6366..7106 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368125.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene dnaQ tRNA 7234..7310 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(7425..8201) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111965864.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS complement(8306..10759) product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973130.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene fadE CDS 10999..11580 product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284051.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene lpcA CDS 11626..12393 product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095728.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(12364..13104) product peptidoglycan meso-diaminopimelic acid protein amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095729.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 gene dpaA CDS 13371..14426 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226164.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene dinB CDS complement(14521..15978) product cytosol nonspecific dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704477.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene pepD CDS 16240..16698 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863205.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene gpt CDS 16812..18059 product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189584.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene frsA CDS 18117..18518 product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025760274.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene crl CDS complement(18590..19651) product phosphoporin PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095744.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene phoE CDS 19942..21045 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095745.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene proB CDS 21057..22310 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095746.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene proA tRNA 22425..22500 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 23304..25280 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963667.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(25595..27505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(27536..28504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(28501..29103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 29245..29430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(29479..30039) product Ail/Lom family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605048.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(30230..30775) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524160.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(30769..31692) product molybdenum cofactor insertion chaperone PaoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122401.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene paoD CDS complement(31706..33907) product aldehyde oxidoreductase molybdenum-binding subunit PaoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667026.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 gene paoC CDS complement(33909..34859) product aldehyde oxidoreductase FAD-binding subunit PaoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643333.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene paoB CDS complement(34856..35422) product aldehyde dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070685.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 gene paoA CDS 35682..35975 product type I toxin-antitoxin system antitoxin YafN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554758.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 gene yafN CDS 35972..36376 product type II toxin-antitoxin system mRNA interferase toxin YafO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263501.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene yafO CDS complement(36465..37424) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969953.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(37524..38597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(38594..39478) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066594.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(39468..40307) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537570.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 40578..41900 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038841.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS 42398..43615 product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096959.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 43627..43809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(43822..44601) product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037405.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene eutC CDS complement(44598..45986) product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541772.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(45999..47375) product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267271.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene eat assembly_gap 47827..47856 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(47885..48931) product ferric ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078833.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 gene fbpC CDS complement(48936..51014) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084161.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(51085..52116) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095789.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(52113..53408) product MFS transporter family glucose-6-phosphate receptor UhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543352.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene uhpC CDS complement(53494..55035) product MASE1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095791.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(55035..55664) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095792.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(55726..55947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(55919..57607) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095797.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 57954..59738 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815979.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(59794..60765) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095798.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene hemB CDS 61306..64221 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556513.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS 64316..64939 product hydrogen peroxide resistance inhibitor IprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295817.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene iprA CDS complement(64953..66083) product D-alanyl-D-alanine-carboxypeptidase/endopeptidase AmpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830774.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene ampH CDS 66317..66850 product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095802.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 66983..68203 product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095803.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene sbmA CDS 68217..69308 product surface-exposed outer membrane lipoprotein YaiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271423.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene yaiW CDS complement(69318..69626) product YaiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763139.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 69879..70106 product DUF2754 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095806.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(70103..71212) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096588.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene ddlA CDS 71308..71991 product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095808.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 72022..73227 product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095809.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 73418..73678 product anti-adapter protein IraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095810.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene iraP CDS 73766..75181 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814404.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene phoA CDS 75275..75595 product phosphate starvation-inducible protein PsiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295332.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene psiF CDS 75863..76801 product diguanylate cyclase AdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484075.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene adrA CDS complement(76817..77626) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095814.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene proC CDS 77768..78226 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704544.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 78453..78977 product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095816.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene aroL CDS 79022..79213 product protein YaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095817.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene yaiA CDS 79466..80143 product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704547.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 80218..80502 product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368017.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene ppnP CDS complement(80628..81551) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964305.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene rdgC CDS 81664..82572 product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219315.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene mak CDS complement(82578..83753) product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196824.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene araJ CDS complement(83767..86922) product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698907.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene sbcC CDS complement(86919..88121) product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221332.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene sbcD CDS 88320..89009 product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428026.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 gene phoB CDS 89031..90326 product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893648.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene phoR CDS 90736..92055 product branched-chain amino acid transporter carrier protein BrnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149625.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene brnQ CDS 92129..93499 product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602179.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene proY CDS 93640..95481 product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297133.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 gene malZ CDS 95509..98187 product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105345.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 98184..99554 product DUF3999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765555.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS complement(99558..100139) product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009858.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene acpH CDS 100356..101426 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266503.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 101655..102782 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095832.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene tgt CDS 102805..103137 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859109.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene yajC CDS 103165..105012 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934811.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene secD CDS 105023..105994 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095834.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene secF CDS 106109..107509 product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081059.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(107547..108431) product nucleoside-specific channel-forming protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025756198.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(108701..109243) product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830864.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS 109398..109847 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543535.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene nrdR CDS 109852..110955 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095839.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene ribD CDS 111042..111512 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021161.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene ribE CDS 111534..111953 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006809908.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene nusB CDS 112035..113012 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742107.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene thiL CDS 112999..113505 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154063.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene pgpA CDS complement(113646..114620) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095841.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(114685..116547) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006797.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 gene dxs CDS complement(116572..117471) product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367988.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 gene ispA CDS complement(117473..117715) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503331.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 gene xseB CDS 117912..119360 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095844.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 gene thiI CDS 119424..120158 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936183.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(120160..120882) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932350.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(120879..122207) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726689.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(122219..123487) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254437.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(123733..124332) product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367984.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 gene yajL CDS complement(124295..125206) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705874.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 gene panE CDS 125384..125875 product nucleotide binding protein YajQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138904.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 gene yajQ CDS complement(125916..127280) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095847.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(127598..128485) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971351.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene cyoE CDS complement(128497..128826) product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019869.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(128826..129365) product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061708214.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(129430..131421) product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704587.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 gene cyoB CDS complement(131442..132389) product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095851.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene cyoA CDS 132919..134619 product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268782.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 134631..135953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(135968..137443) product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095853.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene ampG CDS complement(137485..138117) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095854.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS 138370..138687 product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095855.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene bolA CDS 139022..140320 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367952.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene tig CDS 140607..141230 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021624.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene clpP CDS 141356..142630 product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095858.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene clpX CDS 142816..145170 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067728.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene lon CDS 145381..145653 product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002444653.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene hupB CDS 145855..147726 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095860.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 gene ppiD CDS 147872..148246 product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680322.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 148342..148740 product long-chain acyl-CoA thioesterase FadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194543.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene fadM CDS complement(148943..149635) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095864.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene queC CDS complement(149701..151401) product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238179.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 151500..152318 product HMP-PP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095866.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 gene cof CDS complement(152395..153153) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068169.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(153140..154003) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924650.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(154021..154860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472332.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(154888..156474) product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099738.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(156782..157825) product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095867.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 157941..158399 product DNA-binding transcriptional regulator DecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884593.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 gene decR CDS 158451..160223 product SmdA family multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235628.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 160216..161994 product SmdB family multidrug efflux ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256093.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS 162250..162588 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780338.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene glnK CDS 162618..163904 product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000685029.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 gene amtB CDS complement(164254..165114) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095873.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene tesB CDS 165335..165904 product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779802.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS complement(165948..166259) product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095875.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS 167587..168204 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620669.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(168194..173761) product ATP-binding sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095415.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(173758..174144) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095414.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(174162..174422) product XapX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095413.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(174425..174646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23200 note possible pseudo, frameshifted CDS complement(174705..175397) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095411.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 175630..177507 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095410.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 177512..177943 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095409.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 177930..179549 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095408.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 179583..180404 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095407.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS 180673..180924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095876.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 180921..181136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367928.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS 181337..181609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069541.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 181609..181977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(182016..183443) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704605.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS 183530..184129 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367926.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 184163..185269 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095880.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 185378..188455 product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095881.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS complement(188659..190251) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095884.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 190375..191091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(191088..192287) product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803798.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 192567..193940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 194072..194332 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006176933.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS complement(194473..195183) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704607.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(195271..195747) product YlaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136192.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS complement(195850..196416) product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095888.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene maa CDS complement(196587..196805) product HHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095889.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(196834..197208) product Hha toxicity modulator TomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344807.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene tomB CDS complement(197719..200868) product multidrug efflux RND transporter permease subunit AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095890.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene acrB CDS complement(200891..202087) product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020079451.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene acrA CDS 202287..202880 product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095892.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 gene acrR CDS 203088..206363 product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095893.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene mscK CDS complement(206500..206667) product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095894.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 gene rsmS CDS complement(206683..207210) product primosomal replication protein N'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704614.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 gene priC CDS 207280..207657 product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095896.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 207809..208360 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127359.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 gene apt CDS 208473..210407 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121969.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 gene dnaX CDS 210487..210816 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(210855..211760) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811380.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 211869..212738 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705784.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 212895..213500 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195026.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene recR CDS 213601..215475 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001682145.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 gene htpG CDS 215751..216395 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220237.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene adk CDS 216519..217481 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095900.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene hemH CDS 217542..218846 product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671574.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 gene gsk CDS 218906..219088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(219001..220677) product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095902.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 gene ybaL CDS complement(220910..222124) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095903.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 222303..223955 product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095904.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene ushA CDS complement(224066..224953) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703507.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(225050..225529) product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186620.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene ybaK CDS complement(225714..226523) product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095905.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 repeat_region 226610..226740 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccctctccctcagggagaggg CDS complement(226764..229265) product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418822.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene copA CDS 229363..229767 product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095907.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene cueR CDS complement(229817..230275) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561177.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(230272..231186) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499312.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(231365..232219) product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095911.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(232402..233169) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095912.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(233198..233854) product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095913.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene tesA CDS 233792..234478 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095914.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 234475..236889 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095915.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(237047..238111) product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095917.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene mnmH CDS 238184..238318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(238315..239382) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815527.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene purK CDS complement(239379..239888) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295318.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene purE CDS complement(240127..240849) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095922.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene lpxH CDS complement(240853..241347) product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095923.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 gene ppiB CDS 241522..242907 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704630.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene cysS CDS complement(242989..243510) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143542.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(243584..244600) product Mal regulon transcriptional regulator MalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095926.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 gene malI CDS complement(244691..246145) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095927.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS 246144..246338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(246556..246768) product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095928.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 gene ybcJ CDS complement(246770..247636) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095929.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 gene folD tRNA 247863..247939 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(248014..248670) product formate dehydrogenase-N subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705520.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 gene fdnI CDS complement(248663..249547) product formate dehydrogenase N subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240581.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 gene fdnH CDS complement(249559..252606) product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154231912.1 transl_table 11 codon_start 1 transl_except (pos:252019..252021,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_23920 gene fdnG CDS complement(252787..253767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(253764..254411) product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965517.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(254408..254776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS complement(254796..254987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(255081..256148) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267673.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS 256250..257164 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103634.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(257161..258270) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365665.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 258379..258903 product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399415.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 259249..259680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 260066..260305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(260323..261102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(261096..261512) product DUF1987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(261505..262098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS complement(262095..263264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS 263723..264811 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704680.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS 264866..267052 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704681.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS 267171..268562 product phenylalanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786293.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene pheP CDS complement(268598..271201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS complement(271572..271733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 271851..273092 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 273108..274178 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097690.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 274171..275322 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS 275399..276379 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097688.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 276399..277262 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483368.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS complement(277279..277650) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097681.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(277651..278232) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097680.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS 278458..279525 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020079396.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 279566..279907 product RamA family antibiotic efflux transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367806.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(279992..282115) product ferrichrome porin FhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124373.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 gene fhuA CDS 282231..283880 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146602274.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(283840..284085) product DUF1158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682500.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(284312..285430) product YbdK family carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130659.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(285574..285918) product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968855.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS 286290..287945 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173726.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 287966..288919 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090644.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 288922..289815 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090643.