>Feature sequence01 172 753 gene locus_tag LOCUS_00010 172 753 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098133.1 protein_id gnl|my_center|LOCUS_00010 1029 1811 gene locus_tag LOCUS_00020 gene argT 1029 1811 CDS product lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098132.1 protein_id gnl|my_center|LOCUS_00020 2040 2822 gene locus_tag LOCUS_00030 gene hisJ 2040 2822 CDS product histidine ABC transporter substrate-binding protein HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731871.1 protein_id gnl|my_center|LOCUS_00030 2901 3587 gene locus_tag LOCUS_00040 gene hisQ 2901 3587 CDS product histidine ABC transporter permease HisQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965518.1 protein_id gnl|my_center|LOCUS_00040 3584 4300 gene locus_tag LOCUS_00050 3584 4300 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502590.1 protein_id gnl|my_center|LOCUS_00050 4308 5081 gene locus_tag LOCUS_00060 gene hisP 4308 5081 CDS product histidine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293612.1 protein_id gnl|my_center|LOCUS_00060 5740 5201 gene locus_tag LOCUS_00070 5740 5201 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446135.1 protein_id gnl|my_center|LOCUS_00070 6704 5811 gene locus_tag LOCUS_00080 6704 5811 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028341.1 protein_id gnl|my_center|LOCUS_00080 7085 6723 gene locus_tag LOCUS_00090 gene folX 7085 6723 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098127.1 protein_id gnl|my_center|LOCUS_00090 7775 7146 gene locus_tag LOCUS_00100 gene yfcG 7775 7146 CDS product GSH-dependent disulfide bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566559.1 protein_id gnl|my_center|LOCUS_00100 7910 8548 gene locus_tag LOCUS_00110 gene yfcF 7910 8548 CDS product glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365572.1 protein_id gnl|my_center|LOCUS_00110 8745 9290 gene locus_tag LOCUS_00120 gene yfcD 8745 9290 CDS product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098123.1 protein_id gnl|my_center|LOCUS_00120 10311 9292 gene locus_tag LOCUS_00130 10311 9292 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098122.1 protein_id gnl|my_center|LOCUS_00130 10562 11005 gene locus_tag LOCUS_00140 10562 11005 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901818.1 protein_id gnl|my_center|LOCUS_00140 11086 11358 gene locus_tag LOCUS_00150 11086 11358 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699818.1 protein_id gnl|my_center|LOCUS_00150 11381 12772 gene locus_tag LOCUS_00160 11381 12772 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681684.1 protein_id gnl|my_center|LOCUS_00160 12769 13602 gene locus_tag LOCUS_00170 12769 13602 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098118.1 protein_id gnl|my_center|LOCUS_00170 13595 14548 gene locus_tag LOCUS_00180 13595 14548 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098117.1 protein_id gnl|my_center|LOCUS_00180 16777 14636 gene locus_tag LOCUS_00190 gene pta 16777 14636 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098116.1 protein_id gnl|my_center|LOCUS_00190 18055 16853 gene locus_tag LOCUS_00200 gene ackA 18055 16853 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095707.1 protein_id gnl|my_center|LOCUS_00200 18395 18850 gene locus_tag LOCUS_00210 gene yfbV 18395 18850 CDS product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365578.1 protein_id gnl|my_center|LOCUS_00210 18932 19426 gene locus_tag LOCUS_00220 18932 19426 CDS product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098113.1 protein_id gnl|my_center|LOCUS_00220 19437 20096 gene locus_tag LOCUS_00230 19437 20096 CDS product sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013205.1 protein_id gnl|my_center|LOCUS_00230 20171 22006 gene locus_tag LOCUS_00240 20171 22006 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098111.1 protein_id gnl|my_center|LOCUS_00240 22705 22106 gene locus_tag LOCUS_00250 gene yfbR 22705 22106 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813857.1 protein_id gnl|my_center|LOCUS_00250 24000 22786 gene locus_tag LOCUS_00260 gene alaA 24000 22786 CDS product alanine transaminase AlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074527.1 protein_id gnl|my_center|LOCUS_00260 24930 25868 gene locus_tag LOCUS_00270 gene lrhA 24930 25868 CDS product transcriptional regulator LrhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029881734.1 protein_id gnl|my_center|LOCUS_00270 26496 26939 gene locus_tag LOCUS_00280 gene nuoA 26496 26939 CDS product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062993.1 protein_id gnl|my_center|LOCUS_00280 26955 27629 gene locus_tag LOCUS_00290 gene nuoB 26955 27629 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002913178.1 protein_id gnl|my_center|LOCUS_00290 27717 29519 gene locus_tag LOCUS_00300 gene nuoC 27717 29519 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247855.1 protein_id gnl|my_center|LOCUS_00300 29522 30022 gene locus_tag LOCUS_00310 gene nuoE 29522 30022 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545038.1 protein_id gnl|my_center|LOCUS_00310 30019 31356 gene locus_tag LOCUS_00320 gene nuoF 30019 31356 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800046.1 protein_id gnl|my_center|LOCUS_00320 31515 34241 gene locus_tag LOCUS_00330 gene nuoG 31515 34241 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518099.1 protein_id gnl|my_center|LOCUS_00330 34238 35215 gene locus_tag LOCUS_00340 gene nuoH 34238 35215 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098104.1 protein_id gnl|my_center|LOCUS_00340 35230 35772 gene locus_tag LOCUS_00350 gene nuoI 35230 35772 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861491.1 protein_id gnl|my_center|LOCUS_00350 35784 36335 gene locus_tag LOCUS_00360 gene nuoJ 35784 36335 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393511.1 protein_id gnl|my_center|LOCUS_00360 36332 36634 gene locus_tag LOCUS_00370 gene nuoK 36332 36634 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612644.1 protein_id gnl|my_center|LOCUS_00370 36631 38472 gene locus_tag LOCUS_00380 gene nuoL 36631 38472 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832758.1 protein_id gnl|my_center|LOCUS_00380 38581 40110 gene locus_tag LOCUS_00390 gene nuoM 38581 40110 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098102.1 protein_id gnl|my_center|LOCUS_00390 40117 41574 gene locus_tag LOCUS_00400 gene nuoN 40117 41574 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098101.1 protein_id gnl|my_center|LOCUS_00400 42675 41668 gene locus_tag LOCUS_00410 42675 41668 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368546.1 protein_id gnl|my_center|LOCUS_00410 43668 42751 gene locus_tag LOCUS_00420 gene rbn 43668 42751 CDS product ribonuclease BN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817396.1 protein_id gnl|my_center|LOCUS_00420 43742 44203 gene locus_tag LOCUS_00430 43742 44203 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420256.1 protein_id gnl|my_center|LOCUS_00430 44257 44559 gene locus_tag LOCUS_00440 gene elaB 44257 44559 CDS product stress response protein ElaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070621.1 protein_id gnl|my_center|LOCUS_00440 44668 45963 gene locus_tag LOCUS_00450 gene menF 44668 45963 CDS product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191386.1 protein_id gnl|my_center|LOCUS_00450 46052 47722 gene locus_tag LOCUS_00460 gene menD 46052 47722 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116387.1 protein_id gnl|my_center|LOCUS_00460 47719 48498 gene locus_tag LOCUS_00470 gene menH 47719 48498 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600540.1 protein_id gnl|my_center|LOCUS_00470 48495 49352 gene locus_tag LOCUS_00480 gene menB 48495 49352 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640013.1 protein_id gnl|my_center|LOCUS_00480 49352 50317 gene locus_tag LOCUS_00490 gene menC 49352 50317 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706154.1 protein_id gnl|my_center|LOCUS_00490 50314 51684 gene locus_tag LOCUS_00500 gene menE 50314 51684 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098091.1 protein_id gnl|my_center|LOCUS_00500 51785 52318 gene locus_tag LOCUS_00510 51785 52318 CDS product YfaZ family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098023.1 protein_id gnl|my_center|LOCUS_00510 52423 53622 gene locus_tag LOCUS_00520 52423 53622 CDS product nicotinamide mononucleotide deamidase-related protein YfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098022.1 protein_id gnl|my_center|LOCUS_00520 54922 53732 gene locus_tag LOCUS_00530 gene glpC 54922 53732 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000358.1 protein_id gnl|my_center|LOCUS_00530 56175 54919 gene locus_tag LOCUS_00540 gene glpB 56175 54919 CDS product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706148.1 protein_id gnl|my_center|LOCUS_00540 57787 56165 gene locus_tag LOCUS_00550 gene glpA 57787 56165 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857281.1 protein_id gnl|my_center|LOCUS_00550 58282 58704 gene locus_tag LOCUS_00560 58282 58704 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705537.1 protein_id gnl|my_center|LOCUS_00560 59151 58897 gene locus_tag LOCUS_00570 gene yfaE 59151 58897 CDS product ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533921.1 protein_id gnl|my_center|LOCUS_00570 60281 59151 gene locus_tag LOCUS_00580 gene nrdB 60281 59151 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098012.1 protein_id gnl|my_center|LOCUS_00580 62677 60392 gene locus_tag LOCUS_00590 gene nrdA 62677 60392 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076502.1 protein_id gnl|my_center|LOCUS_00590 63740 63012 gene locus_tag LOCUS_00600 gene ubiG 63740 63012 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365620.1 protein_id gnl|my_center|LOCUS_00600 63887 66523 gene locus_tag LOCUS_00610 gene gyrA 63887 66523 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706144.1 protein_id gnl|my_center|LOCUS_00610 68182 66596 gene locus_tag LOCUS_00620 68182 66596 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986061.1 protein_id gnl|my_center|LOCUS_00620 68353 69051 gene locus_tag LOCUS_00630 68353 69051 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094792.1 protein_id gnl|my_center|LOCUS_00630 69237 70571 gene locus_tag LOCUS_00640 69237 70571 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098287.1 protein_id gnl|my_center|LOCUS_00640 70586 71566 gene locus_tag LOCUS_00650 gene akrN 70586 71566 CDS product aldo/keto reductase AkrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245422.1 protein_id gnl|my_center|LOCUS_00650 71754 74600 gene locus_tag LOCUS_00660 gene rcsC 71754 74600 CDS product two-component system sensor histidine kinase RcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098008.1 protein_id gnl|my_center|LOCUS_00660 75300 74647 gene locus_tag LOCUS_00670 gene rcsB 75300 74647 CDS product response regulator transcription factor RcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859405.1 protein_id gnl|my_center|LOCUS_00670 77966 75318 gene locus_tag LOCUS_00680 gene rcsD 77966 75318 CDS product phosphotransferase RcsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619743.1 protein_id gnl|my_center|LOCUS_00680 78804 79931 gene locus_tag LOCUS_00690 78804 79931 CDS product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865526.1 protein_id gnl|my_center|LOCUS_00690 80038 81090 gene locus_tag LOCUS_00700 gene apbE 80038 81090 CDS product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706140.1 protein_id gnl|my_center|LOCUS_00700 81163 82227 gene locus_tag LOCUS_00710 gene ada 81163 82227 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786384.1 protein_id gnl|my_center|LOCUS_00710 82227 82868 gene locus_tag LOCUS_00720 gene alkB 82227 82868 CDS product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884975.1 protein_id gnl|my_center|LOCUS_00720 83115 84758 gene locus_tag LOCUS_00730 83115 84758 CDS product multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098002.1 protein_id gnl|my_center|LOCUS_00730 84843 86279 gene locus_tag LOCUS_00740 gene mgtE 84843 86279 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098001.1 protein_id gnl|my_center|LOCUS_00740 87432 86242 gene locus_tag LOCUS_00750 87432 86242 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098000.1 protein_id gnl|my_center|LOCUS_00750 87869 89407 gene locus_tag LOCUS_00760 gene mqo 87869 89407 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097999.1 protein_id gnl|my_center|LOCUS_00760 89544 89468 gene locus_tag LOCUS_t00010 89544 89468 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 91381 89621 gene locus_tag LOCUS_00770 gene yejM 91381 89621 CDS product LPS biosynthesis-modulating metalloenzyme YejM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097996.1 protein_id gnl|my_center|LOCUS_00770 91663 91400 gene locus_tag LOCUS_00780 91663 91400 CDS product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135586.1 protein_id gnl|my_center|LOCUS_00780 91771 92778 gene locus_tag LOCUS_00790 gene yejK 91771 92778 CDS product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097995.1 protein_id gnl|my_center|LOCUS_00790 93107 92823 gene locus_tag LOCUS_00800 gene rplY 93107 92823 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494192.1 protein_id gnl|my_center|LOCUS_00800 94992 93232 gene locus_tag LOCUS_00810 94992 93232 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578056.1 protein_id gnl|my_center|LOCUS_00810 95276 95983 gene locus_tag LOCUS_00820 gene rsuA 95276 95983 CDS product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234850.1 protein_id gnl|my_center|LOCUS_00820 95999 97195 gene locus_tag LOCUS_00830 95999 97195 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097989.1 protein_id gnl|my_center|LOCUS_00830 97516 97860 gene locus_tag LOCUS_00840 97516 97860 CDS product YejG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094639.1 protein_id gnl|my_center|LOCUS_00840 99453 97864 gene locus_tag LOCUS_00850 gene yejF 99453 97864 CDS product microcin C ABC transporter ATP-binding protein YejF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097987.1 protein_id gnl|my_center|LOCUS_00850 100480 99455 gene locus_tag LOCUS_00860 100480 99455 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088916.1 protein_id gnl|my_center|LOCUS_00860 101574 100480 gene locus_tag LOCUS_00870 101574 100480 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501583.1 protein_id gnl|my_center|LOCUS_00870 103392 101584 gene locus_tag LOCUS_00880 103392 101584 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602410.1 protein_id gnl|my_center|LOCUS_00880 104063 103599 gene locus_tag LOCUS_00890 gene mepS 104063 103599 CDS product bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619753.1 protein_id gnl|my_center|LOCUS_00890 105298 104582 gene locus_tag LOCUS_00900 105298 104582 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178088.1 protein_id gnl|my_center|LOCUS_00900 106319 105333 gene locus_tag LOCUS_00910 gene yeiR 106319 105333 CDS product zinc-binding GTPase YeiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198816.1 protein_id gnl|my_center|LOCUS_00910 107916 106450 gene locus_tag LOCUS_00920 107916 106450 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091919.1 protein_id gnl|my_center|LOCUS_00920 108124 109314 gene locus_tag LOCUS_00930 gene uxuA 108124 109314 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097978.1 protein_id gnl|my_center|LOCUS_00930 110041 109469 gene locus_tag LOCUS_00940 gene yeiP 110041 109469 CDS product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365690.1 protein_id gnl|my_center|LOCUS_00940 110130 110453 gene locus_tag LOCUS_00950 110130 110453 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365691.1 protein_id gnl|my_center|LOCUS_00950 111631 110450 gene locus_tag LOCUS_00960 gene setB 111631 110450 CDS product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097970.1 protein_id gnl|my_center|LOCUS_00960 111999 113129 gene locus_tag LOCUS_00970 gene fruB 111999 113129 CDS product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097968.1 protein_id gnl|my_center|LOCUS_00970 113129 114067 gene locus_tag LOCUS_00980 gene fruK 113129 114067 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365695.1 protein_id gnl|my_center|LOCUS_00980 114084 115772 gene locus_tag LOCUS_00990 gene fruA 114084 115772 CDS product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854408.1 protein_id gnl|my_center|LOCUS_00990 116670 115822 gene locus_tag LOCUS_01000 gene nfo 116670 115822 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873890.1 protein_id gnl|my_center|LOCUS_01000 117785 116742 gene locus_tag LOCUS_01010 117785 116742 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097963.1 protein_id gnl|my_center|LOCUS_01010 117878 118771 gene locus_tag LOCUS_01020 gene yieE 117878 118771 CDS product DNA-binding transcriptional regulator YeiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548316.1 protein_id gnl|my_center|LOCUS_01020 119031 120431 gene locus_tag LOCUS_01030 119031 120431 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097961.1 protein_id gnl|my_center|LOCUS_01030 120814 122691 gene locus_tag LOCUS_01040 gene cirA 120814 122691 CDS product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420204.1 protein_id gnl|my_center|LOCUS_01040 123576 122740 gene locus_tag LOCUS_01050 gene yeiG 123576 122740 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425456.1 protein_id gnl|my_center|LOCUS_01050 123718 124866 gene locus_tag LOCUS_01060 123718 124866 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097958.1 protein_id gnl|my_center|LOCUS_01060 124971 125636 gene locus_tag LOCUS_01070 gene folE 124971 125636 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097957.1 protein_id gnl|my_center|LOCUS_01070 125652 126809 gene locus_tag LOCUS_01080 gene yeiB 125652 126809 CDS product DUF418 domain-containing protein YeiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440902.1 protein_id gnl|my_center|LOCUS_01080 126965 127990 gene locus_tag LOCUS_01090 gene galS 126965 127990 CDS product HTH-type transcriptional regulator GalS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097955.1 protein_id gnl|my_center|LOCUS_01090 128319 129275 gene locus_tag LOCUS_01100 gene mglB 128319 129275 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036964.1 protein_id gnl|my_center|LOCUS_01100 129357 130877 gene locus_tag LOCUS_01110 gene mglA 129357 130877 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255039.1 protein_id gnl|my_center|LOCUS_01110 130893 131903 gene locus_tag LOCUS_01120 gene mglC 130893 131903 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097952.1 protein_id gnl|my_center|LOCUS_01120 132200 131961 gene locus_tag LOCUS_01130 132200 131961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 132862 132416 gene locus_tag LOCUS_01140 132862 132416 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096670.1 protein_id gnl|my_center|LOCUS_01140 133324 132872 gene locus_tag LOCUS_01150 133324 132872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096671.1 protein_id gnl|my_center|LOCUS_01150 133774 135000 gene locus_tag LOCUS_01160 133774 135000 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097093.1 protein_id gnl|my_center|LOCUS_01160 135740 135003 gene locus_tag LOCUS_01170 gene sanA 135740 135003 CDS product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097950.1 protein_id gnl|my_center|LOCUS_01170 136755 135871 gene locus_tag LOCUS_01180 gene cdd 136755 135871 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097949.1 protein_id gnl|my_center|LOCUS_01180 137580 136885 gene locus_tag LOCUS_01190 137580 136885 CDS product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097948.1 protein_id gnl|my_center|LOCUS_01190 137975 137577 gene locus_tag LOCUS_01200 137975 137577 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045719.1 protein_id gnl|my_center|LOCUS_01200 138207 139145 gene locus_tag LOCUS_01210 gene dusC 138207 139145 CDS product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706102.1 protein_id gnl|my_center|LOCUS_01210 139424 140194 gene locus_tag LOCUS_01220 139424 140194 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097944.1 protein_id gnl|my_center|LOCUS_01220 140896 140312 gene locus_tag LOCUS_01230 140896 140312 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365433.1 protein_id gnl|my_center|LOCUS_01230 141037 141624 gene locus_tag LOCUS_01240 141037 141624 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097942.1 protein_id gnl|my_center|LOCUS_01240 141798 142748 gene locus_tag LOCUS_01250 gene pbpG 141798 142748 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295432.1 protein_id gnl|my_center|LOCUS_01250 143303 142749 gene locus_tag LOCUS_01260 143303 142749 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097939.1 protein_id gnl|my_center|LOCUS_01260 145136 143409 gene locus_tag LOCUS_01270 gene dld 145136 143409 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097938.1 protein_id gnl|my_center|LOCUS_01270 145349 147616 gene locus_tag LOCUS_01280 gene bglX 145349 147616 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097937.1 protein_id gnl|my_center|LOCUS_01280 147787 149031 gene locus_tag LOCUS_01290 147787 149031 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246197.1 protein_id gnl|my_center|LOCUS_01290 149096 150013 gene locus_tag LOCUS_01300 149096 150013 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097936.1 protein_id gnl|my_center|LOCUS_01300 150026 151180 gene locus_tag LOCUS_01310 150026 151180 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278105.1 protein_id gnl|my_center|LOCUS_01310 151177 152124 gene locus_tag LOCUS_01320 gene yehX 151177 152124 CDS product glycine betaine ABC transporter ATP binding protein YehX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569352.1 protein_id gnl|my_center|LOCUS_01320 152108 152839 gene locus_tag LOCUS_01330 152108 152839 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097933.1 protein_id gnl|my_center|LOCUS_01330 153719 152988 gene locus_tag LOCUS_01340 gene mlrA 153719 152988 CDS product HTH-type transcriptional regulator MlrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240415.1 protein_id gnl|my_center|LOCUS_01340 153943 155631 gene locus_tag LOCUS_01350 153943 155631 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097931.1 protein_id gnl|my_center|LOCUS_01350 155625 156344 gene locus_tag LOCUS_01360 gene btsR 155625 156344 CDS product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097930.1 protein_id gnl|my_center|LOCUS_01360 156357 156875 gene locus_tag LOCUS_01370 156357 156875 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295430.1 protein_id gnl|my_center|LOCUS_01370 157376 156918 gene locus_tag LOCUS_01380 157376 156918 CDS product YehR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703137.1 protein_id gnl|my_center|LOCUS_01380 159501 157459 gene locus_tag LOCUS_01390 gene metG 159501 157459 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097928.1 protein_id gnl|my_center|LOCUS_01390 159625 160734 gene locus_tag LOCUS_01400 gene apbC 159625 160734 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005448.1 protein_id gnl|my_center|LOCUS_01400 163263 160831 gene locus_tag LOCUS_01410 163263 160831 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209345.1 protein_id gnl|my_center|LOCUS_01410 164167 163268 gene locus_tag LOCUS_01420 164167 163268 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097441.1 protein_id gnl|my_center|LOCUS_01420 164302 164964 gene locus_tag LOCUS_01430 gene fsa 164302 164964 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420897.1 protein_id gnl|my_center|LOCUS_01430 165824 165069 gene locus_tag LOCUS_01440 gene moeB 165824 165069 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097439.1 protein_id gnl|my_center|LOCUS_01440 167059 165824 gene locus_tag LOCUS_01450 gene moeA 167059 165824 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097438.1 protein_id gnl|my_center|LOCUS_01450 167261 168208 gene locus_tag LOCUS_01460 gene iaaA 167261 168208 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513761.1 protein_id gnl|my_center|LOCUS_01460 168219 170090 gene locus_tag LOCUS_01470 gene gsiA 168219 170090 CDS product glutathione ABC transporter ATP-binding protein GsiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097436.1 protein_id gnl|my_center|LOCUS_01470 170134 171672 gene locus_tag LOCUS_01480 gene gsiB 170134 171672 CDS product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097435.1 protein_id gnl|my_center|LOCUS_01480 171914 172834 gene locus_tag LOCUS_01490 gene gsiC 171914 172834 CDS product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936066.1 protein_id gnl|my_center|LOCUS_01490 172837 173748 gene locus_tag LOCUS_01500 gene gsiD 172837 173748 CDS product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704838.1 protein_id gnl|my_center|LOCUS_01500 175178 173859 gene locus_tag LOCUS_01510 gene rimO 175178 173859 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073304.1 protein_id gnl|my_center|LOCUS_01510 175376 175756 gene locus_tag LOCUS_01520 gene bssR 175376 175756 CDS product biofilm formation regulator BssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259651.1 protein_id gnl|my_center|LOCUS_01520 175865 176980 gene locus_tag LOCUS_01530 175865 176980 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097429.1 protein_id gnl|my_center|LOCUS_01530 178297 177005 gene locus_tag LOCUS_01540 178297 177005 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210835.1 protein_id gnl|my_center|LOCUS_01540 179404 178301 gene locus_tag LOCUS_01550 179404 178301 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095405.1 protein_id gnl|my_center|LOCUS_01550 179562 180572 gene locus_tag LOCUS_01560 179562 180572 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095404.1 protein_id gnl|my_center|LOCUS_01560 181238 180612 gene locus_tag LOCUS_01570 gene gstB 181238 180612 CDS product glutathione S-transferase GstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061831.1 protein_id gnl|my_center|LOCUS_01570 181613 182683 gene locus_tag LOCUS_01580 gene dacC 181613 182683 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831210.1 protein_id gnl|my_center|LOCUS_01580 183448 182690 gene locus_tag LOCUS_01590 gene deoR 183448 182690 CDS product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367546.1 protein_id gnl|my_center|LOCUS_01590 184125 183517 gene locus_tag LOCUS_01600 gene ybjG 184125 183517 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520197.1 protein_id gnl|my_center|LOCUS_01600 184422 185651 gene locus_tag LOCUS_01610 184422 185651 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097422.1 protein_id gnl|my_center|LOCUS_01610 186888 185686 gene locus_tag LOCUS_01620 186888 185686 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217437.1 protein_id gnl|my_center|LOCUS_01620 187308 187039 gene locus_tag LOCUS_01630 gene yahO 187308 187039 CDS product DUF1471 family periplasmic protein YahO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848026.1 protein_id gnl|my_center|LOCUS_01630 188569 187433 gene locus_tag LOCUS_01640 188569 187433 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369193.1 protein_id gnl|my_center|LOCUS_01640 188897 188574 gene locus_tag LOCUS_01650 188897 188574 CDS product DUF3302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478193.1 protein_id gnl|my_center|LOCUS_01650 189705 189037 gene locus_tag LOCUS_01660 189705 189037 CDS product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261034.1 protein_id gnl|my_center|LOCUS_01660 189906 190118 gene locus_tag LOCUS_01670 189906 190118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 191894 190218 gene locus_tag LOCUS_01680 191894 190218 CDS product DUF4041 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195116.1 protein_id gnl|my_center|LOCUS_01680 194231 192546 gene locus_tag LOCUS_01690 194231 192546 CDS product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024851.1 protein_id gnl|my_center|LOCUS_01690 194431 194880 gene locus_tag LOCUS_01700 194431 194880 CDS product inner membrane protein YbjM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680848.1 protein_id gnl|my_center|LOCUS_01700 195005 195727 gene locus_tag LOCUS_01710 gene nfsA 195005 195727 CDS product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097374.1 protein_id gnl|my_center|LOCUS_01710 195802 196704 gene locus_tag LOCUS_01720 gene rimK 195802 196704 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684361.1 protein_id gnl|my_center|LOCUS_01720 196781 197257 gene locus_tag LOCUS_01730 196781 197257 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624817.1 protein_id gnl|my_center|LOCUS_01730 197605 198714 gene locus_tag LOCUS_01740 gene potF 197605 198714 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097372.1 protein_id gnl|my_center|LOCUS_01740 198810 199943 gene locus_tag LOCUS_01750 gene potG 198810 199943 CDS product putrescine ABC transporter ATP-binding subunit PotG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097371.1 protein_id gnl|my_center|LOCUS_01750 199953 200906 gene locus_tag LOCUS_01760 gene potH 199953 200906 CDS product putrescine ABC transporter permease PotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097370.1 protein_id gnl|my_center|LOCUS_01760 200903 201748 gene locus_tag LOCUS_01770 gene potI 200903 201748 CDS product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061634.1 protein_id gnl|my_center|LOCUS_01770 201836 202291 gene locus_tag LOCUS_01780 201836 202291 CDS product DUF2593 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763976.1 protein_id gnl|my_center|LOCUS_01780 202334 203467 gene locus_tag LOCUS_01790 gene rlmC 202334 203467 CDS product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149762.1 protein_id gnl|my_center|LOCUS_01790 204235 203504 gene locus_tag LOCUS_01800 gene artJ 204235 203504 CDS product ABC transporter substrate-binding protein ArtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097364.1 protein_id gnl|my_center|LOCUS_01800 205166 204498 gene locus_tag LOCUS_01810 gene artM 205166 204498 CDS product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097363.1 protein_id gnl|my_center|LOCUS_01810 205882 205166 gene locus_tag LOCUS_01820 gene artQ 205882 205166 CDS product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001697.1 protein_id gnl|my_center|LOCUS_01820 206620 205889 gene locus_tag LOCUS_01830 gene artJ 206620 205889 CDS product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756586.1 protein_id gnl|my_center|LOCUS_01830 207368 206640 gene locus_tag LOCUS_01840 gene artP 207368 206640 CDS product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367515.1 protein_id gnl|my_center|LOCUS_01840 208133 207591 gene locus_tag LOCUS_01850 208133 207591 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097359.1 protein_id gnl|my_center|LOCUS_01850 208214 209041 gene locus_tag LOCUS_01860 208214 209041 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097358.1 protein_id gnl|my_center|LOCUS_01860 209041 209220 gene locus_tag LOCUS_01870 209041 209220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 210212 209199 gene locus_tag LOCUS_01880 210212 209199 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866904.1 protein_id gnl|my_center|LOCUS_01880 211738 210311 gene locus_tag LOCUS_01890 211738 210311 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097337.1 protein_id gnl|my_center|LOCUS_01890 212749 211748 gene locus_tag LOCUS_01900 gene ltaE 212749 211748 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097336.1 protein_id gnl|my_center|LOCUS_01900 214505 212787 gene locus_tag LOCUS_01910 gene poxB 214505 212787 CDS product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097335.1 protein_id gnl|my_center|LOCUS_01910 214747 215091 gene locus_tag LOCUS_01920 214747 215091 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704866.1 protein_id gnl|my_center|LOCUS_01920 216097 215129 gene locus_tag LOCUS_01930 gene hcr 216097 215129 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178665.1 protein_id gnl|my_center|LOCUS_01930 217795 216110 gene locus_tag LOCUS_01940 gene hcp 217795 216110 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458773.1 protein_id gnl|my_center|LOCUS_01940 218804 217905 gene locus_tag LOCUS_01950 218804 217905 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491116.1 protein_id gnl|my_center|LOCUS_01950 219005 220663 gene locus_tag LOCUS_01960 219005 220663 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704871.1 protein_id gnl|my_center|LOCUS_01960 221478 220660 gene locus_tag LOCUS_01970 221478 220660 CDS product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097328.1 protein_id gnl|my_center|LOCUS_01970 221772 222887 gene locus_tag LOCUS_01980 gene macA 221772 222887 CDS product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097327.1 protein_id gnl|my_center|LOCUS_01980 222884 224830 gene locus_tag LOCUS_01990 gene macB 222884 224830 CDS product macrolide ABC transporter ATP-binding protein/permease MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097326.1 protein_id gnl|my_center|LOCUS_01990 225140 224907 gene locus_tag LOCUS_02000 gene cspD 225140 224907 CDS product cold shock-like protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447499.1 protein_id gnl|my_center|LOCUS_02000 225469 225789 gene locus_tag LOCUS_02010 gene clpS 225469 225789 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006174393.1 protein_id gnl|my_center|LOCUS_02010 225818 228094 gene locus_tag LOCUS_02020 gene clpA 225818 228094 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934041.1 protein_id gnl|my_center|LOCUS_02020 228435 228217 gene locus_tag LOCUS_02030 gene infA 228435 228217 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040187.1 protein_id gnl|my_center|LOCUS_02030 229424 228720 gene locus_tag LOCUS_02040 gene aat 229424 228720 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097324.1 protein_id gnl|my_center|LOCUS_02040 231181 229460 gene locus_tag LOCUS_02050 gene cydC 231181 229460 CDS product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704874.1 protein_id gnl|my_center|LOCUS_02050 232948 231182 gene locus_tag LOCUS_02060 gene cydD 232948 231182 CDS product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097322.1 protein_id gnl|my_center|LOCUS_02060 234035 233067 gene locus_tag LOCUS_02070 gene trxB 234035 233067 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097321.1 protein_id gnl|my_center|LOCUS_02070 234271 234489 gene locus_tag LOCUS_02080 234271 234489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 234587 235081 gene locus_tag LOCUS_02090 gene lrp 234587 235081 CDS product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228469.1 protein_id gnl|my_center|LOCUS_02090 235203 239042 gene locus_tag LOCUS_02100 235203 239042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 239171 239785 gene locus_tag LOCUS_02110 gene lolA 239171 239785 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976047.1 protein_id gnl|my_center|LOCUS_02110 239794 241137 gene locus_tag LOCUS_02120 gene rarA 239794 241137 CDS product replication-associated recombination protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067785.1 protein_id gnl|my_center|LOCUS_02120 241230 242522 gene locus_tag LOCUS_02130 gene serS 241230 242522 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886697.1 protein_id gnl|my_center|LOCUS_02130 242719 245151 gene locus_tag LOCUS_02140 gene dmsA 242719 245151 CDS product dimethylsulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850303.1 protein_id gnl|my_center|LOCUS_02140 245162 245779 gene locus_tag LOCUS_02150 gene dmsB 245162 245779 CDS product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096798.1 protein_id gnl|my_center|LOCUS_02150 245781 246644 gene locus_tag LOCUS_02160 245781 246644 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097315.1 protein_id gnl|my_center|LOCUS_02160 246908 248056 gene locus_tag LOCUS_02170 246908 248056 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097314.1 protein_id gnl|my_center|LOCUS_02170 248884 248144 gene locus_tag LOCUS_02180 gene pflA 248884 248144 CDS product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111043.1 protein_id gnl|my_center|LOCUS_02180 251358 249076 gene locus_tag LOCUS_02190 gene pflB 251358 249076 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097311.1 protein_id gnl|my_center|LOCUS_02190 252267 251410 gene locus_tag LOCUS_02200 gene focA 252267 251410 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097310.1 protein_id gnl|my_center|LOCUS_02200 254431 252671 gene locus_tag LOCUS_02210 gene ycaO 254431 252671 CDS product 30S ribosomal protein S12 methylthiotransferase accessory factor YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420898.1 protein_id gnl|my_center|LOCUS_02210 254569 255261 gene locus_tag LOCUS_02220 254569 255261 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642849.1 protein_id gnl|my_center|LOCUS_02220 255424 256512 gene locus_tag LOCUS_02230 gene serC 255424 256512 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882989.1 protein_id gnl|my_center|LOCUS_02230 256585 257868 gene locus_tag LOCUS_02240 gene aroA 256585 257868 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097306.1 