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 289819..290856 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966121.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 290846..291856 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090640.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS 291872..293041 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529753.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS 293043..294305 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930854.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS 294302..294478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS complement(294464..295924) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527998.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 296161..297015 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167356.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS 297060..297701 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389051.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS 297716..298381 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522302.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS 298374..299135 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389905.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS 299179..299301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS complement(299318..300085) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389976.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS 300267..301604 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893816.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS complement(301812..302546) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156927.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS complement(302530..303354) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132443.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS complement(303347..304180) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131974.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(304180..305193) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640254.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(305404..306972) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592279.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS complement(307294..308796) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704701.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(308813..310231) product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167413.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(310265..311212) product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704703.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(311205..312035) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209438.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS 312349..313299 product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367784.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS 313413..314300 product lateral flagellin LafA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949083.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene lafA CDS 314581..315909 product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609678.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 gene fliD CDS 315939..316331 product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285322.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 gene fliS CDS 316335..316652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415004.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS 316649..317716 product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067489.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS 317734..318192 product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725259.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS 318220..318942 product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938726.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS 318991..319857 product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061067339.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 gene motA CDS 319857..320819 product putative lateral flagellar export/assembly protein LafU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191775997.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene lafU CDS 320826..321566 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056849.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS complement(322209..322367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(322909..323322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(323419..323787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS complement(323784..324944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS complement(324937..325878) product DUF2169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019587.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 sequence05 source 1..246048 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 125..580 product DUF4385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985648.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 701..1630 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122765.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene metA CDS 1875..3476 product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095022.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 gene aceB CDS 3507..4811 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857886.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 gene aceA CDS 4949..6709 product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095024.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 gene aceK CDS complement(6836..7666) product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095025.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 gene iclR CDS 7860..11543 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704023.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene metH CDS 11814..13445 product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095027.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS 13548..14417 product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936361.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 gene rluF CDS complement(14414..14686) product DUF3811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207628.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(14785..15726) product ketopantoate/pantoate/pantothenate transporter PanS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095031.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene panS CDS complement(15820..17169) product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136394.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 gene lysC CDS 17463..19109 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095033.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 gene pgi CDS 19826..20464 product YjbF family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095035.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS 20461..21198 product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095036.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS 21198..23294 product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095037.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS 23585..23995 product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202963.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 gene psiE CDS complement(24083..24973) product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095043.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 gene malG CDS complement(24988..26532) product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095044.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 gene malF CDS complement(26718..27908) product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095045.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 gene malE CDS 28260..29369 product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500080.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene malK CDS 29539..30858 product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095047.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 30973..31929 product maltose operon protein MalM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704037.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 gene malM CDS 32106..32603 product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095049.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 gene ubiC CDS 32617..33486 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455249.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene ubiA CDS complement(33591..36011) product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095051.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 gene plsB CDS 36141..36509 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368764.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS 36619..37227 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646079.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene lexA CDS 37298..38617 product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134711.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 gene dinF CDS 38846..39055 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020686626.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(39137..39652) product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095057.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene zur CDS 39774..40262 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620296.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 40452..41759 product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095059.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 41867..42865 product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704043.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene dusA CDS 43010..43252 product envelope stress response protein PspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891396.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene pspG CDS complement(43430..44413) product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235562.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS 44477..45883 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918353.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 gene dnaB CDS 45900..46979 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147297.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene alr CDS 47164..48357 product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095065.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene tyrB CDS complement(48387..48548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS 48594..49061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25070 note possible pseudo, frameshifted CDS 49043..49306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25080 note possible pseudo, frameshifted CDS 49407..49760 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155657.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(49762..50100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(50110..50532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(50664..53489) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357724.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 gene uvrA CDS 53746..54279 product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168299.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 gene ssb1 CDS complement(54337..54618) product YjcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719058.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS 55258..56751 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418469.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(56758..57081) product superoxide response transcriptional regulator SoxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095071.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene soxS CDS 57165..57623 product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095072.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 gene soxR CDS 57895..58563 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095073.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 58904..60253 product guanine/hypoxanthine transporter GhxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095074.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 gene ghxP CDS 60535..62181 product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402207.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS complement(62334..63221) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095076.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS 63325..63735 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095077.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS 63728..64417 product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095078.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(64443..65720) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098573.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(65833..67128) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167274874.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 67177..68736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703156.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS complement(68952..70604) product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704067.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene actP CDS complement(70601..70915) product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999620.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(71055..73013) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095081.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 gene acs CDS 73428..74741 product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095082.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene gltP CDS complement(74846..74998) product Hok/Gef family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095084.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 75584..76318 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095088.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(76315..77286) product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970599.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(77187..78179) product ketose 1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418474.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS complement(78191..78877) product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095092.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(78993..79934) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095094.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS complement(79967..80974) product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095095.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(80967..82478) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095096.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS 82837..85140 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095097.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 85212..85538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS complement(85535..86083) product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368697.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 gene phnH CDS complement(86248..86583) product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056482.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS 87152..89503 product clamp-binding protein CrfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095116.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 gene crfC CDS 89500..90384 product diguanylate cyclase regulator RdcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882903.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(90422..91420) product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095118.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 gene kdgT CDS 92103..93605 product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919708.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 gene proP CDS complement(93705..94658) product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418498.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS 94887..95966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(96013..98805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS 99159..99845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103250.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(99888..100439) product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179442.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS 100684..101721 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161578.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS complement(101798..102142) product DUF1869 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706012.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(102153..102485) product DUF1971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706013.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(102482..102844) product DUF1971 domain-containing protein YeaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939322.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 gene yeaR tRNA complement(103082..103157) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 103329..104174 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091026.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS 104214..104816 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114018.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(104819..105394) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095254.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS complement(105442..107223) product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095255.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(107199..107522) product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704145.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 gene cutA CDS complement(107617..108918) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368669.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(109028..110464) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368668.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 gene aspA CDS 110803..111270 product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267448.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene fxsA CDS complement(111299..112537) product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418505.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 gene yjeH CDS 112776..113069 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027827.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS 113113..114759 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729126.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 gene groL CDS 114918..115271 product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605289.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(115317..116174) product YjeJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008027.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(116319..117161) product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940500.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene epmB CDS 117389..117955 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855940.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene efp CDS 118123..118269 product lipoprotein toxin entericidin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368653.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 gene ecnB CDS complement(118311..118910) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095267.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS 119174..119491 product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118469.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 gene sugE CDS complement(119488..120018) product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238395.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 120232..121767 product glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838205.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 gene ptsG CDS 121789..123504 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202887107.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 123507..124376 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127403.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS 124378..125322 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868944.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(125377..125736) product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368650.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene frdD CDS complement(125746..126141) product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704155.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 gene frdC CDS complement(126152..126886) product fumarate reductase iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095274.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 gene frdB CDS complement(126879..128546) product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095275.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 gene frdA CDS 128908..129885 product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004789.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 gene epmA CDS 130327..131043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129713135.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 131134..131355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 131573..133909 product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098948.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene arcB CDS 134142..134795 product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300411.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene elbB CDS 134792..135511 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098946.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene mtgA CDS complement(135695..135967) product PTS phosphocarrier protein NPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861872.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene npr CDS complement(135964..136818) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098945.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 gene rapZ CDS complement(136864..137355) product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098944.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 gene ptsN CDS complement(137438..137725) product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176588.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 gene hpf CDS complement(137748..139181) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809059.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 gene rpoN CDS complement(139227..139952) product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098941.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 gene lptB CDS complement(139959..140513) product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669785.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 gene lptA CDS complement(140482..141057) product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098939.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 gene lptC CDS complement(141054..141620) product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098938.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 gene kdsC CDS complement(141634..142620) product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098937.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 gene kdsD CDS complement(142633..143610) product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098936.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS 143828..144640 product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098935.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 gene mlaF CDS 144648..145430 product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925795.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 gene mlaE CDS 145435..145989 product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193591.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 gene mlaD CDS 146003..146638 product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476475.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 gene mlaC CDS 146638..146931 product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098932.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 gene mlaB CDS 147057..147311 product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501458.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 gene ibaG CDS 147365..148624 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369505.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 gene murA CDS complement(148703..148978) product DNA-binding transcriptional regulator SfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098930.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 gene sfsB CDS complement(149202..150173) product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098929.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 gene ispB CDS 150430..150741 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025032.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 gene rplU CDS 150762..151019 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002434222.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 gene rpmA CDS 151113..152078 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369509.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 152094..153272 product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369510.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 gene cgtA CDS complement(153318..154664) product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420697.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 gene dacB CDS 154998..155474 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369513.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 gene greA CDS complement(155629..155961) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196654.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 gene yhbY CDS 156046..156675 product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861812.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 gene rlmE CDS 156766..158709 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369514.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 gene ftsH CDS 158795..159643 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764731.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 gene folP CDS 159636..160973 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071169.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 gene glmM CDS 161202..161534 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272680.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 gene secG tRNA 161544..161630 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(161750..163096) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098918.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene argG tRNA 163566..163642 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 163881..164303 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296446.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 gene rimP CDS 164332..165834 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098917.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 gene nusA CDS 165859..168570 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098916.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 gene infB CDS 168714..169118 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918248.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 gene rbfA CDS 169118..170062 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089698.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 gene truB CDS 170212..170481 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098914.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 gene rpsO CDS 170726..172861 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369529.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 gene pnp CDS 172975..173859 product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098912.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene nlpI CDS 174039..175958 product DEAD/DEAH family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098911.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS 176108..177352 product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224390.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene mtr CDS complement(177514..178521) product luciferase-like monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130380.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS complement(178602..179480) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703594.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS complement(179489..180484) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098907.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS 180725..181249 product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098906.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 181243..181746 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908562.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(181733..182035) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928379.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS 182090..182527 product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449030.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS complement(182513..183031) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098902.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 183163..183810 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001638995.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS 183887..184927 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147632.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(185068..185643) product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643280.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene dolP CDS complement(185653..186243) product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861754.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene diaA CDS complement(186266..186661) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246847.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS complement(186619..188655) product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249248.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS 188766..189629 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809263.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 gene rsmI CDS 189896..191653 product type VI secretion system tube protein TssD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502511.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 gene tssD CDS 191658..191948 product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481663.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS 192120..192410 product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282228.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS complement(192517..193308) product PTS galactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534347.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 gene agaD CDS complement(193298..194101) product PTS galactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544474.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 gene agaC CDS complement(194156..194632) product PTS galactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098022.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 gene agaB CDS complement(194682..195554) product tagatose-bisphosphate aldolase subunit KbaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022773.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 gene kbaY CDS complement(195558..196703) product AgaS family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114873.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(196979..197413) product PTS galactosamine/N-acetylgalactosamine transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948824.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 gene agaF CDS complement(197540..198844) product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024130977.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 gene kbaZ CDS 199091..199900 product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098886.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS complement(199957..200847) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168564.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(200919..201467) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390815.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 201636..202643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(202702..203379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095762.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS 203583..203852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS complement(203931..205502) product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273719.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 gene garD CDS 205978..206748 product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057715.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene garL CDS 206780..207670 product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178106.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 gene garR CDS 207764..208909 product glycerate 2-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703577.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene garK CDS complement(209514..209681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS complement(209704..210405) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098873.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS 210510..211409 product DNA-binding transcriptional regulator YhaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041028.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 gene yhaJ CDS complement(211435..211800) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369567.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS complement(212025..213662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS 213807..214985 product oligogalacturonate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816209.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 gene ogl CDS 214997..216283 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170166.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS 216340..217155 product 5-keto-L-gluconate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083268.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 gene iolO CDS complement(217176..218180) product glutathionyl-hydroquinone reductase YqjG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531180.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene yqjG CDS complement(218251..218643) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732240.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(218839..219135) product YqjK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095496.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS complement(219135..219530) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785626.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS complement(219532..219840) product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098866.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS complement(219873..220241) product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877297.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS complement(220390..220773) product EnvZ/OmpR regulon moderator MzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098864.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 gene mzrA CDS complement(220775..221437) product DedA family general envelope maintenance protein YqjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369576.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene yqjA CDS complement(221768..222544) product transcriptional regulator ExuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098862.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 gene exuR CDS complement(222683..223987) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098861.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS 224455..225867 product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187442.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene uxaC CDS 225885..227372 product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098859.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS 227477..228031 product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128143.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS complement(228048..229292) product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235369.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 gene sstT CDS complement(229521..230489) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703564.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS complement(230734..231714) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098856.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(231804..232295) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202966.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS 232380..233516 product 23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098854.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 gene rlmG CDS 233700..234563 product DUF3289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059672.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS 234599..235087 product DUF943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837563.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS complement(235124..237142) product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098853.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS complement(237386..238969) product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098852.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene lsrK CDS complement(239006..239977) product transcriptional regulator LsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098851.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 gene lsrR CDS 240194..241684 product autoinducer 2 ABC transporter ATP-binding protein LsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098850.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 gene lsrA CDS 241681..242715 product autoinducer 2 ABC transporter permease LsrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098849.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 gene lsrC CDS 242716..243708 product autoinducer 2 ABC transporter permease LsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703557.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 gene lsrD CDS 243710..244711 product autoinducer 2 ABC transporter substrate-binding protein LsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098847.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 gene lsrB CDS 244723..245610 product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917724.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene lsrF CDS 245607..245900 product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098845.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene lsrG CDS 245900..246031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27040 sequence06 source 1..232467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(137..409) product YfiM family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370273.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS complement(517..1755) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949286.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene pssA CDS complement(1993..4647) product protein lysine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098332.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene pat CDS complement(4680..5207) product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703189.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 gene tapT CDS complement(5447..5866) product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098330.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 gene trxC CDS 6069..7124 product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098329.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(7158..7847) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098328.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 gene ung CDS 8163..8546 product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914084.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene grcA CDS complement(8591..9913) product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098326.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 gene srmB CDS 10123..10782 product tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302911.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 gene trmN CDS complement(10771..12375) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094491.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 gene nadB CDS 12800..13375 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006176728.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 gene rpoE CDS 13408..14061 product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168379.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 gene rseA CDS 14061..15014 product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098322.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene rseB CDS 15011..15490 product SoxR-reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703183.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 gene rseC CDS 15659..17458 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370288.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 gene lepA CDS 17474..18448 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098319.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene lepB CDS 18724..19338 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860711.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 gene rnc CDS 19335..20243 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102231.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene era CDS 20250..20969 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098316.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 gene recO CDS 21086..21817 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098315.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 gene pdxJ CDS 21817..22197 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986023.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 gene acpS CDS complement(22194..22454) product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370294.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS complement(22511..23359) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098313.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 23478..24371 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098312.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 gene murQ CDS 24382..25743 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098311.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS 25747..26379 product phosphatidylglycerophosphatase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190651.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 gene yfhb CDS 26432..26932 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134566.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene tadA CDS complement(26929..28479) product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098308.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 gene mltF CDS 28747..32634 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098307.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 gene purL CDS 33173..34561 product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420402.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 gene qseE CDS 34558..35292 product two-component system QseEF-associated lipoprotein QseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098305.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 gene qseG CDS 35289..36626 product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098304.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 gene glrR CDS 36707..37045 product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914032.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 gene glnB CDS complement(37124..38314) product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098303.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 gene hmpA CDS 38640..39893 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919178.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS complement(39953..40552) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210048.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(40549..42186) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210047.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS complement(42204..43157) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210046.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS complement(43159..44148) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210045.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS complement(44141..45649) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210044.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS complement(45735..46718) product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210043.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 47193..48332 product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173729.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS complement(48329..49540) product stationary phase inducible protein CsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098299.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 gene csiE CDS 49731..50369 product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805721.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS 50360..51340 product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098297.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS complement(51346..52194) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299515.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS complement(52492..53298) product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553464.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 gene suhB CDS 53419..54153 product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370313.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 gene trmJ CDS 54379..54870 product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098294.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 gene iscR CDS 55010..56224 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703173.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 gene iscS CDS 56252..56638 product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703172.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene iscU CDS 56650..56973 product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012540868.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 gene iscA CDS 57050..57565 product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384391.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene hscB CDS 57580..59430 product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196613.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene hscA CDS 59432..59767 product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124466.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 gene fdx CDS 59769..59969 product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860650.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene iscX CDS 60032..61321 product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098291.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 gene pepB CDS 61472..62248 product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001337650.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 gene sseB CDS complement(62267..63037) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098289.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS complement(63040..63879) product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098288.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 gene sseA CDS complement(63975..65336) product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098287.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS complement(65348..66895) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420384.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS complement(67084..67305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 67401..72137 product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098285.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS 72139..74466 product peptidoglycan glycosyltransferase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098284.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 gene pbpC CDS 75006..77027 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098283.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS 77024..77653 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098282.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 gene dmsB CDS 77646..78449 product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098281.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS 78449..79309 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247794.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS 79569..80000 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963846.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 gene ndk CDS 80152..81318 product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098279.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS 81614..82618 product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098278.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene rodZ CDS 82645..83763 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551807.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 gene ispG CDS 83871..85145 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107167.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 gene hisS CDS 85183..85803 product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409190.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 85814..86992 product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177072.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 gene bamB CDS 87125..88612 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370328.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 gene der CDS 88720..88938 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196896.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS complement(88952..90325) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937889.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 gene xseA CDS 90484..91950 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370334.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 gene guaB CDS 92016..93593 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098264.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 gene guaA CDS 93781..93996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS 94485..96560 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098245.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS complement(96585..98129) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832869.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 gene ppx CDS complement(98133..100193) product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098243.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 gene ppk1 CDS complement(100418..101059) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098242.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 gene purN CDS complement(101056..102177) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098241.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 gene purM CDS 102327..102953 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860560.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 gene upp CDS 103054..104343 product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098238.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 gene uraA CDS 104364..105140 product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100388.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(105302..105661) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365459.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 gene arsC CDS complement(105674..107137) product beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489667.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 gene bepA CDS 107336..108397 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098230.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS complement(108468..108938) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098229.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 gene bcp CDS complement(108938..109510) product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001576288.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 109656..110534 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098227.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 gene dapA CDS 110551..111585 product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331881.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 gene bamC CDS 111703..112416 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501631.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS 112542..113408 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267498.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS 113421..115436 product tRNA cytosine(34) acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829314.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 gene tmcA CDS 115514..116212 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703146.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 gene ypfH CDS complement(116380..116568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(116596..117723) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098221.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 gene dapE CDS complement(117727..118089) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631925.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS complement(118803..121919) product multidrug efflux RND transporter permease AcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273136.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 gene acrD CDS complement(122089..123780) product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350312.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 gene narQ CDS 124237..125157 product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098215.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(125147..127141) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098214.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 gene tkt CDS complement(127162..128112) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098213.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 gene tal CDS 128394..130673 product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098212.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 gene maeB CDS complement(130792..131694) product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309639.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 gene hemF CDS complement(131694..132566) product N-acetylmuramoyl-L-alanine amidase AmiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102892.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 gene amiA CDS 132776..133201 product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098209.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS 133290..133637 product DUF2919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300381.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS 133702..134277 product RpoE-regulated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838945.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS 134370..135269 product porphyrinogen peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084583.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 gene yfeX CDS 135512..136528 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365488.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS 136528..137361 product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458420.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 gene cysT CDS 137361..138236 product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703135.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 gene cysW CDS 138226..139323 product sulfate/thiosulfate ABC transporter ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021036.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 gene cysA CDS 139436..140347 product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098201.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene cysM CDS 140358..141206 product pyridoxine/pyridoxal/pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529606.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 gene pdxK CDS 141264..141917 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209852.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS complement(141982..142491) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522253.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 gene crr CDS complement(142532..144259) product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098199.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene ptsI CDS complement(144303..144560) product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487600.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 gene ptsH CDS complement(144946..145917) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098198.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 gene cysK CDS complement(146059..146820) product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255008.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 gene cysZ CDS complement(147165..147383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS 147400..147627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 147675..148076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS 148148..150163 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433258.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 gene ligA CDS 150165..150380 product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878164.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(150377..151381) product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098194.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS complement(151554..151895) product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098192.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 tRNA complement(152225..152300) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA complement(152305..152380) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(152416..152491) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(152535..152610) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 152868..154283 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695623.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 gene gltX CDS complement(154337..154729) product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826500.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS complement(154734..155087) product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472034.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 tRNA 155305..155380 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA 155421..155496 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS 156690..157901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS complement(157977..159164) product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098187.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 159515..160750 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420300.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(160832..161179) product DUF2502 domain-containing protein YpeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490091.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 gene ypeC CDS complement(161302..162300) product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098184.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 gene mgrA CDS 162544..163509 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098181.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 gene glk CDS complement(163512..164243) product two-component system response regulator YpdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091327.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 gene ypdB CDS complement(164258..165955) product two-component system sensor histidine kinase YpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544379.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 gene ypdA CDS 166343..167557 product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098178.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 gene alaC CDS 168216..170990 product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287111.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 171094..171516 product PTS mannose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287112.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS 171531..172001 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287114.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS 172017..172796 product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357107.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS 172774..173622 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002401797.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS 173633..174694 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383119.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS 174716..175726 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236585662.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 175999..178971 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037794.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 gene fdhF CDS 178971..179450 product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037793.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS 179452..180837 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037792.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS 180830..181813 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037791.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 gene cydB CDS complement(181838..183634) product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530887.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 tRNA complement(183742..183816) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(183892..184833) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377769.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS 185111..185863 product phospholipid-binding lipoprotein MlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776787.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 gene mlaA CDS complement(185924..187207) product long-chain fatty acid transporter FadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350318.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 gene fadL CDS 187570..187854 product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030904.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 188015..189325 product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420286.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 gene fadI CDS 189325..191472 product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425046.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 gene fadJ CDS 191780..192166 product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195808.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 gene sixA CDS complement(192241..192792) product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730806.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 gene smrB CDS 192960..193892 product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098152.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 gene prmB CDS 193954..195039 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297933.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 gene aroC CDS 195043..195867 product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098150.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 gene mepA CDS 195867..196676 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098149.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS 196676..197224 product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098148.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS 197250..197528 product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098147.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS 198010..198249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS 198621..199547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS 199620..201035 product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817199.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS 201052..202191 product CpaE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213784.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 202228..203517 product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213785.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS 203514..204428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS 204430..205287 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817202.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS 205281..206573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS 206669..207028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS 207110..207625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS 207643..208140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS 208218..208649 product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261277.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS 208651..209133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS 209149..209763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS 209789..211558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS 211587..212243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS 212499..213044 product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207703.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS 213087..213446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229623.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS 213971..216034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28970 note possible pseudo, frameshifted CDS complement(216086..218092) product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683534.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 gene mnmC CDS 218250..219467 product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098145.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 gene fabB CDS 219537..220724 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098144.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS 220797..222227 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098239.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(222277..223287) product flagella biosynthesis regulator Flk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098143.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 gene flk CDS 223412..224524 product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699105.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 gene pdxB CDS 224591..225604 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365551.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS 225604..226416 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283586.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 gene truA CDS 226442..227101 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365553.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 227205..228119 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118383.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 gene accD CDS 228273..229454 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098137.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 gene folC CDS 229471..230091 product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832787.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 gene dedD CDS 230153..230353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS 230369..230857 product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098135.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 gene cvpA CDS 230891..232408 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098134.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 gene purF sequence07 source 1..204213 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(118..1182) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210202.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 gene ugpC CDS complement(1196..2569) product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839208.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 gene cpsG CDS complement(2597..3631) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210200.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS 3816..5105 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210199.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS 5115..5981 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210198.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS 5982..6809 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210197.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS 6820..8316 product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989597.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 8300..9358 product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210196.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 assembly_gap 9375..9418 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9495..10784) product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098827.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 gene ygjG CDS 11294..12814 product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098826.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS 13271..14830 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098825.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS complement(14827..15255) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098824.