protein_id gnl|my_center|LOCUS_02240 258122 259543 gene locus_tag LOCUS_02250 258122 259543 CDS product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096164.1 protein_id gnl|my_center|LOCUS_02250 259518 261278 gene locus_tag LOCUS_02260 259518 261278 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644028.1 protein_id gnl|my_center|LOCUS_02260 261424 262323 gene locus_tag LOCUS_02270 261424 262323 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262519.1 protein_id gnl|my_center|LOCUS_02270 262453 263220 gene locus_tag LOCUS_02280 262453 263220 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792300.1 protein_id gnl|my_center|LOCUS_02280 263394 264077 gene locus_tag LOCUS_02290 gene cmk 263394 264077 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125016.1 protein_id gnl|my_center|LOCUS_02290 264194 265867 gene locus_tag LOCUS_02300 gene rpsA 264194 265867 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499966.1 protein_id gnl|my_center|LOCUS_02300 266037 266324 gene locus_tag LOCUS_02310 gene ihfB 266037 266324 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004100704.1 protein_id gnl|my_center|LOCUS_02310 266582 268846 gene locus_tag LOCUS_02320 266582 268846 CDS product ComEC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705734.1 protein_id gnl|my_center|LOCUS_02320 268883 270631 gene locus_tag LOCUS_02330 gene msbA 268883 270631 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097303.1 protein_id gnl|my_center|LOCUS_02330 270628 271611 gene locus_tag LOCUS_02340 gene lpxK 270628 271611 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561698.1 protein_id gnl|my_center|LOCUS_02340 271647 272876 gene locus_tag LOCUS_02350 271647 272876 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097301.1 protein_id gnl|my_center|LOCUS_02350 272931 273113 gene locus_tag LOCUS_02360 gene ycaR 272931 273113 CDS product protein YcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097300.1 protein_id gnl|my_center|LOCUS_02360 273110 273856 gene locus_tag LOCUS_02370 gene kdsB 273110 273856 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011613.1 protein_id gnl|my_center|LOCUS_02370 273985 274890 gene locus_tag LOCUS_02380 273985 274890 CDS product YcbJ family phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097298.1 protein_id gnl|my_center|LOCUS_02380 275634 274855 gene locus_tag LOCUS_02390 gene elyC 275634 274855 CDS product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097297.1 protein_id gnl|my_center|LOCUS_02390 275753 276532 gene locus_tag LOCUS_02400 gene cmoM 275753 276532 CDS product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097296.1 protein_id gnl|my_center|LOCUS_02400 276536 277858 gene locus_tag LOCUS_02410 gene mukF 276536 277858 CDS product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097295.1 protein_id gnl|my_center|LOCUS_02410 277839 278543 gene locus_tag LOCUS_02420 gene mukE 277839 278543 CDS product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295931.1 protein_id gnl|my_center|LOCUS_02420 278543 282997 gene locus_tag LOCUS_02430 gene mukB 278543 282997 CDS product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704893.1 protein_id gnl|my_center|LOCUS_02430 283212 285044 gene locus_tag LOCUS_02440 gene ldtD 283212 285044 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925899.1 protein_id gnl|my_center|LOCUS_02440 285184 285777 gene locus_tag LOCUS_02450 285184 285777 CDS product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097290.1 protein_id gnl|my_center|LOCUS_02450 285799 286446 gene locus_tag LOCUS_02460 285799 286446 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097289.1 protein_id gnl|my_center|LOCUS_02460 287717 286527 gene locus_tag LOCUS_02470 gene aspC 287717 286527 CDS product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462680.1 protein_id gnl|my_center|LOCUS_02470 289036 287903 gene locus_tag LOCUS_02480 gene ompF 289036 287903 CDS product porin OmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977709.1 protein_id gnl|my_center|LOCUS_02480 291036 289636 gene locus_tag LOCUS_02490 gene asnS 291036 289636 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117867.1 protein_id gnl|my_center|LOCUS_02490 292405 291203 gene locus_tag LOCUS_02500 gene pncB 292405 291203 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097285.1 protein_id gnl|my_center|LOCUS_02500 292669 295281 gene locus_tag LOCUS_02510 gene pepN 292669 295281 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097275.1 protein_id gnl|my_center|LOCUS_02510 296211 295444 gene locus_tag LOCUS_02520 gene ssuB 296211 295444 CDS product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097274.1 protein_id gnl|my_center|LOCUS_02520 296996 296208 gene locus_tag LOCUS_02530 gene ssuC 296996 296208 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097273.1 protein_id gnl|my_center|LOCUS_02530 298152 297007 gene locus_tag LOCUS_02540 gene ssuD 298152 297007 CDS product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055996.1 protein_id gnl|my_center|LOCUS_02540 299123 298149 gene locus_tag LOCUS_02550 gene ssuA 299123 298149 CDS product aliphatic sulfonate ABC transporter substrate-binding protein SsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244308.1 protein_id gnl|my_center|LOCUS_02550 299691 299116 gene locus_tag LOCUS_02560 gene ssuE 299691 299116 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097270.1 protein_id gnl|my_center|LOCUS_02560 299939 300949 gene locus_tag LOCUS_02570 gene pyrD 299939 300949 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295352.1 protein_id gnl|my_center|LOCUS_02570 301118 301660 gene locus_tag LOCUS_02580 gene zapC 301118 301660 CDS product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220671.1 protein_id gnl|my_center|LOCUS_02580 302766 301657 gene locus_tag LOCUS_02590 302766 301657 CDS product YcbX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097267.1 protein_id gnl|my_center|LOCUS_02590 302866 304974 gene locus_tag LOCUS_02600 gene rlmKL 302866 304974 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086472.1 protein_id gnl|my_center|LOCUS_02600 304985 306892 gene locus_tag LOCUS_02610 304985 306892 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704904.1 protein_id gnl|my_center|LOCUS_02610 306923 308176 gene locus_tag LOCUS_02620 gene pqiA 306923 308176 CDS product membrane integrity-associated transporter subunit PqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027912.1 protein_id gnl|my_center|LOCUS_02620 308181 309818 gene locus_tag LOCUS_02630 gene pqiB 308181 309818 CDS product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433416.1 protein_id gnl|my_center|LOCUS_02630 309818 310384 gene locus_tag LOCUS_02640 gene pqiC 309818 310384 CDS product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097262.1 protein_id gnl|my_center|LOCUS_02640 310642 310809 gene locus_tag LOCUS_02650 gene rmf 310642 310809 CDS product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704906.1 protein_id gnl|my_center|LOCUS_02650 311445 310864 gene locus_tag LOCUS_02660 gene fabA 311445 310864 CDS product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018747.1 protein_id gnl|my_center|LOCUS_02660 313212 311452 gene locus_tag LOCUS_02670 313212 311452 CDS product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097259.1 protein_id gnl|my_center|LOCUS_02670 313399 313851 gene locus_tag LOCUS_02680 gene matP 313399 313851 CDS product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877174.1 protein_id gnl|my_center|LOCUS_02680 314976 313918 gene locus_tag LOCUS_02690 gene ompA 314976 313918 CDS product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989142.1 protein_id gnl|my_center|LOCUS_02690 315846 315331 gene locus_tag LOCUS_02700 gene sulA 315846 315331 CDS product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288692.1 protein_id gnl|my_center|LOCUS_02700 316001 315861 gene locus_tag LOCUS_02710 316001 315861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 316059 316688 gene locus_tag LOCUS_02720 316059 316688 CDS product TfoX/Sxy family DNA transformation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097255.1 protein_id gnl|my_center|LOCUS_02720 318799 316673 gene locus_tag LOCUS_02730 gene yccS 318799 316673 CDS product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950867.1 protein_id gnl|my_center|LOCUS_02730 319263 318817 gene locus_tag LOCUS_02740 319263 318817 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261222.1 protein_id gnl|my_center|LOCUS_02740 319386 321440 gene locus_tag LOCUS_02750 gene helD 319386 321440 CDS product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420536.1 protein_id gnl|my_center|LOCUS_02750 321942 321484 gene locus_tag LOCUS_02760 gene mgsA 321942 321484 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424187.1 protein_id gnl|my_center|LOCUS_02760 322716 322054 gene locus_tag LOCUS_02770 322716 322054 CDS product DUF2057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097250.1 protein_id gnl|my_center|LOCUS_02770 322886 323299 gene locus_tag LOCUS_02780 322886 323299 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301418.1 protein_id gnl|my_center|LOCUS_02780 323785 323468 gene locus_tag LOCUS_02790 gene hspQ 323785 323468 CDS product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561983.1 protein_id gnl|my_center|LOCUS_02790 325036 323846 gene locus_tag LOCUS_02800 gene rlmI 325036 323846 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097247.1 protein_id gnl|my_center|LOCUS_02800 325130 325411 gene locus_tag LOCUS_02810 gene yccX 325130 325411 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097246.1 protein_id gnl|my_center|LOCUS_02810 325737 325408 gene locus_tag LOCUS_02820 gene tusE 325737 325408 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904446.1 protein_id gnl|my_center|LOCUS_02820 326484 325825 gene locus_tag LOCUS_02830 gene yccA 326484 325825 CDS product FtsH protease modulator YccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704916.1 protein_id gnl|my_center|LOCUS_02830 330997 326774 gene locus_tag LOCUS_02840 gene ehaA 330997 326774 CDS product autotransporter adhesin EhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386603.1 protein_id gnl|my_center|LOCUS_02840 331499 333127 gene locus_tag LOCUS_02850 331499 333127 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097243.1 protein_id gnl|my_center|LOCUS_02850 333257 333344 gene locus_tag LOCUS_t00020 333257 333344 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 334675 333455 gene locus_tag LOCUS_02860 334675 333455 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420953.1 protein_id gnl|my_center|LOCUS_02860 335449 334685 gene locus_tag LOCUS_02870 335449 334685 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098479.1 protein_id gnl|my_center|LOCUS_02870 336486 335449 gene locus_tag LOCUS_02880 336486 335449 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098478.1 protein_id gnl|my_center|LOCUS_02880 337484 336486 gene locus_tag LOCUS_02890 337484 336486 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098477.1 protein_id gnl|my_center|LOCUS_02890 338609 337608 gene locus_tag LOCUS_02900 338609 337608 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033652390.1 protein_id gnl|my_center|LOCUS_02900 339418 338606 gene locus_tag LOCUS_02910 339418 338606 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705828.1 protein_id gnl|my_center|LOCUS_02910 340388 339582 gene locus_tag LOCUS_02920 340388 339582 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040904057.1 protein_id gnl|my_center|LOCUS_02920 341568 340621 gene locus_tag LOCUS_02930 341568 340621 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797363.1 protein_id gnl|my_center|LOCUS_02930 342647 341568 gene locus_tag LOCUS_02940 342647 341568 CDS product cysteine protease StiP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182415.1 protein_id gnl|my_center|LOCUS_02940 343422 342649 gene locus_tag LOCUS_02950 343422 342649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040057.1 protein_id gnl|my_center|LOCUS_02950 344548 343415 gene locus_tag LOCUS_02960 344548 343415 CDS product phosphoribosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280118.1 protein_id gnl|my_center|LOCUS_02960 345621 344566 gene locus_tag LOCUS_02970 345621 344566 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035169.1 protein_id gnl|my_center|LOCUS_02970 345857 345699 gene locus_tag LOCUS_02980 345857 345699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 345924 346505 gene locus_tag LOCUS_02990 345924 346505 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254140.1 protein_id gnl|my_center|LOCUS_02990 346505 347659 gene locus_tag LOCUS_03000 346505 347659 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054787.1 protein_id gnl|my_center|LOCUS_03000 347682 348137 gene locus_tag LOCUS_03010 347682 348137 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007449.1 protein_id gnl|my_center|LOCUS_03010 348159 349199 gene locus_tag LOCUS_03020 gene terC 348159 349199 CDS product tellurium resistance membrane protein TerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255079.1 protein_id gnl|my_center|LOCUS_03020 349243 349821 gene locus_tag LOCUS_03030 gene terD 349243 349821 CDS product tellurium resistance membrane protein TerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116677.1 protein_id gnl|my_center|LOCUS_03030 349892 350467 gene locus_tag LOCUS_03040 349892 350467 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301248.1 protein_id gnl|my_center|LOCUS_03040 350722 350546 gene locus_tag LOCUS_03050 350722 350546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 350679 350882 gene locus_tag LOCUS_03060 350679 350882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 352724 351114 gene locus_tag LOCUS_03070 352724 351114 CDS product FAD-NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096935.1 protein_id gnl|my_center|LOCUS_03070 353140 352901 gene locus_tag LOCUS_03080 353140 352901 CDS product DinI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096351.1 protein_id gnl|my_center|LOCUS_03080 353316 354557 gene locus_tag LOCUS_03090 gene agp 353316 354557 CDS product bifunctional glucose-1-phosphatase/inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012132910.1 protein_id gnl|my_center|LOCUS_03090 354821 354594 gene locus_tag LOCUS_03100 354821 354594 CDS product YccJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499832.1 protein_id gnl|my_center|LOCUS_03100 355457 354840 gene locus_tag LOCUS_03110 gene wrbA 355457 354840 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170081.1 protein_id gnl|my_center|LOCUS_03110 356741 355548 gene locus_tag LOCUS_03120 356741 355548 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646142.1 protein_id gnl|my_center|LOCUS_03120 357750 356854 gene locus_tag LOCUS_03130 357750 356854 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096673.1 protein_id gnl|my_center|LOCUS_03130 358023 358541 gene locus_tag LOCUS_03140 358023 358541 CDS product 2-oxo-tetronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235351.1 protein_id gnl|my_center|LOCUS_03140 358770 358988 gene locus_tag LOCUS_03150 358770 358988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 359339 359076 gene locus_tag LOCUS_03160 359339 359076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 360863 359361 gene locus_tag LOCUS_03170 gene lysS 360863 359361 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003805.1 protein_id gnl|my_center|LOCUS_03170 361524 360979 gene locus_tag LOCUS_03180 361524 360979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 361718 361984 gene locus_tag LOCUS_03190 361718 361984 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433427.1 protein_id gnl|my_center|LOCUS_03190 362076 363401 gene locus_tag LOCUS_03200 gene potE 362076 363401 CDS product putrescine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042659.1 protein_id gnl|my_center|LOCUS_03200 363405 365543 gene locus_tag LOCUS_03210 gene cadA 363405 365543 CDS product lysine decarboxylase CadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367858.1 protein_id gnl|my_center|LOCUS_03210 365690 366616 gene locus_tag LOCUS_03220 365690 366616 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097200.1 protein_id gnl|my_center|LOCUS_03220 367113 366613 gene locus_tag LOCUS_03230 gene rutF 367113 366613 CDS product pyrimidine utilization flavin reductase protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097198.1 protein_id gnl|my_center|LOCUS_03230 367713 367123 gene locus_tag LOCUS_03240 367713 367123 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367246.1 protein_id gnl|my_center|LOCUS_03240 368525 367710 gene locus_tag LOCUS_03250 gene rutD 368525 367710 CDS product pyrimidine utilization protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001337722.1 protein_id gnl|my_center|LOCUS_03250 368916 368530 gene locus_tag LOCUS_03260 gene rutC 368916 368530 CDS product pyrimidine utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097195.1 protein_id gnl|my_center|LOCUS_03260 369618 368920 gene locus_tag LOCUS_03270 gene rutB 369618 368920 CDS product peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307708.1 protein_id gnl|my_center|LOCUS_03270 370709 369618 gene locus_tag LOCUS_03280 gene rutA 370709 369618 CDS product pyrimidine utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326839.1 protein_id gnl|my_center|LOCUS_03280 370987 371625 gene locus_tag LOCUS_03290 gene rutR 370987 371625 CDS product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097192.1 protein_id gnl|my_center|LOCUS_03290 372017 371622 gene locus_tag LOCUS_03300 372017 371622 CDS product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882762.1 protein_id gnl|my_center|LOCUS_03300 376051 372104 gene locus_tag LOCUS_03310 gene putA 376051 372104 CDS product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001356407.1 protein_id gnl|my_center|LOCUS_03310 376469 377977 gene locus_tag LOCUS_03320 gene putP 376469 377977 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018485.1 protein_id gnl|my_center|LOCUS_03320 378207 379040 gene locus_tag LOCUS_03330 378207 379040 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097186.1 protein_id gnl|my_center|LOCUS_03330 379096 380223 gene locus_tag LOCUS_03340 379096 380223 CDS product iron uptake system protein EfeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097185.1 protein_id gnl|my_center|LOCUS_03340 380228 381511 gene locus_tag LOCUS_03350 gene efeB 380228 381511 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097184.1 protein_id gnl|my_center|LOCUS_03350 382054 382842 gene locus_tag LOCUS_03360 gene phoH 382054 382842 CDS product phosphate starvation-inducible protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097183.1 protein_id gnl|my_center|LOCUS_03360 384325 382913 gene locus_tag LOCUS_03370 384325 382913 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096552.1 protein_id gnl|my_center|LOCUS_03370 385811 384396 gene locus_tag LOCUS_03380 385811 384396 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108116.1 protein_id gnl|my_center|LOCUS_03380 386907 385798 gene locus_tag LOCUS_03390 386907 385798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 387692 388621 gene locus_tag LOCUS_03400 387692 388621 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262519.1 protein_id gnl|my_center|LOCUS_03400 388965 389053 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 389369 389701 gene locus_tag LOCUS_03410 gene emrE 389369 389701 CDS product SMR family multidrug efflux protein EmrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070449.1 protein_id gnl|my_center|LOCUS_03410 390035 390514 gene locus_tag LOCUS_03420 390035 390514 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251083.1 protein_id gnl|my_center|LOCUS_03420 390680 390697 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 391100 392038 gene locus_tag LOCUS_03430 gene ghrA 391100 392038 CDS product glyoxylate/hydroxypyruvate reductase GhrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097178.1 protein_id gnl|my_center|LOCUS_03430 392109 392846 gene locus_tag LOCUS_03440 392109 392846 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367224.1 protein_id gnl|my_center|LOCUS_03440 392866 393420 gene locus_tag LOCUS_03450 gene ycdY 392866 393420 CDS product molecular chaperone YcdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001921.1 protein_id gnl|my_center|LOCUS_03450 393513 394004 gene locus_tag LOCUS_03460 393513 394004 CDS product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337814.1 protein_id gnl|my_center|LOCUS_03460 394885 394052 gene locus_tag LOCUS_03470 gene csgG 394885 394052 CDS product curli production assembly/transport protein CsgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137620.1 protein_id gnl|my_center|LOCUS_03470 395332 394916 gene locus_tag LOCUS_03480 gene csgF 395332 394916 CDS product curli production assembly/transport protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264088.1 protein_id gnl|my_center|LOCUS_03480 395749 395360 gene locus_tag LOCUS_03490 gene csgE 395749 395360 CDS product curli production assembly/transport protein CsgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833288.1 protein_id gnl|my_center|LOCUS_03490 396404 395754 gene locus_tag LOCUS_03500 gene csgD 396404 395754 CDS product biofilm master transcriptional regulator CsgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097171.1 protein_id gnl|my_center|LOCUS_03500 397148 397603 gene locus_tag LOCUS_03510 gene csgB 397148 397603 CDS product curli minor subunit CsgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001360656.1 protein_id gnl|my_center|LOCUS_03510 397646 398095 gene locus_tag LOCUS_03520 gene csgA 397646 398095 CDS product curli major subunit CsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771416.1 protein_id gnl|my_center|LOCUS_03520 398152 398481 gene locus_tag LOCUS_03530 gene csgC 398152 398481 CDS product curli assembly chaperone CsgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992821.1 protein_id gnl|my_center|LOCUS_03530 398560 399102 gene locus_tag LOCUS_03540 gene ymdB 398560 399102 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857405.1 protein_id gnl|my_center|LOCUS_03540 399086 400522 gene locus_tag LOCUS_03550 399086 400522 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976323.1 protein_id gnl|my_center|LOCUS_03550 401688 400558 gene locus_tag LOCUS_03560 gene mdoC 401688 400558 CDS product glucans biosynthesis protein MdoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097165.1 protein_id gnl|my_center|LOCUS_03560 401931 403496 gene locus_tag LOCUS_03570 gene mdoG 401931 403496 CDS product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001562609.1 protein_id gnl|my_center|LOCUS_03570 403489 406017 gene locus_tag LOCUS_03580 gene mdoH 403489 406017 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097163.1 protein_id gnl|my_center|LOCUS_03580 406110 406337 gene locus_tag LOCUS_03590 406110 406337 CDS product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237207.1 protein_id gnl|my_center|LOCUS_03590 406712 406338 gene locus_tag LOCUS_03600 406712 406338 CDS product MysB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180068.1 protein_id gnl|my_center|LOCUS_03600 408026 406806 gene locus_tag LOCUS_03610 gene mdtG 408026 406806 CDS product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075040.1 protein_id gnl|my_center|LOCUS_03610 409088 408168 gene locus_tag LOCUS_03620 gene lpxL 409088 408168 CDS product kdo(2)-lipid IV(A) lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062003.1 protein_id gnl|my_center|LOCUS_03620 409309 410358 gene locus_tag LOCUS_03630 409309 410358 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705028.1 protein_id gnl|my_center|LOCUS_03630 410974 410399 gene locus_tag LOCUS_03640 410974 410399 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739886.1 protein_id gnl|my_center|LOCUS_03640 411542 410976 gene locus_tag LOCUS_03650 411542 410976 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419093.1 protein_id gnl|my_center|LOCUS_03650 413108 411987 gene locus_tag LOCUS_03660 gene solA 413108 411987 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872833.1 protein_id gnl|my_center|LOCUS_03660 413482 413228 gene locus_tag LOCUS_03670 gene bssS 413482 413228 CDS product biofilm formation regulator BssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500827.1 protein_id gnl|my_center|LOCUS_03670 413994 413749 gene locus_tag LOCUS_03680 gene dinI 413994 413749 CDS product DNA damage-inducible protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217754.1 protein_id gnl|my_center|LOCUS_03680 415115 414069 gene locus_tag LOCUS_03690 gene pyrC 415115 414069 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097150.1 protein_id gnl|my_center|LOCUS_03690 416009 415449 gene locus_tag LOCUS_03700 416009 415449 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713057.1 protein_id gnl|my_center|LOCUS_03700 416781 416134 gene locus_tag LOCUS_03710 gene grxB 416781 416134 CDS product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780893.1 protein_id gnl|my_center|LOCUS_03710 418055 416847 gene locus_tag LOCUS_03720 gene mdtH 418055 416847 CDS product multidrug efflux MFS transporter MdtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097148.1 protein_id gnl|my_center|LOCUS_03720 418267 418851 gene locus_tag LOCUS_03730 gene rimJ 418267 418851 CDS product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468182.1 protein_id gnl|my_center|LOCUS_03730 418861 419502 gene locus_tag LOCUS_03740 418861 419502 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877137.1 protein_id gnl|my_center|LOCUS_03740 419504 420427 gene locus_tag LOCUS_03750 419504 420427 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097144.1 protein_id gnl|my_center|LOCUS_03750 420536 422071 gene locus_tag LOCUS_03760 gene murJ 420536 422071 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419099.1 protein_id gnl|my_center|LOCUS_03760 422530 422108 gene locus_tag LOCUS_03770 gene flgN 422530 422108 CDS product flagella biosynthesis chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197547.1 protein_id gnl|my_center|LOCUS_03770 422831 422535 gene locus_tag LOCUS_03780 gene flgM 422831 422535 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097141.1 protein_id gnl|my_center|LOCUS_03780 423584 422925 gene locus_tag LOCUS_03790 gene flgA 423584 422925 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194076.1 protein_id gnl|my_center|LOCUS_03790 423746 424162 gene locus_tag LOCUS_03800 gene flgB 423746 424162 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097139.1 protein_id gnl|my_center|LOCUS_03800 424166 424570 gene locus_tag LOCUS_03810 gene flgC 424166 424570 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097138.1 protein_id gnl|my_center|LOCUS_03810 424582 425259 gene locus_tag LOCUS_03820 gene flgD 424582 425259 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097137.1 protein_id gnl|my_center|LOCUS_03820 425285 426559 gene locus_tag LOCUS_03830 gene flgE 425285 426559 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885860.1 protein_id gnl|my_center|LOCUS_03830 426580 427335 gene locus_tag LOCUS_03840 426580 427335 CDS product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097135.1 protein_id gnl|my_center|LOCUS_03840 427351 428133 gene locus_tag LOCUS_03850 gene flgG 427351 428133 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625837.1 protein_id gnl|my_center|LOCUS_03850 428191 428889 gene locus_tag LOCUS_03860 gene flgH 428191 428889 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857987.1 protein_id gnl|my_center|LOCUS_03860 428902 429999 gene locus_tag LOCUS_03870 428902 429999 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518955.1 protein_id gnl|my_center|LOCUS_03870 429999 430976 gene locus_tag LOCUS_03880 gene flgJ 429999 430976 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578683.1 protein_id gnl|my_center|LOCUS_03880 431053 432699 gene locus_tag LOCUS_03890 gene flgK 431053 432699 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096470.1 protein_id gnl|my_center|LOCUS_03890 432713 433669 gene locus_tag LOCUS_03900 gene flgL 432713 433669 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212768.1 protein_id gnl|my_center|LOCUS_03900 434956 433742 gene locus_tag LOCUS_03910 434956 433742 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097130.1 protein_id gnl|my_center|LOCUS_03910 435056 435994 gene locus_tag LOCUS_03920 435056 435994 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165457189.1 protein_id gnl|my_center|LOCUS_03920 439255 436040 gene locus_tag LOCUS_03930 gene rne 439255 436040 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705034.1 protein_id gnl|my_center|LOCUS_03930 439853 440779 gene locus_tag LOCUS_03940 gene rluC 439853 440779 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705035.1 protein_id gnl|my_center|LOCUS_03940 441861 440824 gene locus_tag LOCUS_03950 441861 440824 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815394.1 protein_id gnl|my_center|LOCUS_03950 442636 442052 gene locus_tag LOCUS_03960 442636 442052 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028074.1 protein_id gnl|my_center|LOCUS_03960 442778 443299 gene locus_tag LOCUS_03970 gene yceD 442778 443299 CDS product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097124.1 protein_id gnl|my_center|LOCUS_03970 443349 443522 gene locus_tag LOCUS_03980 gene rpmF 443349 443522 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857964.1 protein_id gnl|my_center|LOCUS_03980 443548 444618 gene locus_tag LOCUS_03990 gene plsX 443548 444618 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197585.1 protein_id gnl|my_center|LOCUS_03990 444625 445578 gene locus_tag LOCUS_04000 gene fabH 444625 445578 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288138.1 protein_id gnl|my_center|LOCUS_04000 445596 446525 gene locus_tag LOCUS_04010 gene fabD 445596 446525 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191346.1 protein_id gnl|my_center|LOCUS_04010 446544 447278 gene locus_tag LOCUS_04020 gene fabG 446544 447278 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008535.1 protein_id gnl|my_center|LOCUS_04020 447457 447693 gene locus_tag LOCUS_04030 gene acpP 447457 447693 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103754.1 protein_id gnl|my_center|LOCUS_04030 447782 449023 gene locus_tag LOCUS_04040 gene fabF 447782 449023 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705037.1 protein_id gnl|my_center|LOCUS_04040 449147 449962 gene locus_tag LOCUS_04050 gene pabC 449147 449962 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705038.1 protein_id gnl|my_center|LOCUS_04050 449959 450981 gene locus_tag LOCUS_04060 gene yceG 449959 450981 CDS product cell division protein YceG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097117.1 protein_id gnl|my_center|LOCUS_04060 450971 451612 gene locus_tag LOCUS_04070 gene tmk 450971 451612 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535399.1 protein_id gnl|my_center|LOCUS_04070 451609 452610 gene locus_tag LOCUS_04080 gene holB 451609 452610 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097115.1 protein_id gnl|my_center|LOCUS_04080 452621 453415 gene locus_tag LOCUS_04090 452621 453415 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705042.1 protein_id gnl|my_center|LOCUS_04090 453713 455146 gene locus_tag LOCUS_04100 gene ptsG 453713 455146 CDS product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475719.1 protein_id gnl|my_center|LOCUS_04100 457579 455363 gene locus_tag LOCUS_04110 gene fhuE 457579 455363 CDS product ferric-rhodotorulic acid/ferric-coprogen receptor FhuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097112.1 protein_id gnl|my_center|LOCUS_04110 457880 458236 gene locus_tag LOCUS_04120 gene hinT 457880 458236 CDS product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532068.1 protein_id gnl|my_center|LOCUS_04120 458242 458616 gene locus_tag LOCUS_04130 458242 458616 CDS product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589560.1 protein_id gnl|my_center|LOCUS_04130 458629 459276 gene locus_tag LOCUS_04140 gene lpoB 458629 459276 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097109.1 protein_id gnl|my_center|LOCUS_04140 459257 460078 gene locus_tag LOCUS_04150 gene thiK 459257 460078 CDS product thiamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116570.1 protein_id gnl|my_center|LOCUS_04150 460090 461112 gene locus_tag LOCUS_04160 gene nagZ 460090 461112 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529284.1 protein_id gnl|my_center|LOCUS_04160 461152 461694 gene locus_tag LOCUS_04170 gene ycfP 461152 461694 CDS product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587943.1 protein_id gnl|my_center|LOCUS_04170 461929 463233 gene locus_tag LOCUS_04180 461929 463233 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097105.1 protein_id gnl|my_center|LOCUS_04180 463431 463970 gene locus_tag LOCUS_04190 463431 463970 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043449.1 protein_id gnl|my_center|LOCUS_04190 465107 464469 gene locus_tag LOCUS_04200 465107 464469 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097103.1 protein_id gnl|my_center|LOCUS_04200 465351 465608 gene locus_tag LOCUS_04210 gene bhsA 465351 465608 CDS product multiple stress resistance protein BhsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097102.1 protein_id gnl|my_center|LOCUS_04210 466648 465686 gene locus_tag LOCUS_04220 466648 465686 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097101.1 protein_id gnl|my_center|LOCUS_04220 470228 466782 gene locus_tag LOCUS_04230 gene mfd 470228 466782 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114340.1 protein_id gnl|my_center|LOCUS_04230 471409 470336 gene locus_tag LOCUS_04240 471409 470336 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097099.1 protein_id gnl|my_center|LOCUS_04240 471689 472888 gene locus_tag LOCUS_04250 gene lolC 471689 472888 CDS product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097098.1 protein_id gnl|my_center|LOCUS_04250 472881 473582 gene locus_tag LOCUS_04260 gene lolD 472881 473582 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033714.1 protein_id gnl|my_center|LOCUS_04260 473582 474826 gene locus_tag LOCUS_04270 gene lolE 473582 474826 CDS product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097096.1 protein_id gnl|my_center|LOCUS_04270 474843 475754 gene locus_tag LOCUS_04280 gene nagK 474843 475754 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291303.1 protein_id gnl|my_center|LOCUS_04280 475770 476591 gene locus_tag LOCUS_04290 gene cobB 475770 476591 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097094.1 protein_id gnl|my_center|LOCUS_04290 477112 476603 gene locus_tag LOCUS_04300 477112 476603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 478221 477355 gene locus_tag LOCUS_04310 478221 477355 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646942.1 protein_id gnl|my_center|LOCUS_04310 479399 478356 gene locus_tag LOCUS_04320 gene potD 479399 478356 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759329.1 protein_id gnl|my_center|LOCUS_04320 480187 479396 gene locus_tag LOCUS_04330 gene potC 480187 479396 CDS product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097091.1 protein_id gnl|my_center|LOCUS_04330 481041 480184 gene locus_tag LOCUS_04340 gene potB 481041 480184 CDS product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097090.1 protein_id gnl|my_center|LOCUS_04340 482143 481025 gene locus_tag LOCUS_04350 gene potA 482143 481025 CDS product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097089.1 protein_id gnl|my_center|LOCUS_04350 482437 483666 gene locus_tag LOCUS_04360 gene pepT 482437 483666 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097087.1 protein_id gnl|my_center|LOCUS_04360 484870 483749 gene locus_tag LOCUS_04370 484870 483749 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097085.1 protein_id gnl|my_center|LOCUS_04370 486437 484974 gene locus_tag LOCUS_04380 gene phoQ 486437 484974 CDS product two-component system sensor histidine kinase PhoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029881973.1 protein_id gnl|my_center|LOCUS_04380 487108 486434 gene locus_tag LOCUS_04390 gene phoP 487108 486434 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097083.1 protein_id gnl|my_center|LOCUS_04390 488592 487222 gene locus_tag LOCUS_04400 gene purB 488592 487222 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423737.1 protein_id gnl|my_center|LOCUS_04400 489240 488611 gene locus_tag LOCUS_04410 gene hflD 489240 488611 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097081.1 protein_id gnl|my_center|LOCUS_04410 490382 489276 gene locus_tag LOCUS_04420 gene mnmA 490382 489276 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004540.1 protein_id gnl|my_center|LOCUS_04420 490896 490438 gene locus_tag LOCUS_04430 490896 490438 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367142.1 protein_id gnl|my_center|LOCUS_04430 491452 490907 gene locus_tag LOCUS_04440 gene rluE 491452 490907 CDS product 23S rRNA pseudouridine(2457) synthase RluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097078.1 protein_id gnl|my_center|LOCUS_04440 491678 492928 gene locus_tag