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS 15220..15363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS 15598..16368 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098823.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS complement(16369..17538) product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098822.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS complement(17727..18170) product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098729.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 gene lysM CDS 18334..20304 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704237.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS 20304..21638 product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704236.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS 21657..22286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS complement(22328..22903) product phage repressor protein CI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071886413.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS 23124..23462 product DUF5347 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996717.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS 23565..23786 product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785510.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS 23776..25284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29350 note possible pseudo, frameshifted CDS 25281..25796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29360 note possible pseudo, frameshifted CDS 25964..26131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS 26337..26540 product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005917735.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS 26531..26767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS 26751..27260 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069919.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS 27257..27682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS 27657..27815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS 27778..28245 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098790.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS 28392..29033 product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048619997.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS 29030..29377 product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816097.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS 29382..30290 product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816096.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS 30283..30894 product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816095.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS 30891..32057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS 32059..32493 product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174915.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS complement(32462..32629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS 32812..34002 product phage tail sheath protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046120.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS 34016..34534 product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007848874.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS 34596..34871 product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048619990.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS 34965..37028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS 37044..37511 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980413.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS 37501..38598 product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011760.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS 38666..38863 product prophage transcriptional regulator OgrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468310.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 gene ogrK CDS complement(39046..40098) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098812.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS complement(40101..40454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS 40821..41057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098810.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS 41092..41601 product phage regulatory CII family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460852.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS 41803..42168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS 42238..42477 product DUF2732 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244240.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS 42477..42704 product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098805.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS 42713..43555 product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098804.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS 43552..45780 product replication endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816116.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS 45914..46102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154444.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS 46113..46346 product DinI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217561.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS 46458..47480 product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(47511..48191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS complement(48193..49335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS complement(49690..50655) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049560050.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS complement(50727..52499) product terminase ATPase subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098422.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS 52668..53522 product GPO family capsid scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216223.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS 53578..54651 product phage major capsid protein, P2 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098795.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS 54655..55401 product terminase endonuclease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059199.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS 55496..55996 product head completion/stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010835209.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS 55996..56199 product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005917735.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS 56190..56411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS 56395..56904 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069919.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS 56901..57326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS 57214..57435 product Rz1-like lysis system protein LysC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223151184.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 gene lysC CDS 57422..57889 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039939.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS 57882..58334 product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829122.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS 58371..59045 product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048619997.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS 59042..59389 product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098787.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS 59394..60302 product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816096.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS 60295..60906 product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816095.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS 60903..62387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS 62389..62811 product tail assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344820.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS 63001..64191 product phage tail sheath protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046120.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS 64205..64723 product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007848874.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS 64782..65057 product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048619990.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS 65202..67790 product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001390260.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS 67803..68279 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098780.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 68282..69430 product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011760.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 tRNA complement(69879..69954) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS 70080..70586 product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098778.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 gene mug CDS complement(70728..72572) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098777.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 gene rpoD CDS complement(72729..74438) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918867.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 gene dnaG CDS complement(74591..74806) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 gene rpsU CDS 75043..76056 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264352.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 gene tsaD CDS complement(76100..76723) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272784.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 gene plsY CDS 76828..77199 product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295541.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 gene folB CDS 77305..78123 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281933.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 gene bacA CDS complement(78134..79375) product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098762.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS complement(79440..80123) product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125331.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS 80299..81600 product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046287.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 gene ygiF CDS 81622..84465 product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098759.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 gene glnE CDS 84519..85949 product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098758.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 gene hldE CDS complement(85997..87268) product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037404.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS 87555..87728 product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928914.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS 87784..88203 product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211129.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS 88365..89735 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095438.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS complement(89845..90804) product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297640.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 gene yjiA CDS complement(90817..91011) product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856610.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS complement(91139..93289) product pyruvate/proton symporter BtsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309197.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 gene btsT CDS complement(93559..94101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934391.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS 94345..96006 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095457.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 gene tsr CDS complement(96068..98359) product phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292715.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 gene opgB CDS complement(98653..99390) product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799923.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 gene dnaC CDS complement(99393..99932) product primosomal protein DnaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368405.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 gene dnaT CDS complement(100075..100503) product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095463.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS complement(100583..101038) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095464.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS complement(101082..101723) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095465.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS complement(101791..102264) product threonine/serine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511327.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS complement(102255..102941) product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368403.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 103489..104226 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020688833.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS 104172..104849 product DNA-binding transcriptional activator BglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431550.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 gene bglJ CDS complement(104988..105449) product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368396.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS 105787..107130 product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704317.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS complement(107158..107958) product siderophore-iron reductase FhuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331596.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 gene fhuF CDS complement(108051..108953) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418641.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS 109370..109609 product DUF1435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001577669.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 tRNA complement(109642..109727) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(109760..109845) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA complement(109874..109959) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS complement(110082..111110) product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095479.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 gene rsmC CDS 111214..111627 product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203999.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS 111596..112036 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092461.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 gene rimI CDS 112056..112733 product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870710.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 gene yjjG CDS 112827..114416 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175968.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 gene prfC CDS 114835..115458 product molecular chaperone OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095484.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 gene osmY CDS 115574..115735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS 115853..116926 product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531551.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS 116923..117717 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095486.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS complement(117692..118507) product YjjW family glycine radical enzyme activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088427.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS complement(118527..120077) product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143253.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS 120274..121128 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368381.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 gene deoC CDS 121195..122517 product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095490.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 gene deoA CDS 122604..123827 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095491.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 gene deoB CDS 123900..124619 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002887789.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 gene deoD CDS complement(124755..125771) product lipoate--protein ligase LplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105844.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 gene lplA CDS complement(125793..126440) product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090060.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS 126544..127515 product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095495.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 gene serB CDS 127526..128908 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029720.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 gene radA CDS 128987..130222 product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532645.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 gene nadR CDS complement(130342..132009) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704325.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 gene ettA CDS 132245..134182 product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409429.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 gene sltY CDS 134237..134566 product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068678.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 gene trpR CDS complement(134557..135078) product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704327.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 gene yjjX CDS 135125..135772 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704328.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene gpmB CDS complement(135769..136638) product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704329.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 gene robA CDS 136850..137326 product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095506.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 gene creA CDS 137337..138029 product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368366.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 gene creB CDS 138029..139453 product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219596.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 gene creC CDS 139511..140875 product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920350.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 gene creD CDS complement(140910..141626) product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856501.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 gene arcA CDS complement(141632..141823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS 142257..142943 product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223132.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS 143301..145763 product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264731.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 gene thrA CDS 145765..146694 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095510.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 gene thrB CDS 146698..147984 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781063.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 gene thrC CDS complement(148140..148913) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906171.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 gene yaaA CDS complement(148969..150420) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113816.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS 150613..151566 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095515.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 gene tal CDS 151678..152265 product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095516.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene mog CDS 152390..153697 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095517.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS complement(153749..154315) product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095518.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 gene satP CDS 154614..156530 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516126.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 gene dnaK CDS 156616..157755 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118464.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 gene dnaJ CDS 158091..159044 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534904.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS 159198..159536 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704339.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(159570..160115) product glycoside hydrolase family 108 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368347.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS complement(160105..160542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 160941..163007 product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704340.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS 163085..166123 product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704341.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS 166289..167449 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681337.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 gene nhaA CDS complement(167554..167817) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274021.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 gene rpsT CDS 168145..169083 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020688470.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 gene ribF CDS 169121..171937 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286898.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 gene ileS CDS 171937..172434 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368327.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 gene lspA CDS 172489..172938 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095528.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 gene fkpB CDS 172940..173890 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095529.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 gene ispH CDS 173957..174871 product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704354.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 gene rihC CDS complement(174979..177636) product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990052.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(177649..179607) product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990051.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS 179830..180390 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706187.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS 180383..181165 product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811367.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS complement(181325..182140) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706181.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS complement(182140..182937) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706182.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS complement(182934..183443) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706183.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS complement(183453..183881) product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706184.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS complement(183883..185622) product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706185.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS 185805..186815 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819931.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS 186953..187774 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543582.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 gene dapB CDS 188334..189377 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704367.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 gene carA CDS 189396..192620 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095532.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 gene carB CDS 192764..192997 product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095533.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS 193143..193673 product glutathione-regulated potassium-efflux system oxidoreductase KefF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704370.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 gene kefF CDS 193666..195528 product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377186.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 gene kefC CDS 195703..196182 product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624378.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 gene folA CDS complement(196300..197148) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095538.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 gene apaH CDS complement(197153..197530) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368292.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 gene apaG CDS complement(197534..198235) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065397.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 gene rsmA CDS 198122..198358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS complement(198352..199338) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095541.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 gene pdxA CDS complement(199338..200624) product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095542.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 gene surA CDS complement(200678..203155) product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095543.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 gene lptD CDS 203278..204096 product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095544.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 gene djlA sequence08 source 1..163744 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(27..1163) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098670.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene hemW CDS complement(1156..1749) product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098669.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS complement(1759..2049) product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277205.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 gene yggU CDS complement(2046..2612) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369729.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS complement(2631..3335) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098666.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS 3353..4333 product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883139.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS complement(4330..6588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS 6655..7347 product global regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098333.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS complement(7474..7890) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006811925.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 gene ruvX CDS complement(7890..8453) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369734.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS complement(8549..9496) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593260.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 gene gshB CDS complement(9509..10240) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098662.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 gene rsmE CDS complement(10406..11113) product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001327408.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 gene endA CDS complement(11208..11666) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860035.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS complement(11794..13149) product galactose/proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098659.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 gene galP CDS complement(13463..14662) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004149807.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 gene metK CDS 15498..17396 product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278580.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 gene speA CDS complement(17486..25069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS complement(25083..26810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS complement(27024..27245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS 27330..28250 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002434404.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 gene speB CDS complement(28267..28449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS complement(28412..29170) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703437.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS 29449..31440 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420542.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 gene tkt CDS 31735..32181 product PTS mannitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239650.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 gene cmtB CDS 32212..33600 product PTS mannitol transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428805.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene cmtA CDS 33614..34891 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853233.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS 34888..35859 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987303.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 gene glpX CDS 35875..36384 product fumarase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224135.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 gene fumE CDS 36381..37082 product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687699.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS complement(37121..39688) product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861780.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS complement(39685..41709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS complement(41714..42928) product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029647.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS complement(42928..44562) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861822.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS complement(44801..45454) product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956878.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS complement(45448..46125) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256969.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS complement(46113..46820) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553215.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS complement(46821..47399) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124001.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS complement(47426..47845) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218564.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS 48218..49237 product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098636.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 gene epd CDS 49295..50458 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098635.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 gene pgk CDS 50553..51629 product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098634.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 gene fbaA CDS 51938..52801 product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389833.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS 53009..53599 product arginine exporter ArgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098632.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 gene argO CDS 53695..54471 product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098631.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS complement(54506..55399) product DNA-binding transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499727.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 gene argP CDS 55573..56232 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098630.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene rpiA CDS 56484..57716 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098629.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 gene serA CDS complement(57825..58301) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098628.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS complement(58673..59002) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006811891.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 gene zapA CDS 59212..59796 product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027229.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS 59824..61140 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193684.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 gene pepP CDS 61137..62315 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098625.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 gene ubiH CDS 62326..63528 product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098624.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 gene ubiI CDS 63977..65071 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068738.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 gene gcvT CDS 65095..65484 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098622.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 gene gcvH CDS 65670..68543 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098621.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 gene gcvP CDS 68610..69353 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098620.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS complement(69375..70808) product 6-phospho-beta-glucosidase BglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350137.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 gene bglA CDS complement(70955..71689) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098618.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS 71989..72648 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250274.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(72716..73807) product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886087.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 gene ygfZ CDS 73941..74207 product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369791.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 gene sdhE CDS 74188..74604 product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369792.