LOCUS_04450 gene icd 491678 492928 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097077.1 protein_id gnl|my_center|LOCUS_04450 493655 492978 gene locus_tag LOCUS_04460 493655 492978 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334583.1 protein_id gnl|my_center|LOCUS_04460 494524 493985 gene locus_tag LOCUS_04470 494524 493985 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383136.1 protein_id gnl|my_center|LOCUS_04470 494593 495213 gene locus_tag LOCUS_04480 494593 495213 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096586.1 protein_id gnl|my_center|LOCUS_04480 496814 495231 gene locus_tag LOCUS_04490 496814 495231 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196212.1 protein_id gnl|my_center|LOCUS_04490 498862 497048 gene locus_tag LOCUS_04500 498862 497048 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268903.1 protein_id gnl|my_center|LOCUS_04500 500251 499223 gene locus_tag LOCUS_04510 500251 499223 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097070.1 protein_id gnl|my_center|LOCUS_04510 501019 500519 gene locus_tag LOCUS_04520 501019 500519 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705161.1 protein_id gnl|my_center|LOCUS_04520 501183 501890 gene locus_tag LOCUS_04530 501183 501890 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097066.1 protein_id gnl|my_center|LOCUS_04530 503084 501894 gene locus_tag LOCUS_04540 503084 501894 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097065.1 protein_id gnl|my_center|LOCUS_04540 503396 504220 gene locus_tag LOCUS_04550 503396 504220 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182015315.1 protein_id gnl|my_center|LOCUS_04550 504222 505058 gene locus_tag LOCUS_04560 504222 505058 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704527.1 protein_id gnl|my_center|LOCUS_04560 505042 505815 gene locus_tag LOCUS_04570 505042 505815 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704526.1 protein_id gnl|my_center|LOCUS_04570 505805 506497 gene locus_tag LOCUS_04580 505805 506497 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704525.1 protein_id gnl|my_center|LOCUS_04580 506926 506480 gene locus_tag LOCUS_04590 506926 506480 CDS product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460698.1 protein_id gnl|my_center|LOCUS_04590 508504 507221 gene locus_tag LOCUS_04600 508504 507221 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097061.1 protein_id gnl|my_center|LOCUS_04600 510550 508616 gene locus_tag LOCUS_04610 gene yeaG 510550 508616 CDS product protein kinase YeaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019882.1 protein_id gnl|my_center|LOCUS_04610 510981 511727 gene locus_tag LOCUS_04620 510981 511727 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163762.1 protein_id gnl|my_center|LOCUS_04620 511806 512660 gene locus_tag LOCUS_04630 gene yeaE 511806 512660 CDS product methylglyoxal reductase YeaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186359.1 protein_id gnl|my_center|LOCUS_04630 513801 512917 gene locus_tag LOCUS_04640 513801 512917 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366147.1 protein_id gnl|my_center|LOCUS_04640 514890 513886 gene locus_tag LOCUS_04650 gene gapA 514890 513886 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203784.1 protein_id gnl|my_center|LOCUS_04650 515222 515635 gene locus_tag LOCUS_04660 gene msrB 515222 515635 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097052.1 protein_id gnl|my_center|LOCUS_04660 515678 515950 gene locus_tag LOCUS_04670 515678 515950 CDS product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366149.1 protein_id gnl|my_center|LOCUS_04670 516747 516106 gene locus_tag LOCUS_04680 gene pncA 516747 516106 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097049.1 protein_id gnl|my_center|LOCUS_04680 517774 516758 gene locus_tag LOCUS_04690 gene ansA 517774 516758 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170162.1 protein_id gnl|my_center|LOCUS_04690 519680 517824 gene locus_tag LOCUS_04700 gene sppA 519680 517824 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259835.1 protein_id gnl|my_center|LOCUS_04700 519844 520395 gene locus_tag LOCUS_04710 519844 520395 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097046.1 protein_id gnl|my_center|LOCUS_04710 520513 521556 gene locus_tag LOCUS_04720 gene selD 520513 521556 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097045.1 protein_id gnl|my_center|LOCUS_04720 521561 523489 gene locus_tag LOCUS_04730 gene topB 521561 523489 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235800.1 protein_id gnl|my_center|LOCUS_04730 524956 523613 gene locus_tag LOCUS_04740 gene gdhA 524956 523613 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097043.1 protein_id gnl|my_center|LOCUS_04740 525193 525477 gene locus_tag LOCUS_04750 525193 525477 CDS product YnjH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097042.1 protein_id gnl|my_center|LOCUS_04750 526287 525481 gene locus_tag LOCUS_04760 gene xthA 526287 525481 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673924.1 protein_id gnl|my_center|LOCUS_04760 526718 527938 gene locus_tag LOCUS_04770 526718 527938 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097032.1 protein_id gnl|my_center|LOCUS_04770 527935 528966 gene locus_tag LOCUS_04780 gene astA 527935 528966 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097031.1 protein_id gnl|my_center|LOCUS_04780 528966 530441 gene locus_tag LOCUS_04790 gene astD 528966 530441 CDS product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097030.1 protein_id gnl|my_center|LOCUS_04790 530441 531766 gene locus_tag LOCUS_04800 gene astB 530441 531766 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994955.1 protein_id gnl|my_center|LOCUS_04800 531776 532741 gene locus_tag LOCUS_04810 gene astE 531776 532741 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368452.1 protein_id gnl|my_center|LOCUS_04810 533087 533569 gene locus_tag LOCUS_04820 gene spy 533087 533569 CDS product ATP-independent periplasmic protein-refolding chaperone Spy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097027.1 protein_id gnl|my_center|LOCUS_04820 533675 533496 gene locus_tag LOCUS_04830 533675 533496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 533876 534433 gene locus_tag LOCUS_04840 gene ves 533876 534433 CDS product environmental stress-induced protein Ves inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097026.1 protein_id gnl|my_center|LOCUS_04840 535302 534427 gene locus_tag LOCUS_04850 gene cho 535302 534427 CDS product excinuclease Cho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705763.1 protein_id gnl|my_center|LOCUS_04850 536250 535423 gene locus_tag LOCUS_04860 gene nadE 536250 535423 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097024.1 protein_id gnl|my_center|LOCUS_04860 536504 536845 gene locus_tag LOCUS_04870 gene osmE 536504 536845 CDS product osmotically-inducible lipoprotein OsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039301.1 protein_id gnl|my_center|LOCUS_04870 537096 537413 gene locus_tag LOCUS_04880 gene chbB 537096 537413 CDS product PTS N,N'-diacetylchitobiose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366183.1 protein_id gnl|my_center|LOCUS_04880 537493 538851 gene locus_tag LOCUS_04890 gene chbC 537493 538851 CDS product PTS N,N'-diacetylchitobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097022.1 protein_id gnl|my_center|LOCUS_04890 538873 539223 gene locus_tag LOCUS_04900 gene chbA 538873 539223 CDS product PTS N,N'-diacetylchitobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968919.1 protein_id gnl|my_center|LOCUS_04900 539238 540077 gene locus_tag LOCUS_04910 gene chbR 539238 540077 CDS product transcriptional regulator ChbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366186.1 protein_id gnl|my_center|LOCUS_04910 540115 541461 gene locus_tag LOCUS_04920 540115 541461 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097019.1 protein_id gnl|my_center|LOCUS_04920 541473 542231 gene locus_tag LOCUS_04930 gene chbG 541473 542231 CDS product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705760.1 protein_id gnl|my_center|LOCUS_04930 544547 542289 gene locus_tag LOCUS_04940 gene katE 544547 542289 CDS product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077825.1 protein_id gnl|my_center|LOCUS_04940 544752 545000 gene locus_tag LOCUS_04950 gene cedA 544752 545000 CDS product cell division activator CedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366190.1 protein_id gnl|my_center|LOCUS_04950 546451 545060 gene locus_tag LOCUS_04960 gene tcyP 546451 545060 CDS product cystine/sulfocysteine:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097015.1 protein_id gnl|my_center|LOCUS_04960 547173 546583 gene locus_tag LOCUS_04970 547173 546583 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097014.1 protein_id gnl|my_center|LOCUS_04970 548032 547271 gene locus_tag LOCUS_04980 gene kduD 548032 547271 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 protein_id gnl|my_center|LOCUS_04980 548844 548176 gene locus_tag LOCUS_04990 gene hxpB 548844 548176 CDS product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097012.1 protein_id gnl|my_center|LOCUS_04990 548990 549526 gene locus_tag LOCUS_05000 548990 549526 CDS product YniB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097011.1 protein_id gnl|my_center|LOCUS_05000 550426 549566 gene locus_tag LOCUS_05010 550426 549566 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097010.1 protein_id gnl|my_center|LOCUS_05010 550822 550532 gene locus_tag LOCUS_05020 gene ghoS 550822 550532 CDS product type V toxin-antitoxin system endoribonuclease antitoxin GhoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146133.1 protein_id gnl|my_center|LOCUS_05020 551868 550936 gene locus_tag LOCUS_05030 gene pfkB 551868 550936 CDS product 6-phosphofructokinase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251728.1 protein_id gnl|my_center|LOCUS_05030 552160 552918 gene locus_tag LOCUS_05040 552160 552918 CDS product YdiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097007.1 protein_id gnl|my_center|LOCUS_05040 553188 553418 gene locus_tag LOCUS_05050 553188 553418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097006.1 protein_id gnl|my_center|LOCUS_05050 553784 553999 gene locus_tag LOCUS_05060 gene fumD 553784 553999 CDS product fumarate hydratase FumD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096944.1 protein_id gnl|my_center|LOCUS_05060 554257 556185 gene locus_tag LOCUS_05070 gene thrS 554257 556185 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097005.1 protein_id gnl|my_center|LOCUS_05070 556297 556731 gene locus_tag LOCUS_05080 gene infC 556297 556731 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058403.1 protein_id gnl|my_center|LOCUS_05080 556826 557023 gene locus_tag LOCUS_05090 gene rpmI 556826 557023 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124225.1 protein_id gnl|my_center|LOCUS_05090 557073 557429 gene locus_tag LOCUS_05100 gene rplT 557073 557429 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004102963.1 protein_id gnl|my_center|LOCUS_05100 557735 558718 gene locus_tag LOCUS_05110 gene pheS 557735 558718 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018588.1 protein_id gnl|my_center|LOCUS_05110 558733 561120 gene locus_tag LOCUS_05120 gene pheT 558733 561120 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672328.1 protein_id gnl|my_center|LOCUS_05120 561125 561424 gene locus_tag LOCUS_05130 gene ihfA 561125 561424 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229266.1 protein_id gnl|my_center|LOCUS_05130 561527 562507 gene locus_tag LOCUS_05140 gene btuC 561527 562507 CDS product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956528.1 protein_id gnl|my_center|LOCUS_05140 562544 563095 gene locus_tag LOCUS_05150 562544 563095 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096998.1 protein_id gnl|my_center|LOCUS_05150 563095 563844 gene locus_tag LOCUS_05160 gene btuD 563095 563844 CDS product vitamin B12 ABC transporter ATP-binding protein BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029466.1 protein_id gnl|my_center|LOCUS_05160 563915 564379 gene locus_tag LOCUS_05170 563915 564379 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213259.1 protein_id gnl|my_center|LOCUS_05170 564923 564729 gene locus_tag LOCUS_05180 564923 564729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 564831 565400 gene locus_tag LOCUS_05190 564831 565400 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096995.1 protein_id gnl|my_center|LOCUS_05190 565465 566907 gene locus_tag LOCUS_05200 gene selO 565465 566907 CDS product protein adenylyltransferase SelO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175592.1 protein_id gnl|my_center|LOCUS_05200 568059 567013 gene locus_tag LOCUS_05210 gene aroH 568059 567013 CDS product 3-deoxy-7-phosphoheptulonate synthase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419178.1 protein_id gnl|my_center|LOCUS_05210 569059 568226 gene locus_tag LOCUS_05220 gene ppsR 569059 568226 CDS product posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620693.1 protein_id gnl|my_center|LOCUS_05220 569388 571763 gene locus_tag LOCUS_05230 gene ppsA 569388 571763 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096979.1 protein_id gnl|my_center|LOCUS_05230 573188 572115 gene locus_tag LOCUS_05240 gene ydiK 573188 572115 CDS product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248612.1 protein_id gnl|my_center|LOCUS_05240 573435 576491 gene locus_tag LOCUS_05250 573435 576491 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419180.1 protein_id gnl|my_center|LOCUS_05250 576488 576898 gene locus_tag LOCUS_05260 gene menI 576488 576898 CDS product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637930.1 protein_id gnl|my_center|LOCUS_05260 577085 578002 gene locus_tag LOCUS_05270 gene lpxP 577085 578002 CDS product kdo(2)-lipid IV(A) palmitoleoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645259.1 protein_id gnl|my_center|LOCUS_05270 578349 578717 gene locus_tag LOCUS_05280 gene sufA 578349 578717 CDS product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367169.1 protein_id gnl|my_center|LOCUS_05280 578726 580210 gene locus_tag LOCUS_05290 gene sufB 578726 580210 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089364.1 protein_id gnl|my_center|LOCUS_05290 580228 580974 gene locus_tag LOCUS_05300 gene sufC 580228 580974 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096955.1 protein_id gnl|my_center|LOCUS_05300 580949 582220 gene locus_tag LOCUS_05310 gene sufD 580949 582220 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096954.1 protein_id gnl|my_center|LOCUS_05310 582217 583437 gene locus_tag LOCUS_05320 gene sufS 582217 583437 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096953.1 protein_id gnl|my_center|LOCUS_05320 583450 583866 gene locus_tag LOCUS_05330 gene sufE 583450 583866 CDS product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096952.1 protein_id gnl|my_center|LOCUS_05330 583964 584977 gene locus_tag LOCUS_05340 gene ldtE 583964 584977 CDS product L,D-transpeptidase LdtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817109.1 protein_id gnl|my_center|LOCUS_05340 585283 585047 gene locus_tag LOCUS_05350 585283 585047 CDS product major outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002908860.1 protein_id gnl|my_center|LOCUS_05350 587005 585593 gene locus_tag LOCUS_05360 gene pykF 587005 585593 CDS product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751448.1 protein_id gnl|my_center|LOCUS_05360 588584 587415 gene locus_tag LOCUS_05370 588584 587415 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403811.1 protein_id gnl|my_center|LOCUS_05370 589398 588607 gene locus_tag LOCUS_05380 gene hisN 589398 588607 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606663.1 protein_id gnl|my_center|LOCUS_05380 589746 589670 gene locus_tag LOCUS_t00030 589746 589670 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 589838 589762 gene locus_tag LOCUS_t00040 589838 589762 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 590897 590124 gene locus_tag LOCUS_05390 590897 590124 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706486.1 protein_id gnl|my_center|LOCUS_05390 591464 593122 gene locus_tag LOCUS_05400 591464 593122 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817182.1 protein_id gnl|my_center|LOCUS_05400 593188 594420 gene locus_tag LOCUS_05410 593188 594420 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097093.1 protein_id gnl|my_center|LOCUS_05410 594656 594958 gene locus_tag LOCUS_05420 594656 594958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 595002 595235 gene locus_tag LOCUS_05430 595002 595235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 596727 595354 gene locus_tag LOCUS_05440 596727 595354 CDS product multidrug efflux MATE transporter MdtK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175077.1 protein_id gnl|my_center|LOCUS_05440 596955 597587 gene locus_tag LOCUS_05450 596955 597587 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096933.1 protein_id gnl|my_center|LOCUS_05450 598770 597622 gene locus_tag LOCUS_05460 gene cfa 598770 597622 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098879.1 protein_id gnl|my_center|LOCUS_05460 600253 599072 gene locus_tag LOCUS_05470 gene punC 600253 599072 CDS product purine nucleoside transporter PunC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096931.1 protein_id gnl|my_center|LOCUS_05470 600363 601274 gene locus_tag LOCUS_05480 gene punR 600363 601274 CDS product DNA-binding transcriptional activator PunR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269501.1 protein_id gnl|my_center|LOCUS_05480 602345 601320 gene locus_tag LOCUS_05490 gene purR 602345 601320 CDS product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096929.1 protein_id gnl|my_center|LOCUS_05490 602898 604070 gene locus_tag LOCUS_05500 602898 604070 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096927.1 protein_id gnl|my_center|LOCUS_05500 604948 604109 gene locus_tag LOCUS_05510 604948 604109 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096925.1 protein_id gnl|my_center|LOCUS_05510 605289 605627 gene locus_tag LOCUS_05520 605289 605627 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366878.1 protein_id gnl|my_center|LOCUS_05520 606236 605697 gene locus_tag LOCUS_05530 606236 605697 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808672.1 protein_id gnl|my_center|LOCUS_05530 607039 606296 gene locus_tag LOCUS_05540 607039 606296 CDS product YciC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096283.1 protein_id gnl|my_center|LOCUS_05540 607369 608004 gene locus_tag LOCUS_05550 gene ompW 607369 608004 CDS product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096285.1 protein_id gnl|my_center|LOCUS_05550 608865 608056 gene locus_tag LOCUS_05560 gene trpA 608865 608056 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443081.1 protein_id gnl|my_center|LOCUS_05560 610058 608865 gene locus_tag LOCUS_05570 gene trpB 610058 608865 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096356.1 protein_id gnl|my_center|LOCUS_05570 611434 610070 gene locus_tag LOCUS_05580 gene trpCF 611434 610070 CDS product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096357.1 protein_id gnl|my_center|LOCUS_05580 613030 611435 gene locus_tag LOCUS_05590 gene trpD 613030 611435 CDS product bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763524.1 protein_id gnl|my_center|LOCUS_05590 614592 613030 gene locus_tag LOCUS_05600 614592 613030 CDS product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883574.1 protein_id gnl|my_center|LOCUS_05600 614873 615754 gene locus_tag LOCUS_05610 gene rnm 614873 615754 CDS product RNase AM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096361.1 protein_id gnl|my_center|LOCUS_05610 615751 616371 gene locus_tag LOCUS_05620 615751 616371 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096362.1 protein_id gnl|my_center|LOCUS_05620 616603 617499 gene locus_tag LOCUS_05630 gene rluB 616603 617499 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291216.1 protein_id gnl|my_center|LOCUS_05630 618165 617575 gene locus_tag LOCUS_05640 gene cobO 618165 617575 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278906.1 protein_id gnl|my_center|LOCUS_05640 618920 618162 gene locus_tag LOCUS_05650 618920 618162 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366220.1 protein_id gnl|my_center|LOCUS_05650 619142 620224 gene locus_tag LOCUS_05660 gene sohB 619142 620224 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096366.1 protein_id gnl|my_center|LOCUS_05660 620515 620264 gene locus_tag LOCUS_05670 620515 620264 CDS product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548616.1 protein_id gnl|my_center|LOCUS_05670 620912 623509 gene locus_tag LOCUS_05680 gene topA 620912 623509 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513593.1 protein_id gnl|my_center|LOCUS_05680 623692 624666 gene locus_tag LOCUS_05690 gene cysB 623692 624666 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006175683.1 protein_id gnl|my_center|LOCUS_05690 625716 628391 gene locus_tag LOCUS_05700 gene acnA 625716 628391 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099530.1 protein_id gnl|my_center|LOCUS_05700 629021 628434 gene locus_tag LOCUS_05710 gene ribA 629021 628434 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096372.1 protein_id gnl|my_center|LOCUS_05710 629217 629990 gene locus_tag LOCUS_05720 gene pgpB 629217 629990 CDS product phosphatidylglycerophosphatase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948651.1 protein_id gnl|my_center|LOCUS_05720 630158 630466 gene locus_tag LOCUS_05730 630158 630466 CDS product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096374.1 protein_id gnl|my_center|LOCUS_05730 630473 631642 gene locus_tag LOCUS_05740 gene lapB 630473 631642 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096375.1 protein_id gnl|my_center|LOCUS_05740 631828 632565 gene locus_tag LOCUS_05750 gene pyrF 631828 632565 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705735.1 protein_id gnl|my_center|LOCUS_05750 632565 632891 gene locus_tag LOCUS_05760 gene yciH 632565 632891 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295580.1 protein_id gnl|my_center|LOCUS_05760 633229 633008 gene locus_tag LOCUS_05770 gene osmB 633229 633008 CDS product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498253.1 protein_id gnl|my_center|LOCUS_05770 634246 633488 gene locus_tag LOCUS_05780 634246 633488 CDS product DNA-binding transcriptional regulator YciT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096378.1 protein_id gnl|my_center|LOCUS_05780 634645 634463 gene locus_tag LOCUS_05790 gene yciZ 634645 634463 CDS product protein YciZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069350.1 protein_id gnl|my_center|LOCUS_05790 636713 634722 gene locus_tag LOCUS_05800 gene pdeR 636713 634722 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096381.1 protein_id gnl|my_center|LOCUS_05800 638931 636997 gene locus_tag LOCUS_05810 638931 636997 CDS product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000485046.1 protein_id gnl|my_center|LOCUS_05810 640167 639013 gene locus_tag LOCUS_05820 640167 639013 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705732.1 protein_id gnl|my_center|LOCUS_05820 641125 640337 gene locus_tag LOCUS_05830 gene fabI 641125 640337 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506501.1 protein_id gnl|my_center|LOCUS_05830 642126 641320 gene locus_tag LOCUS_05840 gene sapF 642126 641320 CDS product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573407.1 protein_id gnl|my_center|LOCUS_05840 643120 642128 gene locus_tag LOCUS_05850 gene sapD 643120 642128 CDS product peptide ABC transporter ATP-binding protein SapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096394.1 protein_id gnl|my_center|LOCUS_05850 644010 643120 gene locus_tag LOCUS_05860 gene sapC 644010 643120 CDS product peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096395.1 protein_id gnl|my_center|LOCUS_05860 644962 643997 gene locus_tag LOCUS_05870 gene sapB 644962 643997 CDS product peptide ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583298.1 protein_id gnl|my_center|LOCUS_05870 646572 644959 gene locus_tag LOCUS_05880 gene sapA 646572 644959 CDS product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096397.1 protein_id gnl|my_center|LOCUS_05880 648081 646690 gene locus_tag LOCUS_05890 648081 646690 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096576.1 protein_id gnl|my_center|LOCUS_05890 648217 649140 gene locus_tag LOCUS_05900 648217 649140 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096577.1 protein_id gnl|my_center|LOCUS_05900 649178 649522 gene locus_tag LOCUS_05910 gene yajD 649178 649522 CDS product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006808895.1 protein_id gnl|my_center|LOCUS_05910 650513 649524 gene locus_tag LOCUS_05920 gene pspF 650513 649524 CDS product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273326.1 protein_id gnl|my_center|LOCUS_05920 650666 651334 gene locus_tag LOCUS_05930 gene pspA 650666 651334 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511000.1 protein_id gnl|my_center|LOCUS_05930 651392 651616 gene locus_tag LOCUS_05940 gene pspB 651392 651616 CDS product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274953.1 protein_id gnl|my_center|LOCUS_05940 651616 651975 gene locus_tag LOCUS_05950 gene pspC 651616 651975 CDS product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096405.1 protein_id gnl|my_center|LOCUS_05950 652002 652229 gene locus_tag LOCUS_05960 gene pspD 652002 652229 CDS product phage shock protein PspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097607.1 protein_id gnl|my_center|LOCUS_05960 652426 654111 gene locus_tag LOCUS_05970 652426 654111 CDS product sugar phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096407.1 protein_id gnl|my_center|LOCUS_05970 654126 655418 gene locus_tag LOCUS_05980 654126 655418 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597458.1 protein_id gnl|my_center|LOCUS_05980 655437 656318 gene locus_tag LOCUS_05990 655437 656318 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096409.1 protein_id gnl|my_center|LOCUS_05990 656305 657150 gene locus_tag LOCUS_06000 656305 657150 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096410.1 protein_id gnl|my_center|LOCUS_06000 657182 658231 gene locus_tag LOCUS_06010 657182 658231 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096411.1 protein_id gnl|my_center|LOCUS_06010 658237 659040 gene locus_tag LOCUS_06020 658237 659040 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690229.1 protein_id gnl|my_center|LOCUS_06020 659055 660098 gene locus_tag LOCUS_06030 659055 660098 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833563.1 protein_id gnl|my_center|LOCUS_06030 660092 662347 gene locus_tag LOCUS_06040 660092 662347 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096414.1 protein_id gnl|my_center|LOCUS_06040 662344 663018 gene locus_tag LOCUS_06050 gene pgmB 662344 663018 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775779.1 protein_id gnl|my_center|LOCUS_06050 663034 664113 gene locus_tag LOCUS_06060 663034 664113 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057977.1 protein_id gnl|my_center|LOCUS_06060 664183 665085 gene locus_tag LOCUS_06070 gene ompG 664183 665085 CDS product monomeric porin OmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735246.1 protein_id gnl|my_center|LOCUS_06070 666125 665127 gene locus_tag LOCUS_06080 666125 665127 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075386.1 protein_id gnl|my_center|LOCUS_06080 666303 667700 gene locus_tag LOCUS_06090 666303 667700 CDS product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825858.1 protein_id gnl|my_center|LOCUS_06090 667697 668752 gene locus_tag LOCUS_06100 667697 668752 CDS product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138728.1 protein_id gnl|my_center|LOCUS_06100 668909 670450 gene locus_tag LOCUS_06110 gene tyrR 668909 670450 CDS product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235493.1 protein_id gnl|my_center|LOCUS_06110 671022 670516 gene locus_tag LOCUS_06120 gene tpx 671022 670516 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096423.1 protein_id gnl|my_center|LOCUS_06120 671140 672105 gene locus_tag LOCUS_06130 gene ycjG 671140 672105 CDS product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602338.1 protein_id gnl|my_center|LOCUS_06130 672809 672096 gene locus_tag LOCUS_06140 gene mpaA 672809 672096 CDS product murein tripeptide amidase MpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296042.1 protein_id gnl|my_center|LOCUS_06140 672971 674587 gene locus_tag LOCUS_06150 672971 674587 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096426.1 protein_id gnl|my_center|LOCUS_06150 674986 676152 gene locus_tag LOCUS_06160 674986 676152 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062729484.1 protein_id gnl|my_center|LOCUS_06160 676788 677771 gene locus_tag LOCUS_06170 gene zntB 676788 677771 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387372.1 protein_id gnl|my_center|LOCUS_06170 678048 678197 gene locus_tag LOCUS_06180 678048 678197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 678261 679634 gene locus_tag LOCUS_06190 gene dbpA 678261 679634 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096453.1 protein_id gnl|my_center|LOCUS_06190 680612 679677 gene locus_tag LOCUS_06200 gene ttcA 680612 679677 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081419.1 protein_id gnl|my_center|LOCUS_06200 681900 680662 gene locus_tag LOCUS_06210 681900 680662 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040852.1 protein_id gnl|my_center|LOCUS_06210 682114 681902 gene locus_tag LOCUS_06220 gene xisR 682114 681902 CDS product excisionase XisR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079604.1 protein_id gnl|my_center|LOCUS_06220 682421 682179 gene locus_tag LOCUS_06230 682421 682179 CDS product DUF4060 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096292.1 protein_id gnl|my_center|LOCUS_06230 682597 682418 gene locus_tag LOCUS_06240 682597 682418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 683679 682630 gene locus_tag LOCUS_06250 683679 682630 CDS product recombinase RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001539618.1 protein_id gnl|my_center|LOCUS_06250 686900 683694 gene locus_tag LOCUS_06260 686900 683694 CDS product PD-(D/E)XK nuclease-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705727.1 protein_id gnl|my_center|LOCUS_06260 687489 687211 gene locus_tag LOCUS_06270 687489 687211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 687403 687582 gene locus_tag LOCUS_06280 687403 687582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 689848 688241 gene locus_tag LOCUS_06290 689848 688241 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009229.1 protein_id gnl|my_center|LOCUS_06290 690432 690040 gene locus_tag LOCUS_06300 690432 690040 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170276.1 protein_id gnl|my_center|LOCUS_06300 690535 690753 gene locus_tag LOCUS_06310 690535 690753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 690765 691316 gene locus_tag LOCUS_06320 690765 691316 CDS product toxin YdaT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182881.1 protein_id gnl|my_center|LOCUS_06320 691497 692402 gene locus_tag LOCUS_06330 691497 692402 CDS product replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705905.1 protein_id gnl|my_center|LOCUS_06330 692399 693088 gene locus_tag LOCUS_06340 692399 693088 CDS product replication protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070133977.1 protein_id gnl|my_center|LOCUS_06340 693085 693456 gene locus_tag LOCUS_06350 693085 693456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 693453 693818 gene locus_tag LOCUS_06360 693453 693818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 693815 694288 gene locus_tag LOCUS_06370 693815 694288 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445792.1 protein_id gnl|my_center|LOCUS_06370 694616 695098 gene locus_tag LOCUS_06380 694616 695098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 695373 695783 gene locus_tag LOCUS_06390 695373 695783 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096735.1 protein_id gnl|my_center|LOCUS_06390 696049 696306 gene locus_tag LOCUS_06400 696049 696306 CDS product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168435353.1 protein_id gnl|my_center|LOCUS_06400 696558 696887 gene locus_tag LOCUS_06410 696558 696887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 697218 697457 gene locus_tag LOCUS_06420 697218 697457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 697492 698088 gene locus_tag LOCUS_06430 697492 698088 CDS product DUF1367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929790.1 protein_id gnl|my_center|LOCUS_06430 698093 698293 gene locus_tag LOCUS_06440 698093 698293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 698296 698715 gene locus_tag LOCUS_06450 698296 698715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 698700 698993 gene locus_tag LOCUS_06460 698700 698993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 698990 699352 gene locus_tag LOCUS_06470 698990 699352 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096306.1 protein_id gnl|my_center|LOCUS_06470 699355 699930 gene locus_tag LOCUS_06480 699355 699930 CDS product DUF1133 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640149.1 protein_id gnl|my_center|LOCUS_06480 700402 700013 gene locus_tag LOCUS_06490 700402 700013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 700690 700511 gene locus_tag LOCUS_06500 700690 700511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 701400 701476 gene locus_tag LOCUS_t00050 701400 701476 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 701600 701788 gene locus_tag LOCUS_06510 701600 701788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 702348 702587 gene locus_tag LOCUS_06520 702348 702587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 702580 703092 gene locus_tag LOCUS_06530 702580 703092 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816484.1 protein_id gnl|my_center|LOCUS_06530 703082 703543 gene locus_tag LOCUS_06540 703082 703543 CDS product lysis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001390466.1 protein_id gnl|my_center|LOCUS_06540 703531 703755 gene locus_tag LOCUS_06550 703531 703755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 704147 703827 gene locus_tag LOCUS_06560 704147 703827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 704833 704970 gene locus_tag LOCUS_06570 704833 704970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 705359 705090 gene locus_tag LOCUS_06580 705359 705090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 706387 706614 gene locus_tag LOCUS_06590 706387 706614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010434226.1 protein_id gnl|my_center|LOCUS_06590 706748 707383 gene locus_tag LOCUS_06600 706748 707383 CDS product putative metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095975.1 protein_id gnl|my_center|LOCUS_06600 707415 707894 gene locus_tag LOCUS_06610 707415 707894 CDS product DUF2280 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211724.1 protein_id gnl|my_center|LOCUS_06610 707881 709365 gene locus_tag LOCUS_06620 707881 709365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 709386 710735 gene locus_tag LOCUS_06630 709386 710735 CDS product DUF1073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095979.1 protein_id gnl|my_center|LOCUS_06630 710689 711648 gene locus_tag LOCUS_06640 710689 711648 CDS product phage minor head protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095980.1 protein_id gnl|my_center|LOCUS_06640 711664 712929 gene locus_tag LOCUS_06650 711664 712929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095981.1 protein_id gnl|my_center|LOCUS_06650 712972 713427 gene locus_tag LOCUS_06660 712972 713427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095982.1 protein_id gnl|my_center|LOCUS_06660 713445 714548 gene locus_tag LOCUS_06670 713445 714548 CDS product DUF6260 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095983.1 protein_id gnl|my_center|LOCUS_06670 714558 714860 gene locus_tag LOCUS_06680 714558 714860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095984.1 protein_id gnl|my_center|LOCUS_06680 714927 715331 gene locus_tag LOCUS_06690 714927 715331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097717.1 protein_id gnl|my_center|LOCUS_06690 715307 715504 gene locus_tag LOCUS_06700 715307 715504 CDS product DUF551 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126356113.1 protein_id gnl|my_center|LOCUS_06700 715501 715887 gene locus_tag LOCUS_06710 715501 715887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705872.1 protein_id gnl|my_center|LOCUS_06710 715905 716300 gene locus_tag LOCUS_06720 715905 716300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705871.1 protein_id gnl|my_center|LOCUS_06720 716297 716683 gene locus_tag LOCUS_06730 716297 716683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 716697 717431 gene locus_tag LOCUS_06740 716697 