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS complement(74611..75132) product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369793.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 gene fldB CDS 75293..76189 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434302.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 gene xerD CDS 76214..76927 product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745614.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 gene dsbC CDS 76933..78666 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813193.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 gene recJ CDS 78812..79855 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095908218.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 gene prfB CDS 79865..81382 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098608.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 gene lysS CDS 81560..82258 product amidase activator ActS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369803.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 gene actS tRNA 82349..82422 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS 82536..83501 product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605880.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 gene uvsE CDS complement(83505..84449) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096538.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS 84567..85316 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619652.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS complement(85350..86258) product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488351.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS complement(86297..86809) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109977.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS complement(86898..87374) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038765.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(87767..89947) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108110.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 gene katG CDS complement(89934..90089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS 90178..94791 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310034.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS 95059..95997 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230262.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS 96016..97059 product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533385.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 gene fni CDS 97056..98297 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024453.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS 98294..99445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS 99442..100920 product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106515452.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS 100917..101846 product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338116.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS complement(101785..102312) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS 102260..102481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS 102592..103614 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096947.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS 103607..104275 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096946.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS 104288..105115 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096945.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS 105272..106453 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620438.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS 106905..107585 product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098578.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS complement(107798..108973) product oligogalacturonate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098577.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS 109442..110278 product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383248.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 gene kduI CDS 110340..111101 product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703339.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 gene kduD CDS complement(111240..112370) product oligogalacturonate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816209.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 gene ogl CDS complement(112435..113724) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098573.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS complement(113738..114865) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098572.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 gene ugpC CDS complement(114878..115780) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098571.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS complement(115773..116663) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098570.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS complement(117145..117471) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098568.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS 117613..118305 product aspartate/glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098567.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS complement(118302..119228) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703333.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS 119347..120609 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098565.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 gene lysA CDS complement(120606..121619) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098564.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS 121941..123278 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098563.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS 123286..124713 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098562.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS 124790..125563 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098561.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS 125560..126009 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098560.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS complement(126006..127013) product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201064.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 gene galR CDS 127442..129601 product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098558.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 gene aas CDS 129594..130784 product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620430.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 gene lplT CDS complement(130831..131871) product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199295.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS complement(131997..132215) product lipoprotein YgdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758655.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 gene ygdR CDS complement(132450..133163) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895635.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS complement(133226..133921) product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369924.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 gene mutH CDS 134669..135133 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098553.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 gene rppH CDS 135146..137392 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957883.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 gene ptsP CDS 137569..138444 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204645.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 gene lgt CDS 138451..139245 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098550.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 gene thyA CDS 139429..139899 product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857051.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS 139890..140453 product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144322.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS 140450..140857 product DUF2509 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703325.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS 140842..141165 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098547.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS 141178..144546 product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946942.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 gene recC CDS 144671..147571 product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098545.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 gene ptrA CDS 147568..151113 product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098544.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 gene recB CDS 151110..152936 product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155175.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 gene recD CDS complement(153045..154376) product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098542.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 gene argA CDS 154662..155858 product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011916.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 gene amiC tRNA complement(155918..155994) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(156045..156121) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(156169..156245) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS 156455..157558 product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098540.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 gene mltA CDS 157561..157806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS 157848..158654 product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117724.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 gene tcdA CDS complement(158645..159088) product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184261.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 gene csdE CDS complement(159085..160293) product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300698.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 gene csdA CDS 160487..160714 product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750393.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS 161125..161979 product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369945.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 gene gcvA CDS 162020..162415 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369946.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS 162408..163508 product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098534.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 gene rlmM sequence09 source 1..162400 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 185..874 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099390.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS 890..2287 product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099391.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 gene mdtD CDS complement(2284..3276) product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099392.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 gene rbsR CDS complement(3283..4212) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420966.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 gene rbsK CDS complement(4287..5177) product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056273.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 gene rbsB CDS complement(5204..6169) product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099395.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 gene rbsC CDS complement(6166..7680) product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099396.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 gene rbsA CDS complement(7688..8107) product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099397.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 gene rbsD CDS complement(8321..10189) product low affinity potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099398.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 gene kup CDS 10411..11907 product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099399.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 gene ravA CDS 11901..13352 product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956591.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 gene viaA CDS complement(13354..14346) product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099401.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 gene asnA CDS 14497..14955 product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500198.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 gene asnC CDS 15046..15495 product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099402.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 gene mioC CDS 15869..17758 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499788.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 gene mnmG CDS 17859..18482 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099403.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 gene rsmG CDS 19096..19476 product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145371.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 gene atpI CDS 19485..20303 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135618.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 gene atpB CDS 20351..20590 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429386.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 gene atpE CDS 20649..21119 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052219.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 gene atpF CDS 21134..21667 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099407.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 gene atpH CDS 21680..23221 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862367.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 gene atpA CDS 23272..24135 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862364.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 gene atpG CDS 24162..25544 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862362.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 gene atpD CDS 25565..25984 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006177560.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS complement(26360..28537) product exopolygalacturonate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482823.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS 28933..30249 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099408.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 gene glmU CDS 30498..32327 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334049.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 gene glmS CDS 32616..33656 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099410.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 gene pstS CDS 33784..34743 product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741630.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 gene pstC CDS 34743..35633 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099412.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 gene pstA CDS 35682..36455 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063118.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 gene pstB CDS 36470..37195 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377800.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 gene phoU CDS complement(37309..37974) product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099413.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 gene yieH CDS 38144..39481 product adenine permease AdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214973.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 gene adeP CDS complement(39518..39970) product DUF1198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094815.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS complement(40037..41053) product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213216.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS complement(41025..42371) product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998359.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 gene fucP CDS complement(42404..43324) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350272.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 gene rbsK CDS 43510..44298 product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448638.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS complement(44301..44591) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171826.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 gene ilvN CDS complement(44595..46283) product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703882.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 gene ilvB CDS complement(46635..46808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS 46967..47164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096722.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS 47166..47942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096723.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS complement(48383..48595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS 48610..49443 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703884.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS 49654..50805 product multidrug efflux MFS transporter EmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828742.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 gene emrD CDS 50893..52212 product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703886.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 gene dsdA CDS complement(52209..52571) product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113457.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(52561..52908) product YidH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703959.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS complement(53100..54422) product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094794.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS complement(54419..56035) product alpha-glucoside-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369051.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS 56258..56992 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094792.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS complement(56972..58633) product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279784.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS 58911..59201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS complement(59264..59692) product heat shock chaperone IbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001766501.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 gene ibpB CDS complement(59787..60200) product heat shock chaperone IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532742.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 gene ibpA CDS 60579..60839 product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369045.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS complement(60840..62066) product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094788.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS complement(62117..63409) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032706561.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS complement(63522..64670) product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094786.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 gene dgoD CDS complement(64667..65284) product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094785.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS complement(65268..66146) product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094784.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS complement(66143..66832) product D-galactonate utilization transcriptional regulator DgoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369039.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 gene dgoR CDS complement(67080..67892) product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985571.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 gene yidA CDS complement(68205..70619) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072047.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 gene gyrB CDS complement(70648..71721) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094779.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 gene recF CDS complement(71721..72821) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673464.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 gene dnaN CDS complement(72840..74165) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014068246.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 gene dnaA CDS 75028..75354 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703902.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 gene rnpA CDS 75578..77224 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378272.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 gene yidC CDS 77324..78688 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282361.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 gene mnmE CDS 78902..79114 product RNA chaperone/antiterminator CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860775.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 gene cspA CDS 79348..80028 product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190678.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS 80048..80614 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369022.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS 80740..81921 product purine ribonucleoside efflux pump NepI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004798.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 gene nepI CDS complement(82008..83387) product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094819.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS complement(83531..83833) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171894.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS complement(83836..85233) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270464.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS complement(85247..86572) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094821.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS complement(86584..86898) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094822.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS 87192..88139 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094823.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS complement(88274..88807) product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369089.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS 88932..89855 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703863.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS complement(89852..90505) product oxygen-insensitive NAD(P)H-dependent nitroreductase NfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073505.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS 90622..91530 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039278.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS complement(91527..91721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS 91791..92552 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971207.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS 92555..93751 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530113.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS 93754..94674 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850115.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 tRNA complement(94737..94831) product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS complement(94844..95005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS 95120..96514 product glycoside-pentoside-hexuronide family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834439.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS 96526..98844 product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703001.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 gene yicI CDS complement(98892..100271) product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703822.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS complement(100285..101835) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703821.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS complement(102042..103757) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094876.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS complement(103878..105284) product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094877.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS 105451..106293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS complement(106306..108387) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016758.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 gene recG CDS complement(108391..109080) product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070177.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 gene trmH CDS complement(109085..111199) product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094882.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 gene spoT CDS complement(111218..111493) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 gene rpoZ CDS complement(111548..112171) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046966.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 gene gmk CDS 112431..114122 product NAD-dependent DNA ligase LigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094885.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 gene ligB CDS complement(114248..115111) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621336.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS 115236..115952 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369149.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 gene rph CDS 116018..116659 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703811.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 gene pyrE CDS complement(116694..117290) product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369151.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 gene slmA CDS complement(117414..117872) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015570042.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 gene dut CDS complement(117850..119064) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703809.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 gene coaBC CDS 119232..119894 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380129.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 gene radC CDS 120113..120349 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002436699.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 gene rpmB CDS 120370..120537 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208990.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 gene rpmG CDS 120609..121418 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094894.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 gene mutM CDS complement(121512..121991) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703808.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 gene coaD CDS complement(121988..122758) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094896.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS complement(122758..124032) product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094897.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 gene waaA CDS 124221..125324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS complement(125303..126412) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703804.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS complement(126409..127512) product putative lipopolysaccharide heptosyltransferase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094901.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 gene rfaQ CDS complement(127505..128482) product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264584.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 gene rfaC CDS complement(128486..129532) product ADP-heptose--LPS heptosyltransferase RfaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094907.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 gene rfaF CDS complement(129612..130592) product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094908.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 gene rfaD CDS 130808..132004 product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094909.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 gene kbl CDS 132014..133039 product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369171.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 gene tdh CDS 133254..134525 product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453199.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS 134595..135443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS 135463..136386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS 136487..137443 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704101.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 CDS complement(137450..138394) product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094917.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS complement(138398..139579) product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094918.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 gene envC CDS complement(139673..141220) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116577.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 gene gpmM CDS 141468..141899 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156179.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS 141943..142194 product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010426371.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 gene grxC CDS 142229..142696 product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003370.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 gene secB CDS 142696..143715 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076194.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 gene gpsA CDS 143784..144605 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004106845.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 gene cysE CDS complement(144602..145075) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094923.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 gene trmL CDS complement(145248..146432) product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094925.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 gene lldD CDS complement(146429..147184) product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369184.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 gene lldR CDS 147282..147449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS complement(147432..147794) product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665677.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS complement(147853..148377) product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094931.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 gene mtlR CDS complement(148440..149588) product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094932.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 gene mtlD CDS complement(149753..151660) product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094933.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS complement(152162..153841) product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705650.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS complement(153894..155348) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162184131.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS 155791..156399 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766681.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS 156492..157880 product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206261.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 gene selA CDS 157877..159724 product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582424.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 gene selB CDS complement(159721..160608) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188270.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS 160773..162311 product aldehyde dehydrogenase AldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183998.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 gene aldB sequence10 source 1..146888 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(169..2283) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099032.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 gene fusA CDS complement(2380..2850) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861706.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 gene rpsG CDS complement(2946..3320) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246815.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 gene rpsL CDS complement(3445..3732) product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369415.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 gene tusB CDS complement(3740..4099) product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369414.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 gene tusC CDS complement(4099..4485) product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209689.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 gene tusD CDS complement(4485..5207) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861697.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS complement(5379..6200) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099036.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 gene fkpA CDS 6431..6649 product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861693.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS complement(6704..7288) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099037.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 gene slyD CDS complement(7383..7583) product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004106389.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS complement(7593..9398) product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099039.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 gene kefB CDS complement(9398..9949) product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297514.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 gene kefG CDS 10102..12003 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099041.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS complement(12052..13542) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206821.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS complement(13556..14416) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072072.