717431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 717462 718103 gene locus_tag LOCUS_06750 717462 718103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 718207 718506 gene locus_tag LOCUS_06760 718207 718506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 718762 718962 gene locus_tag LOCUS_06770 718762 718962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 719024 722233 gene locus_tag LOCUS_06780 719024 722233 CDS product tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097710.1 protein_id gnl|my_center|LOCUS_06780 722490 722260 gene locus_tag LOCUS_06790 722490 722260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 722547 722894 gene locus_tag LOCUS_06800 722547 722894 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440566.1 protein_id gnl|my_center|LOCUS_06800 723478 723257 gene locus_tag LOCUS_06810 723478 723257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 723645 724349 gene locus_tag LOCUS_06820 723645 724349 CDS product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816463.1 protein_id gnl|my_center|LOCUS_06820 724349 725068 gene locus_tag LOCUS_06830 724349 725068 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140761.1 protein_id gnl|my_center|LOCUS_06830 725065 725538 gene locus_tag LOCUS_06840 725065 725538 CDS product tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246289.1 protein_id gnl|my_center|LOCUS_06840 725548 729270 gene locus_tag LOCUS_06850 725548 729270 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515491.1 protein_id gnl|my_center|LOCUS_06850 729270 729581 gene locus_tag LOCUS_06860 729270 729581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 729581 730249 gene locus_tag LOCUS_06870 729581 730249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 730311 731207 gene locus_tag LOCUS_06880 730311 731207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 731218 731457 gene locus_tag LOCUS_06890 731218 731457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 731848 731705 gene locus_tag LOCUS_06900 731848 731705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 733349 733071 gene locus_tag LOCUS_06910 733349 733071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 733578 733958 gene locus_tag LOCUS_06920 733578 733958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 734596 734192 gene locus_tag LOCUS_06930 734596 734192 CDS product cell envelope integrity TolA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001453090.1 protein_id gnl|my_center|LOCUS_06930 734821 735045 gene locus_tag LOCUS_06940 734821 735045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 736283 735540 gene locus_tag LOCUS_06950 736283 735540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 736757 737122 gene locus_tag LOCUS_06960 736757 737122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 738357 737581 gene locus_tag LOCUS_06970 738357 737581 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104931.1 protein_id gnl|my_center|LOCUS_06970 738533 739447 gene locus_tag LOCUS_06980 gene gcvA 738533 739447 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062802403.1 protein_id gnl|my_center|LOCUS_06980 739692 739925 gene locus_tag LOCUS_06990 739692 739925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 740163 740582 gene locus_tag LOCUS_07000 740163 740582 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394197.1 protein_id gnl|my_center|LOCUS_07000 740585 741856 gene locus_tag LOCUS_07010 740585 741856 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705848.1 protein_id gnl|my_center|LOCUS_07010 741921 742373 gene locus_tag LOCUS_07020 741921 742373 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383469.1 protein_id gnl|my_center|LOCUS_07020 742363 743253 gene locus_tag LOCUS_07030 742363 743253 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383468.1 protein_id gnl|my_center|LOCUS_07030 743717 744211 gene locus_tag LOCUS_07040 743717 744211 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365842.1 protein_id gnl|my_center|LOCUS_07040 744230 746158 gene locus_tag LOCUS_07050 744230 746158 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706014.1 protein_id gnl|my_center|LOCUS_07050 746820 746239 gene locus_tag LOCUS_07060 746820 746239 CDS product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039271.1 protein_id gnl|my_center|LOCUS_07060 748049 747018 gene locus_tag LOCUS_07070 748049 747018 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704695.1 protein_id gnl|my_center|LOCUS_07070 749060 748077 gene locus_tag LOCUS_07080 749060 748077 CDS product DUF1852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704696.1 protein_id gnl|my_center|LOCUS_07080 750213 749302 gene locus_tag LOCUS_07090 750213 749302 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107014379.1 protein_id gnl|my_center|LOCUS_07090 750339 751223 gene locus_tag LOCUS_07100 750339 751223 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530571.1 protein_id gnl|my_center|LOCUS_07100 751452 751240 gene locus_tag LOCUS_07110 751452 751240 CDS product KTSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161573.1 protein_id gnl|my_center|LOCUS_07110 755136 751612 gene locus_tag LOCUS_07120 gene nifJ 755136 751612 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096463.1 protein_id gnl|my_center|LOCUS_07120 756513 755485 gene locus_tag LOCUS_07130 756513 755485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 757709 756525 gene locus_tag LOCUS_07140 757709 756525 CDS product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 protein_id gnl|my_center|LOCUS_07140 759075 759725 gene locus_tag LOCUS_07150 gene zinT 759075 759725 CDS product metal-binding protein ZinT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234684.1 protein_id gnl|my_center|LOCUS_07150 760593 760171 gene locus_tag LOCUS_07160 gene hslJ 760593 760171 CDS product heat shock protein HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309480.1 protein_id gnl|my_center|LOCUS_07160 761669 760680 gene locus_tag LOCUS_07170 761669 760680 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096773.1 protein_id gnl|my_center|LOCUS_07170 761879 764518 gene locus_tag LOCUS_07180 761879 764518 CDS product YdbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900912.1 protein_id gnl|my_center|LOCUS_07180 764515 764697 gene locus_tag LOCUS_07190 764515 764697 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020688201.1 protein_id gnl|my_center|LOCUS_07190 764851 765717 gene locus_tag LOCUS_07200 gene pdxI 764851 765717 CDS product pyridoxine 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097801.1 protein_id gnl|my_center|LOCUS_07200 766372 765767 gene locus_tag LOCUS_07210 gene azoR 766372 765767 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096706.1 protein_id gnl|my_center|LOCUS_07210 766575 770477 gene locus_tag LOCUS_07220 gene hrpA 766575 770477 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420907.1 protein_id gnl|my_center|LOCUS_07220 772041 770662 gene locus_tag LOCUS_07230 772041 770662 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705601.1 protein_id gnl|my_center|LOCUS_07230 773120 772038 gene locus_tag LOCUS_07240 773120 772038 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096702.1 protein_id gnl|my_center|LOCUS_07240 774822 773167 gene locus_tag LOCUS_07250 774822 773167 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096701.1 protein_id gnl|my_center|LOCUS_07250 775123 775926 gene locus_tag LOCUS_07260 775123 775926 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098505.1 protein_id gnl|my_center|LOCUS_07260 776126 777565 gene locus_tag LOCUS_07270 gene aldA 776126 777565 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115947.1 protein_id gnl|my_center|LOCUS_07270 778579 777653 gene locus_tag LOCUS_07280 778579 777653 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103676442.1 protein_id gnl|my_center|LOCUS_07280 778680 779210 gene locus_tag LOCUS_07290 gene cybB 778680 779210 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096695.1 protein_id gnl|my_center|LOCUS_07290 779406 780731 gene locus_tag LOCUS_07300 gene proP 779406 780731 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028291.1 protein_id gnl|my_center|LOCUS_07300 780918 781214 gene locus_tag LOCUS_07310 780918 781214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434330.1 protein_id gnl|my_center|LOCUS_07310 781354 781887 gene locus_tag LOCUS_07320 781354 781887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963497.1 protein_id gnl|my_center|LOCUS_07320 783108 782032 gene locus_tag LOCUS_07330 783108 782032 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036137.1 protein_id gnl|my_center|LOCUS_07330 783606 783226 gene locus_tag LOCUS_07340 783606 783226 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315823.1 protein_id gnl|my_center|LOCUS_07340 783706 784437 gene locus_tag LOCUS_07350 783706 784437 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315822.1 protein_id gnl|my_center|LOCUS_07350 784687 785160 gene locus_tag LOCUS_07360 784687 785160 CDS product DUF4126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275228.1 protein_id gnl|my_center|LOCUS_07360 785250 785525 gene locus_tag LOCUS_07370 785250 785525 CDS product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096678.1 protein_id gnl|my_center|LOCUS_07370 785557 786675 gene locus_tag LOCUS_07380 785557 786675 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366371.1 protein_id gnl|my_center|LOCUS_07380 787071 788522 gene locus_tag LOCUS_07390 787071 788522 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419375.1 protein_id gnl|my_center|LOCUS_07390 791057 788688 gene locus_tag LOCUS_07400 791057 788688 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096675.1 protein_id gnl|my_center|LOCUS_07400 793816 791516 gene locus_tag LOCUS_07410 793816 791516 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816272.1 protein_id gnl|my_center|LOCUS_07410 794866 793943 gene locus_tag LOCUS_07420 794866 793943 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096674.1 protein_id gnl|my_center|LOCUS_07420 795170 796513 gene locus_tag LOCUS_07430 795170 796513 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096660.1 protein_id gnl|my_center|LOCUS_07430 796550 798055 gene locus_tag LOCUS_07440 796550 798055 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366380.1 protein_id gnl|my_center|LOCUS_07440 798893 798042 gene locus_tag LOCUS_07450 798893 798042 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446327.1 protein_id gnl|my_center|LOCUS_07450 799006 800175 gene locus_tag LOCUS_07460 799006 800175 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096656.1 protein_id gnl|my_center|LOCUS_07460 800188 800967 gene locus_tag LOCUS_07470 800188 800967 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096655.1 protein_id gnl|my_center|LOCUS_07470 801198 802853 gene locus_tag LOCUS_07480 801198 802853 CDS product glucan biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096654.1 protein_id gnl|my_center|LOCUS_07480 802965 803507 gene locus_tag LOCUS_07490 gene rimL 802965 803507 CDS product 50S ribosomal protein L7/L12-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366387.1 protein_id gnl|my_center|LOCUS_07490 804479 803499 gene locus_tag LOCUS_07500 gene ydcK 804479 803499 CDS product YdcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096652.1 protein_id gnl|my_center|LOCUS_07500 804592 805596 gene locus_tag LOCUS_07510 gene tehA 804592 805596 CDS product dicarboxylate transporter/tellurite-resistance protein TehA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096651.1 protein_id gnl|my_center|LOCUS_07510 805593 806189 gene locus_tag LOCUS_07520 gene tehB 805593 806189 CDS product tellurite resistance methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218282.1 protein_id gnl|my_center|LOCUS_07520 807415 806186 gene locus_tag LOCUS_07530 gene pepT 807415 806186 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096649.1 protein_id gnl|my_center|LOCUS_07530 807530 809125 gene locus_tag LOCUS_07540 807530 809125 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419397.1 protein_id gnl|my_center|LOCUS_07540 809259 809927 gene locus_tag LOCUS_07550 809259 809927 CDS product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096647.1 protein_id gnl|my_center|LOCUS_07550 810854 809928 gene locus_tag LOCUS_07560 810854 809928 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705569.1 protein_id gnl|my_center|LOCUS_07560 811038 811910 gene locus_tag LOCUS_07570 811038 811910 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096645.1 protein_id gnl|my_center|LOCUS_07570 813056 811890 gene locus_tag LOCUS_07580 813056 811890 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096644.1 protein_id gnl|my_center|LOCUS_07580 813148 813684 gene locus_tag LOCUS_07590 813148 813684 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705566.1 protein_id gnl|my_center|LOCUS_07590 813758 815722 gene locus_tag LOCUS_07600 gene rlhA 813758 815722 CDS product 23S rRNA 5-hydroxycytidine C2501 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313806.1 protein_id gnl|my_center|LOCUS_07600 815942 815814 gene locus_tag LOCUS_07610 815942 815814 CDS product DUF2474 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096467.1 protein_id gnl|my_center|LOCUS_07610 816952 815942 gene locus_tag LOCUS_07620 gene cydB 816952 815942 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096468.1 protein_id gnl|my_center|LOCUS_07620 818337 816952 gene locus_tag LOCUS_07630 818337 816952 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096469.1 protein_id gnl|my_center|LOCUS_07630 818599 818931 gene locus_tag LOCUS_07640 818599 818931 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513548.1 protein_id gnl|my_center|LOCUS_07640 818933 819217 gene locus_tag LOCUS_07650 gene nadS 818933 819217 CDS product NadS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007436.1 protein_id gnl|my_center|LOCUS_07650 819298 820707 gene locus_tag LOCUS_07660 819298 820707 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096471.1 protein_id gnl|my_center|LOCUS_07660 820860 822005 gene locus_tag LOCUS_07670 820860 822005 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047447.1 protein_id gnl|my_center|LOCUS_07670 822009 823022 gene locus_tag LOCUS_07680 822009 823022 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220396.1 protein_id gnl|my_center|LOCUS_07680 823024 823965 gene locus_tag LOCUS_07690 823024 823965 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251315.1 protein_id gnl|my_center|LOCUS_07690 823955 824749 gene locus_tag LOCUS_07700 823955 824749 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555471.1 protein_id gnl|my_center|LOCUS_07700 824772 826196 gene locus_tag LOCUS_07710 gene patD 824772 826196 CDS product aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096477.1 protein_id gnl|my_center|LOCUS_07710 826482 826655 gene locus_tag LOCUS_07720 826482 826655 CDS product GhoT/OrtT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096478.1 protein_id gnl|my_center|LOCUS_07720 827326 826652 gene locus_tag LOCUS_07730 827326 826652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 827420 827593 gene locus_tag LOCUS_07740 827420 827593 CDS product GhoT/OrtT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096478.1 protein_id gnl|my_center|LOCUS_07740 827694 828926 gene locus_tag LOCUS_07750 827694 828926 CDS product putative acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091577.1 protein_id gnl|my_center|LOCUS_07750 831194 829020 gene locus_tag LOCUS_07760 831194 829020 CDS product virulence factor SrfC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419532.1 protein_id gnl|my_center|LOCUS_07760 834169 831191 gene locus_tag LOCUS_07770 834169 831191 CDS product virulence factor SrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096481.1 protein_id gnl|my_center|LOCUS_07770 835549 834173 gene locus_tag LOCUS_07780 835549 834173 CDS product SrfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096482.1 protein_id gnl|my_center|LOCUS_07780 835830 837428 gene locus_tag LOCUS_07790 835830 837428 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705554.1 protein_id gnl|my_center|LOCUS_07790 837438 837671 gene locus_tag LOCUS_07800 837438 837671 CDS product YdcY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096483.1 protein_id gnl|my_center|LOCUS_07800 838122 837673 gene locus_tag LOCUS_07810 838122 837673 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096484.1 protein_id gnl|my_center|LOCUS_07810 838637 838119 gene locus_tag LOCUS_07820 838637 838119 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096485.1 protein_id gnl|my_center|LOCUS_07820 838874 838701 gene locus_tag LOCUS_07830 838874 838701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 838792 839250 gene locus_tag LOCUS_07840 838792 839250 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096486.1 protein_id gnl|my_center|LOCUS_07840 839315 840352 gene locus_tag LOCUS_07850 839315 840352 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096487.1 protein_id gnl|my_center|LOCUS_07850 840606 841265 gene locus_tag LOCUS_07860 840606 841265 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096488.1 protein_id gnl|my_center|LOCUS_07860 841460 843100 gene locus_tag LOCUS_07870 841460 843100 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817438.1 protein_id gnl|my_center|LOCUS_07870 845244 843226 gene locus_tag LOCUS_07880 gene pqqU 845244 843226 CDS product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096489.1 protein_id gnl|my_center|LOCUS_07880 845604 846665 gene locus_tag LOCUS_07890 845604 846665 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705546.1 protein_id gnl|my_center|LOCUS_07890 848273 846780 gene locus_tag LOCUS_07900 gene ansP 848273 846780 CDS product L-asparagine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020684770.1 protein_id gnl|my_center|LOCUS_07900 848699 849688 gene locus_tag LOCUS_07910 848699 849688 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209763.1 protein_id gnl|my_center|LOCUS_07910 850089 849760 gene locus_tag LOCUS_07920 850089 849760 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280945.1 protein_id gnl|my_center|LOCUS_07920 850466 850089 gene locus_tag LOCUS_07930 850466 850089 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000539519.1 protein_id gnl|my_center|LOCUS_07930 851442 850555 gene locus_tag LOCUS_07940 851442 850555 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209764.1 protein_id gnl|my_center|LOCUS_07940 851595 852635 gene locus_tag LOCUS_07950 851595 852635 CDS product MsnO8 family LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705544.1 protein_id gnl|my_center|LOCUS_07950 852632 853750 gene locus_tag LOCUS_07960 852632 853750 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705543.1 protein_id gnl|my_center|LOCUS_07960 853770 855089 gene locus_tag LOCUS_07970 853770 855089 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096495.1 protein_id gnl|my_center|LOCUS_07970 855100 856032 gene locus_tag LOCUS_07980 855100 856032 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096496.1 protein_id gnl|my_center|LOCUS_07980 856043 856549 gene locus_tag LOCUS_07990 856043 856549 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096497.1 protein_id gnl|my_center|LOCUS_07990 856559 857485 gene locus_tag LOCUS_08000 856559 857485 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705541.1 protein_id gnl|my_center|LOCUS_08000 857469 858242 gene locus_tag LOCUS_08010 857469 858242 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366435.1 protein_id gnl|my_center|LOCUS_08010 858252 859142 gene locus_tag LOCUS_08020 858252 859142 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096500.1 protein_id gnl|my_center|LOCUS_08020 860345 859149 gene locus_tag LOCUS_08030 860345 859149 CDS product L-talarate/galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218254.1 protein_id gnl|my_center|LOCUS_08030 860733 861668 gene locus_tag LOCUS_08040 860733 861668 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981551.1 protein_id gnl|my_center|LOCUS_08040 861671 862204 gene locus_tag LOCUS_08050 861671 862204 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020684771.1 protein_id gnl|my_center|LOCUS_08050 862261 862491 gene locus_tag LOCUS_08060 gene pptA 862261 862491 CDS product tautomerase PptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096502.1 protein_id gnl|my_center|LOCUS_08060 863108 862539 gene locus_tag LOCUS_08070 863108 862539 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096509.1 protein_id gnl|my_center|LOCUS_08070 863337 864038 gene locus_tag LOCUS_08080 863337 864038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 864035 865003 gene locus_tag LOCUS_08090 864035 865003 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385516.1 protein_id gnl|my_center|LOCUS_08090 865045 866700 gene locus_tag LOCUS_08100 865045 866700 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385517.1 protein_id gnl|my_center|LOCUS_08100 866755 867606 gene locus_tag LOCUS_08110 gene nhoA 866755 867606 CDS product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096510.1 protein_id gnl|my_center|LOCUS_08110 868192 867614 gene locus_tag LOCUS_08120 868192 867614 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121044.1 protein_id gnl|my_center|LOCUS_08120 868307 869794 gene locus_tag LOCUS_08130 gene smvA 868307 869794 CDS product methyl viologen efflux MFS transporter SmvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489748.1 protein_id gnl|my_center|LOCUS_08130 870684 869803 gene locus_tag LOCUS_08140 gene yddG 870684 869803 CDS product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419505.1 protein_id gnl|my_center|LOCUS_08140 871220 870804 gene locus_tag LOCUS_08150 gene higA 871220 870804 CDS product type II toxin-antitoxin system antitoxin HigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560253.1 protein_id gnl|my_center|LOCUS_08150 871534 871367 gene locus_tag LOCUS_08160 871534 871367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08160 873391 871694 gene locus_tag LOCUS_08170 873391 871694 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450511.1 protein_id gnl|my_center|LOCUS_08170 873693 873559 gene locus_tag LOCUS_08180 gene sra 873693 873559 CDS product stationary-phase-induced ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096533.1 protein_id gnl|my_center|LOCUS_08180 875770 874058 gene locus_tag LOCUS_08190 875770 874058 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096531.1 protein_id gnl|my_center|LOCUS_08190 877436 876102 gene locus_tag LOCUS_08200 877436 876102 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_08200 878161 877667 gene locus_tag LOCUS_08210 878161 877667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 878483 878761 gene locus_tag LOCUS_08220 878483 878761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 878762 879202 gene locus_tag LOCUS_08230 878762 879202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 879382 879630 gene locus_tag LOCUS_08240 879382 879630 CDS product biofilm/acid-resistance regulator YmgB/AriR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208085.1 protein_id gnl|my_center|LOCUS_08240 880348 880061 gene locus_tag LOCUS_08250 880348 880061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 880617 882401 gene locus_tag LOCUS_08260 gene treZ 880617 882401 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095550.1 protein_id gnl|my_center|LOCUS_08260 882398 884932 gene locus_tag LOCUS_08270 gene treY 882398 884932 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613170.1 protein_id gnl|my_center|LOCUS_08270 884992 887067 gene locus_tag LOCUS_08280 gene glgX 884992 887067 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096571.1 protein_id gnl|my_center|LOCUS_08280 887299 887081 gene locus_tag LOCUS_08290 887299 887081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 888200 887256 gene locus_tag LOCUS_08300 888200 887256 CDS product mannuronate-specific alginate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103481.1 protein_id gnl|my_center|LOCUS_08300 889803 888253 gene locus_tag LOCUS_08310 889803 888253 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189772.1 protein_id gnl|my_center|LOCUS_08310 891241 890174 gene locus_tag LOCUS_08320 gene ascG 891241 890174 CDS product DNA-binding transcriptional regulator AscG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001394680.1 protein_id gnl|my_center|LOCUS_08320 893205 891316 gene locus_tag LOCUS_08330 893205 891316 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721858.1 protein_id gnl|my_center|LOCUS_08330 893441 893878 gene locus_tag LOCUS_08340 893441 893878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704919.1 protein_id gnl|my_center|LOCUS_08340 893875 895173 gene locus_tag LOCUS_08350 893875 895173 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704918.1 protein_id gnl|my_center|LOCUS_08350 895540 895304 gene locus_tag LOCUS_08360 895540 895304 CDS product biofilm development regulator YmgB/AriR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096961.1 protein_id gnl|my_center|LOCUS_08360 895931 895620 gene locus_tag LOCUS_08370 895931 895620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 896248 896009 gene locus_tag LOCUS_08380 gene ycgZ 896248 896009 CDS product regulatory protein YcgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367637.1 protein_id gnl|my_center|LOCUS_08380 896457 897659 gene locus_tag LOCUS_08390 896457 897659 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704783.1 protein_id gnl|my_center|LOCUS_08390 897808 898539 gene locus_tag LOCUS_08400 gene bluR 897808 898539 CDS product DNA-binding transcriptional repressor BluR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332303.1 protein_id gnl|my_center|LOCUS_08400 899876 898527 gene locus_tag LOCUS_08410 899876 898527 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419480.1 protein_id gnl|my_center|LOCUS_08410 900562 899960 gene locus_tag LOCUS_08420 900562 899960 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705172.1 protein_id gnl|my_center|LOCUS_08420 900702 901103 gene locus_tag LOCUS_08430 900702 901103 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705171.1 protein_id gnl|my_center|LOCUS_08430 901772 902653 gene locus_tag LOCUS_08440 901772 902653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096464.1 protein_id gnl|my_center|LOCUS_08440 902865 903392 gene locus_tag LOCUS_08450 902865 903392 CDS product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168624.1 protein_id gnl|my_center|LOCUS_08450 903712 903437 gene locus_tag LOCUS_08460 903712 903437 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063445805.1 protein_id gnl|my_center|LOCUS_08460 905093 903816 gene locus_tag LOCUS_08470 905093 903816 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263029.1 protein_id gnl|my_center|LOCUS_08470 906987 905428 gene locus_tag LOCUS_08480 906987 905428 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038812.1 protein_id gnl|my_center|LOCUS_08480 907359 908927 gene locus_tag LOCUS_08490 907359 908927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 909531 909052 gene locus_tag LOCUS_08500 909531 909052 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095424.1 protein_id gnl|my_center|LOCUS_08500 909623 911011 gene locus_tag LOCUS_08510 909623 911011 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095423.1 protein_id gnl|my_center|LOCUS_08510 912110 911196 gene locus_tag LOCUS_08520 912110 911196 CDS product bestrophin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001670736.1 protein_id gnl|my_center|LOCUS_08520 913796 912345 gene locus_tag LOCUS_08530 gene uxaB 913796 912345 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854633.1 protein_id gnl|my_center|LOCUS_08530 914440 913913 gene locus_tag LOCUS_08540 914440 913913 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705327.1 protein_id gnl|my_center|LOCUS_08540 915492 914515 gene locus_tag LOCUS_08550 915492 914515 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096606.1 protein_id gnl|my_center|LOCUS_08550 916538 915546 gene locus_tag LOCUS_08560 916538 915546 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096607.1 protein_id gnl|my_center|LOCUS_08560 918156 916684 gene locus_tag LOCUS_08570 918156 916684 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096608.1 protein_id gnl|my_center|LOCUS_08570 919211 918291 gene locus_tag LOCUS_08580 gene glsB 919211 918291 CDS product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096610.1 protein_id gnl|my_center|LOCUS_08580 920690 919266 gene locus_tag LOCUS_08590 920690 919266 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096611.1 protein_id gnl|my_center|LOCUS_08590 922337 920955 gene locus_tag LOCUS_08600 gene sad 922337 920955 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096612.1 protein_id gnl|my_center|LOCUS_08600 922442 923311 gene locus_tag LOCUS_08610 922442 923311 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705323.1 protein_id gnl|my_center|LOCUS_08610 923401 924345 gene locus_tag LOCUS_08620 923401 924345 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732587.1 protein_id gnl|my_center|LOCUS_08620 925187 924390 gene locus_tag LOCUS_08630 925187 924390 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096623.1 protein_id gnl|my_center|LOCUS_08630 925384 926577 gene locus_tag LOCUS_08640 925384 926577 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419406.1 protein_id gnl|my_center|LOCUS_08640 927400 926729 gene locus_tag LOCUS_08650 927400 926729 CDS product MarC family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968968.1 protein_id gnl|my_center|LOCUS_08650 927629 928063 gene locus_tag LOCUS_08660 gene marR 927629 928063 CDS product multiple antibiotic resistance transcriptional regulator MarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843414.1 protein_id gnl|my_center|LOCUS_08660 928083 928457 gene locus_tag LOCUS_08670 gene marA 928083 928457 CDS product MDR efflux pump AcrAB transcriptional activator MarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091194.1 protein_id gnl|my_center|LOCUS_08670 928617 928832 gene locus_tag LOCUS_08680 gene marB 928617 928832 CDS product multiple antibiotic resistance protein MarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096628.1 protein_id gnl|my_center|LOCUS_08680 929760 928864 gene locus_tag LOCUS_08690 gene eamA 929760 928864 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096629.1 protein_id gnl|my_center|LOCUS_08690 929951 931144 gene locus_tag LOCUS_08700 gene ydeE 929951 931144 CDS product efflux MFS transporter YdeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068053.1 protein_id gnl|my_center|LOCUS_08700 931155 931289 gene locus_tag LOCUS_08710 931155 931289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 932395 931295 gene locus_tag LOCUS_08720 932395 931295 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096637.1 protein_id gnl|my_center|LOCUS_08720 932963 932547 gene locus_tag LOCUS_08730 932963 932547 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096638.1 protein_id gnl|my_center|LOCUS_08730 933058 934038 gene locus_tag LOCUS_08740 gene ftrA 933058 934038 CDS product transcriptional regulator FtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420910.1 protein_id gnl|my_center|LOCUS_08740 934912 935067 gene locus_tag LOCUS_08750 934912 935067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 937127 935085 gene locus_tag LOCUS_08760 gene dcp 937127 935085 CDS product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640153.1 protein_id gnl|my_center|LOCUS_08760 937322 938068 gene locus_tag LOCUS_08770 gene ydfG 937322 938068 CDS product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636564.1 protein_id gnl|my_center|LOCUS_08770 938158 938844 gene locus_tag LOCUS_08780 938158 938844 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096780.1 protein_id gnl|my_center|LOCUS_08780 940180 938897 gene locus_tag LOCUS_08790 940180 938897 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382183.1 protein_id gnl|my_center|LOCUS_08790 941355 940255 gene locus_tag LOCUS_08800 gene rspA 941355 940255 CDS product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706283.1 protein_id gnl|my_center|LOCUS_08800 943044 941581 gene locus_tag LOCUS_08810 943044 941581 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096786.1 protein_id gnl|my_center|LOCUS_08810 944760 943216 gene locus_tag LOCUS_08820 944760 943216 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096787.1 protein_id gnl|my_center|LOCUS_08820 946191 944782 gene locus_tag LOCUS_08830 gene uxaC 946191 944782 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096788.1 protein_id gnl|my_center|LOCUS_08830 947339 946242 gene locus_tag LOCUS_08840 gene rspA 947339 946242 CDS product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706283.1 protein_id gnl|my_center|LOCUS_08840 947913 947542 gene locus_tag LOCUS_08850 947913 947542 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096792.1 protein_id gnl|my_center|LOCUS_08850 949137 947950 gene locus_tag LOCUS_08860 949137 947950 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931022.1 protein_id gnl|my_center|LOCUS_08860 950472 949354 gene locus_tag LOCUS_08870 950472 949354 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456065.1 protein_id gnl|my_center|LOCUS_08870 950589 950930 gene locus_tag LOCUS_08880 950589 950930 CDS product DUF1283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096793.1 protein_id gnl|my_center|LOCUS_08880 951647 950937 gene locus_tag LOCUS_08890 951647 950937 CDS product YnfC family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096795.1 protein_id gnl|my_center|LOCUS_08890 951918 953711 gene locus_tag LOCUS_08900 gene atzF 951918 953711 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206338.1 protein_id gnl|my_center|LOCUS_08900 953704 957318 gene locus_tag LOCUS_08910 gene uca 953704 957318 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140960.1 protein_id gnl|my_center|LOCUS_08910 957323 958018 gene locus_tag LOCUS_08920 957323 958018 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267779.1 protein_id gnl|my_center|LOCUS_08920 958081 959355 gene locus_tag LOCUS_08930 gene urtA 958081 959355 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096636.1 protein_id gnl|my_center|LOCUS_08930 959416 960990 gene locus_tag LOCUS_08940 gene urtB 959416 960990 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210793.1 protein_id gnl|my_center|LOCUS_08940 960990 962066 gene locus_tag LOCUS_08950 gene urtC 960990 962066 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210794.1 protein_id gnl|my_center|LOCUS_08950 962059 962850 gene locus_tag LOCUS_08960 gene urtD 962059 962850 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096633.1 protein_id gnl|my_center|LOCUS_08960 962852 963550 gene locus_tag LOCUS_08970 gene urtE 962852 963550 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096632.1 protein_id gnl|my_center|LOCUS_08970 963617 963916 gene locus_tag LOCUS_08980 963617 963916 CDS product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059218804.1 protein_id gnl|my_center|LOCUS_08980 963978 963889 gene locus_tag LOCUS_t00060 963978 963889 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 964229 966667 gene locus_tag LOCUS_08990 964229 966667 CDS product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096797.1 protein_id gnl|my_center|LOCUS_08990 966678 967295 gene locus_tag LOCUS_09000 gene dmsB 966678 967295 CDS product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213069.1 protein_id gnl|my_center|LOCUS_09000 967297 968154 gene locus_tag LOCUS_09010 967297 968154 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526492.1 protein_id gnl|my_center|LOCUS_09010 968167 968778 gene locus_tag LOCUS_09020 gene dmsD 968167 968778 CDS product Tat proofreading chaperone DmsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206559.1 protein_id gnl|my_center|LOCUS_09020 969088 969795 gene locus_tag LOCUS_09030 gene osmY 969088 969795 CDS product osmoprotectant ABC transporter permease OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096821.1 protein_id gnl|my_center|LOCUS_09030 969814 970716 gene locus_tag LOCUS_09040 gene osmX 969814 970716 CDS product osmoprotectant ABC transporter substrate-binding protein OsmX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096822.1 protein_id gnl|my_center|LOCUS_09040 970726 971373 gene locus_tag LOCUS_09050 gene osmW 970726 971373 CDS product osmoprotectant ABC transporter permease OsmW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006808875.1 protein_id gnl|my_center|LOCUS_09050 971373 972521 gene locus_tag LOCUS_09060 gene osmV 971373 972521 CDS product osmoprotectant ABC transporter ATP-binding protein OsmV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096823.1 protein_id gnl|my_center|LOCUS_09060 973354 972659 gene locus_tag LOCUS_09070 gene bioD 973354 972659 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096826.1 protein_id gnl|my_center|LOCUS_09070 974700 973480 gene locus_tag LOCUS_09080 974700 973480 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096827.1 protein_id gnl|my_center|LOCUS_09080 975738 974848 gene locus_tag LOCUS_09090 975738 974848 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705289.1 protein_id gnl|my_center|LOCUS_09090 975858 977117 gene locus_tag LOCUS_09100 975858 977117 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091796.1 protein_id gnl|my_center|LOCUS_09100 977427 978911 gene locus_tag LOCUS_09110 977427 978911 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096839.1 protein_id gnl|my_center|LOCUS_09110 979248 979568 gene locus_tag LOCUS_09120 979248 979568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 979830 980651 gene locus_tag LOCUS_09130 979830 980651 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096841.1 protein_id gnl|my_center|LOCUS_09130 980837 980694 gene locus_tag LOCUS_09140 980837 980694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 981325 980876 gene locus_tag LOCUS_09150 981325 980876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 981742 981503 gene locus_tag LOCUS_09160 981742 981503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 982203 983087 gene locus_tag LOCUS_09170 982203 983087 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096673.1 protein_id gnl|my_center|LOCUS_09170 983133 984971 gene locus_tag LOCUS_09180 983133 984971 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036278.1 protein_id gnl|my_center|LOCUS_09180 985355 985621 gene locus_tag LOCUS_09190 985355 985621 CDS product ParD-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209417.1 protein_id gnl|my_center|LOCUS_09190 985618 986403 gene locus_tag LOCUS_09200 gene map 985618 986403 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209416.1 protein_id gnl|my_center|LOCUS_09200 987242 986679 gene locus_tag LOCUS_09210 gene smrA 987242 986679 CDS product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046820.1 protein_id gnl|my_center|LOCUS_09210 987852 988367 gene locus_tag LOCUS_09220 gene ogt 987852 988367 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096864.1 protein_id gnl|my_center|LOCUS_09220 988457 989314 gene locus_tag LOCUS_09230 gene fnr 988457 989314 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006174991.1 protein_id gnl|my_center|LOCUS_09230 989459 990406 gene locus_tag LOCUS_09240 gene uspE 989459 990406 CDS product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366817.1 protein_id gnl|my_center|LOCUS_09240 991850 990462 gene locus_tag LOCUS_09250 gene pntB 991850 990462 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096868.1 protein_id gnl|my_center|LOCUS_09250 993390 991861 gene locus_tag LOCUS_09260 gene pntA 993390 991861 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096869.1 protein_id gnl|my_center|LOCUS_09260 993915 994859 gene locus_tag LOCUS_09270 gene ydgH 993915 994859 CDS product DUF1471 family protein YdgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769298.1 protein_id gnl|my_center|LOCUS_09270 995039 996421 gene locus_tag LOCUS_09280 995039 996421 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096871.1 protein_id gnl|my_center|LOCUS_09280 996460 997182 gene locus_tag LOCUS_09290 gene folM 996460 997182 CDS product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096872.1 protein_id gnl|my_center|LOCUS_09290 997514 997179 gene locus_tag LOCUS_09300 997514 997179 CDS product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096873.1 protein_id gnl|my_center|LOCUS_09300 997585 998355 gene locus_tag LOCUS_09310 gene rstA 997585 998355 CDS product two-component system response regulator RstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096874.1 protein_id gnl|my_center|LOCUS_09310 998589 998957 gene locus_tag LOCUS_09320 998589 998957 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118257.1 protein_id gnl|my_center|LOCUS_09320 998957 999460 gene locus_tag LOCUS_09330 998957 999460 CDS product YbjP/YqhG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847532.1 protein_id gnl|my_center|LOCUS_09330 999621 1000916 gene locus_tag LOCUS_09340 gene rstB 999621 1000916 CDS product two-component system sensor histidine kinase RstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705253.1 protein_id gnl|my_center|LOCUS_09340 1001032 1001817 gene locus_tag LOCUS_09350 gene tus 1001032 1001817 CDS product DNA replication terminus site-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096877.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09350 1001808 1001960 gene locus_tag LOCUS_09360 1001808 1001960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09360 1003360 1001957 gene locus_tag LOCUS_09370 gene fumC 1003360 1001957 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096878.1 protein_id gnl|my_center|LOCUS_09370 1005138 1003492 gene locus_tag LOCUS_09380 gene fumA 1005138 1003492 CDS product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096879.1 protein_id gnl|my_center|LOCUS_09380 1005333 1006511 gene locus_tag LOCUS_09390 gene manA 1005333 1006511 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096880.1 protein_id gnl|my_center|LOCUS_09390 1006605 1008140 gene locus_tag LOCUS_09400 1006605 1008140 CDS product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753325.1 protein_id gnl|my_center|LOCUS_09400 1008581 1012285 gene locus_tag LOCUS_09410 1008581 1012285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 1012602 1013771 gene locus_tag LOCUS_09420 1012602 1013771 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096892.1 protein_id gnl|my_center|LOCUS_09420 1013878 1014882 gene locus_tag LOCUS_09430 gene add 1013878 1014882 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096893.1 protein_id gnl|my_center|LOCUS_09430 1015966 1014926 gene locus_tag LOCUS_09440 1015966 1014926 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300538.1 protein_id gnl|my_center|LOCUS_09440 1016195 1016332 gene locus_tag LOCUS_09450 gene blr 1016195 1016332 CDS product division septum protein Blr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168112406.1 protein_id gnl|my_center|LOCUS_09450 1016484 1016924 gene locus_tag LOCUS_09460 1016484 1016924 CDS product DUF2569 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096897.1 protein_id gnl|my_center|LOCUS_09460 1017000 1017581 gene locus_tag LOCUS_09470 gene rsxA 1017000 1017581 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366851.1 protein_id gnl|my_center|LOCUS_09470 1017581 1018159 gene locus_tag LOCUS_09480 gene rsxB 1017581 1018159 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096899.1 protein_id gnl|my_center|LOCUS_09480 1018152 1020326 gene locus_tag LOCUS_09490 1018152 1020326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1020327 1021376 gene locus_tag LOCUS_09500 gene rsxD 1020327 1021376 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419218.1 protein_id gnl|my_center|LOCUS_09500 1021386 1022006 gene locus_tag LOCUS_09510 gene rsxG 1021386 1022006 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920811.1 protein_id gnl|my_center|LOCUS_09510 1022009 1022710 gene locus_tag LOCUS_09520 1022009 1022710 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366856.1 protein_id gnl|my_center|LOCUS_09520 1022710 1023345 gene locus_tag LOCUS_09530 gene nth 1022710 1023345 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705230.1 protein_id gnl|my_center|LOCUS_09530 1023932 1025437 gene locus_tag LOCUS_09540 gene dtpA 1023932 1025437 CDS product dipeptide/tripeptide permease DtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366858.1 protein_id gnl|my_center|LOCUS_09540 1025555 1026157 gene locus_tag LOCUS_09550 gene gstA 1025555 1026157 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765742.1 protein_id gnl|my_center|LOCUS_09550 1027518 1026244 gene locus_tag LOCUS_09560 gene tyrS 1027518 1026244 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366861.1 protein_id gnl|my_center|LOCUS_09560 1028299 1027643 gene locus_tag LOCUS_09570 gene pdxH 1028299 1027643 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282834.1 protein_id gnl|my_center|LOCUS_09570 1028680 1028357 gene locus_tag LOCUS_09580 gene mliC 1028680 1028357 CDS product C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178044.1 protein_id gnl|my_center|LOCUS_09580 1029897 1028773 gene locus_tag LOCUS_09590 gene anmK 1029897 1028773 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096911.1 protein_id gnl|my_center|LOCUS_09590 1030071 1030538 gene locus_tag LOCUS_09600 gene slyB 1030071 1030538 CDS product outer membrane lipoprotein SlyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597179.1 protein_id gnl|my_center|LOCUS_09600 1031062 1030628 gene locus_tag LOCUS_09610 gene slyA 1031062 1030628 CDS product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445639.1 protein_id gnl|my_center|LOCUS_09610 1031252 1031485 gene locus_tag LOCUS_09620 1031252 1031485 CDS product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670998.1 protein_id gnl|my_center|LOCUS_09620 1031491 1032348 gene locus_tag LOCUS_09630 1031491 1032348 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096915.1 protein_id gnl|my_center|LOCUS_09630 1032351 1034354 gene locus_tag LOCUS_09640 1032351 1034354 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096916.1 protein_id gnl|my_center|LOCUS_09640 1034868 1034347 gene locus_tag LOCUS_09650 gene sodC 1034868 1034347 CDS product superoxide dismutase [Cu-Zn] SodC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096917.1 protein_id gnl|my_center|LOCUS_09650 1035844 1034948 gene locus_tag LOCUS_09660 1035844 1034948 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250656.1 protein_id gnl|my_center|LOCUS_09660 1036133 1035894 gene locus_tag LOCUS_09670 1036133 1035894 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096919.1 protein_id gnl|my_center|LOCUS_09670 1036214 1036831 gene locus_tag LOCUS_09680 1036214 1036831 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419211.1 protein_id gnl|my_center|LOCUS_09680 1036888 1037982 gene locus_tag LOCUS_09690 1036888 1037982 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092935.1 protein_id gnl|my_center|LOCUS_09690 1038071 1038478 gene locus_tag LOCUS_09700 gene gloA 1038071 1038478 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096923.1 protein_id gnl|my_center|LOCUS_09700 1038578 1039234 gene locus_tag LOCUS_09710 gene rnt 1038578 1039234 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282267.1 protein_id gnl|my_center|LOCUS_09710 1039306 1039704 gene locus_tag LOCUS_09720 gene yciA 1039306 1039704 CDS product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096281.1 protein_id gnl|my_center|LOCUS_09720 1040213 1039779 gene locus_tag LOCUS_09730 gene arsC 1040213 1039779 CDS product glutaredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065782.1 protein_id gnl|my_center|LOCUS_09730 1041515 1040226 gene locus_tag LOCUS_09740 1041515 1040226 CDS product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706112.1 protein_id gnl|my_center|LOCUS_09740 1041880 1041560 gene locus_tag LOCUS_09750 1041880 1041560 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706111.1 protein_id gnl|my_center|LOCUS_09750 1042742 1042083 gene locus_tag LOCUS_09760 1042742 1042083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 1043033 1043329 gene locus_tag LOCUS_09770 1043033 1043329 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967595.1 protein_id gnl|my_center|LOCUS_09770 1043686 1045146 gene locus_tag LOCUS_09780 gene cls 1043686 1045146 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206886.1 protein_id gnl|my_center|LOCUS_09780 1045180 1045509 gene locus_tag LOCUS_09790 1045180 1045509 CDS product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367064.1 protein_id gnl|my_center|LOCUS_09790 1046585 1045581 gene locus_tag LOCUS_09800 gene oppF 1046585 1045581 CDS product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367066.1 protein_id gnl|my_center|LOCUS_09800 1047595 1046582 gene locus_tag LOCUS_09810 1047595 1046582 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096273.1 protein_id gnl|my_center|LOCUS_09810 1048515 1047607 gene locus_tag LOCUS_09820 gene oppC 1048515 1047607 CDS product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096272.1 protein_id gnl|my_center|LOCUS_09820 1049450 1048530 gene locus_tag LOCUS_09830 gene oppB 1049450 1048530 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911094.1 protein_id gnl|my_center|LOCUS_09830 1051191 1049557 gene locus_tag LOCUS_09840 gene oppA 1051191 1049557 CDS product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182039.1 protein_id gnl|my_center|LOCUS_09840 1051430 1051251 gene locus_tag LOCUS_09850 1051430 1051251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 1052606 1051959 gene locus_tag LOCUS_09860 1052606 1051959 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419826.1 protein_id gnl|my_center|LOCUS_09860 1053077 1055755 gene locus_tag LOCUS_09870 gene adhE 1053077 1055755 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096268.1 protein_id gnl|my_center|LOCUS_09870 1056365 1055841 gene locus_tag LOCUS_09880 gene tdk 1056365 1055841 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068076.1 protein_id gnl|my_center|LOCUS_09880 1057003 1057416 gene locus_tag LOCUS_09890 gene hns 1057003 1057416 CDS product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502781.1 protein_id gnl|my_center|LOCUS_09890 1058531 1057686 gene locus_tag LOCUS_09900 gene galU 1058531 1057686 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718995.1 protein_id gnl|my_center|LOCUS_09900 1059807 1058794 gene locus_tag LOCUS_09910 gene rssB 1059807 1058794 CDS product two-component system response regulator RssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193432.1 protein_id gnl|my_center|LOCUS_09910 1060447 1060806 gene locus_tag LOCUS_09920 1060447 1060806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 1060855 1061697 gene locus_tag LOCUS_09930 gene purU 1060855 1061697 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096262.1 protein_id gnl|my_center|LOCUS_09930 1061858 1061907 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1063164 1062487 gene locus_tag LOCUS_09940 gene narI 1063164 1062487 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367083.1 protein_id gnl|my_center|LOCUS_09940 1063874 1063164 gene locus_tag LOCUS_09950 gene narJ 1063874 1063164 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096258.1 protein_id gnl|my_center|LOCUS_09950 1065406 1063871 gene locus_tag LOCUS_09960 gene narH 1065406 1063871 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702629.1 protein_id gnl|my_center|LOCUS_09960 1069146 1065403 gene locus_tag LOCUS_09970 1069146 1065403 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096256.1 protein_id gnl|my_center|LOCUS_09970 1071025 1069532 gene locus_tag LOCUS_09980 gene narK 1071025 1069532 CDS product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019848.1 protein_id gnl|my_center|LOCUS_09980 1071235 1073031 gene locus_tag LOCUS_09990 gene narX 1071235 1073031 CDS product nitrate/nitrite two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476239.1 protein_id gnl|my_center|LOCUS_09990 1073024 1073674 gene locus_tag LOCUS_10000 gene narL 1073024 1073674 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064595.1 protein_id gnl|my_center|LOCUS_10000 1075081 1073675 gene locus_tag LOCUS_10010 1075081 1073675 CDS product YchO/YchP family invasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419841.1 protein_id gnl|my_center|LOCUS_10010 1075254 1075805 gene locus_tag LOCUS_10020 1075254 1075805 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444179.1 protein_id gnl|my_center|LOCUS_10020 1078370 1075782 gene locus_tag LOCUS_10030 1078370 1075782 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705092.1 protein_id gnl|my_center|LOCUS_10030 1082431 1078367 gene locus_tag LOCUS_10040 gene nirB 1082431 1078367 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186277852.1 protein_id gnl|my_center|LOCUS_10040 1083229 1082441 gene locus_tag LOCUS_10050 1083229 1082441 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096250.1 protein_id gnl|my_center|LOCUS_10050 1084121 1083240 gene locus_tag LOCUS_10060 gene ntrB 1084121 1083240 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096249.1 protein_id gnl|my_center|LOCUS_10060 1085382 1084123 gene locus_tag LOCUS_10070 1085382 1084123 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882726.1 protein_id gnl|my_center|LOCUS_10070 1086888 1085722 gene locus_tag LOCUS_10080 gene nasR 1086888 1085722 CDS product nitrate regulatory protein NasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096246.1 protein_id gnl|my_center|LOCUS_10080 1086956 1087306 gene locus_tag LOCUS_10090 1086956 1087306 CDS product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179794.1 protein_id gnl|my_center|LOCUS_10090 1087414 1089198 gene locus_tag LOCUS_10100 1087414 1089198 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096244.1 protein_id gnl|my_center|LOCUS_10100 1089411 1089656 gene locus_tag LOCUS_10110 1089411 1089656 CDS product DUF1883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705086.1 protein_id gnl|my_center|LOCUS_10110 1090354 1089659 gene locus_tag LOCUS_10120 1090354 1089659 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096242.1 protein_id gnl|my_center|LOCUS_10120 1090785 1090555 gene locus_tag LOCUS_10130 gene chaB 1090785 1090555 CDS product putative cation transport regulator ChaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096240.1 protein_id gnl|my_center|LOCUS_10130 1091059 1092159 gene locus_tag LOCUS_10140 gene chaA 1091059 1092159 CDS product sodium-potassium/proton antiporter ChaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096238.1 protein_id gnl|my_center|LOCUS_10140 1092602 1092195 gene locus_tag LOCUS_10150 1092602 1092195 CDS product type II toxin-antitoxin system MqsA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809516.1 protein_id gnl|my_center|LOCUS_10150 1092901 1092599 gene locus_tag LOCUS_10160 1092901 1092599 CDS product type II toxin-antitoxin system MqsR family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809515.1 protein_id gnl|my_center|LOCUS_10160 1093920 1093066 gene locus_tag LOCUS_10170 gene kdsA 1093920 1093066 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811046.1 protein_id gnl|my_center|LOCUS_10170 1094757 1093957 gene locus_tag LOCUS_10180 gene sirB1 1094757 1093957 CDS product invasion regulator SirB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096236.1 protein_id gnl|my_center|LOCUS_10180 1095162 1094770 gene locus_tag LOCUS_10190 gene sirB2 1095162 1094770 CDS product invasion regulator SirB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096235.1 protein_id gnl|my_center|LOCUS_10190 1096007 1095168 gene locus_tag LOCUS_10200 gene prmC 1096007 1095168 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705084.1 protein_id gnl|my_center|LOCUS_10200 1097089 1096007 gene locus_tag LOCUS_10210 gene prfA 1097089 1096007 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096233.1 protein_id gnl|my_center|LOCUS_10210 1098387 1097131 gene locus_tag LOCUS_10220 gene hemA 1098387 1097131 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299679.1 protein_id gnl|my_center|LOCUS_10220 1098589 1099212 gene locus_tag LOCUS_10230 gene lolB 1098589 1099212 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130692.1 protein_id gnl|my_center|LOCUS_10230 1099209 1100078 gene locus_tag LOCUS_10240 gene ispE 1099209 1100078 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367112.1 protein_id gnl|my_center|LOCUS_10240 1100202 1101149 gene locus_tag LOCUS_10250 gene prs 1100202 1101149 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518537.1 protein_id gnl|my_center|LOCUS_10250 1101274 1102953 gene locus_tag LOCUS_10260 gene dauA 1101274 1102953 CDS product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705081.1 protein_id gnl|my_center|LOCUS_10260 1103302 1103024 gene locus_tag LOCUS_10270 gene ychH 1103302 1103024 CDS product stress-induced protein YchH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823874.1 protein_id gnl|my_center|LOCUS_10270 1103573 1104157 gene locus_tag LOCUS_10280 gene pth 1103573 1104157 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096226.1 protein_id gnl|my_center|LOCUS_10280 1104285 1105376 gene locus_tag LOCUS_10290 gene ychF 1104285 1105376 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505850.1 protein_id gnl|my_center|LOCUS_10290 1106193 1105447 gene locus_tag LOCUS_10300 1106193 1105447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 1106390 1106914 gene locus_tag LOCUS_10310 1106390 1106914 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527976.1 protein_id gnl|my_center|LOCUS_10310 1107250 1107432 gene locus_tag LOCUS_10320 1107250 1107432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 1107537 1108040 gene locus_tag LOCUS_10330 1107537 1108040 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022822.1 protein_id gnl|my_center|LOCUS_10330 1109793 1108210 gene locus_tag LOCUS_10340 1109793 1108210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 1111016 1109805 gene locus_tag LOCUS_10350 1111016 1109805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 1112385 1111159 gene locus_tag LOCUS_10360 1112385 1111159 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094912.1 protein_id gnl|my_center|LOCUS_10360 1112553 1113533 gene locus_tag LOCUS_10370 1112553 1113533 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096169.1 protein_id gnl|my_center|LOCUS_10370 1113612 1114622 gene locus_tag LOCUS_10380 gene gap 1113612 1114622 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096168.1 protein_id gnl|my_center|LOCUS_10380 1116191 1114671 gene locus_tag LOCUS_10390 1116191 1114671 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118247.1 protein_id gnl|my_center|LOCUS_10390 1116463 1118217 gene locus_tag LOCUS_10400 1116463 1118217 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703227.1 protein_id gnl|my_center|LOCUS_10400 1118288 1119184 gene locus_tag LOCUS_10410 1118288 1119184 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852073.1 protein_id gnl|my_center|LOCUS_10410 1119650 1119222 gene locus_tag LOCUS_10420 gene pgaD 1119650 1119222 CDS product poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212041.1 protein_id gnl|my_center|LOCUS_10420 1120981 1119650 gene locus_tag LOCUS_10430 gene pgaC 1120981 1119650 CDS product poly-beta-1,6-N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368679.1 protein_id gnl|my_center|LOCUS_10430 1122948 1120978 gene locus_tag LOCUS_10440 gene pgaB 1122948 1120978 CDS product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368678.1 protein_id gnl|my_center|LOCUS_10440 1125309 1123003 gene locus_tag LOCUS_10450 gene pgaA 1125309 1123003 CDS product poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063447004.1 protein_id gnl|my_center|LOCUS_10450 1129572 1125973 gene locus_tag LOCUS_10460 gene uca 1129572 1125973 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096802.1 protein_id gnl|my_center|LOCUS_10460 1130366 1129731 gene locus_tag LOCUS_10470 1130366 1129731 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_10470 1131106 1130378 gene locus_tag LOCUS_10480 1131106 1130378 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420904.1 protein_id gnl|my_center|LOCUS_10480 1131888 1131106 gene locus_tag LOCUS_10490 1131888 1131106 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096805.1 protein_id gnl|my_center|LOCUS_10490 1132700 1131885 gene locus_tag LOCUS_10500 1132700 1131885 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096806.1 protein_id gnl|my_center|LOCUS_10500 1133663 1132725 gene locus_tag LOCUS_10510 1133663 1132725 CDS product putative urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096807.1 protein_id gnl|my_center|LOCUS_10510 1134383 1134877 gene locus_tag LOCUS_10520 1134383 1134877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096174.1 protein_id gnl|my_center|LOCUS_10520 1134995 1135954 gene locus_tag LOCUS_10530 1134995 1135954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096186.1 protein_id gnl|my_center|LOCUS_10530 1135995 1137368 gene locus_tag LOCUS_10540 1135995 1137368 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096192.1 protein_id gnl|my_center|LOCUS_10540 1137562 1139259 gene locus_tag LOCUS_10550 1137562 1139259 CDS product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096163.1 protein_id gnl|my_center|LOCUS_10550 1139493 1141601 gene locus_tag LOCUS_10560 1139493 1141601 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045360620.1 protein_id gnl|my_center|LOCUS_10560 1141997 1141743 gene locus_tag LOCUS_10570 1141997 1141743 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511323.1 protein_id gnl|my_center|LOCUS_10570 1142208 1142939 gene locus_tag LOCUS_10580 1142208 1142939 CDS product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096160.1 protein_id gnl|my_center|LOCUS_10580 1143560 1142946 gene locus_tag LOCUS_10590 gene emtA 1143560 1142946 CDS product membrane-bound lytic murein transglycosylase EmtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096159.1 protein_id gnl|my_center|LOCUS_10590 1143660 1144568 gene locus_tag LOCUS_10600 gene ldcA 1143660 1144568 CDS product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051613.1 protein_id gnl|my_center|LOCUS_10600 1144700 1146433 gene locus_tag LOCUS_10610 1144700 1146433 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096157.1 protein_id gnl|my_center|LOCUS_10610 1147532 1146459 gene locus_tag LOCUS_10620 gene dadX 1147532 1146459 CDS product catabolic alanine racemase DadX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197840.1 protein_id gnl|my_center|LOCUS_10620 1148843 1147545 gene locus_tag LOCUS_10630 1148843 1147545 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266934.1 protein_id gnl|my_center|LOCUS_10630 1149165 1150697 gene locus_tag LOCUS_10640 1149165 1150697 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096153.1 protein_id gnl|my_center|LOCUS_10640 1151568 1150807 gene locus_tag LOCUS_10650 gene fadR 1151568 1150807 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234823.1 protein_id gnl|my_center|LOCUS_10650 1151977 1152456 gene locus_tag LOCUS_10660 gene dsbB 1151977 1152456 CDS product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028084.1 protein_id gnl|my_center|LOCUS_10660 1152997 1152551 gene locus_tag LOCUS_10670 1152997 1152551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1153666 1153220 gene locus_tag LOCUS_10680 1153666 1153220 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306825.1 protein_id gnl|my_center|LOCUS_10680 1154420 1153761 gene locus_tag LOCUS_10690 1154420 1153761 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096147.1 protein_id gnl|my_center|LOCUS_10690 1154816 1154541 gene locus_tag LOCUS_10700 1154816 1154541 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250286.1 protein_id gnl|my_center|LOCUS_10700 1154938 1155639 gene locus_tag LOCUS_10710 gene minC 1154938 1155639 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072527.1 protein_id gnl|my_center|LOCUS_10710 1155662 1156474 gene locus_tag LOCUS_10720 gene minD 1155662 1156474 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096144.1 protein_id gnl|my_center|LOCUS_10720 1156478 1156744 gene locus_tag LOCUS_10730 gene minE 1156478 1156744 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185666.1 protein_id gnl|my_center|LOCUS_10730 1157983 1156856 gene locus_tag LOCUS_10740 gene rnd 1157983 1156856 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109156.1 protein_id gnl|my_center|LOCUS_10740 1159738 1158053 gene locus_tag LOCUS_10750 gene fadD 1159738 1158053 CDS product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705923.1 protein_id gnl|my_center|LOCUS_10750 1160534 1159944 gene locus_tag LOCUS_10760 1160534 1159944 CDS product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096141.1 protein_id gnl|my_center|LOCUS_10760 1161266 1160571 gene locus_tag LOCUS_10770 gene tsaB 1161266 1160571 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705925.1 protein_id gnl|my_center|LOCUS_10770 1163259 1161334 gene locus_tag LOCUS_10780 1163259 1161334 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128847.1 protein_id gnl|my_center|LOCUS_10780 1163383 1163727 gene locus_tag LOCUS_10790 1163383 1163727 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295493.1 protein_id gnl|my_center|LOCUS_10790 1163915 1163733 gene locus_tag LOCUS_10800 1163915 1163733 CDS product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500497.1 protein_id gnl|my_center|LOCUS_10800 1163998 1165374 gene locus_tag LOCUS_10810 gene pabB 1163998 1165374 CDS product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978456.1 protein_id gnl|my_center|LOCUS_10810 1165361 1165939 gene locus_tag LOCUS_10820 1165361 1165939 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705928.1 protein_id gnl|my_center|LOCUS_10820 1166014 1166191 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1167627 1166431 gene locus_tag LOCUS_10830 1167627 1166431 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541054.1 protein_id gnl|my_center|LOCUS_10830 1167778 1168686 gene locus_tag LOCUS_10840 1167778 1168686 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268187.1 protein_id gnl|my_center|LOCUS_10840 1168796 1169058 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1169745 1169197 gene locus_tag LOCUS_10850 1169745 1169197 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223560.1 protein_id gnl|my_center|LOCUS_10850 1170534 1169773 gene locus_tag LOCUS_10860 1170534 1169773 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113396.1 protein_id gnl|my_center|LOCUS_10860 1172116 1171502 gene locus_tag LOCUS_10870 1172116 1171502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 1173277 1172318 gene locus_tag LOCUS_10880 1173277 1172318 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247693.1 protein_id gnl|my_center|LOCUS_10880 1174153 1173377 gene locus_tag LOCUS_10890 1174153 1173377 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094851.1 protein_id gnl|my_center|LOCUS_10890 1174466 1175242 gene locus_tag LOCUS_10900 1174466 1175242 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928911.1 protein_id gnl|my_center|LOCUS_10900 1175603 1176568 gene locus_tag LOCUS_10910 1175603 1176568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 1176707 1177954 gene locus_tag LOCUS_10920 1176707 1177954 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095494537.1 protein_id gnl|my_center|LOCUS_10920 1178816 1177920 gene locus_tag LOCUS_10930 1178816 1177920 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967782.1 protein_id gnl|my_center|LOCUS_10930 1179597 1179091 gene locus_tag LOCUS_10940 1179597 1179091 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406573.1 protein_id gnl|my_center|LOCUS_10940 1180187 1179795 gene locus_tag LOCUS_10950 1180187 1179795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 1181111 1180191 gene locus_tag LOCUS_10960 1181111 1180191 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064501.1 protein_id gnl|my_center|LOCUS_10960 1181204 1181779 gene locus_tag LOCUS_10970 1181204 1181779 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931294.1 protein_id gnl|my_center|LOCUS_10970 1182052 1182621 gene locus_tag LOCUS_10980 1182052 1182621 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196513.1 protein_id gnl|my_center|LOCUS_10980 1182679 1183155 gene locus_tag LOCUS_10990 1182679 1183155 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096727.1 protein_id gnl|my_center|LOCUS_10990 1183421 1183786 gene locus_tag LOCUS_11000 1183421 1183786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1183797 1185893 gene locus_tag LOCUS_11010 1183797 1185893 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337648.1 protein_id gnl|my_center|LOCUS_11010 1188948 1186012 gene locus_tag LOCUS_11020 1188948 1186012 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705231.1 protein_id gnl|my_center|LOCUS_11020 1190274 1189150 gene locus_tag LOCUS_11030 1190274 1189150 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182976012.1 protein_id gnl|my_center|LOCUS_11030 1191673 1190315 gene locus_tag LOCUS_11040 gene smvA 1191673 1190315 CDS product methyl viologen efflux MFS transporter SmvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489748.1 protein_id gnl|my_center|LOCUS_11040 1191919 1192512 gene locus_tag LOCUS_11050 1191919 1192512 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207043.1 protein_id gnl|my_center|LOCUS_11050 1192923 1193345 gene locus_tag LOCUS_11060 1192923 1193345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 1194269 1194730 gene locus_tag LOCUS_11070 1194269 1194730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1195985 1194843 gene locus_tag LOCUS_11080 1195985 1194843 CDS product glycoside hydrolase family 105 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096071.1 protein_id gnl|my_center|LOCUS_11080 1197182 1196091 gene locus_tag LOCUS_11090 1197182 1196091 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043445520.1 protein_id gnl|my_center|LOCUS_11090 1198419 1197427 gene locus_tag LOCUS_11100 1198419 1197427 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210220.1 protein_id gnl|my_center|LOCUS_11100 1199454 1198555 gene locus_tag LOCUS_11110 1199454 1198555 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687183.1 protein_id gnl|my_center|LOCUS_11110 1199553 1200275 gene locus_tag LOCUS_11120 1199553 1200275 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361969.1 protein_id gnl|my_center|LOCUS_11120 1200944 1200366 gene locus_tag LOCUS_11130 1200944 1200366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 1201181 1202545 gene locus_tag LOCUS_11140 gene sdaA 1201181 1202545 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419892.1 protein_id gnl|my_center|LOCUS_11140 1202683 1204284 gene locus_tag LOCUS_11150 1202683 1204284 CDS product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096134.1 protein_id gnl|my_center|LOCUS_11150 1205846 1204287 gene locus_tag LOCUS_11160 gene yoaE 1205846 1204287 CDS product CNNM family cation transport protein YoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096133.1 protein_id gnl|my_center|LOCUS_11160 1206294 1207253 gene locus_tag LOCUS_11170 gene manX 1206294 1207253 CDS product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150523.1 protein_id gnl|my_center|LOCUS_11170 1207308 1208108 gene locus_tag LOCUS_11180 gene manY 1207308 1208108 CDS product PTS mannose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859914.1 protein_id gnl|my_center|LOCUS_11180 1208121 1208972 gene locus_tag LOCUS_11190 1208121 1208972 CDS product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006175979.1 protein_id gnl|my_center|LOCUS_11190 1209029 1209499 gene locus_tag LOCUS_11200 1209029 1209499 CDS product DUF986 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096131.1 protein_id gnl|my_center|LOCUS_11200 1209868 1210431 gene locus_tag LOCUS_11210 gene mntP 1209868 1210431 CDS product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096130.1 protein_id gnl|my_center|LOCUS_11210 1211210 1210428 gene locus_tag LOCUS_11220 gene rlmA 1211210 1210428 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096129.1 protein_id gnl|my_center|LOCUS_11220 1211233 1211397 gene locus_tag LOCUS_11230 1211233 1211397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1211633 1211424 gene locus_tag LOCUS_11240 gene cspE 1211633 1211424 CDS product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062678.1 protein_id gnl|my_center|LOCUS_11240 1213309 1212305 gene locus_tag LOCUS_11250 1213309 1212305 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096126.1 protein_id gnl|my_center|LOCUS_11250 1213614 1213330 gene locus_tag LOCUS_11260 1213614 1213330 CDS product YebO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000660.1 protein_id gnl|my_center|LOCUS_11260 1213994 1214233 gene locus_tag LOCUS_11270 1213994 1214233 CDS product YobH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096123.1 protein_id gnl|my_center|LOCUS_11270 1215076 1214285 gene locus_tag LOCUS_11280 gene kdgR 1215076 1214285 CDS product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262197.1 protein_id gnl|my_center|LOCUS_11280 1216130 1215249 gene locus_tag LOCUS_11290 gene htpX 1216130 1215249 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096120.1 protein_id gnl|my_center|LOCUS_11290 1218370 1216322 gene locus_tag LOCUS_11300 gene prc 1218370 1216322 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096119.1 protein_id gnl|my_center|LOCUS_11300 1219082 1218390 gene locus_tag LOCUS_11310 gene proQ 1219082 1218390 CDS product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096118.1 protein_id gnl|my_center|LOCUS_11310 1219677 1219180 gene locus_tag LOCUS_11320 1219677 1219180 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096117.1 protein_id gnl|my_center|LOCUS_11320 1220045 1221091 gene locus_tag LOCUS_11330 gene yebS 1220045 1221091 CDS product membrane integrity lipid transport subunit YebS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419906.1 protein_id gnl|my_center|LOCUS_11330 1221060 1223693 gene locus_tag LOCUS_11340 1221060 1223693 CDS product PqiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419908.1 protein_id gnl|my_center|LOCUS_11340 1223819 1225213 gene locus_tag LOCUS_11350 gene rsmF 1223819 1225213 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096114.1 protein_id gnl|my_center|LOCUS_11350 1225327 1225566 gene locus_tag LOCUS_11360 1225327 1225566 CDS product