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 gene prs CDS 14614..15333 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072071.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS 15414..16430 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703647.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS 16431..16649 product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907085.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS 16694..17563 product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274680.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS complement(17672..18076) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703648.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS 18375..19007 product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242758.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 gene crp CDS 19060..21138 product YccS/YhfK family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099057.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS complement(21135..22355) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833535.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS complement(22442..23005) product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099059.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 gene pabA CDS complement(23105..23707) product putative adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280679.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 CDS complement(23697..23867) product YhfG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519136.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS complement(23976..24452) product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920482.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 gene ppiA CDS 24828..26012 product MFS transporter TsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185249.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 gene tsgA CDS complement(26031..27329) product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703651.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS complement(27468..27713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS 27606..30113 product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099064.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 gene nirB CDS 30110..30436 product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099065.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 gene nirD CDS 30585..31391 product nitrite transporter NirC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493575.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 gene nirC CDS 31410..32783 product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349908.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 gene cysG CDS complement(32833..33837) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099067.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 gene trpS CDS complement(33830..34591) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099068.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 gene gph CDS complement(34584..35261) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816280.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 gene rpe CDS complement(35301..36113) product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742132.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 gene dam CDS complement(36181..37476) product cell division protein DamX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099070.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 gene damX CDS complement(37579..38550) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439848.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 gene aroB CDS complement(38717..39238) product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861630.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 gene aroK CDS complement(39574..40791) product DNA uptake porin HofQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832818.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 gene hofQ CDS complement(40730..41137) product HofP DNA utilization family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868832.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS complement(41127..41591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS complement(41575..42114) product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951390.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS complement(42114..42905) product DNA utilization protein HofM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296474.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 gene hofM CDS 43167..45578 product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099079.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 gene mrcA CDS complement(45721..46281) product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099080.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 gene nudE CDS 46739..48739 product intracellular growth attenuator protein IgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104086.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 gene igaA CDS 48797..49480 product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099082.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 gene yrfG CDS 49477..49878 product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099083.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 gene hslR CDS 49903..50781 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001775502.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 gene hslO CDS complement(50823..52553) product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446446.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS complement(52658..52825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS 52929..54548 product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265689.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 gene pckA CDS complement(54759..56102) product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253694.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 gene envZ CDS complement(56108..56827) product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157751.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 gene ompR CDS 56986..57459 product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703675.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 gene greB CDS 57560..59890 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703676.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS 60310..60537 product ferrous iron transporter A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160955.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 gene feoA CDS 60568..62889 product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099092.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 gene feoB CDS 62900..63136 product [Fe-S]-dependent transcriptional repressor FeoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099093.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 gene feoC CDS complement(63133..63906) product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703680.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 gene bioH CDS 63790..64149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS 64142..64627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS 64686..65261 product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619389.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 gene nfuA CDS 65580..66896 product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369355.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 gene gntT CDS complement(67056..69140) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444342.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 gene malQ CDS complement(69149..71542) product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099099.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 gene malP CDS 72179..74884 product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420753.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 gene malT CDS complement(74881..75639) product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099103.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS complement(75656..76486) product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928705.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 gene glpG CDS complement(76540..76869) product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369349.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 gene glpE CDS 77235..78740 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448178.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 gene glpD CDS complement(78707..78913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS complement(79000..81447) product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993423.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 gene glgP CDS complement(81467..82900) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197646.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 gene glgA CDS complement(82992..84275) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099110.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 gene glgC CDS complement(84290..86266) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099111.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 gene glgX CDS complement(86263..88449) product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283723.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 gene glgB CDS complement(88728..89834) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703691.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 gene asd CDS 90009..90602 product NAAT family transporter YhgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002551.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 gene yhgN CDS 90644..91351 product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905450.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS complement(91505..92749) product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833577.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 gene gntU CDS complement(92860..93381) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420757.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 gene gntK CDS complement(93508..94503) product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730239.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 gene gntR CDS complement(94607..95302) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639789.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS complement(95425..96462) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099119.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS 96419..96607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS 96775..97263 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099120.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 gene yhhY CDS complement(97400..99151) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 gene ggt CDS 99267..99722 product DUF2756 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826133.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS complement(99719..100459) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703700.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 gene ugpQ CDS complement(100456..101529) product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099124.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS complement(101531..102376) product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703702.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 gene ugpE CDS complement(102373..103272) product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099126.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 gene ugpA CDS complement(103500..104816) product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028113.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 gene ugpB CDS 105010..106173 product DUF1996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705141.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS complement(106260..106973) product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099128.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 gene livF CDS complement(106975..107742) product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369325.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 gene livG CDS complement(107739..109016) product branched chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369324.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 gene livM CDS complement(109013..109939) product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099131.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 gene livH CDS complement(109994..111082) product high-affinity branched-chain amino acid ABC transporter substrate-binding protein LivK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301528.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 gene livK CDS 111584..111967 product aspartate 1-decarboxylase autocleavage activator PanM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099135.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 gene panM CDS complement(112073..113170) product branched chain amino acid ABC transporter substrate-binding protein LivJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021986.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 gene livJ CDS complement(113442..114707) product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099137.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS complement(114928..115782) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159621.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 gene rpoH CDS complement(116049..117104) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099139.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 gene ftsX CDS complement(117097..117765) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099140.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 gene ftsE CDS complement(117768..119216) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040649.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 gene ftsY CDS 119421..120017 product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883606.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 gene rsmD CDS 120007..120282 product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099143.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS 120409..121035 product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964735.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS 121108..123315 product Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106499.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 gene zntA CDS complement(123424..123666) product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833603.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 gene tusA CDS 123834..124499 product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100467.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS 124572..125129 product DcrB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099152.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS complement(125141..126340) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240225.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS 126486..127535 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361522.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS 127805..128194 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301470.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS 128264..129322 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273200.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS 129375..130097 product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301843.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS 130094..130891 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302735.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 CDS 130891..131148 product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369304.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS 131163..131414 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139646.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 CDS 131421..132002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014366.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS 131999..133357 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815059.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS 133344..133697 product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703718.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS 133688..135382 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115628.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS 135385..135807 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369298.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS 135804..136409 product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670562.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS 136378..138696 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149367168.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS 138693..139280 product DUF3261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595147.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS 139282..140451 product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703723.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS 140448..140924 product 3-hydroxy-fatty acyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020249.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 CDS 140921..141652 product 3-ketoacyl-ACP reductase FabG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091664.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS 141649..142878 product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198470.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS 142881..143459 product 4'-phosphopantetheinyl transferase AcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285785.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 gene acpT CDS 143532..144326 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099180.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS complement(144419..146251) product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602701.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 gene tssF sequence11 source 1..138623 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(99..617) product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989262.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 gene mobB CDS complement(599..1183) product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052181.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 gene mobA CDS 1254..1523 product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099387.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS 1600..2586 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099386.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS 2614..3237 product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099385.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 gene dsbA CDS complement(3251..3622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS 4574..7360 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249956.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 gene polA CDS complement(7656..8282) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703927.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 gene yihA CDS complement(8530..8730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS 8868..9386 product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099380.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 gene yihI CDS 9573..10946 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116087.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 gene hemN CDS complement(11342..12751) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602497.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 gene glnG CDS complement(12760..13809) product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501857.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 gene glnL CDS complement(14074..15483) product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099376.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 gene glnA CDS 15864..17687 product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099375.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 gene typA CDS 17820..18092 product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041497.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS 18082..18390 product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971265.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS complement(18373..19755) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420847.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS complement(19798..21183) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099372.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS complement(21229..23265) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087028.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS complement(23288..24529) product sulfoquinovose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099370.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 gene yihS CDS complement(24543..25418) product sulfofructosephosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046464.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 gene yihT CDS complement(25440..26336) product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099368.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 gene yihU CDS 26504..27400 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520529.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 CDS 27436..28224 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099366.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 CDS complement(28221..28973) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113827.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS 29070..29999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868990.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 CDS 30136..30735 product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099365.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 gene yihX CDS 30729..31601 product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920762.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 CDS 31598..32035 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368967.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 gene dtd CDS 32080..33021 product fatty acid biosynthesis protein FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099362.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 gene fabY CDS complement(33037..33489) product type II toxin-antitoxin system HigA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259009.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS 34193..34411 product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001523745.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS 34405..34542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS complement(34577..35506) product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027727.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 gene fdhE CDS complement(35503..36138) product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099357.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 gene fdoI CDS complement(36135..37037) product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368961.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 gene fdxH CDS complement(37044..40094) product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989259.1 transl_table 11 codon_start 1 transl_except (pos:39507..39509,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_35880 gene fdnG CDS 40279..41085 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753617.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 gene fdhD CDS 41210..41422 product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099352.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS 41822..42802 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429132.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 gene pfkA CDS 42814..43128 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292534.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS 43121..44488 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296769.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS 44475..45317 product class II fructose-bisphosphate aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294699.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS 45376..45645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS 45655..46092 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050067.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS 46089..46652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS complement(46684..48402) product putative frv operon regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931299.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS complement(48411..49472) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019480.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 CDS complement(49462..50907) product PTS fructose-like transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446023.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 CDS complement(50918..51364) product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729611.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS 51908..53305 product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749944.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS 53511..54506 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099344.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS 54619..56742 product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420832.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS 56785..58047 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099342.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS complement(58271..58477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS 58805..59119 product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161265.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS 59112..60227 product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722978.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS 60314..62899 product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648976.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 gene mngB CDS 62915..64072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS 64021..64440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS 64463..66448 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969597.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS 66585..67580 product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938996.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS complement(67625..67939) product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619478.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 gene rhaM CDS complement(67936..69084) product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009255.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 gene fucO CDS complement(69307..70311) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968717.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS complement(70308..71312) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973085.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS complement(71312..72823) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391991.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS complement(73114..74100) product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327310.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 gene rhaS CDS complement(74183..75013) product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099339.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 gene rhaD CDS complement(75153..76412) product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311268.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 gene rhaA CDS complement(76409..77863) product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099337.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 gene rhaB CDS 78152..79000 product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217112.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 gene rhaS CDS 79085..79963 product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368942.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 gene rhaR CDS 80130..80750 product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861999.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 gene sodA CDS 81226..81897 product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378721.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS 82037..82711 product 6-hydroxyaminopurine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099332.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 gene yiiM CDS complement(82861..84225) product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580417.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 gene cpxA CDS complement(84234..84932) product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862004.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 gene cpxR CDS 85081..85584 product cell-envelope stress modulator CpxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233466.1 transl_table 11 codon_start 1 locus_tag LOCUS_36300 gene cpxP CDS 85752..86657 product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099328.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 gene fieF CDS 86838..87800 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099327.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 gene pfkA CDS 87946..88935 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099326.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS 89029..89784 product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369135.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS 89858..91162 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703817.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS complement(91258..92025) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862019.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 gene tpiA CDS complement(92133..92732) product DUF1454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369137.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS 92846..93268 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155261.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS complement(93269..94015) product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796310.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 gene fpr CDS complement(94112..95122) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703815.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 gene glpX CDS complement(95383..96891) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099318.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 gene glpK CDS complement(96913..97761) product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099317.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS 98161..98400 product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099316.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 gene zapB assembly_gap 98426..98448 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(98462..98947) product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872918.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 gene rraA CDS complement(99040..99969) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139635.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 gene menA CDS complement(100037..101371) product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368931.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 gene hslU CDS complement(101381..101911) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368930.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 gene hslV CDS complement(102002..102856) product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099312.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 gene ftsN CDS complement(103055..104080) product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099311.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 gene cytR CDS complement(104228..106423) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109394.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 gene priA CDS 106636..106848 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368925.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 gene rpmE CDS complement(106961..107278) product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862042.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 gene metJ CDS 107555..108715 product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099309.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 gene metB CDS 108718..111150 product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110774.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 gene metL CDS 111448..112338 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007523.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 gene metF CDS complement(112372..113475) product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374033.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS complement(113487..114149) product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703953.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 gene fsa CDS complement(114153..116666) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174088.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 gene ptsP CDS 116970..118046 product PTS fructose transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004442.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS 118061..118381 product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161265.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS 118430..120727 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184828.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS 120693..121547 product [formate-C-acetyltransferase]-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204139.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS 121549..121905 product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323846.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS complement(121892..122743) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274636.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS complement(122825..125476) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099302.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 gene ppc CDS 125674..125802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS complement(125819..126970) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099301.1 transl_table 11 codon_start 1 locus_tag LOCUS_36670 gene argE CDS 127059..128063 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099300.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 gene argC CDS 128076..128852 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020686923.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 gene argB CDS 128924..130297 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368911.