YebV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096113.1 protein_id gnl|my_center|LOCUS_11360 1225671 1225862 gene locus_tag LOCUS_11370 1225671 1225862 CDS product YebW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296140.1 protein_id gnl|my_center|LOCUS_11370 1226507 1225863 gene locus_tag LOCUS_11380 gene pphA 1226507 1225863 CDS product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705940.1 protein_id gnl|my_center|LOCUS_11380 1226631 1227614 gene locus_tag LOCUS_11390 1226631 1227614 CDS product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096111.1 protein_id gnl|my_center|LOCUS_11390 1227705 1228145 gene locus_tag LOCUS_11400 1227705 1228145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 1228899 1228561 gene locus_tag LOCUS_11410 1228899 1228561 CDS product YebY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096105.1 protein_id gnl|my_center|LOCUS_11410 1229785 1228916 gene locus_tag LOCUS_11420 gene copD 1229785 1228916 CDS product copper homeostasis membrane protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096104.1 protein_id gnl|my_center|LOCUS_11420 1230163 1229789 gene locus_tag LOCUS_11430 gene yobA 1230163 1229789 CDS product CopC domain-containing protein YobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168393.1 protein_id gnl|my_center|LOCUS_11430 1230300 1230530 gene locus_tag LOCUS_11440 1230300 1230530 CDS product DNA polymerase III subunit theta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096102.1 protein_id gnl|my_center|LOCUS_11440 1230557 1231219 gene locus_tag LOCUS_11450 gene exoX 1230557 1231219 CDS product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944256.1 protein_id gnl|my_center|LOCUS_11450 1233273 1231216 gene locus_tag LOCUS_11460 gene ptrB 1233273 1231216 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096099.1 protein_id gnl|my_center|LOCUS_11460 1234020 1233361 gene locus_tag LOCUS_11470 1234020 1233361 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024713.1 protein_id gnl|my_center|LOCUS_11470 1234463 1234116 gene locus_tag LOCUS_11480 gene yebF 1234463 1234116 CDS product protein YebF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042123.1 protein_id gnl|my_center|LOCUS_11480 1234830 1234528 gene locus_tag LOCUS_11490 1234830 1234528 CDS product YebG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705951.1 protein_id gnl|my_center|LOCUS_11490 1235007 1236140 gene locus_tag LOCUS_11500 gene purT 1235007 1236140 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173484.1 protein_id gnl|my_center|LOCUS_11500 1236836 1236195 gene locus_tag LOCUS_11510 gene kdgA 1236836 1236195 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800512.1 protein_id gnl|my_center|LOCUS_11510 1238686 1236875 gene locus_tag LOCUS_11520 gene edd 1238686 1236875 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366000.1 protein_id gnl|my_center|LOCUS_11520 1238631 1238867 gene locus_tag LOCUS_11530 1238631 1238867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1240386 1238911 gene locus_tag LOCUS_11540 gene zwf 1240386 1238911 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301712.1 protein_id gnl|my_center|LOCUS_11540 1240729 1241604 gene locus_tag LOCUS_11550 1240729 1241604 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882312.1 protein_id gnl|my_center|LOCUS_11550 1241724 1243166 gene locus_tag LOCUS_11560 gene pyk 1241724 1243166 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365996.1 protein_id gnl|my_center|LOCUS_11560 1244190 1243219 gene locus_tag LOCUS_11570 gene lpxM 1244190 1243219 CDS product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296141.1 protein_id gnl|my_center|LOCUS_11570 1245623 1244301 gene locus_tag LOCUS_11580 gene mepM 1245623 1244301 CDS product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096090.1 protein_id gnl|my_center|LOCUS_11580 1246523 1245639 gene locus_tag LOCUS_11590 gene znuA 1246523 1245639 CDS product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625584.1 protein_id gnl|my_center|LOCUS_11590 1246662 1247417 gene locus_tag LOCUS_11600 gene znuC 1246662 1247417 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832401.1 protein_id gnl|my_center|LOCUS_11600 1247414 1248199 gene locus_tag LOCUS_11610 gene znuB 1247414 1248199 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096087.1 protein_id gnl|my_center|LOCUS_11610 1249316 1248306 gene locus_tag LOCUS_11620 gene ruvB 1249316 1248306 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096086.1 protein_id gnl|my_center|LOCUS_11620 1249936 1249325 gene locus_tag LOCUS_11630 gene ruvA 1249936 1249325 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580323.1 protein_id gnl|my_center|LOCUS_11630 1250233 1250865 gene locus_tag LOCUS_11640 1250233 1250865 CDS product YebB family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069412.1 protein_id gnl|my_center|LOCUS_11640 1251389 1250868 gene locus_tag LOCUS_11650 gene ruvC 1251389 1250868 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022509.1 protein_id gnl|my_center|LOCUS_11650 1252166 1251423 gene locus_tag LOCUS_11660 1252166 1251423 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096082.1 protein_id gnl|my_center|LOCUS_11660 1252636 1252193 gene locus_tag LOCUS_11670 gene nudB 1252636 1252193 CDS product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323632.1 protein_id gnl|my_center|LOCUS_11670 1254416 1252638 gene locus_tag LOCUS_11680 gene aspS 1254416 1252638 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096080.1 protein_id gnl|my_center|LOCUS_11680 1254670 1255236 gene locus_tag LOCUS_11690 1254670 1255236 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096079.1 protein_id gnl|my_center|LOCUS_11690 1255233 1256051 gene locus_tag LOCUS_11700 1255233 1256051 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639226.1 protein_id gnl|my_center|LOCUS_11700 1256106 1256501 gene locus_tag LOCUS_11710 1256106 1256501 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096077.1 protein_id gnl|my_center|LOCUS_11710 1256541 1257284 gene locus_tag LOCUS_11720 gene cmoA 1256541 1257284 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019609.1 protein_id gnl|my_center|LOCUS_11720 1257281 1258252 gene locus_tag LOCUS_11730 gene cmoB 1257281 1258252 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569029.1 protein_id gnl|my_center|LOCUS_11730 1259105 1258362 gene locus_tag LOCUS_11740 gene cutC 1259105 1258362 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419924.1 protein_id gnl|my_center|LOCUS_11740 1259744 1259178 gene locus_tag LOCUS_11750 1259744 1259178 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096073.1 protein_id gnl|my_center|LOCUS_11750 1259981 1261714 gene locus_tag LOCUS_11760 gene argS 1259981 1261714 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705961.1 protein_id gnl|my_center|LOCUS_11760 1263104 1261965 gene locus_tag LOCUS_11770 1263104 1261965 CDS product glycoside hydrolase family 105 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989908.1 protein_id gnl|my_center|LOCUS_11770 1264691 1263105 gene locus_tag LOCUS_11780 1264691 1263105 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096070.1 protein_id gnl|my_center|LOCUS_11780 1265357 1264965 gene locus_tag LOCUS_11790 gene flhe 1265357 1264965 CDS product flagellar protein FlhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259587.1 protein_id gnl|my_center|LOCUS_11790 1267435 1265357 gene locus_tag LOCUS_11800 gene flhA 1267435 1265357 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096067.1 protein_id gnl|my_center|LOCUS_11800 1268576 1267428 gene locus_tag LOCUS_11810 gene flhB 1268576 1267428 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096066.1 protein_id gnl|my_center|LOCUS_11810 1268820 1270352 gene locus_tag LOCUS_11820 gene dgt 1268820 1270352 CDS product dNTP triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003513.1 protein_id gnl|my_center|LOCUS_11820 1270315 1271073 gene locus_tag LOCUS_11830 1270315 1271073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1271435 1272010 gene locus_tag LOCUS_11840 gene fimA 1271435 1272010 CDS product type 1 fimbrial major subunit FimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095930.1 protein_id gnl|my_center|LOCUS_11840 1272196 1272888 gene locus_tag LOCUS_11850 1272196 1272888 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044779.1 protein_id gnl|my_center|LOCUS_11850 1272974 1275430 gene locus_tag LOCUS_11860 1272974 1275430 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136472.1 protein_id gnl|my_center|LOCUS_11860 1275411 1276571 gene locus_tag LOCUS_11870 1275411 1276571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1277265 1276618 gene locus_tag LOCUS_11880 gene cheZ 1277265 1276618 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096065.1 protein_id gnl|my_center|LOCUS_11880 1277663 1277274 gene locus_tag LOCUS_11890 gene cheY 1277663 1277274 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500431.1 protein_id gnl|my_center|LOCUS_11890 1278730 1277681 gene locus_tag LOCUS_11900 1278730 1277681 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096064.1 protein_id gnl|my_center|LOCUS_11900 1279593 1278727 gene locus_tag LOCUS_11910 gene cheR 1279593 1278727 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500429.1 protein_id gnl|my_center|LOCUS_11910 1281211 1279613 gene locus_tag LOCUS_11920 gene tap 1281211 1279613 CDS product methyl-accepting chemotaxis protein IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096062.1 protein_id gnl|my_center|LOCUS_11920 1282883 1281252 gene locus_tag LOCUS_11930 gene tar 1282883 1281252 CDS product methyl-accepting chemotaxis protein II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096061.1 protein_id gnl|my_center|LOCUS_11930 1283988 1283020 gene locus_tag LOCUS_11940 1283988 1283020 CDS product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096060.1 protein_id gnl|my_center|LOCUS_11940 1286348 1283988 gene locus_tag LOCUS_11950 1286348 1283988 CDS product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096059.1 protein_id gnl|my_center|LOCUS_11950 1287115 1286360 gene locus_tag LOCUS_11960 1287115 1286360 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096058.1 protein_id gnl|my_center|LOCUS_11960 1287557 1287132 gene locus_tag LOCUS_11970 1287557 1287132 CDS product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027938.1 protein_id gnl|my_center|LOCUS_11970 1288268 1287699 gene locus_tag LOCUS_11980 1288268 1287699 CDS product spore coat protein U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096056.1 protein_id gnl|my_center|LOCUS_11980 1289378 1288875 gene locus_tag LOCUS_11990 gene cheW 1289378 1288875 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096054.1 protein_id gnl|my_center|LOCUS_11990 1291433 1289400 gene locus_tag LOCUS_12000 gene cheA 1291433 1289400 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096053.1 protein_id gnl|my_center|LOCUS_12000 1292373 1291444 gene locus_tag LOCUS_12010 gene motB 1292373 1291444 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795656.1 protein_id gnl|my_center|LOCUS_12010 1293257 1292370 gene locus_tag LOCUS_12020 gene motA 1293257 1292370 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906317.1 protein_id gnl|my_center|LOCUS_12020 1293959 1293381 gene locus_tag LOCUS_12030 gene flhC 1293959 1293381 CDS product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096051.1 protein_id gnl|my_center|LOCUS_12030 1294315 1293962 gene locus_tag LOCUS_12040 gene flhD 1294315 1293962 CDS product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096050.1 protein_id gnl|my_center|LOCUS_12040 1295105 1295533 gene locus_tag LOCUS_12050 gene uspC 1295105 1295533 CDS product universal stress protein UspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705964.1 protein_id gnl|my_center|LOCUS_12050 1296985 1295561 gene locus_tag LOCUS_12060 gene otsA 1296985 1295561 CDS product alpha,alpha-trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096048.1 protein_id gnl|my_center|LOCUS_12060 1297763 1296960 gene locus_tag LOCUS_12070 gene otsB 1297763 1296960 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096047.1 protein_id gnl|my_center|LOCUS_12070 1298928 1297948 gene locus_tag LOCUS_12080 gene araH 1298928 1297948 CDS product L-arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096046.1 protein_id gnl|my_center|LOCUS_12080 1300457 1298943 gene locus_tag LOCUS_12090 gene araG 1300457 1298943 CDS product arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187828.1 protein_id gnl|my_center|LOCUS_12090 1301522 1300533 gene locus_tag LOCUS_12100 1301522 1300533 CDS product arabinose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705967.1 protein_id gnl|my_center|LOCUS_12100 1301785 1301582 gene locus_tag LOCUS_12110 1301785 1301582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 1302409 1301852 gene locus_tag LOCUS_12120 1302409 1301852 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754799.1 protein_id gnl|my_center|LOCUS_12120 1302932 1303435 gene locus_tag LOCUS_12130 1302932 1303435 CDS product non-heme ferritin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741707.1 protein_id gnl|my_center|LOCUS_12130 1303629 1304972 gene locus_tag LOCUS_12140 1303629 1304972 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096042.1 protein_id gnl|my_center|LOCUS_12140 1305437 1305186 gene locus_tag LOCUS_12150 gene yecJ 1305437 1305186 CDS product DUF2766 family protein YecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082127.1 protein_id gnl|my_center|LOCUS_12150 1305851 1307272 gene locus_tag LOCUS_12160 1305851 1307272 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705969.1 protein_id gnl|my_center|LOCUS_12160 1307957 1307319 gene locus_tag LOCUS_12170 1307957 1307319 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096040.1 protein_id gnl|my_center|LOCUS_12170 1308058 1308309 gene locus_tag LOCUS_12180 1308058 1308309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 1308275 1310389 gene locus_tag LOCUS_12190 1308275 1310389 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063517.1 protein_id gnl|my_center|LOCUS_12190 1310463 1310831 gene locus_tag LOCUS_12200 1310463 1310831 CDS product YecR-like lipofamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803230.1 protein_id gnl|my_center|LOCUS_12200 1311039 1311536 gene locus_tag LOCUS_12210 gene ftnA 1311039 1311536 CDS product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365960.1 protein_id gnl|my_center|LOCUS_12210 1311784 1312962 gene locus_tag LOCUS_12220 gene tyrP 1311784 1312962 CDS product tyrosine transporter TyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797566.1 protein_id gnl|my_center|LOCUS_12220 1313672 1313007 gene locus_tag LOCUS_12230 gene yecA 1313672 1313007 CDS product UPF0149 family protein YecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847882.1 protein_id gnl|my_center|LOCUS_12230 1313896 1313810 gene locus_tag LOCUS_t00070 1313896 1313810 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1313982 1313909 gene locus_tag LOCUS_t00080 1313982 1313909 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1314108 1314033 gene locus_tag LOCUS_t00090 1314108 1314033 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1314808 1314260 gene locus_tag LOCUS_12240 gene pgsA 1314808 1314260 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096028.1 protein_id gnl|my_center|LOCUS_12240 1316698 1314866 gene locus_tag LOCUS_12250 gene uvrC 1316698 1314866 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096027.1 protein_id gnl|my_center|LOCUS_12250 1317351 1316695 gene locus_tag LOCUS_12260 gene uvrY 1317351 1316695 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096026.1 protein_id gnl|my_center|LOCUS_12260 1317809 1318033 gene locus_tag LOCUS_12270 1317809 1318033 CDS product DUF2594 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365908.1 protein_id gnl|my_center|LOCUS_12270 1318810 1318088 gene locus_tag LOCUS_12280 gene sdiA 1318810 1318088 CDS product transcriptional regulator SdiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157173.1 protein_id gnl|my_center|LOCUS_12280 1319325 1319098 gene locus_tag LOCUS_12290 1319325 1319098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1319944 1319348 gene locus_tag LOCUS_12300 1319944 1319348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1320948 1320196 gene locus_tag LOCUS_12310 gene yecC 1320948 1320196 CDS product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096023.1 protein_id gnl|my_center|LOCUS_12310 1321613 1320945 gene locus_tag LOCUS_12320 gene tcyL 1321613 1320945 CDS product cystine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096022.1 protein_id gnl|my_center|LOCUS_12320 1322620 1321634 gene locus_tag LOCUS_12330 gene dcyD 1322620 1321634 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128215.1 protein_id gnl|my_center|LOCUS_12330 1323527 1322727 gene locus_tag LOCUS_12340 gene tcyJ 1323527 1322727 CDS product cystine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096020.1 protein_id gnl|my_center|LOCUS_12340 1324165 1323614 gene locus_tag LOCUS_12350 gene fliZ 1324165 1323614 CDS product flagella biosynthesis regulatory protein FliZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096019.1 protein_id gnl|my_center|LOCUS_12350 1324913 1324224 gene locus_tag LOCUS_12360 1324913 1324224 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096018.1 protein_id gnl|my_center|LOCUS_12360 1325848 1325105 gene locus_tag LOCUS_12370 1325848 1325105 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096017.1 protein_id gnl|my_center|LOCUS_12370 1326300 1325860 gene locus_tag LOCUS_12380 1326300 1325860 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096016.1 protein_id gnl|my_center|LOCUS_12380 1327268 1326297 gene locus_tag LOCUS_12390 1327268 1326297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096015.1 protein_id gnl|my_center|LOCUS_12390 1328227 1327265 gene locus_tag LOCUS_12400 1328227 1327265 CDS product glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028148.1 protein_id gnl|my_center|LOCUS_12400 1328928 1328230 gene locus_tag LOCUS_12410 1328928 1328230 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096013.1 protein_id gnl|my_center|LOCUS_12410 1330106 1328943 gene locus_tag LOCUS_12420 1330106 1328943 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096012.1 protein_id gnl|my_center|LOCUS_12420 1333668 1330207 gene locus_tag LOCUS_12430 1333668 1330207 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096011.1 protein_id gnl|my_center|LOCUS_12430 1335562 1333979 gene locus_tag LOCUS_12440 1335562 1333979 CDS product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079784.1 protein_id gnl|my_center|LOCUS_12440 1335819 1337231 gene locus_tag LOCUS_12450 gene fliD 1335819 1337231 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146805.1 protein_id gnl|my_center|LOCUS_12450 1337243 1337647 gene locus_tag LOCUS_12460 gene fliS 1337243 1337647 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287765.1 protein_id gnl|my_center|LOCUS_12460 1337647 1338018 gene locus_tag LOCUS_12470 gene fliT 1337647 1338018 CDS product flagella biosynthesis regulatory protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204899.1 protein_id gnl|my_center|LOCUS_12470 1338074 1339558 gene locus_tag LOCUS_12480 gene amyA 1338074 1339558 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245709.1 protein_id gnl|my_center|LOCUS_12480 1340014 1339598 gene locus_tag LOCUS_12490 gene yedD 1340014 1339598 CDS product lipoprotein YedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096004.1 protein_id gnl|my_center|LOCUS_12490 1340203 1341408 gene locus_tag LOCUS_12500 gene yedE 1340203 1341408 CDS product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580669.1 protein_id gnl|my_center|LOCUS_12500 1341405 1341638 gene locus_tag LOCUS_12510 gene yedF 1341405 1341638 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096288.1 protein_id gnl|my_center|LOCUS_12510 1342245 1341877 gene locus_tag LOCUS_12520 1342245 1341877 CDS product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125351949.1 protein_id gnl|my_center|LOCUS_12520 1342487 1342248 gene locus_tag LOCUS_12530 1342487 1342248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096002.1 protein_id gnl|my_center|LOCUS_12530 1342936 1344114 gene locus_tag LOCUS_12540 1342936 1344114 CDS product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 protein_id gnl|my_center|LOCUS_12540 1344126 1345148 gene locus_tag LOCUS_12550 1344126 1345148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1347058 1345160 gene locus_tag LOCUS_12560 1347058 1345160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1349592 1347115 gene locus_tag LOCUS_12570 1349592 1347115 CDS product host specificity factor TipJ family phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026094292.1 protein_id gnl|my_center|LOCUS_12570 1349995 1349579 gene locus_tag LOCUS_12580 1349995 1349579 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097707.1 protein_id gnl|my_center|LOCUS_12580 1350428 1349958 gene locus_tag LOCUS_12590 1350428 1349958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095995.1 protein_id gnl|my_center|LOCUS_12590 1350925 1350428 gene locus_tag LOCUS_12600 1350925 1350428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097709.1 protein_id gnl|my_center|LOCUS_12600 1353564 1350925 gene locus_tag LOCUS_12610 1353564 1350925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1353966 1353595 gene locus_tag LOCUS_12620 1353966 1353595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1354731 1354057 gene locus_tag LOCUS_12630 1354731 1354057 CDS product DUF6246 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097711.1 protein_id gnl|my_center|LOCUS_12630 1355534 1354791 gene locus_tag LOCUS_12640 1355534 1354791 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097712.1 protein_id gnl|my_center|LOCUS_12640 1355946 1355554 gene locus_tag LOCUS_12650 1355946 1355554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705870.1 protein_id gnl|my_center|LOCUS_12650 1356311 1355943 gene locus_tag LOCUS_12660 1356311 1355943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705871.1 protein_id gnl|my_center|LOCUS_12660 1356664 1356314 gene locus_tag LOCUS_12670 1356664 1356314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095987.1 protein_id gnl|my_center|LOCUS_12670 1356837 1356664 gene locus_tag LOCUS_12680 1356837 1356664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006820518.1 protein_id gnl|my_center|LOCUS_12680 1357217 1356837 gene locus_tag LOCUS_12690 1357217 1356837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705874.1 protein_id gnl|my_center|LOCUS_12690 1357585 1357220 gene locus_tag LOCUS_12700 1357585 1357220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 1358680 1357595 gene locus_tag LOCUS_12710 1358680 1357595 CDS product DUF6260 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705876.1 protein_id gnl|my_center|LOCUS_12710 1359125 1358691 gene locus_tag LOCUS_12720 1359125 1358691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705877.1 protein_id gnl|my_center|LOCUS_12720 1360526 1359129 gene locus_tag LOCUS_12730 1360526 1359129 CDS product DUF2213 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705878.1 protein_id gnl|my_center|LOCUS_12730 1361099 1360596 gene locus_tag LOCUS_12740 1361099 1360596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816502.1 protein_id gnl|my_center|LOCUS_12740 1362024 1361134 gene locus_tag LOCUS_12750 1362024 1361134 CDS product phage minor head protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705880.1 protein_id gnl|my_center|LOCUS_12750 1363513 1362056 gene locus_tag LOCUS_12760 1363513 1362056 CDS product DUF1073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188035104.1 protein_id gnl|my_center|LOCUS_12760 1365072 1363525 gene locus_tag LOCUS_12770 1365072 1363525 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816477.1 protein_id gnl|my_center|LOCUS_12770 1365719 1365069 gene locus_tag LOCUS_12780 1365719 1365069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705883.1 protein_id gnl|my_center|LOCUS_12780 1365929 1365723 gene locus_tag LOCUS_12790 1365929 1365723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1366144 1365926 gene locus_tag LOCUS_12800 1366144 1365926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 1366769 1366260 gene locus_tag LOCUS_12810 1366769 1366260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024699234.1 protein_id gnl|my_center|LOCUS_12810 1367119 1366847 gene locus_tag LOCUS_12820 1367119 1366847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1367413 1367240 gene locus_tag LOCUS_12830 1367413 1367240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 1367637 1367410 gene locus_tag LOCUS_12840 1367637 1367410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 1367830 1367561 gene locus_tag LOCUS_12850 1367830 1367561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096313.1 protein_id gnl|my_center|LOCUS_12850 1368081 1367827 gene locus_tag LOCUS_12860 1368081 1367827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 1368620 1368081 gene locus_tag LOCUS_12870 1368620 1368081 CDS product putative peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166765.1 protein_id gnl|my_center|LOCUS_12870 1368907 1368617 gene locus_tag LOCUS_12880 1368907 1368617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 1369277 1368897 gene locus_tag LOCUS_12890 1369277 1368897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1369492 1369417 gene locus_tag LOCUS_t00100 1369492 1369417 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1369572 1369498 gene locus_tag LOCUS_t00110 1369572 1369498 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1370360 1369671 gene locus_tag LOCUS_12900 1370360 1369671 CDS product bacteriophage antitermination protein Q inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705893.1 protein_id gnl|my_center|LOCUS_12900 1370518 1370357 gene locus_tag LOCUS_12910 1370518 1370357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 1371114 1370515 gene locus_tag LOCUS_12920 1371114 1370515 CDS product recombination protein NinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211735.1 protein_id gnl|my_center|LOCUS_12920 1371277 1371107 gene locus_tag LOCUS_12930 1371277 1371107 CDS product NinE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095967.1 protein_id gnl|my_center|LOCUS_12930 1371858 1371277 gene locus_tag LOCUS_12940 1371858 1371277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 1372282 1371851 gene locus_tag LOCUS_12950 gene ybcN 1372282 1371851 CDS product DNA base-flipping protein YbcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053016.1 protein_id gnl|my_center|LOCUS_12950 1372966 1372715 gene locus_tag LOCUS_12960 1372966 1372715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 1373263 1373024 gene locus_tag LOCUS_12970 1373263 1373024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1374090 1373260 gene locus_tag LOCUS_12980 1374090 1373260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1374576 1374094 gene locus_tag LOCUS_12990 1374576 1374094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1374851 1374573 gene locus_tag LOCUS_13000 1374851 1374573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1375282 1374848 gene locus_tag LOCUS_13010 1375282 1374848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 1375557 1375279 gene locus_tag LOCUS_13020 1375557 1375279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1375874 1375554 gene locus_tag LOCUS_13030 1375874 1375554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 1376726 1375878 gene locus_tag LOCUS_13040 1376726 1375878 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988183.1 protein_id gnl|my_center|LOCUS_13040 1377625 1376729 gene locus_tag LOCUS_13050 1377625 1376729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1378362 1377625 gene locus_tag LOCUS_13060 1378362 1377625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1378683 1378399 gene locus_tag LOCUS_13070 1378683 1378399 CDS product lambda phage CII family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251072.1 protein_id gnl|my_center|LOCUS_13070 1379051 1378821 gene locus_tag LOCUS_13080 1379051 1378821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072342.1 protein_id gnl|my_center|LOCUS_13080 1379131 1379838 gene locus_tag LOCUS_13090 1379131 1379838 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858975.1 protein_id gnl|my_center|LOCUS_13090 1380104 1380406 gene locus_tag LOCUS_13100 1380104 1380406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1380494 1380757 gene locus_tag LOCUS_13110 1380494 1380757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1380901 1381143 gene locus_tag LOCUS_13120 1380901 1381143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1381140 1381301 gene locus_tag LOCUS_13130 1381140 1381301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095950.1 protein_id gnl|my_center|LOCUS_13130 1381585 1382589 gene locus_tag LOCUS_13140 1381585 1382589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005791.1 protein_id gnl|my_center|LOCUS_13140 1382597 1382875 gene locus_tag LOCUS_13150 gene gamL 1382597 1382875 CDS product host nuclease inhibitor GamL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995345.1 protein_id gnl|my_center|LOCUS_13150 1382895 1383812 gene locus_tag LOCUS_13160 1382895 1383812 CDS product recombinase RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459721.1 protein_id gnl|my_center|LOCUS_13160 1383809 1384492 gene locus_tag LOCUS_13170 1383809 1384492 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095946.1 protein_id gnl|my_center|LOCUS_13170 1384492 1384950 gene locus_tag LOCUS_13180 1384492 1384950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095945.1 protein_id gnl|my_center|LOCUS_13180 1385048 1385266 gene locus_tag LOCUS_13190 1385048 1385266 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032665755.1 protein_id gnl|my_center|LOCUS_13190 1385266 1385646 gene locus_tag LOCUS_13200 1385266 1385646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 1385621 1385860 gene locus_tag LOCUS_13210 1385621 1385860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1386327 1386527 gene locus_tag LOCUS_13220 1386327 1386527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 1386537 1387091 gene locus_tag LOCUS_13230 1386537 1387091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1387129 1387374 gene locus_tag LOCUS_13240 1387129 1387374 CDS product excisionase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097283.1 protein_id gnl|my_center|LOCUS_13240 1387420 1388718 gene locus_tag LOCUS_13250 1387420 1388718 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120816036.1 protein_id gnl|my_center|LOCUS_13250 1389053 1388742 gene locus_tag LOCUS_13260 gene fliE 1389053 1388742 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097729.1 protein_id gnl|my_center|LOCUS_13260 1389282 1391000 gene locus_tag LOCUS_13270 gene fliF 1389282 1391000 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097730.1 protein_id gnl|my_center|LOCUS_13270 1390993 1391988 gene locus_tag LOCUS_13280 gene fliG 1390993 1391988 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067950.1 protein_id gnl|my_center|LOCUS_13280 1391981 1392688 gene locus_tag LOCUS_13290 gene fliH 1391981 1392688 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097731.1 protein_id gnl|my_center|LOCUS_13290 1392688 1394058 gene locus_tag LOCUS_13300 gene fliI 1392688 1394058 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097732.1 protein_id gnl|my_center|LOCUS_13300 1394074 1394520 gene locus_tag LOCUS_13310 gene fliJ 1394074 1394520 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097733.1 protein_id gnl|my_center|LOCUS_13310 1394517 1395782 gene locus_tag LOCUS_13320 gene fliK 1394517 1395782 CDS product flagellar hook length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631663.1 protein_id gnl|my_center|LOCUS_13320 1395932 1396402 gene locus_tag LOCUS_13330 gene fliL 1395932 1396402 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832480.1 protein_id gnl|my_center|LOCUS_13330 1396407 1397411 gene locus_tag LOCUS_13340 gene fliM 1396407 1397411 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502815.1 protein_id gnl|my_center|LOCUS_13340 1397408 1397821 gene locus_tag LOCUS_13350 gene fliN 1397408 1397821 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500318.1 protein_id gnl|my_center|LOCUS_13350 1397824 1398198 gene locus_tag LOCUS_13360 gene fliO 1397824 1398198 CDS product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097737.1 protein_id gnl|my_center|LOCUS_13360 1398198 1398935 gene locus_tag LOCUS_13370 gene fliP 1398198 1398935 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253411.1 protein_id gnl|my_center|LOCUS_13370 1398947 1399216 gene locus_tag LOCUS_13380 gene fliQ 1398947 1399216 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187355.1 protein_id gnl|my_center|LOCUS_13380 1399225 1400010 gene locus_tag LOCUS_13390 gene fliR 1399225 1400010 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983976.1 protein_id gnl|my_center|LOCUS_13390 1400448 1400924 gene locus_tag LOCUS_13400 gene rcsA 1400448 1400924 CDS product transcriptional regulator RcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097740.1 protein_id gnl|my_center|LOCUS_13400 1401167 1400979 gene locus_tag LOCUS_13410 gene dsrB 1401167 1400979 CDS product protein DsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097741.1 protein_id gnl|my_center|LOCUS_13410 1401298 1401528 gene locus_tag LOCUS_13420 gene yodD 1401298 1401528 CDS product YodD family peroxide/acid resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705984.1 protein_id gnl|my_center|LOCUS_13420 1401832 1402671 gene locus_tag LOCUS_13430 1401832 1402671 CDS product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948794.1 protein_id gnl|my_center|LOCUS_13430 1404338 1402626 gene locus_tag LOCUS_13440 gene dgcQ 1404338 1402626 CDS product cellulose biosynthesis regulator diguanylate cyclase DgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001513322.1 protein_id gnl|my_center|LOCUS_13440 1404636 1404454 gene locus_tag LOCUS_13450 1404636 1404454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13450 1405626 1404715 gene locus_tag LOCUS_13460 1405626 1404715 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097746.1 protein_id gnl|my_center|LOCUS_13460 1405805 1406716 gene locus_tag LOCUS_13470 gene yedA 1405805 1406716 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097747.1 protein_id gnl|my_center|LOCUS_13470 1407189 1406719 gene locus_tag LOCUS_13480 gene vsr 1407189 1406719 CDS product VSPR family DNA mismatch endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785988.1 protein_id gnl|my_center|LOCUS_13480 1407905 1407207 gene locus_tag LOCUS_13490 1407905 1407207 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365890.1 protein_id gnl|my_center|LOCUS_13490 1408387 1409562 gene locus_tag LOCUS_13500 gene ompC 1408387 1409562 CDS product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097752.1 protein_id gnl|my_center|LOCUS_13500 1409938 1410378 gene locus_tag LOCUS_13510 1409938 1410378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 1411805 1410537 gene locus_tag LOCUS_13520 1411805 1410537 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705848.1 protein_id gnl|my_center|LOCUS_13520 1412226 1411789 gene locus_tag LOCUS_13530 gene umuD 1412226 1411789 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882790.1 protein_id gnl|my_center|LOCUS_13530 1412792 1412388 gene locus_tag LOCUS_13540 1412792 1412388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 >Feature sequence02 28 103 gene locus_tag LOCUS_t00120 28 103 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1126 368 gene locus_tag LOCUS_13550 1126 368 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099005.1 protein_id gnl|my_center|LOCUS_13550 2238 1135 gene locus_tag LOCUS_13560 2238 1135 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001351330.1 protein_id gnl|my_center|LOCUS_13560 3429 2248 gene locus_tag LOCUS_13570 3429 2248 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019643.1 protein_id gnl|my_center|LOCUS_13570 4536 3511 gene locus_tag LOCUS_13580 4536 3511 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738579.1 protein_id gnl|my_center|LOCUS_13580 5148 4921 gene locus_tag LOCUS_13590 5148 4921 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099001.1 protein_id gnl|my_center|LOCUS_13590 5949 5269 gene locus_tag LOCUS_13600 gene envR 5949 5269 CDS product acrEF/envCD operon transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446923.1 protein_id gnl|my_center|LOCUS_13600 6315 7478 gene locus_tag LOCUS_13610 gene acrE 6315 7478 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AcrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160348.1 protein_id gnl|my_center|LOCUS_13610 7505 10615 gene locus_tag LOCUS_13620 7505 10615 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703631.1 protein_id gnl|my_center|LOCUS_13620 12720 10663 gene locus_tag LOCUS_13630 12720 10663 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098998.1 protein_id gnl|my_center|LOCUS_13630 13507 13211 gene locus_tag LOCUS_13640 gene fis 13507 13211 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210061.1 