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 gene argH CDS 130713..131630 product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025919.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 gene oxyR CDS complement(131613..133013) product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833741.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 gene sthA CDS 133212..133847 product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501784.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 gene fabR CDS 133858..134217 product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501783.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS complement(134332..135435) product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187008.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 gene trmA CDS 135796..137664 product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815316.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 gene btuB CDS 137609..138460 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201825.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 gene murI sequence12 source 1..124362 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 138..704 product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098435.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 gene yqaB CDS 1211..2755 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098433.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 gene gshA CDS 2907..3422 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098432.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 gene luxS CDS 3501..4271 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098431.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS complement(4268..5917) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703237.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 gene leuA CDS complement(6293..7831) product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295176.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 gene emrB CDS complement(7848..9020) product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098428.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 gene emrA CDS complement(9151..9681) product transcriptional repressor MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098427.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 gene mprA CDS complement(9772..10107) product L-valine transporter subunit YgaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119763.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 gene ygaH CDS complement(10097..10831) product L-valine exporter subunit YgaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445658.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 gene ygaZ CDS complement(10956..12140) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098426.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 CDS complement(12418..13413) product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098425.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 gene proX CDS complement(13481..14545) product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370072.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 gene proW CDS complement(14538..15740) product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098423.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 gene proV CDS complement(16178..17140) product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098422.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 gene nrdF CDS complement(17151..19268) product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098421.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 gene nrdE CDS complement(19268..19678) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098420.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 gene nrdI CDS complement(19675..19860) product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028873.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 gene nrdH CDS complement(20101..20532) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209797.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS 20621..21967 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138430.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS complement(22004..22330) product DUF883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519557.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS 22492..22836 product DUF2002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281304.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS complement(22853..23302) product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098416.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 gene alaE CDS complement(23604..23783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098412.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 CDS 24016..24174 product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705362.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS complement(24217..25875) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096858.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS complement(26009..27433) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223883297.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS 27611..29413 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095767.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS 29522..31123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS 31445..33067 product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704284.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS 33067..33615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS 33608..41971 product hemagglutinin repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224144836.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS 41980..42342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS 42495..42665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS complement(43169..44032) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267248.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 CDS 44107..45039 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104668.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS complement(45058..46239) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095215.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 gene nhaA CDS 46901..48427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS 48746..51319 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096775.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 CDS 51655..53193 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816617.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS 53577..53954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS 54349..54573 product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975469.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 CDS complement(54620..55216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS complement(55209..56384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS complement(56385..57410) product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210713.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS complement(57952..58272) product type IV toxin-antitoxin system toxin YpjF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094400.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 gene ypjF CDS complement(58304..58627) product type IV toxin-antitoxin system YeeU family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878136.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS complement(58648..58869) product DUF987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691994.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS complement(58878..59351) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703840.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 gene radC CDS complement(59384..60202) product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101824524.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS 60633..61397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37280 CDS 63392..64204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS complement(64534..64896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37300 CDS complement(64932..65372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS complement(65384..66070) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189409.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS complement(66090..66827) product DUF3944 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323695.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 CDS complement(66968..67546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS complement(68168..69226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098167.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS complement(69655..69870) product DNA-binding transcriptional activator AlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065343.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 gene alpA CDS 70062..70862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS complement(70990..74193) product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053708.1 transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS 74561..75877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS 75870..76565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS 76549..78900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37410 CDS complement(79143..80384) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101723.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 tmRNA complement(80588..80950) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 82015..82242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS 82269..93860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS 93939..95279 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090493.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS 95303..97435 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096691.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS 97446..98615 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208471.1 transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS complement(98823..99350) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518569.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 gene smpB CDS 99461..99898 product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502504.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS 99888..100184 product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117838.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS complement(100255..100596) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703201.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 gene bamE CDS complement(100872..102533) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880915.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 gene recN CDS complement(102619..103497) product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059176.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 gene nadK CDS 103459..103626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37540 CDS 103619..104212 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098354.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 gene grpE CDS complement(104294..105580) product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028086.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS complement(105598..106389) product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001537507.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS 106555..107916 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098351.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 gene ffh CDS 108031..108279 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256453.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 gene rpsP CDS 108298..108846 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043266.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 gene rimM CDS 108891..109631 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264777.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 gene trmD CDS 109699..110046 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914145.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 gene rplS CDS 110165..110590 product DUF2946 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098349.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS 110647..112005 product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098348.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS complement(112002..112943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS complement(113089..113463) product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098344.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS 113681..114751 product 3-deoxy-7-phosphoheptulonate synthase AroF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098343.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 gene aroF CDS 114761..115882 product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098342.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 gene tyrA CDS 115952..116824 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098341.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 CDS complement(116821..117981) product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098340.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 gene pheA CDS complement(118257..118595) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178449.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 gene raiA CDS complement(118865..119602) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197686.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 gene bamD CDS 119736..120716 product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370269.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 gene rluD CDS 120713..121444 product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992642.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 gene yfiH CDS 121578..124151 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235094.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 gene clpB sequence13 source 1..97730 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 29..104 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS complement(215..1036) product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379246.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 gene hdfR CDS 1155..1493 product macrodomain Ori organization protein MaoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841001.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 gene maoP CDS complement(1520..3040) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099289.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS 3618..5264 product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099288.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 gene ilvG CDS 5261..5524 product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860184.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 gene ilvM CDS 5542..6471 product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208528.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 gene ilvE CDS 6625..8475 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127391.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 gene ilvD CDS 8475..10022 product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833732.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 gene ilvA CDS complement(10076..11794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS complement(11775..12926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS complement(12964..13356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37860 CDS complement(13353..14633) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021211.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS complement(14890..15789) product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099284.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 gene ilvY CDS 15945..17420 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703965.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 gene ilvC CDS complement(17561..17821) product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096806.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 gene ppiC CDS 17928..19949 product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099281.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 gene rep CDS complement(20051..21535) product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099280.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 gene gppA CDS complement(21547..22815) product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047509.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 gene rhlB CDS 22960..23289 product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004386384.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 gene trxA CDS 23635..24894 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054528.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 gene rho CDS 25139..26242 product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050960.1 transl_table 11 codon_start 1 locus_tag LOCUS_37960 gene wecA CDS 26256..27302 product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099277.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 gene wzzE CDS 27360..28490 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306792.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 gene wecB CDS 28487..29749 product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099275.1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 gene wecC CDS 29749..30420 product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145189.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 gene rffC CDS 30425..31555 product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099273.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 gene rffA CDS 31557..32807 product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050302.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 gene wzxE CDS 32804..33880 product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099271.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS 33877..35229 product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099270.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 gene wzyE CDS 35244..35984 product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064040.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 gene wecG CDS 36236..37621 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774735.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 tRNA 37734..37810 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA 37877..37952 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA 37978..38063 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA 38101..38177 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS complement(38838..40034) product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921791.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 gene hemY CDS complement(40037..41206) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138976.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 gene hemX CDS complement(41228..41968) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025500.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 gene hemD CDS complement(41965..42906) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099264.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 gene hemC CDS 43249..45795 product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281718.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 gene cyaA CDS complement(45825..46145) product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999940.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 gene cyaY CDS 46282..46485 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799903.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 CDS 46522..47346 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160654.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 gene dapF CDS 47343..48050 product DUF484 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099258.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS 48047..48949 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703983.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 gene xerC CDS 48949..49665 product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099256.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 gene yigB CDS 49753..51915 product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383407.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 gene uvrD CDS 52270..53220 product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501540.1 transl_table 11 codon_start 1 locus_tag LOCUS_38190 gene corA CDS complement(53366..54262) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368860.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 gene rarD CDS complement(54320..54787) product acyl-CoA thioesterase YigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099253.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 gene yigI CDS 54946..55815 product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099252.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 gene pldA CDS 55883..57709 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420793.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 gene recQ CDS 57771..58391 product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703986.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 gene rhtC CDS complement(58427..59347) product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136031866.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS complement(59507..60127) product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099249.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 gene rhtB CDS 60212..61228 product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099248.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 gene pldB CDS 61268..62068 product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099247.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 gene yigL CDS 62140..63039 product biotin transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196238.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 gene bioP CDS complement(62927..63880) product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573621.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 gene metR CDS 64116..66377 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153917.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 gene metE CDS 66856..67833 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173509960.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS 67846..69549 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971998.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS 69537..70565 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180938249.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS 70562..71602 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529322.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS 71812..73215 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711305.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS 73240..74985 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202887107.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS 75051..75776 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940940.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS 75793..77094 product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017936.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS complement(77126..77938) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703993.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 CDS 78198..78959 product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004181652.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 gene udp CDS complement(79051..79488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS 79973..81430 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368848.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 gene rmuC CDS 81497..82264 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099241.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 gene ubiE CDS 82278..82883 product ubiquinone biosynthesis protein UbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099240.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 gene ubiJ CDS 82880..84526 product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099239.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 gene ubiB CDS 84599..84850 product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099238.1 transl_table 11 codon_start 1 locus_tag LOCUS_38470 gene tatA CDS 84854..85375 product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459611.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 gene tatB CDS 85378..86142 product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257554.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 gene tatC CDS 86185..86967 product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099235.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 gene tatD CDS complement(86973..87461) product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099234.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 gene rfaH CDS 87631..89127 product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161496900.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 gene ubiD CDS 89186..89887 product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099232.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 gene fre CDS complement(90104..91267) product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438702.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 gene fadA CDS complement(91277..93466) product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703999.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 gene fadB CDS 93655..94986 product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444529.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 gene pepQ CDS 94986..95600 product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295262.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 CDS 95640..97091 product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545686.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 gene trkH CDS 97103..97654 product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099226.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 gene hemG sequence14 source 1..84529 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(25..117) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 CDS complement(465..650) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906486.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 gene csrA CDS complement(893..3520) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098436.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 gene alaS CDS complement(3651..4151) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703240.1 transl_table 11 codon_start 1 locus_tag LOCUS_38620 gene recX CDS complement(4224..5288) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963150.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 gene recA CDS complement(5377..5874) product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132231.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 gene pncC CDS complement(6025..7110) product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476820.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 gene mltB CDS 7323..8288 product arabinose-5-phosphate isomerase GutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287442.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 gene gutQ CDS complement(8285..9799) product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098451.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 gene norR CDS 9986..11434 product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098452.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 gene norV CDS 11431..12561 product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064713.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 gene norW CDS complement(12631..13680) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420952.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 CDS 13920..15374 product PTS cellobiose/arbutin/salicin transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098459.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 gene ascF CDS 15392..16813 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098460.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 CDS complement(16931..17275) product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015479.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS 17454..18371 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703268.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 CDS 18368..19207 product iron/manganese ABC transporter ATP-binding protein SitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083163.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 gene sitB CDS 19204..20064 product iron/manganese ABC transporter permease subunit SitC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370015.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 gene sitC CDS 20061..20891 product iron/manganese ABC transporter permease subunit SitD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477918.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 gene sitD CDS 21187..22458 product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097093.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 CDS complement(22502..23467) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705307.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 CDS complement(23666..24994) product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158904.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 CDS 25190..25984 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307144.1 transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS 25992..26660 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243465.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS 26673..27404 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243284.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS 27527..28309 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095418.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS 28697..29314 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268606.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 CDS complement(29311..29478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38860 CDS 29743..30729 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045231753.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 CDS 30738..33227 product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974867.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS complement(33331..35004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS complement(35266..36696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38900 CDS complement(37250..38362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS complement(38475..38675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38920 CDS 39038..39442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS complement(39486..40382) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073632.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 CDS complement(40462..40797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38950 CDS 40723..40908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38960 CDS complement(40916..41455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS complement(41497..41919) product DUF2787 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041081.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 CDS complement(41916..42164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38990 CDS complement(42496..42984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39000 CDS 43387..43914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39010 CDS 43929..44288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39020 CDS 44319..44654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39030 CDS 44976..45719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39040 CDS 45754..47052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39050 CDS complement(47510..48178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39060 CDS complement(48280..48609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39070 CDS 49193..50458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS complement(51095..52375) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045419493.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 CDS 52593..55154 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703281.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 gene mutS CDS 55252..55680 product peroxiredoxin OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152305.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 gene osmC CDS complement(55859..56851) product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081498.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 gene rpoS CDS complement(56972..57877) product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272624.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 gene nlpD CDS 57948..58130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39140 CDS complement(58226..58852) product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098496.1 transl_table 11 codon_start 1 locus_tag LOCUS_39150 CDS complement(58846..59607) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221538.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 gene surE CDS complement(59588..60637) product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134253.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 gene truD CDS complement(60634..61113) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703296.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 gene ispF CDS complement(61113..61763) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098500.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 gene ispD CDS complement(61844..62155) product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369983.1 transl_table 11 codon_start 1 locus_tag LOCUS_39200 gene ftsB CDS complement(62313..62636) product DUF3561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098502.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 CDS complement(62686..63291) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098503.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 gene cysC CDS complement(63291..64718) product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098504.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 gene cysN CDS complement(64728..65636) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369979.1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 gene cysD CDS complement(65646..67061) product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162184003.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 gene cysG CDS 67300..68346 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098506.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 repeat_region 68403..70203 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggtttatccccgctctcgcggggaacac CDS complement(70300..70593) product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063176.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 gene cas2e CDS complement(70593..71513) product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144875.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 gene cas1e CDS complement(71510..72154) product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281463.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 gene cas6e CDS complement(72136..72888) product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085058.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 gene cas5e CDS complement(72898..73953) product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206435.1 transl_table 11 codon_start 1 locus_tag LOCUS_39310 gene cas7e CDS complement(73964..74533) product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029331.1 transl_table 11 codon_start 1 locus_tag LOCUS_39320 gene casB CDS complement(74534..76099) product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084082.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 gene casA CDS complement(76011..76220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39340 CDS complement(76615..78846) product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233978.1 transl_table 11 codon_start 1 locus_tag LOCUS_39350 CDS complement(79439..80203) product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098507.1 transl_table 11 codon_start 1 locus_tag LOCUS_39360 gene cysH CDS complement(80324..82036) product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420501.1 transl_table 11 codon_start 1 locus_tag LOCUS_39370 gene cysI CDS complement(82036..83841) product NADPH-dependent assimilatory sulfite reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098509.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 gene cysJ CDS 84147..84509 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010434567.1 transl_table 11 codon_start 1 locus_tag LOCUS_39390 gene queD sequence15 source 1..74630 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(69..1064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS complement(1073..1552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39410 CDS complement(1556..5599) product cellulose biosynthesis protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994102.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS complement(5616..7913) product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263700.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 gene bcsB CDS complement(7910..10021) product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770918.1 transl_table 11 codon_start 1 locus_tag LOCUS_39440 gene bcsA CDS complement(10038..10841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39450 CDS complement(10832..11380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39460 CDS complement(11857..12891) product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694624.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 CDS complement(12891..13202) product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005672747.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS complement(13187..13510) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661200.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS complement(13674..14693) product dipeptide ABC transporter ATP-binding subunit DppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103568.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 gene dppF CDS complement(14680..15672) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094994.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 gene dppD CDS complement(15685..16587) product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084677.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 gene dppC CDS complement(16597..17616) product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830232.1 transl_table 11 codon_start 1 locus_tag LOCUS_39530 gene dppB CDS complement(17788..19368) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418419.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 tRNA complement(20177..20253) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 CDS complement(20360..20893) product long polar fimbrial protein LpfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314219.1 transl_table 11 codon_start 1 locus_tag LOCUS_39550 gene lpfE CDS complement(20899..21957) product long polar fimbrial protein LpfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694926.1 transl_table 11 codon_start 1 locus_tag LOCUS_39560 gene lpfD CDS complement(21975..24503) product outer membrane usher protein LpfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558680.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 gene lpfC CDS complement(24526..25221) product long polar fimbrial biogenesis chaperone LpfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836900.1 transl_table 11 codon_start 1 locus_tag LOCUS_39580 gene lpfB CDS complement(25305..25727) product long polar fimbria major subunit LpfA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758167.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 gene lpfA1 CDS complement(26139..27809) product kdo(2)-lipid A phosphoethanolamine 7''-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069557.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 gene eptB CDS complement(28047..28478) product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095463.1 transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS complement(28550..29764) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094986.1 transl_table 11 codon_start 1 locus_tag LOCUS_39620 CDS complement(29998..30690) product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637074.1 transl_table 11 codon_start 1 locus_tag LOCUS_39630 CDS 30843..31424 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094984.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 gene tag CDS 31402..31842 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094983.1 transl_table 11 codon_start 1 locus_tag LOCUS_39650 CDS complement(31811..33898) product biotin sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185340.1 transl_table 11 codon_start 1 locus_tag LOCUS_39660 gene bisC CDS 34299..34961 product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747548.1 transl_table 11 codon_start 1 locus_tag LOCUS_39670 CDS 35201..36220 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094979.1 transl_table 11 codon_start 1 locus_tag LOCUS_39680 CDS 36322..37071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703772.1 transl_table 11 codon_start 1 locus_tag LOCUS_39690 CDS 37076..38017 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094977.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 CDS 38166..39446 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094976.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 CDS 39482..40456 product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369217.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 gene ghrB CDS 40530..41255 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703823.1 transl_table 11 codon_start 1 locus_tag LOCUS_39730 CDS complement(41186..42595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39740 CDS complement(42595..44217) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861822.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 CDS complement(44550..45260) product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094974.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 CDS 45636..45929 product HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455790.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 CDS complement(46016..48085) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703776.1 transl_table 11 codon_start 1 locus_tag LOCUS_39780 gene glyS CDS complement(48095..49006) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168544.1 transl_table 11 codon_start 1 locus_tag LOCUS_39790 gene glyQ CDS complement(49132..49434) product YsaB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094969.1 transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS 49576..50613 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094968.1 transl_table 11 codon_start 1 locus_tag LOCUS_39810 CDS complement(50606..51526) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094967.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 CDS complement(51523..52065) product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094966.1 transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS 52144..52308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39840 CDS complement(52327..53781) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275378.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 gene xylB CDS complement(53836..55158) product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830210.1 transl_table 11 codon_start 1 locus_tag LOCUS_39860 gene xylA CDS 55613..56518 product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094963.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 gene xylF CDS 56735..58276 product xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094962.1 transl_table 11 codon_start 1 locus_tag LOCUS_39880 CDS 58254..59435 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094961.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 gene gguB CDS 59550..60728 product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094960.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 CDS complement(60761..61333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39910 CDS 61901..63931 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418400.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 CDS 64177..65433 product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094957.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 gene avtA CDS 65963..66235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39940 CDS 66190..67101 product collagen-like triple helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815467.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 CDS 67192..68907 product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175308.1 transl_table 11 codon_start 1 locus_tag LOCUS_39960 CDS complement(68927..69742) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891824.1 transl_table 11 codon_start 1 locus_tag LOCUS_39970 CDS 69998..71395 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204802.1 transl_table 11 codon_start 1 locus_tag LOCUS_39980 CDS 71406..73361 product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026861.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS 73465..73776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40000 CDS complement(73760..74176) product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094943.1 transl_table 11 codon_start 1 locus_tag LOCUS_40010 CDS complement(74192..74434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40020 sequence16 source 1..56532 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(304..1983) product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099223.1 transl_table 11 codon_start 1 locus_tag LOCUS_40030 gene bcsG CDS complement(1976..2173) product cellulose biosynthesis protein BcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988321.1 transl_table 11 codon_start 1 locus_tag LOCUS_40040 gene bcsF CDS complement(2170..3729) product cellulose biosynthesis c-di-GMP-binding protein BcsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099221.1 transl_table 11 codon_start 1 locus_tag LOCUS_40050 gene bcsE CDS 3901..4089 product cellulose biosynthesis protein BcsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099220.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 gene bcsR CDS 4101..4850 product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996130.1 transl_table 11 codon_start 1 locus_tag LOCUS_40070 gene bcsQ CDS 4847..7465 product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099218.1 transl_table 11 codon_start 1 locus_tag LOCUS_40080 gene bcsA CDS 7476..9902 product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099217.1 transl_table 11 codon_start 1 locus_tag LOCUS_40090 gene bcsB CDS 9909..11006 product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988805.1 transl_table 11 codon_start 1 locus_tag LOCUS_40100 gene bcsZ CDS 10994..14521 product cellulose synthase complex outer membrane protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225112.1 transl_table 11 codon_start 1 locus_tag LOCUS_40110 gene bcsC CDS 14647..16653 product biofilm formation regulator HmsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099214.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 gene hmsP CDS 16810..18096 product C4-dicarboxylate transporter DctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858232.1 transl_table 11 codon_start 1 locus_tag LOCUS_40130 gene dctA CDS 18284..19777 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099212.1 transl_table 11 codon_start 1 locus_tag LOCUS_40140 CDS complement(19949..20878) product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306595.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 gene kdgK CDS 21114..21884 product cyclic-guanylate-specific phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099209.1 transl_table 11 codon_start 1 locus_tag LOCUS_40160 gene pdeH CDS 21978..24038 product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296794.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 CDS complement(24002..24136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40180 CDS complement(24248..25570) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149006.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 CDS complement(25832..26866) product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099206.1 transl_table 11 codon_start 1 locus_tag LOCUS_40200 gene yhjD CDS complement(26919..27821) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099205.1 transl_table 11 codon_start 1 locus_tag LOCUS_40210 CDS 27941..28699 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099204.1 transl_table 11 codon_start 1 locus_tag LOCUS_40220 CDS complement(28758..29444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40230 CDS complement(29441..31429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS complement(31565..31966) product YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671737.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 gene ydeI CDS complement(32042..32599) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703751.1 transl_table 11 codon_start 1 locus_tag LOCUS_40260 CDS 32707..34302 product STY4199 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099200.1 transl_table 11 codon_start 1 locus_tag LOCUS_40270 CDS complement(34338..35987) product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099199.1 transl_table 11 codon_start 1 locus_tag LOCUS_40280 CDS 36373..37452 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047054668.1 transl_table 11 codon_start 1 locus_tag LOCUS_40290 CDS complement(37486..37911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40300 CDS complement(38032..39360) product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948070.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 CDS complement(39372..40910) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948069.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 CDS 41174..41872 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094792.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 CDS complement(41921..43273) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099198.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 gene gorA CDS complement(43347..44189) product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703746.1 transl_table 11 codon_start 1 locus_tag LOCUS_40350 CDS 44151..44336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40360 CDS 44363..46405 product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099196.1 transl_table 11 codon_start 1 locus_tag LOCUS_40370 gene prlC CDS 46413..47165 product 16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686620.1 transl_table 11 codon_start 1 locus_tag LOCUS_40380 gene rsmJ CDS complement(47318..47755) product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004145166.1 transl_table 11 codon_start 1 locus_tag LOCUS_40390 gene uspA CDS 48149..48484 product universal stress protein UspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861224.1 transl_table 11 codon_start 1 locus_tag LOCUS_40400 gene uspB CDS complement(48548..50044) product inorganic phosphate transporter PitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099193.1 transl_table 11 codon_start 1 locus_tag LOCUS_40410 gene pitA CDS 50275..51471 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420964.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 CDS complement(51491..51796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40430 CDS complement(51798..52610) product DUF4225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211601.1 transl_table 11 codon_start 1 locus_tag LOCUS_40440 CDS complement(53477..54586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40450 CDS complement(54607..55029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40460 CDS complement(55010..56056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40470 sequence17 source 1..46336 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 336..1253 product nitrogen assimilation transcriptional regulator NAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010432103.1 transl_table 11 codon_start 1 locus_tag LOCUS_40480 gene nac CDS 1354..2304 product HTH-type transcriptional regulator Cbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705998.1 transl_table 11 codon_start 1 locus_tag LOCUS_40490 gene cbl CDS complement(2342..4783) product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993423.1 transl_table 11 codon_start 1 locus_tag LOCUS_40500 gene glgP CDS complement(4936..6219) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253975.1 transl_table 11 codon_start 1 locus_tag LOCUS_40510 gene glgC tRNA complement(6767..6842) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 CDS complement(6943..7740) product DgsA anti-repressor MtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029881844.1 transl_table 11 codon_start 1 locus_tag LOCUS_40520 gene mtfA tRNA 7834..7923 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 CDS complement(8017..9006) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533600.1 transl_table 11 codon_start 1 locus_tag LOCUS_40530 CDS complement(9010..9237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40540 CDS complement(9300..10127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40550 CDS complement(10124..10798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011011060.1 transl_table 11 codon_start 1 locus_tag LOCUS_40560 CDS complement(10791..11087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40570 CDS complement(11132..11662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40580 CDS complement(11659..12189) product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001603282.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 gene yfdR CDS complement(12325..13149) product DUF2303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081287.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 CDS complement(13188..13550) product protein YfdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135680.1 transl_table 11 codon_start 1 locus_tag LOCUS_40610 gene yfdP CDS complement(14636..14932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40620 CDS complement(15264..15962) product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768035.1 transl_table 11 codon_start 1 locus_tag LOCUS_40630 CDS 16031..16261 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067727.1 transl_table 11 codon_start 1 locus_tag LOCUS_40640 CDS 16281..16742 product protein YmfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515837.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 gene ymfL note possible pseudo, frameshifted CDS 16982..17149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40660 CDS 17146..18006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40670 CDS 18003..19253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40680 CDS 19250..19570 product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210170.1 transl_table 11 codon_start 1 locus_tag LOCUS_40690 CDS 19567..19959 product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767129.1 transl_table 11 codon_start 1 locus_tag LOCUS_40700 CDS 19972..20664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40710 CDS 20709..21650 product DUF968 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001360050.1 transl_table 11 codon_start 1 locus_tag LOCUS_40720 CDS 21671..22501 product antitermination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705710.1 transl_table 11 codon_start 1 locus_tag LOCUS_40730 CDS 22909..23337 product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466957.1 transl_table 11 codon_start 1 locus_tag LOCUS_40740 CDS 23337..23489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40750 tRNA 23767..23843 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 CDS 23965..24153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40760 CDS 24363..24743 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294876.1 transl_table 11 codon_start 1 locus_tag LOCUS_40770 CDS 24730..25014 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705707.1 transl_table 11 codon_start 1 locus_tag LOCUS_40780 CDS 25011..25637 product glycoside hydrolase family 19 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403797.1 transl_table 11 codon_start 1 locus_tag LOCUS_40790 CDS 25634..25984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40800 CDS 25959..26099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40810 CDS 26245..26595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40820 CDS complement(26735..26935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40830 CDS 27904..28242 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072872.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 CDS 28366..28830 product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938796.1 transl_table 11 codon_start 1 locus_tag LOCUS_40850 CDS 28784..30529 product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443313.1 transl_table 11 codon_start 1 locus_tag LOCUS_40860 CDS 30529..31860 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072869.1 transl_table 11 codon_start 1 locus_tag LOCUS_40870 CDS 31866..32714 product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337208.1 transl_table 11 codon_start 1 locus_tag LOCUS_40880 CDS 32724..33941 product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072867.1 transl_table 11 codon_start 1 locus_tag LOCUS_40890 CDS 33988..34272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40900 CDS 34282..34611 product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927711.1 transl_table 11 codon_start 1 locus_tag LOCUS_40910 CDS 34613..35002 product phage head closure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702391.1 transl_table 11 codon_start 1 locus_tag LOCUS_40920 CDS 34995..35501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224835.1 transl_table 11 codon_start 1 locus_tag LOCUS_40930 CDS 35498..36058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779294.1 transl_table 11 codon_start 1 locus_tag LOCUS_40940 CDS 36062..36250 product DUF2635 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497751.1 transl_table 11 codon_start 1 locus_tag LOCUS_40950 CDS 36250..37743 product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155695.1 transl_table 11 codon_start 1 locus_tag LOCUS_40960 CDS 37743..38099 product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090992.1 transl_table 11 codon_start 1 locus_tag LOCUS_40970 CDS 38096..38359 product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571713.1 transl_table 11 codon_start 1 locus_tag LOCUS_40980 CDS 38504..40402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40990 CDS 40421..40915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41000 CDS 40961..42358 product DNA circularization N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208631158.1 transl_table 11 codon_start 1 locus_tag LOCUS_41010 CDS 42355..43428 product baseplate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999486.1 transl_table 11 codon_start 1 locus_tag LOCUS_41020 CDS 43428..43982 product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259080.1 transl_table 11 codon_start 1 locus_tag LOCUS_41030 CDS 43982..44395 product phage GP46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424732.1 transl_table 11 codon_start 1 locus_tag LOCUS_41040 CDS 44388..45455 product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785298.1 transl_table 11 codon_start 1 locus_tag LOCUS_41050 CDS 45446..46027 product YmfQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383564.1 transl_table 11 codon_start 1 locus_tag LOCUS_41060 sequence18 source 1..32955 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 252..635 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275691.1 transl_table 11 codon_start 1 locus_tag LOCUS_41070 gene secE CDS 637..1182 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862341.1 transl_table 11 codon_start 1 locus_tag LOCUS_41080 gene nusG CDS 1339..1767 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085926.1 transl_table 11 codon_start 1 locus_tag LOCUS_41090 gene rplK CDS 1771..2475 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096676.1 transl_table 11 codon_start 1 locus_tag LOCUS_41100 gene rplA CDS 2747..3244 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207203.1 transl_table 11 codon_start 1 locus_tag LOCUS_41110 gene rplJ CDS 3311..3676 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028882.1 transl_table 11 codon_start 1 locus_tag LOCUS_41120 gene rplL CDS 3998..8026 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503453.1 transl_table 11 codon_start 1 locus_tag LOCUS_41130 gene rpoB CDS 8103..12326 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095003.1 transl_table 11 codon_start 1 locus_tag LOCUS_41140 gene rpoC CDS complement(12420..12737) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095004.1 transl_table 11 codon_start 1 locus_tag LOCUS_41150 CDS complement(12742..13047) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023334100.1 transl_table 11 codon_start 1 locus_tag LOCUS_41160 CDS complement(13164..14291) product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847474.1 transl_table 11 codon_start 1 locus_tag LOCUS_41170 gene thiH CDS complement(14291..15058) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944065.1 transl_table 11 codon_start 1 locus_tag LOCUS_41180 gene thiG CDS complement(15060..15260) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704010.1 transl_table 11 codon_start 1 locus_tag LOCUS_41190 gene thiS CDS complement(15244..15999) product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095010.1 transl_table 11 codon_start 1 locus_tag LOCUS_41200 CDS complement(15992..16627) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284602.1 transl_table 11 codon_start 1 locus_tag LOCUS_41210 gene thiE CDS complement(16627..18522) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276897.1 transl_table 11 codon_start 1 locus_tag LOCUS_41220 gene thiC CDS complement(18787..19980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41230 CDS complement(19995..22385) product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129197795.1 transl_table 11 codon_start 1 locus_tag LOCUS_41240 CDS complement(22532..23245) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815806.1 transl_table 11 codon_start 1 locus_tag LOCUS_41250 CDS complement(23328..23903) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244646.1 transl_table 11 codon_start 1 locus_tag LOCUS_41260 CDS complement(24559..25062) product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095013.1 transl_table 11 codon_start 1 locus_tag LOCUS_41270 CDS 25161..25934 product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373941.1 transl_table 11 codon_start 1 locus_tag LOCUS_41280 gene nudC CDS 25975..27039 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137652.1 transl_table 11 codon_start 1 locus_tag LOCUS_41290 gene hemE CDS 27049..27720 product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362359.1 transl_table 11 codon_start 1 locus_tag LOCUS_41300 gene nfi CDS 27763..28353 product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704016.1 transl_table 11 codon_start 1 locus_tag LOCUS_41310 CDS 28540..28812 product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002445246.1 transl_table 11 codon_start 1 locus_tag LOCUS_41320 gene hupA CDS 28852..29517 product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023621286.1 transl_table 11 codon_start 1 locus_tag LOCUS_41330 CDS complement(29677..30966) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095019.1 transl_table 11 codon_start 1 locus_tag LOCUS_41340 gene purD CDS complement(30982..32631) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095020.1 transl_table 11 codon_start 1 locus_tag LOCUS_41350 gene purH sequence19 source 1..15206 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(200..1342) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098521.1 transl_table 11 codon_start 1 locus_tag LOCUS_41360 CDS complement(1421..2761) product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098237.1 transl_table 11 codon_start 1 locus_tag LOCUS_41370 gene gudD CDS complement(2782..4125) product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211753.1 transl_table 11 codon_start 1 locus_tag LOCUS_41380 CDS complement(4125..5477) product galactarate/glucarate/glycerate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097011.1 transl_table 11 codon_start 1 locus_tag LOCUS_41390 gene gudP CDS complement(5965..6414) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807756.1 transl_table 11 codon_start 1 locus_tag LOCUS_41400 CDS complement(6432..7214) product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703313.1 transl_table 11 codon_start 1 locus_tag LOCUS_41410 gene truC CDS complement(7214..7543) product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098527.1 transl_table 11 codon_start 1 locus_tag LOCUS_41420 CDS complement(7562..7801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41430 CDS complement(8181..8726) product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343990.1 transl_table 11 codon_start 1 locus_tag LOCUS_41440 gene syd CDS 8795..9640 product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100402.1 transl_table 11 codon_start 1 locus_tag LOCUS_41450 gene queF CDS 9757..11121 product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098530.1 transl_table 11 codon_start 1 locus_tag LOCUS_41460 gene ppnN CDS 11569..12858 product HAAAP family serine/threonine permease SdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859030.1 transl_table 11 codon_start 1 locus_tag LOCUS_41470 gene sdaC CDS 12914..14281 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098532.1 transl_table 11 codon_start 1 locus_tag LOCUS_41480 CDS 14411..15166 product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268232.1 transl_table 11 codon_start 1 locus_tag LOCUS_41490 gene xni sequence20 source 1..14740 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(28..2784) product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186405.1 transl_table 11 codon_start 1 locus_tag LOCUS_41500 gene barA CDS 2842..4155 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098519.1 transl_table 11 codon_start 1 locus_tag LOCUS_41510 gene rlmD CDS 4203..6446 product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226815.1 transl_table 11 codon_start 1 locus_tag LOCUS_41520 CDS 6588..7379 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703306.1 transl_table 11 codon_start 1 locus_tag LOCUS_41530 gene mazG CDS 7607..9244 product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703305.1 transl_table 11 codon_start 1 locus_tag LOCUS_41540 gene pyrG CDS 9323..10618 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098515.1 transl_table 11 codon_start 1 locus_tag LOCUS_41550 gene eno CDS complement(10674..11498) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098513.1 transl_table 11 codon_start 1 locus_tag LOCUS_41560 CDS 11670..13226 product maltose/glucose-specific PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098512.1 transl_table 11 codon_start 1 locus_tag LOCUS_41570 CDS 13223..13930 product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859648.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 CDS 13986..14657 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098510.1 transl_table 11 codon_start 1 locus_tag LOCUS_41590 gene queE sequence21 source 1..14379 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 131..577 product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248917.1 transl_table 11 codon_start 1 locus_tag LOCUS_41600 gene fliJ CDS 577..969 product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859527.1 transl_table 11 codon_start 1 locus_tag LOCUS_41610 CDS complement(1084..2421) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279402.1 transl_table 11 codon_start 1 locus_tag LOCUS_41620 gene fliI CDS complement(2414..3118) product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151516.1 transl_table 11 codon_start 1 locus_tag LOCUS_41630 gene fliH CDS complement(3130..4146) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293168.1 transl_table 11 codon_start 1 locus_tag LOCUS_41640 CDS complement(4124..5797) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993674.1 transl_table 11 codon_start 1 locus_tag LOCUS_41650 gene fliF CDS complement(5802..6089) product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029087.1 transl_table 11 codon_start 1 locus_tag LOCUS_41660 CDS complement(6173..7165) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292195.1 transl_table 11 codon_start 1 locus_tag LOCUS_41670 CDS 7628..8497 product FliM/FliN family flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922504.1 transl_table 11 codon_start 1 locus_tag LOCUS_41680 CDS 8490..8861 product FliM/FliN family flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043127.1 transl_table 11 codon_start 1 locus_tag LOCUS_41690 CDS 8858..9613 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830282.1 transl_table 11 codon_start 1 locus_tag LOCUS_41700 gene fliP CDS 9627..9899 product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958542.1 transl_table 11 codon_start 1 locus_tag LOCUS_41710 CDS 9901..10680 product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260504.1 transl_table 11 codon_start 1 locus_tag LOCUS_41720 gene fliR CDS 10673..11812 product flagellar type III secretion system protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785648.1 transl_table 11 codon_start 1 locus_tag LOCUS_41730 CDS 11796..13889 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140817.1 transl_table 11 codon_start 1 locus_tag LOCUS_41740 gene flhA CDS 13922..14137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41750