protein_id gnl|my_center|LOCUS_13640 14405 13533 gene locus_tag LOCUS_13650 gene dusB 14405 13533 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369451.1 protein_id gnl|my_center|LOCUS_13650 15703 14822 gene locus_tag LOCUS_13660 gene prmA 15703 14822 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145849.1 protein_id gnl|my_center|LOCUS_13660 17166 15715 gene locus_tag LOCUS_13670 gene panF 17166 15715 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098994.1 protein_id gnl|my_center|LOCUS_13670 17398 17156 gene locus_tag LOCUS_13680 17398 17156 CDS product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098993.1 protein_id gnl|my_center|LOCUS_13680 18854 17505 gene locus_tag LOCUS_13690 gene accC 18854 17505 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369455.1 protein_id gnl|my_center|LOCUS_13690 19336 18866 gene locus_tag LOCUS_13700 gene accB 19336 18866 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354622.1 protein_id gnl|my_center|LOCUS_13700 19810 19358 gene locus_tag LOCUS_13710 gene aroQ 19810 19358 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369457.1 protein_id gnl|my_center|LOCUS_13710 20644 20045 gene locus_tag LOCUS_13720 gene msrQ 20644 20045 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098990.1 protein_id gnl|my_center|LOCUS_13720 21646 20645 gene locus_tag LOCUS_13730 gene msrP 21646 20645 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098989.1 protein_id gnl|my_center|LOCUS_13730 21923 23863 gene locus_tag LOCUS_13740 gene csrD 21923 23863 CDS product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098987.1 protein_id gnl|my_center|LOCUS_13740 24169 25212 gene locus_tag LOCUS_13750 gene mreB 24169 25212 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918653.1 protein_id gnl|my_center|LOCUS_13750 25280 26275 gene locus_tag LOCUS_13760 gene mreC 25280 26275 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098986.1 protein_id gnl|my_center|LOCUS_13760 26275 26763 gene locus_tag LOCUS_13770 gene mreD 26275 26763 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098985.1 protein_id gnl|my_center|LOCUS_13770 26773 27366 gene locus_tag LOCUS_13780 gene yhdE 26773 27366 CDS product nucleoside triphosphate pyrophosphatase YhdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203096.1 protein_id gnl|my_center|LOCUS_13780 27356 28825 gene locus_tag LOCUS_13790 gene rng 27356 28825 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123188.1 protein_id gnl|my_center|LOCUS_13790 28872 32672 gene locus_tag LOCUS_13800 gene yhdP 28872 32672 CDS product AsmA2 domain-containing protein YhdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098981.1 protein_id gnl|my_center|LOCUS_13800 32787 34235 gene locus_tag LOCUS_13810 gene tldD 32787 34235 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055913.1 protein_id gnl|my_center|LOCUS_13810 35287 34358 gene locus_tag LOCUS_13820 gene aaeR 35287 34358 CDS product HTH-type transcriptional activator AaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098979.1 protein_id gnl|my_center|LOCUS_13820 35467 35670 gene locus_tag LOCUS_13830 gene aaeX 35467 35670 CDS product p-hydroxybenzoic acid efflux pump operon protein AaeX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051840.1 protein_id gnl|my_center|LOCUS_13830 35678 36610 gene locus_tag LOCUS_13840 gene aaeA 35678 36610 CDS product p-hydroxybenzoic acid efflux pump subunit AaeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855134.1 protein_id gnl|my_center|LOCUS_13840 36616 38583 gene locus_tag LOCUS_13850 gene aaeB 36616 38583 CDS product p-hydroxybenzoic acid efflux pump subunit AaeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098977.1 protein_id gnl|my_center|LOCUS_13850 38665 40119 gene locus_tag LOCUS_13860 38665 40119 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098976.1 protein_id gnl|my_center|LOCUS_13860 40152 40424 gene locus_tag LOCUS_13870 40152 40424 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029005.1 protein_id gnl|my_center|LOCUS_13870 40745 40482 gene locus_tag LOCUS_13880 gene yhcN 40745 40482 CDS product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098973.1 protein_id gnl|my_center|LOCUS_13880 41563 41123 gene locus_tag LOCUS_13890 gene argR 41563 41123 CDS product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257847.1 protein_id gnl|my_center|LOCUS_13890 42016 42954 gene locus_tag LOCUS_13900 gene mdh 42016 42954 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098971.1 protein_id gnl|my_center|LOCUS_13900 44076 43009 gene locus_tag LOCUS_13910 gene degS 44076 43009 CDS product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098970.1 protein_id gnl|my_center|LOCUS_13910 45531 44164 gene locus_tag LOCUS_13920 gene degQ 45531 44164 CDS product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098969.1 protein_id gnl|my_center|LOCUS_13920 46105 45701 gene locus_tag LOCUS_13930 gene zapG 46105 45701 CDS product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481183.1 protein_id gnl|my_center|LOCUS_13930 46293 47417 gene locus_tag LOCUS_13940 gene zapE 46293 47417 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192314.1 protein_id gnl|my_center|LOCUS_13940 47727 48155 gene locus_tag LOCUS_13950 gene rplM 47727 48155 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847559.1 protein_id gnl|my_center|LOCUS_13950 48170 48562 gene locus_tag LOCUS_13960 gene rpsI 48170 48562 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829815.1 protein_id gnl|my_center|LOCUS_13960 48874 49512 gene locus_tag LOCUS_13970 gene sspA 48874 49512 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257300.1 protein_id gnl|my_center|LOCUS_13970 49518 50015 gene locus_tag LOCUS_13980 gene sspB 49518 50015 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366112.1 protein_id gnl|my_center|LOCUS_13980 50679 50044 gene locus_tag LOCUS_13990 50679 50044 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001317442.1 protein_id gnl|my_center|LOCUS_13990 50846 51634 gene locus_tag LOCUS_14000 50846 51634 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005053961.1 protein_id gnl|my_center|LOCUS_14000 51650 52801 gene locus_tag LOCUS_14010 51650 52801 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257480.1 protein_id gnl|my_center|LOCUS_14010 52811 53644 gene locus_tag LOCUS_14020 52811 53644 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067536.1 protein_id gnl|my_center|LOCUS_14020 53723 54940 gene locus_tag LOCUS_14030 53723 54940 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368095.1 protein_id gnl|my_center|LOCUS_14030 54950 57019 gene locus_tag LOCUS_14040 54950 57019 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080381.1 protein_id gnl|my_center|LOCUS_14040 57119 57904 gene locus_tag LOCUS_14050 gene nanR 57119 57904 CDS product transcriptional regulator NanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382926.1 protein_id gnl|my_center|LOCUS_14050 58065 58934 gene locus_tag LOCUS_14060 gene nanA 58065 58934 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029662.1 protein_id gnl|my_center|LOCUS_14060 59093 60583 gene locus_tag LOCUS_14070 gene nanT 59093 60583 CDS product sialic acid transporter NanT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108474.1 protein_id gnl|my_center|LOCUS_14070 60643 61518 gene locus_tag LOCUS_14080 gene nanK 60643 61518 CDS product N-acetylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208982.1 protein_id gnl|my_center|LOCUS_14080 61515 61991 gene locus_tag LOCUS_14090 gene nanQ 61515 61991 CDS product N-acetylneuraminate anomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979896.1 protein_id gnl|my_center|LOCUS_14090 63511 62093 gene locus_tag LOCUS_14100 gene gltD 63511 62093 CDS product glutamate synthase subunit GltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098959.1 protein_id gnl|my_center|LOCUS_14100 67981 63521 gene locus_tag LOCUS_14110 gene gltB 67981 63521 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098958.1 protein_id gnl|my_center|LOCUS_14110 68653 69582 gene locus_tag LOCUS_14120 68653 69582 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296449.1 protein_id gnl|my_center|LOCUS_14120 73030 69707 gene locus_tag LOCUS_14130 gene mscM 73030 69707 CDS product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236760.1 protein_id gnl|my_center|LOCUS_14130 74014 73052 gene locus_tag LOCUS_14140 gene asd 74014 73052 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934927.1 protein_id gnl|my_center|LOCUS_14140 75154 74102 gene locus_tag LOCUS_14150 gene rsgA 75154 74102 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041970.1 protein_id gnl|my_center|LOCUS_14150 75262 75807 gene locus_tag LOCUS_14160 gene orn 75262 75807 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704162.1 protein_id gnl|my_center|LOCUS_14160 76126 76284 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 77707 76568 gene locus_tag LOCUS_14170 gene queG 77707 76568 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095281.1 protein_id gnl|my_center|LOCUS_14170 77706 79232 gene locus_tag LOCUS_14180 gene nnr 77706 79232 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418520.1 protein_id gnl|my_center|LOCUS_14180 79225 79686 gene locus_tag LOCUS_14190 gene tsaE 79225 79686 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095283.1 protein_id gnl|my_center|LOCUS_14190 79703 81040 gene locus_tag LOCUS_14200 gene amiB 79703 81040 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619489.1 protein_id gnl|my_center|LOCUS_14200 81050 82906 gene locus_tag LOCUS_14210 gene mutL 81050 82906 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122547.1 protein_id gnl|my_center|LOCUS_14210 82899 83849 gene locus_tag LOCUS_14220 gene miaA 82899 83849 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280339.1 protein_id gnl|my_center|LOCUS_14220 83946 84254 gene locus_tag LOCUS_14230 gene hfq 83946 84254 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095287.1 protein_id gnl|my_center|LOCUS_14230 84330 85610 gene locus_tag LOCUS_14240 gene hflX 84330 85610 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095288.1 protein_id gnl|my_center|LOCUS_14240 85680 86936 gene locus_tag LOCUS_14250 gene hflK 85680 86936 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095289.1 protein_id gnl|my_center|LOCUS_14250 86939 87943 gene locus_tag LOCUS_14260 gene hflC 86939 87943 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232412.1 protein_id gnl|my_center|LOCUS_14260 88024 88221 gene locus_tag LOCUS_14270 88024 88221 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095291.1 protein_id gnl|my_center|LOCUS_14270 88324 89622 gene locus_tag LOCUS_14280 88324 89622 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002885665.1 protein_id gnl|my_center|LOCUS_14280 89777 90202 gene locus_tag LOCUS_14290 gene nsrR 89777 90202 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095292.1 protein_id gnl|my_center|LOCUS_14290 90241 92721 gene locus_tag LOCUS_14300 gene rnr 90241 92721 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704173.1 protein_id gnl|my_center|LOCUS_14300 92787 93518 gene locus_tag LOCUS_14310 gene rlmB 92787 93518 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095294.1 protein_id gnl|my_center|LOCUS_14310 93803 95422 gene locus_tag LOCUS_14320 93803 95422 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095296.1 protein_id gnl|my_center|LOCUS_14320 97344 95419 gene locus_tag LOCUS_14330 97344 95419 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095297.1 protein_id gnl|my_center|LOCUS_14330 97785 97510 gene locus_tag LOCUS_14340 gene yjfN 97785 97510 CDS product DUF1471 family protease activator YjfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139152684.1 protein_id gnl|my_center|LOCUS_14340 98241 97939 gene locus_tag LOCUS_14350 gene bsmA 98241 97939 CDS product biofilm peroxide resistance protein BsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586831.1 protein_id gnl|my_center|LOCUS_14350 98421 99173 gene locus_tag LOCUS_14360 gene yjfP 98421 99173 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095300.1 protein_id gnl|my_center|LOCUS_14360 99528 99253 gene locus_tag LOCUS_14370 gene yjfY 99528 99253 CDS product DUF1471 family protein YjfY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095308.1 protein_id gnl|my_center|LOCUS_14370 99873 100268 gene locus_tag LOCUS_14380 gene rpsF 99873 100268 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004098001.1 protein_id gnl|my_center|LOCUS_14380 100275 100589 gene locus_tag LOCUS_14390 gene priB 100275 100589 CDS product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856035.1 protein_id gnl|my_center|LOCUS_14390 100594 100821 gene locus_tag LOCUS_14400 gene rpsR 100594 100821 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135199.1 protein_id gnl|my_center|LOCUS_14400 100863 101312 gene locus_tag LOCUS_14410 gene rplI 100863 101312 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196065.1 protein_id gnl|my_center|LOCUS_14410 101473 102402 gene locus_tag LOCUS_14420 101473 102402 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095309.1 protein_id gnl|my_center|LOCUS_14420 103059 102442 gene locus_tag LOCUS_14430 103059 102442 CDS product OapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095310.1 protein_id gnl|my_center|LOCUS_14430 103292 103912 gene locus_tag LOCUS_14440 gene fklB 103292 103912 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001663320.1 protein_id gnl|my_center|LOCUS_14440 104228 105640 gene locus_tag LOCUS_14450 gene cycA 104228 105640 CDS product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228366.1 protein_id gnl|my_center|LOCUS_14450 106432 105770 gene locus_tag LOCUS_14460 gene ytfE 106432 105770 CDS product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331457.1 protein_id gnl|my_center|LOCUS_14460 106692 108341 gene locus_tag LOCUS_14470 106692 108341 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095313.1 protein_id gnl|my_center|LOCUS_14470 109314 108373 gene locus_tag LOCUS_14480 109314 108373 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095314.1 protein_id gnl|my_center|LOCUS_14480 110218 109388 gene locus_tag LOCUS_14490 110218 109388 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095315.1 protein_id gnl|my_center|LOCUS_14490 111142 110294 gene locus_tag LOCUS_14500 gene qorB 111142 110294 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560561.1 protein_id gnl|my_center|LOCUS_14500 111226 111618 gene locus_tag LOCUS_14510 111226 111618 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084623.1 protein_id gnl|my_center|LOCUS_14510 113591 111651 gene locus_tag LOCUS_14520 113591 111651 CDS product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589381.1 protein_id gnl|my_center|LOCUS_14520 113783 114529 gene locus_tag LOCUS_14530 gene cysQ 113783 114529 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886909.1 protein_id gnl|my_center|LOCUS_14530 115076 114519 gene locus_tag LOCUS_14540 115076 114519 CDS product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095323.1 protein_id gnl|my_center|LOCUS_14540 115403 115609 gene locus_tag LOCUS_14550 115403 115609 CDS product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501430.1 protein_id gnl|my_center|LOCUS_14550 117664 115697 gene locus_tag LOCUS_14560 117664 115697 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269419.1 protein_id gnl|my_center|LOCUS_14560 119139 117805 gene locus_tag LOCUS_14570 119139 117805 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095324.1 protein_id gnl|my_center|LOCUS_14570 119541 120317 gene locus_tag LOCUS_14580 119541 120317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 121383 120361 gene locus_tag LOCUS_14590 121383 120361 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095327.1 protein_id gnl|my_center|LOCUS_14590 122459 121383 gene locus_tag LOCUS_14600 122459 121383 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095328.1 protein_id gnl|my_center|LOCUS_14600 123634 122480 gene locus_tag LOCUS_14610 123634 122480 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_14610 123841 124875 gene locus_tag LOCUS_14620 123841 124875 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882373.1 protein_id gnl|my_center|LOCUS_14620 125032 124889 gene locus_tag LOCUS_14630 125032 124889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 126279 125029 gene locus_tag LOCUS_14640 gene tnaB 126279 125029 CDS product low affinity tryptophan permease TnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131925.1 protein_id gnl|my_center|LOCUS_14640 127804 126389 gene locus_tag LOCUS_14650 gene tnaA 127804 126389 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302010.1 protein_id gnl|my_center|LOCUS_14650 128853 128323 gene locus_tag LOCUS_14660 gene msrA 128853 128323 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830428.1 protein_id gnl|my_center|LOCUS_14660 129172 130905 gene locus_tag LOCUS_14670 gene tamA 129172 130905 CDS product autotransporter assembly complex protein TamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095333.1 protein_id gnl|my_center|LOCUS_14670 130902 134678 gene locus_tag LOCUS_14680 gene tamB 130902 134678 CDS product autotransporter assembly complex protein TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095334.1 protein_id gnl|my_center|LOCUS_14680 134681 135025 gene locus_tag LOCUS_14690 134681 135025 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704194.1 protein_id gnl|my_center|LOCUS_14690 135643 135113 gene locus_tag LOCUS_14700 gene ppa 135643 135113 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055079.1 protein_id gnl|my_center|LOCUS_14700 135886 135719 gene locus_tag LOCUS_14710 135886 135719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 136043 136999 gene locus_tag LOCUS_14720 gene ytfQ 136043 136999 CDS product galactofuranose ABC transporter substrate-binding protein YtfQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265942.1 protein_id gnl|my_center|LOCUS_14720 137197 138690 gene locus_tag LOCUS_14730 137197 138690 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205813.1 protein_id gnl|my_center|LOCUS_14730 138704 139726 gene locus_tag LOCUS_14740 138704 139726 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161799150.1 protein_id gnl|my_center|LOCUS_14740 139713 140714 gene locus_tag LOCUS_14750 gene yjfF 139713 140714 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830436.1 protein_id gnl|my_center|LOCUS_14750 140947 142512 gene locus_tag LOCUS_14760 140947 142512 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095343.1 protein_id gnl|my_center|LOCUS_14760 143601 142603 gene locus_tag LOCUS_14770 gene fbp 143601 142603 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095345.1 protein_id gnl|my_center|LOCUS_14770 143777 145159 gene locus_tag LOCUS_14780 gene mpl 143777 145159 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219792.1 protein_id gnl|my_center|LOCUS_14780 145823 145272 gene locus_tag LOCUS_14790 gene yjgA 145823 145272 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501414.1 protein_id gnl|my_center|LOCUS_14790 145918 147270 gene locus_tag LOCUS_14800 gene pmbA 145918 147270 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020079799.1 protein_id gnl|my_center|LOCUS_14800 147301 147684 gene locus_tag LOCUS_14810 gene cybC 147301 147684 CDS product cytochrome b562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232245.1 protein_id gnl|my_center|LOCUS_14810 148268 147804 gene locus_tag LOCUS_14820 gene nrdG 148268 147804 CDS product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106233.1 protein_id gnl|my_center|LOCUS_14820 150594 148456 gene locus_tag LOCUS_14830 gene nrdD 150594 148456 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368566.1 protein_id gnl|my_center|LOCUS_14830 152749 151094 gene locus_tag LOCUS_14840 gene treC 152749 151094 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298928.1 protein_id gnl|my_center|LOCUS_14840 154215 152797 gene locus_tag LOCUS_14850 gene treB 154215 152797 CDS product PTS trehalose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420863.1 protein_id gnl|my_center|LOCUS_14850 155364 154354 gene locus_tag LOCUS_14860 gene treR 155364 154354 CDS product trehalose operon repressor TreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181306.1 protein_id gnl|my_center|LOCUS_14860 155781 156758 gene locus_tag LOCUS_14870 155781 156758 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051196.1 protein_id gnl|my_center|LOCUS_14870 156821 157330 gene locus_tag LOCUS_14880 156821 157330 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168610.1 protein_id gnl|my_center|LOCUS_14880 157360 158646 gene locus_tag LOCUS_14890 157360 158646 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213124.1 protein_id gnl|my_center|LOCUS_14890 159348 158713 gene locus_tag LOCUS_14900 159348 158713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 159878 159492 gene locus_tag LOCUS_14910 gene ridA 159878 159492 CDS product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047544.1 protein_id gnl|my_center|LOCUS_14910 160420 159959 gene locus_tag LOCUS_14920 gene pyrI 160420 159959 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368555.1 protein_id gnl|my_center|LOCUS_14920 161369 160434 gene locus_tag LOCUS_14930 gene pyrB 161369 160434 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704213.1 protein_id gnl|my_center|LOCUS_14930 162083 161607 gene locus_tag LOCUS_14940 162083 161607 CDS product ArgR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095367.1 protein_id gnl|my_center|LOCUS_14940 163570 162167 gene locus_tag LOCUS_14950 163570 162167 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095368.1 protein_id gnl|my_center|LOCUS_14950 164625 163621 gene locus_tag LOCUS_14960 gene argF 164625 163621 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095369.1 protein_id gnl|my_center|LOCUS_14960 165716 164805 gene locus_tag LOCUS_14970 165716 164805 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095370.1 protein_id gnl|my_center|LOCUS_14970 166948 165728 gene locus_tag LOCUS_14980 gene arcA 166948 165728 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095371.1 protein_id gnl|my_center|LOCUS_14980 167623 168075 gene locus_tag LOCUS_14990 167623 168075 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095372.1 protein_id gnl|my_center|LOCUS_14990 169243 168239 gene locus_tag LOCUS_15000 gene argF 169243 168239 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012907.1 protein_id gnl|my_center|LOCUS_15000 169407 169832 gene locus_tag LOCUS_15010 gene rraB 169407 169832 CDS product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006810300.1 protein_id gnl|my_center|LOCUS_15010 169890 170648 gene locus_tag LOCUS_15020 gene miaE 169890 170648 CDS product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095379.1 protein_id gnl|my_center|LOCUS_15020 170665 171399 gene locus_tag LOCUS_15030 170665 171399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095380.1 protein_id gnl|my_center|LOCUS_15030 172065 171553 gene locus_tag LOCUS_15040 172065 171553 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368548.1 protein_id gnl|my_center|LOCUS_15040 172283 173446 gene locus_tag LOCUS_15050 172283 173446 CDS product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209177.1 protein_id gnl|my_center|LOCUS_15050 173433 174455 gene locus_tag LOCUS_15060 173433 174455 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209176.1 protein_id gnl|my_center|LOCUS_15060 177366 174511 gene locus_tag LOCUS_15070 177366 174511 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368547.1 protein_id gnl|my_center|LOCUS_15070 177809 177366 gene locus_tag LOCUS_15080 gene holC 177809 177366 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368546.1 protein_id gnl|my_center|LOCUS_15080 179461 177950 gene locus_tag LOCUS_15090 gene pepA 179461 177950 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098951.1 protein_id gnl|my_center|LOCUS_15090 179727 180836 gene locus_tag LOCUS_15100 gene lptF 179727 180836 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420700.1 protein_id gnl|my_center|LOCUS_15100 180836 181918 gene locus_tag LOCUS_15110 gene lptG 180836 181918 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182241.1 protein_id gnl|my_center|LOCUS_15110 181949 182185 gene locus_tag LOCUS_15120 181949 182185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 182188 183831 gene locus_tag LOCUS_15130 182188 183831 CDS product glycerone kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098955.1 protein_id gnl|my_center|LOCUS_15130 184888 183869 gene locus_tag LOCUS_15140 184888 183869 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098954.1 protein_id gnl|my_center|LOCUS_15140 185625 185047 gene locus_tag LOCUS_15150 185625 185047 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109982.1 protein_id gnl|my_center|LOCUS_15150 186647 185625 gene locus_tag LOCUS_15160 186647 185625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 186885 186969 gene locus_tag LOCUS_t00130 186885 186969 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 187156 187614 gene locus_tag LOCUS_15170 187156 187614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15170 187615 188430 gene locus_tag LOCUS_15180 187615 188430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15180 188755 188973 gene locus_tag LOCUS_15190 188755 188973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 188995 189297 gene locus_tag LOCUS_15200 188995 189297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 192188 189333 gene locus_tag LOCUS_15210 192188 189333 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968623.1 protein_id gnl|my_center|LOCUS_15210 195220 192296 gene locus_tag LOCUS_15220 195220 192296 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_15220 195683 195234 gene locus_tag LOCUS_15230 195683 195234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 199222 195680 gene locus_tag LOCUS_15240 199222 195680 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968627.1 protein_id gnl|my_center|LOCUS_15240 199518 199279 gene locus_tag LOCUS_15250 199518 199279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141034.1 protein_id gnl|my_center|LOCUS_15250 200361 200032 gene locus_tag LOCUS_15260 200361 200032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 201221 200385 gene locus_tag LOCUS_15270 201221 200385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15270 201517 201254 gene locus_tag LOCUS_15280 201517 201254 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745635.1 protein_id gnl|my_center|LOCUS_15280 201858 201649 gene locus_tag LOCUS_15290 201858 201649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 202133 203254 gene locus_tag LOCUS_15300 202133 203254 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816845.1 protein_id gnl|my_center|LOCUS_15300 203777 203304 gene locus_tag LOCUS_15310 203777 203304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15310 204089 203784 gene locus_tag LOCUS_15320 204089 203784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15320 204177 205082 gene locus_tag LOCUS_15330 204177 205082 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523537.1 protein_id gnl|my_center|LOCUS_15330 206559 205087 gene locus_tag LOCUS_15340 206559 205087 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095421.1 protein_id gnl|my_center|LOCUS_15340 206679 206843 gene locus_tag LOCUS_15350 206679 206843 CDS product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704272.1 protein_id gnl|my_center|LOCUS_15350 207073 208140 gene locus_tag LOCUS_15360 207073 208140 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095433.1 protein_id gnl|my_center|LOCUS_15360 208143 209213 gene locus_tag LOCUS_15370 208143 209213 CDS product DUF2955 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095434.1 protein_id gnl|my_center|LOCUS_15370 209567 209247 gene locus_tag LOCUS_15380 gene ubiK 209567 209247 CDS product ubiquinone biosynthesis accessory factor UbiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098757.1 protein_id gnl|my_center|LOCUS_15380 209946 210599 gene locus_tag LOCUS_15390 gene ribB 209946 210599 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703517.1 protein_id gnl|my_center|LOCUS_15390 210762 210944 gene locus_tag LOCUS_15400 210762 210944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469259.1 protein_id gnl|my_center|LOCUS_15400 211727 210954 gene locus_tag LOCUS_15410 gene zupT 211727 210954 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115874.1 protein_id gnl|my_center|LOCUS_15410 211925 212713 gene locus_tag LOCUS_15420 gene ygiD 211925 212713 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098747.1 protein_id gnl|my_center|LOCUS_15420 213961 212801 gene locus_tag LOCUS_15430 213961 212801 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442833.1 protein_id gnl|my_center|LOCUS_15430 214635 213967 gene locus_tag LOCUS_15440 214635 213967 CDS product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831528.1 protein_id gnl|my_center|LOCUS_15440 216285 214795 gene locus_tag LOCUS_15450 gene tolC 216285 214795 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735274.1 protein_id gnl|my_center|LOCUS_15450 216489 217121 gene locus_tag LOCUS_15460 gene nudF 216489 217121 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098743.1 protein_id gnl|my_center|LOCUS_15460 217118 217540 gene locus_tag LOCUS_15470 217118 217540 CDS product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862516.1 protein_id gnl|my_center|LOCUS_15470 217565 218392 gene locus_tag LOCUS_15480 gene cpdA 217565 218392 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098742.1 protein_id gnl|my_center|LOCUS_15480 218392 218967 gene locus_tag LOCUS_15490 gene yqiA 218392 218967 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105725.1 protein_id gnl|my_center|LOCUS_15490 219007 220899 gene locus_tag LOCUS_15500 gene parE 219007 220899 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195318.1 protein_id gnl|my_center|LOCUS_15500 221791 220940 gene locus_tag LOCUS_15510 221791 220940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 222829 221963 gene locus_tag LOCUS_15520 222829 221963 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098733.1 protein_id gnl|my_center|LOCUS_15520 223062 224834 gene locus_tag LOCUS_15530 223062 224834 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098732.1 protein_id gnl|my_center|LOCUS_15530 224888 226156 gene locus_tag LOCUS_15540 224888 226156 CDS product oligosaccharide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098731.1 protein_id gnl|my_center|LOCUS_15540 226187 227377 gene locus_tag LOCUS_15550 226187 227377 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098730.1 protein_id gnl|my_center|LOCUS_15550 227847 227533 gene locus_tag LOCUS_15560 227847 227533 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098728.1 protein_id gnl|my_center|LOCUS_15560 228459 227878 gene locus_tag LOCUS_15570 228459 227878 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098727.1 protein_id gnl|my_center|LOCUS_15570 229913 228561 gene locus_tag LOCUS_15580 gene qseC 229913 228561 CDS product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098726.1 protein_id gnl|my_center|LOCUS_15580 230569 229910 gene locus_tag LOCUS_15590 gene qseB 230569 229910 CDS product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369657.1 protein_id gnl|my_center|LOCUS_15590 230718 231122 gene locus_tag LOCUS_15600 230718 231122 CDS product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020689494.1 protein_id gnl|my_center|LOCUS_15600 231262 233520 gene locus_tag LOCUS_15610 gene parC 231262 233520 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281881.1 protein_id gnl|my_center|LOCUS_15610 233701 234441 gene locus_tag LOCUS_15620 gene plsC 233701 234441 CDS product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965712.1 protein_id gnl|my_center|LOCUS_15620 234498 235910 gene locus_tag LOCUS_15630 gene ftsP 234498 235910 CDS product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059395.1 protein_id gnl|my_center|LOCUS_15630 236191 238263 gene locus_tag LOCUS_15640 236191 238263 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274469.1 protein_id gnl|my_center|LOCUS_15640 239250 238423 gene locus_tag LOCUS_15650 gene dkgA 239250 238423 CDS product 2,5-didehydrogluconate reductase DkgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098717.1 protein_id gnl|my_center|LOCUS_15650 240519 239356 gene locus_tag LOCUS_15660 gene yqhD 240519 239356 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098716.1 protein_id gnl|my_center|LOCUS_15660 240697 241596 gene locus_tag LOCUS_15670 240697 241596 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703501.1 protein_id gnl|my_center|LOCUS_15670 241596 241733 gene locus_tag LOCUS_15680 241596 241733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 242367 241708 gene locus_tag LOCUS_15690 gene yghB 242367 241708 CDS product DedA family general envelope maintenance protein YghB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268419.1 protein_id gnl|my_center|LOCUS_15690 243692 242505 gene locus_tag LOCUS_15700 gene metC 243692 242505 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703500.1 protein_id gnl|my_center|LOCUS_15700 243957 244676 gene locus_tag LOCUS_15710 gene exbB 243957 244676 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527844.1 protein_id gnl|my_center|LOCUS_15710 244683 245108 gene locus_tag LOCUS_15720 gene exbD 244683 245108 CDS product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240712.1 protein_id gnl|my_center|LOCUS_15720 245654 245205 gene locus_tag LOCUS_15730 245654 245205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098710.1 protein_id gnl|my_center|LOCUS_15730 246060 245656 gene locus_tag LOCUS_15740 246060 245656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098709.1 protein_id gnl|my_center|LOCUS_15740 246163 246681 gene locus_tag LOCUS_15750 246163 246681 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098708.1 protein_id gnl|my_center|LOCUS_15750 247750 246710 gene locus_tag LOCUS_15760 gene gpr 247750 246710 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262193.1 protein_id gnl|my_center|LOCUS_15760 248635 250275 gene locus_tag LOCUS_15770 248635 250275 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098705.1 protein_id gnl|my_center|LOCUS_15770 250997 250272 gene locus_tag LOCUS_15780 gene fucR 250997 250272 CDS product L-fucose operon activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642330.1 protein_id gnl|my_center|LOCUS_15780 251974 250994 gene locus_tag LOCUS_15790 251974 250994 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704684.1 protein_id gnl|my_center|LOCUS_15790 252949 252083 gene locus_tag LOCUS_15800 gene yghU 252949 252083 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309762.1 protein_id gnl|my_center|LOCUS_15800 253548 252985 gene locus_tag LOCUS_15810 253548 252985 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703498.1 protein_id gnl|my_center|LOCUS_15810 254962 253706 gene locus_tag LOCUS_15820 254962 253706 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049802.1 protein_id gnl|my_center|LOCUS_15820 255403 255170 gene locus_tag LOCUS_15830 255403 255170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 255500 256240 gene locus_tag LOCUS_15840 255500 256240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 256897 256280 gene locus_tag LOCUS_15850 256897 256280 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198772.1 protein_id gnl|my_center|LOCUS_15850 257119 257044 gene locus_tag LOCUS_t00140 257119 257044 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 257944 257225 gene locus_tag LOCUS_15860 257944 257225 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098689.1 protein_id gnl|my_center|LOCUS_15860 258351 260480 gene locus_tag LOCUS_15870 258351 260480 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098688.1 protein_id gnl|my_center|LOCUS_15870 261739 260654 gene locus_tag LOCUS_15880 gene mltC 261739 260654 CDS product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369719.1 protein_id gnl|my_center|LOCUS_15880 262065 261793 gene locus_tag LOCUS_15890 262065 261793 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091700.1 protein_id gnl|my_center|LOCUS_15890 263143 262091 gene locus_tag LOCUS_15900 gene mutY 263143 262091 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645253.1 protein_id gnl|my_center|LOCUS_15900 263286 264005 gene locus_tag LOCUS_15910 gene trmB 263286 264005 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786887.1 protein_id gnl|my_center|LOCUS_15910 264005 264331 gene locus_tag LOCUS_15920 264005 264331 CDS product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107569.1 protein_id gnl|my_center|LOCUS_15920 264388 265107 gene locus_tag LOCUS_15930 264388 265107 CDS product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984827.1 protein_id gnl|my_center|LOCUS_15930 265221 266219 gene locus_tag LOCUS_15940 265221 266219 CDS product DUF1202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252198.1 protein_id gnl|my_center|LOCUS_15940 266997 266344 gene locus_tag LOCUS_15950 gene rluA 266997 266344 CDS product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095545.1 protein_id gnl|my_center|LOCUS_15950 269922 267016 gene locus_tag LOCUS_15960 gene rapA 269922 267016 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704377.1 protein_id gnl|my_center|LOCUS_15960 272391 270100 gene locus_tag LOCUS_15970 gene polB 272391 270100 CDS product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095547.1 protein_id gnl|my_center|LOCUS_15970 273236 272637 gene locus_tag LOCUS_15980 273236 272637 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035634.1 protein_id gnl|my_center|LOCUS_15980 274057 273362 gene locus_tag LOCUS_15990 gene araD 274057 273362 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888666.1 protein_id gnl|my_center|LOCUS_15990 275688 274186 gene locus_tag LOCUS_16000 gene araA 275688 274186 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095549.1 protein_id gnl|my_center|LOCUS_16000 277394 275700 gene locus_tag LOCUS_16010 gene araB 277394 275700 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095550.1 protein_id gnl|my_center|LOCUS_16010 277734 278579 gene locus_tag LOCUS_16020 gene araC 277734 278579 CDS product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368277.1 protein_id gnl|my_center|LOCUS_16020 278662 279432 gene locus_tag LOCUS_16030 278662 279432 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095552.1 protein_id gnl|my_center|LOCUS_16030 280245 279544 gene locus_tag LOCUS_16040 gene thiQ 280245 279544 CDS product thiamine ABC transporter ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095553.1 protein_id gnl|my_center|LOCUS_16040 281830 280229 gene locus_tag LOCUS_16050 gene thiP 281830 280229 CDS product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235674.1 protein_id gnl|my_center|LOCUS_16050 282789 281806 gene locus_tag LOCUS_16060 gene thiB 282789 281806 CDS product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915326.1 protein_id gnl|my_center|LOCUS_16060 283238 283687 gene locus_tag LOCUS_16070 283238 283687 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116491597.1 protein_id gnl|my_center|LOCUS_16070 283806 284123 gene locus_tag LOCUS_16080 283806 284123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 286914 284320 gene locus_tag LOCUS_16090 286914 284320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 287714 288229 gene locus_tag LOCUS_16100 287714 288229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16100 290554 288407 gene locus_tag LOCUS_16110 290554 288407 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097826.1 protein_id gnl|my_center|LOCUS_16110 291655 290882 gene locus_tag LOCUS_16120 291655 290882 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035567.1 protein_id gnl|my_center|LOCUS_16120 291897 292655 gene locus_tag LOCUS_16130 291897 292655 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035566.1 protein_id gnl|my_center|LOCUS_16130 293166 292684 gene locus_tag LOCUS_16140 293166 292684 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090910.1 protein_id gnl|my_center|LOCUS_16140 294218 293343 gene locus_tag LOCUS_16150 294218 293343 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104615281.1 protein_id gnl|my_center|LOCUS_16150 294888 295310 gene locus_tag LOCUS_16160 294888 295310 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061029547.1 protein_id gnl|my_center|LOCUS_16160 295682 297154 gene locus_tag LOCUS_16170 295682 297154 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102149.1 protein_id gnl|my_center|LOCUS_16170 297252 297896 gene locus_tag LOCUS_16180 297252 297896 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819270.1 protein_id gnl|my_center|LOCUS_16180 299140 297941 gene locus_tag LOCUS_16190 299140 297941 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816438.1 protein_id gnl|my_center|LOCUS_16190 300260 299274 gene locus_tag LOCUS_16200 300260 299274 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968596.1 protein_id gnl|my_center|LOCUS_16200 300418 301353 gene locus_tag LOCUS_16210 300418 301353 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086503.1 protein_id gnl|my_center|LOCUS_16210 302176 301421 gene locus_tag LOCUS_16220 302176 301421 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966801.1 protein_id gnl|my_center|LOCUS_16220 302425 303201 gene locus_tag LOCUS_16230 302425 303201 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975807.1 protein_id gnl|my_center|LOCUS_16230 305270 303273 gene locus_tag LOCUS_16240 gene betT 305270 303273 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097075.1 protein_id gnl|my_center|LOCUS_16240 305488 306723 gene locus_tag LOCUS_16250 305488 306723 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105667.1 protein_id gnl|my_center|LOCUS_16250 308256 306781 gene locus_tag LOCUS_16260 308256 306781 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098720.1 protein_id gnl|my_center|LOCUS_16260 308445 309755 gene locus_tag LOCUS_16270 gene bdlA 308445 309755 CDS product biofilm dispersion protein BdlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082971.1 protein_id gnl|my_center|LOCUS_16270 310076 309846 gene locus_tag LOCUS_16280 310076 309846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 311951 310290 gene locus_tag LOCUS_16290 gene sgrR 311951 310290 CDS product HTH-type transcriptional regulator SgrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095556.1 protein_id gnl|my_center|LOCUS_16290 312153 313331 gene locus_tag LOCUS_16300 312153 313331 CDS product sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095558.1 protein_id gnl|my_center|LOCUS_16300 313982 313377 gene locus_tag LOCUS_16310 gene leuD 313982 313377 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818229.1 protein_id gnl|my_center|LOCUS_16310 315393 313993 gene locus_tag LOCUS_16320 gene leuC 315393 313993 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095560.1 protein_id gnl|my_center|LOCUS_16320 316487 315396 gene locus_tag LOCUS_16330 gene leuB 316487 315396 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042356.1 protein_id gnl|my_center|LOCUS_16330 318058 316487 gene locus_tag LOCUS_16340 gene leuA 318058 316487 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082846.1 protein_id gnl|my_center|LOCUS_16340 318328 318543 gene locus_tag LOCUS_16350 318328 318543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 318856 319818 gene locus_tag LOCUS_16360 gene leuO 318856 319818 CDS product transcriptional regulator LeuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095563.1 protein_id gnl|my_center|LOCUS_16360 320193 321917 gene locus_tag LOCUS_16370 gene ilvI 320193 321917 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095564.1 protein_id gnl|my_center|LOCUS_16370 321920 322411 gene locus_tag LOCUS_16380 gene ilvN 321920 322411 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252744.1 protein_id gnl|my_center|LOCUS_16380 322592 323596 gene locus_tag LOCUS_16390 gene cra 322592 323596 CDS product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095565.1 protein_id gnl|my_center|LOCUS_16390 324202 324660 gene locus_tag LOCUS_16400 gene mraZ 324202 324660 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488291.1 protein_id gnl|my_center|LOCUS_16400 324663 325604 gene locus_tag LOCUS_16410 gene rsmH 324663 325604 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368254.1 protein_id gnl|my_center|LOCUS_16410 325601 325966 gene locus_tag LOCUS_16420 gene ftsL 325601 325966 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625651.1 protein_id gnl|my_center|LOCUS_16420 325982 327748 gene locus_tag LOCUS_16430 325982 327748 CDS product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095569.1 protein_id gnl|my_center|LOCUS_16430 327807 329222 gene locus_tag LOCUS_16440 gene murE 327807 329222 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095570.1 protein_id gnl|my_center|LOCUS_16440 329219 330577 gene locus_tag LOCUS_16450 gene murF 329219 330577 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626670.1 protein_id gnl|my_center|LOCUS_16450 330571 331653 gene locus_tag LOCUS_16460 gene mraY 330571 331653 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964122.1 protein_id gnl|my_center|LOCUS_16460 331656 332972 gene locus_tag LOCUS_16470 gene murD 331656 332972 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704401.1 protein_id gnl|my_center|LOCUS_16470 332972 334213 gene locus_tag LOCUS_16480 gene ftsW 332972 334213 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239803.1 protein_id gnl|my_center|LOCUS_16480 334213 335280 gene locus_tag LOCUS_16490 gene murG 334213 335280 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016559.1 protein_id gnl|my_center|LOCUS_16490 335336 336811 gene locus_tag LOCUS_16500 gene murC 335336 336811 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096048.1 protein_id gnl|my_center|LOCUS_16500 336804 337724 gene locus_tag LOCUS_16510 gene ddlB 336804 337724 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130059.1 protein_id gnl|my_center|LOCUS_16510 337726 338559 gene locus_tag LOCUS_16520 gene ftsQ 337726 338559 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095577.1 protein_id gnl|my_center|LOCUS_16520 338556 339812 gene locus_tag LOCUS_16530 gene ftsA 338556 339812 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006173845.1 protein_id gnl|my_center|LOCUS_16530 339929 341080 gene locus_tag LOCUS_16540 gene ftsZ 339929 341080 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004857884.1 protein_id gnl|my_center|LOCUS_16540 341181 342098 gene locus_tag LOCUS_16550 gene lpxC 341181 342098 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095578.1 protein_id gnl|my_center|LOCUS_16550 342382 342882 gene locus_tag LOCUS_16560 gene secM 342382 342882 CDS product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704404.1 protein_id gnl|my_center|LOCUS_16560 342941 345646 gene locus_tag LOCUS_16570 gene secA 342941 345646 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905780.1 protein_id gnl|my_center|LOCUS_16570 345705 346097 gene locus_tag LOCUS_16580 gene mutT 345705 346097 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368238.1 protein_id gnl|my_center|LOCUS_16580 346288 346094 gene locus_tag LOCUS_16590 gene yacG 346288 346094 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856332.1 protein_id gnl|my_center|LOCUS_16590 347055 346312 gene locus_tag LOCUS_16600 gene zapD 347055 346312 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095583.1 protein_id gnl|my_center|LOCUS_16600 347675 347055 gene locus_tag LOCUS_16610 gene coaE 347675 347055 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095584.1 protein_id gnl|my_center|LOCUS_16610 347940 348983 gene locus_tag LOCUS_16620 gene guaC 347940 348983 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217337.1 protein_id gnl|my_center|LOCUS_16620 350221 349025 gene locus_tag LOCUS_16630 gene hofC 350221 349025 CDS product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157287.1 protein_id gnl|my_center|LOCUS_16630 351596 350211 gene locus_tag LOCUS_16640 gene gspE 351596 350211 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095587.1 protein_id gnl|my_center|LOCUS_16640 352043 351606 gene locus_tag LOCUS_16650 gene ppdD 352043 351606 CDS product prepilin peptidase-dependent pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704409.1 protein_id gnl|my_center|LOCUS_16650 353180 352287 gene locus_tag LOCUS_16660 gene nadC 353180 352287 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135134.1 protein_id gnl|my_center|LOCUS_16660 353268 353831 gene locus_tag LOCUS_16670 gene ampD 353268 353831 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936326.1 protein_id gnl|my_center|LOCUS_16670 353828 354682 gene locus_tag LOCUS_16680 gene ampE 353828 354682 CDS product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095591.1 protein_id gnl|my_center|LOCUS_16680 355673 354723 gene locus_tag LOCUS_16690 355673 354723 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704412.1 protein_id gnl|my_center|LOCUS_16690 357079 355673 gene locus_tag LOCUS_16700 357079 355673 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095593.1 protein_id gnl|my_center|LOCUS_16700 357366 357055 gene locus_tag LOCUS_16710 357366 357055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 358793 357417 gene locus_tag LOCUS_16720 gene aroP 358793 357417 CDS product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969915.1 protein_id gnl|my_center|LOCUS_16720 359331 360095 gene locus_tag LOCUS_16730 gene pdhR 359331 360095 CDS product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095596.1 protein_id gnl|my_center|LOCUS_16730 360215 362878 gene locus_tag LOCUS_16740 gene aceE 360215 362878 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368222.1 protein_id gnl|my_center|LOCUS_16740 362893 364791 gene locus_tag LOCUS_16750 gene aceF 362893 364791 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095598.1 protein_id gnl|my_center|LOCUS_16750 364989 366413 gene locus_tag LOCUS_16760 gene lpdA 364989 366413 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519338.1 protein_id gnl|my_center|LOCUS_16760 367261 366464 gene locus_tag LOCUS_16770 367261 366464 CDS product DUF2950 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757452.1 protein_id gnl|my_center|LOCUS_16770 368827 367271 gene locus_tag LOCUS_16780 368827 367271 CDS product DUF3300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174529.1 protein_id gnl|my_center|LOCUS_16780 369217 371814 gene locus_tag LOCUS_16790 gene acnB 369217 371814 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888954.1 protein_id gnl|my_center|LOCUS_16790 372055 372417 gene locus_tag LOCUS_16800 gene yacL 372055 372417 CDS product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095603.1 protein_id gnl|my_center|LOCUS_16800 373244 372450 gene locus_tag LOCUS_16810 gene speD 373244 372450 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734287.1 protein_id gnl|my_center|LOCUS_16810 374125 373265 gene locus_tag LOCUS_16820 gene speE 374125 373265 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095610.1 protein_id gnl|my_center|LOCUS_16820 374600 374277 gene locus_tag LOCUS_16830 374600 374277 CDS product YacC family pilotin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830675.1 protein_id gnl|my_center|LOCUS_16830 374770 376323 gene locus_tag LOCUS_16840 gene cueO 374770 376323 CDS product multicopper oxidase CueO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095612.1 protein_id gnl|my_center|LOCUS_16840 378840 376450 gene locus_tag LOCUS_16850 378840 376450 CDS product pyrroloquinoline quinone-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095613.1 protein_id gnl|my_center|LOCUS_16850 379047 379583 gene locus_tag LOCUS_16860 gene hpt 379047 379583 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683335.1 protein_id gnl|my_center|LOCUS_16860 380290 379676 gene locus_tag LOCUS_16870 gene can 380290 379676 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651600.1 protein_id gnl|my_center|LOCUS_16870 380446 381372 gene locus_tag LOCUS_16880 380446 381372 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368204.1 protein_id gnl|my_center|LOCUS_16880 381369 382139 gene locus_tag LOCUS_16890 381369 382139 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368203.1 protein_id gnl|my_center|LOCUS_16890 382325 383572 gene locus_tag LOCUS_16900 382325 383572 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420882.1 protein_id gnl|my_center|LOCUS_16900 383954 383574 gene locus_tag LOCUS_16910 gene panD 383954 383574 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621526.1 protein_id gnl|my_center|LOCUS_16910 384959 384108 gene locus_tag LOCUS_16920 gene panC 384959 384108 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368199.1 protein_id gnl|my_center|LOCUS_16920 385762 384971 gene locus_tag LOCUS_16930 gene panB 385762 384971 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095628.1 protein_id gnl|my_center|LOCUS_16930 386342 385851 gene locus_tag LOCUS_16940 gene folK 386342 385851 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095629.1 protein_id gnl|my_center|LOCUS_16940 387673 386399 gene locus_tag LOCUS_16950 387673 386399 CDS product fimbrial-like adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846620.1 protein_id gnl|my_center|LOCUS_16950 388274 387666 gene locus_tag LOCUS_16960 388274 387666 CDS product fimbrial-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553755.1 protein_id gnl|my_center|LOCUS_16960 388895 388287 gene locus_tag LOCUS_16970 388895 388287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 391379 388896 gene locus_tag LOCUS_16980 gene htrE 391379 388896 CDS product Yad fimbria usher protein HtrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153166.1 protein_id gnl|my_center|LOCUS_16980 392341 391535 gene locus_tag LOCUS_16990 392341 391535 CDS product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967611.1 protein_id gnl|my_center|LOCUS_16990 392969 392364 gene locus_tag LOCUS_17000 392969 392364 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709193.1 protein_id gnl|my_center|LOCUS_17000 394815 393472 gene locus_tag LOCUS_17010 gene pcnB 394815 393472 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174643.1 protein_id gnl|my_center|LOCUS_17010 395821 394925 gene locus_tag LOCUS_17020 gene gluQRS 395821 394925 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937424.1 protein_id gnl|my_center|LOCUS_17020 396345 395890 gene locus_tag LOCUS_17030 gene dksA 396345 395890 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007373199.1 protein_id gnl|my_center|LOCUS_17030 397226 396522 gene locus_tag LOCUS_17040 gene sfsA 397226 396522 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095633.1 protein_id gnl|my_center|LOCUS_17040 397767 397237 gene locus_tag LOCUS_17050 gene thpR 397767 397237 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095634.1 protein_id gnl|my_center|LOCUS_17050 397845 400274 gene locus_tag LOCUS_17060 gene hrpB 397845 400274 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095635.1 protein_id gnl|my_center|LOCUS_17060 400525 403038 gene locus_tag LOCUS_17070 gene mrcB 400525 403038 CDS product bifunctional glycosyl transferase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095636.1 protein_id gnl|my_center|LOCUS_17070 403376 405565 gene locus_tag LOCUS_17080 gene fhuA 403376 405565 CDS product ferrichrome porin FhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704432.1 protein_id gnl|my_center|LOCUS_17080 405613 406410 gene locus_tag LOCUS_17090 gene fhuC 405613 406410 CDS product Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620747.1 protein_id gnl|my_center|LOCUS_17090 406410 407300 gene locus_tag LOCUS_17100 gene fhuD 406410 407300 CDS product Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095639.1 protein_id gnl|my_center|LOCUS_17100 407297 409279 gene locus_tag LOCUS_17110 gene fhuB 407297 409279 CDS product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095640.1 protein_id gnl|my_center|LOCUS_17110 410706 409426 gene locus_tag LOCUS_17120 gene hemL 410706 409426 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095641.1 protein_id gnl|my_center|LOCUS_17120 410882 410703 gene locus_tag LOCUS_17130 410882 410703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 410881 412299 gene locus_tag LOCUS_17140 gene clcA 410881 412299 CDS product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368182.1 protein_id gnl|my_center|LOCUS_17140 412380 412724 gene locus_tag LOCUS_17150 gene erpA 412380 412724 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095643.1 protein_id gnl|my_center|LOCUS_17150 413399 412776 gene locus_tag LOCUS_17160 413399 412776 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095644.1 protein_id gnl|my_center|LOCUS_17160 414201 413401 gene locus_tag LOCUS_17170 gene btuF 414201 413401 CDS product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118833.1 protein_id gnl|my_center|LOCUS_17170 414892 414194 gene locus_tag LOCUS_17180 gene mtnN 414892 414194 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095646.1 protein_id gnl|my_center|LOCUS_17180 414998 416512 gene locus_tag LOCUS_17190 gene dgt 414998 416512 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057086.1 protein_id gnl|my_center|LOCUS_17190 416650 418083 gene locus_tag LOCUS_17200 gene degP 416650 418083 CDS product serine endoprotease DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095648.1 protein_id gnl|my_center|LOCUS_17200 418189 419400 gene locus_tag LOCUS_17210 gene cdaR 418189 419400 CDS product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929458.1 protein_id gnl|my_center|LOCUS_17210 419923 419534 gene locus_tag LOCUS_17220 419923 419534 CDS product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501916.1 protein_id gnl|my_center|LOCUS_17220 420778 420041 gene locus_tag LOCUS_17230 420778 420041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 421711 420887 gene locus_tag LOCUS_17240 gene dapD 421711 420887 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186656.1 protein_id gnl|my_center|LOCUS_17240 424418 421746 gene locus_tag LOCUS_17250 gene glnD 424418 421746 CDS product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095651.1 protein_id gnl|my_center|LOCUS_17250 425279 424485 gene locus_tag LOCUS_17260 gene map 425279 424485 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095652.1 protein_id gnl|my_center|LOCUS_17260 425600 426325 gene locus_tag LOCUS_17270 gene rpsB 425600 426325 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246886.1 protein_id gnl|my_center|LOCUS_17270 426464 427315 gene locus_tag LOCUS_17280 gene tsf 426464 427315 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501911.1 protein_id gnl|my_center|LOCUS_17280 427465 428190 gene locus_tag LOCUS_17290 gene pyrH 427465 428190 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224567.1 protein_id gnl|my_center|LOCUS_17290 428353 428910 gene locus_tag LOCUS_17300 gene frr 428353 428910 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622418.1 protein_id gnl|my_center|LOCUS_17300 429006 430205 gene locus_tag LOCUS_17310 gene ispC 429006 430205 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811924.1 protein_id gnl|my_center|LOCUS_17310 430461 431150 gene locus_tag LOCUS_17320 gene ispU 430461 431150 CDS product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028110.1 protein_id gnl|my_center|LOCUS_17320 431163 432020 gene locus_tag LOCUS_17330 gene cdsA 431163 432020 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922446.1 protein_id gnl|my_center|LOCUS_17330 432032 433384 gene locus_tag LOCUS_17340 gene rseP 432032 433384 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095658.1 protein_id gnl|my_center|LOCUS_17340 433414 435822 gene locus_tag LOCUS_17350 gene bamA 433414 435822 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095659.1 protein_id gnl|my_center|LOCUS_17350 435846 436415 gene locus_tag LOCUS_17360 gene skp 435846 436415 CDS product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758966.1 protein_id gnl|my_center|LOCUS_17360 436419 437444 gene locus_tag LOCUS_17370 gene lpxD 436419 437444 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139282.1 protein_id gnl|my_center|LOCUS_17370 437547 438002 gene locus_tag LOCUS_17380 gene fabZ 437547 438002 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010426706.1 protein_id gnl|my_center|LOCUS_17380 438006 438794 gene locus_tag LOCUS_17390 gene lpxA 438006 438794 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566033.1 protein_id gnl|my_center|LOCUS_17390 438794 439939 gene locus_tag LOCUS_17400 gene lpxB 438794 439939 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095663.1 protein_id gnl|my_center|LOCUS_17400 438970 439047 gene locus_tag LOCUS_t00150 438970 439047 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 439936 440532 gene locus_tag LOCUS_17410 gene rnhB 439936 440532 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095664.1 protein_id gnl|my_center|LOCUS_17410 440567 444049 gene locus_tag LOCUS_17420 gene dnaE 440567 444049 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095665.1 protein_id gnl|my_center|LOCUS_17420 444062 445021 gene locus_tag LOCUS_17430 gene accA 444062 445021 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055753.1 protein_id gnl|my_center|LOCUS_17430 445211 446977 gene locus_tag LOCUS_17440 445211 446977 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524168.1 protein_id gnl|my_center|LOCUS_17440 447058 449196 gene locus_tag LOCUS_17450 447058 449196 CDS product lysine decarboxylase LdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095667.1 protein_id gnl|my_center|LOCUS_17450 449256 449645 gene locus_tag LOCUS_17460 449256 449645 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901082.1 protein_id gnl|my_center|LOCUS_17460 449708 451003 gene locus_tag LOCUS_17470 gene tilS 449708 451003 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704454.1 protein_id gnl|my_center|LOCUS_17470 451299 451039 gene locus_tag LOCUS_17480 gene rof 451299 451039 CDS product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830722.1 protein_id gnl|my_center|LOCUS_17480 451486 451286 gene locus_tag LOCUS_17490 451486 451286 CDS product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417058.1 protein_id gnl|my_center|LOCUS_17490 451684 452226 gene locus_tag LOCUS_17500 451684 452226 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185319.1 protein_id gnl|my_center|LOCUS_17500 452223 452642 gene locus_tag LOCUS_17510 gene arfB 452223 452642 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095673.1 protein_id gnl|my_center|LOCUS_17510 454420 452702 gene locus_tag LOCUS_17520 gene proS 454420 452702 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260712.1 protein_id gnl|my_center|LOCUS_17520 455236 454532 gene locus_tag LOCUS_17530 gene tsaA 455236 454532 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095676.1 protein_id gnl|my_center|LOCUS_17530 455637 455233 gene locus_tag LOCUS_17540 gene rcsF 455637 455233 CDS product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202329.1 protein_id gnl|my_center|LOCUS_17540 456560 455745 gene locus_tag LOCUS_17550 gene metQ 456560 455745 CDS product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095678.1 protein_id gnl|my_center|LOCUS_17550 457258 456605 gene locus_tag LOCUS_17560 457258 456605 CDS product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856130.1 protein_id gnl|my_center|LOCUS_17560 458282 457251 gene locus_tag LOCUS_17570 gene metN 458282 457251 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095679.1 protein_id gnl|my_center|LOCUS_17570 458471 459037 gene locus_tag LOCUS_17580 gene gmhB 458471 459037 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704459.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence03 99 275 gene locus_tag LOCUS_17590 99 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 1065 298 gene locus_tag LOCUS_17600 1065 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 3600 1084 gene locus_tag LOCUS_17610 3600 1084 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181816997.1 protein_id gnl|my_center|LOCUS_17610 4593 3646 gene locus_tag LOCUS_17620 4593 3646 CDS product lysine-N-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191775953.1 protein_id gnl|my_center|LOCUS_17620 5054 4617 gene locus_tag LOCUS_17630 5054 4617 CDS product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027804.1 protein_id gnl|my_center|LOCUS_17630 5357 5058 gene locus_tag LOCUS_17640 5357 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 6250 5477 gene locus_tag LOCUS_17650 gene flgA 6250 5477 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309268.1 protein_id gnl|my_center|LOCUS_17650 6343 6690 gene locus_tag LOCUS_17660 6343 6690 CDS product flagellar biosynthesis protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512950.1 protein_id gnl|my_center|LOCUS_17660 6693 7124 gene locus_tag LOCUS_17670 gene flgC 6693 7124 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010941.1 protein_id gnl|my_center|LOCUS_17670 7121 7840 gene locus_tag LOCUS_17680 7121 7840 CDS product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093678.1 protein_id gnl|my_center|LOCUS_17680 7878 9071 gene locus_tag LOCUS_17690 gene flgE 7878 9071 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119538.1 protein_id gnl|my_center|LOCUS_17690 9086 9823 gene locus_tag LOCUS_17700 9086 9823 CDS product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375450.1 protein_id gnl|my_center|LOCUS_17700 9848 10633 gene locus_tag LOCUS_17710 gene flgG 9848 10633 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990540.1 protein_id gnl|my_center|LOCUS_17710 10713 11357 gene locus_tag LOCUS_17720 gene flgH 10713 11357 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800864.1 protein_id gnl|my_center|LOCUS_17720 11370 12485 gene locus_tag LOCUS_17730 11370 12485 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059224973.1 protein_id gnl|my_center|LOCUS_17730 12485 12790 gene locus_tag LOCUS_17740 12485 12790 CDS product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867281.1 protein_id gnl|my_center|LOCUS_17740 12881 14254 gene locus_tag LOCUS_17750 gene flgK 12881 14254 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367245.1 protein_id gnl|my_center|LOCUS_17750 14276 15205 gene locus_tag LOCUS_17760 gene flgL 14276 15205 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266799.1 protein_id gnl|my_center|LOCUS_17760 15242 16252 gene locus_tag LOCUS_17770 15242 16252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195938.1 protein_id gnl|my_center|LOCUS_17770 16713 16249 gene locus_tag LOCUS_17780 16713 16249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 17629 16691 gene locus_tag LOCUS_17790 17629 16691 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181672479.1 protein_id gnl|my_center|LOCUS_17790 18075 18977 gene locus_tag LOCUS_17800 gene lafA 18075 18977 CDS product lateral flagellin LafA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949083.1 protein_id gnl|my_center|LOCUS_17800 20191 19103 gene locus_tag LOCUS_17810 20191 19103 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815639.1 protein_id gnl|my_center|LOCUS_17810 21719 20193 gene locus_tag LOCUS_17820 21719 20193 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209436.1 protein_id gnl|my_center|LOCUS_17820 22327 21719 gene locus_tag LOCUS_17830 22327 21719 CDS product DUF2291 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167399.1 protein_id gnl|my_center|LOCUS_17830 23281 22340 gene locus_tag LOCUS_17840 23281 22340 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209434.1 protein_id gnl|my_center|LOCUS_17840 24034 23399 gene locus_tag LOCUS_17850 gene entD 24034 23399 CDS product enterobactin synthase subunit EntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681620.1 protein_id gnl|my_center|LOCUS_17850 23915 24136 gene locus_tag LOCUS_17860 23915 24136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 26404 24155 gene locus_tag LOCUS_17870 gene fepA 26404 24155 CDS product siderophore enterobactin receptor FepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704704.1 protein_id gnl|my_center|LOCUS_17870 26589 27791 gene locus_tag LOCUS_17880 gene fes 26589 27791 CDS product enterochelin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097642.1 protein_id gnl|my_center|LOCUS_17880 27808 28017 gene locus_tag LOCUS_17890 gene ybdZ 27808 28017 CDS product enterobactin biosynthesis protein YbdZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885783.1 protein_id gnl|my_center|LOCUS_17890 28019 31900 gene locus_tag LOCUS_17900 gene entF 28019 31900 CDS product enterobactin non-ribosomal peptide synthetase EntF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077749.1 protein_id gnl|my_center|LOCUS_17900 32138 33271 gene locus_tag LOCUS_17910 gene wzz(fepE) 32138 33271 CDS product LPS O-antigen length regulator Wzz(fepE) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096767.1 protein_id gnl|my_center|LOCUS_17910 34105 33308 gene locus_tag LOCUS_17920 gene fepC 34105 33308 CDS product iron-enterobactin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367776.1 protein_id gnl|my_center|LOCUS_17920 35094 34102 gene locus_tag LOCUS_17930 gene fepG 35094 34102 CDS product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640923.1 protein_id gnl|my_center|LOCUS_17930 36098 35091 gene locus_tag LOCUS_17940 gene fepD 36098 35091 CDS product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704708.1 protein_id gnl|my_center|LOCUS_17940 36210 37454 gene locus_tag LOCUS_17950 gene entS 36210 37454 CDS product enterobactin transporter EntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097636.1 protein_id gnl|my_center|LOCUS_17950 37433 37612 gene locus_tag LOCUS_17960 37433 37612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 38543 37584 gene locus_tag LOCUS_17970 gene fepB 38543 37584 CDS product Fe2+-enterobactin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234314.1 protein_id gnl|my_center|LOCUS_17970 38727 39902 gene locus_tag LOCUS_17980 gene entC 38727 39902 CDS product isochorismate synthase EntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381303.1 protein_id gnl|my_center|LOCUS_17980 39912 41522 gene locus_tag LOCUS_17990 gene entE 39912 41522 CDS product (2,3-dihydroxybenzoyl)adenylate synthase EntE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222445.1 protein_id gnl|my_center|LOCUS_17990 41536 42390 gene locus_tag LOCUS_18000 gene entB 41536 42390 CDS product enterobactin biosynthesis bifunctional isochorismatase/aryl carrier protein EntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007142.1 protein_id gnl|my_center|LOCUS_18000 42390 43145 gene locus_tag LOCUS_18010 gene entA 42390 43145 CDS product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase EntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347636.1 protein_id gnl|my_center|LOCUS_18010 43145 43558 gene locus_tag LOCUS_18020 gene entH 43145 43558 CDS product proofreading thioesterase EntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637953.1 protein_id gnl|my_center|LOCUS_18020 43644 43715 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43877 45982 gene locus_tag LOCUS_18030 gene cstA 43877 45982 CDS product pyruvate/proton symporter CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043134.1 protein_id gnl|my_center|LOCUS_18030 46114 46311 gene locus_tag LOCUS_18040 46114 46311 CDS product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097627.1 protein_id gnl|my_center|LOCUS_18040 47055 46312 gene locus_tag LOCUS_18050 47055 46312 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097624.1 protein_id gnl|my_center|LOCUS_18050 48283 47129 gene locus_tag LOCUS_18060 48283 47129 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097623.1 protein_id gnl|my_center|LOCUS_18060 48380 49882 gene locus_tag LOCUS_18070 48380 49882 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097622.1 protein_id gnl|my_center|LOCUS_18070 49879 50874 gene locus_tag LOCUS_18080 49879 50874 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367760.1 protein_id gnl|my_center|LOCUS_18080 50898 51956 gene locus_tag LOCUS_18090 50898 51956 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097620.1 protein_id gnl|my_center|LOCUS_18090 52077 53321 gene locus_tag LOCUS_18100 52077 53321 CDS product LVIVD repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097619.1 protein_id gnl|my_center|LOCUS_18100 54639 53440 gene locus_tag LOCUS_18110 gene mtnK 54639 53440 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097617.1 protein_id gnl|my_center|LOCUS_18110 54745 55743 gene locus_tag LOCUS_18120 gene mtnA 54745 55743 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097616.1 protein_id gnl|my_center|LOCUS_18120 56429 55887 gene locus_tag LOCUS_18130 56429 55887 CDS product 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097614.1 protein_id gnl|my_center|LOCUS_18130 57115 56426 gene locus_tag LOCUS_18140 gene mtnC 57115 56426 CDS product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097613.1 protein_id gnl|my_center|LOCUS_18140 57723 57112 gene locus_tag LOCUS_18150 57723 57112 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097612.1 protein_id gnl|my_center|LOCUS_18150 57839 58999 gene locus_tag LOCUS_18160 57839 58999 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164518318.1 protein_id gnl|my_center|LOCUS_18160 59626 59000 gene locus_tag LOCUS_18170 59626 59000 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097610.1 protein_id gnl|my_center|LOCUS_18170 60831 59611 gene locus_tag LOCUS_18180 60831 59611 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882127.1 protein_id gnl|my_center|LOCUS_18180 61931 61029 gene locus_tag LOCUS_18190 61931 61029 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097608.1 protein_id gnl|my_center|LOCUS_18190 62889 62146 gene locus_tag LOCUS_18200 gene dsbG 62889 62146 CDS product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597117.1 protein_id gnl|my_center|LOCUS_18200 63151 63714 gene locus_tag LOCUS_18210 gene ahpC 63151 63714 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501015.1 protein_id gnl|my_center|LOCUS_18210 63953 65515 gene locus_tag LOCUS_18220 gene ahpF 63953 65515 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887645.1 protein_id gnl|my_center|LOCUS_18220 66273 65611 gene locus_tag LOCUS_18230 66273 65611 CDS product DUF2931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387039.1 protein_id gnl|my_center|LOCUS_18230 67042 66386 gene locus_tag LOCUS_18240 67042 66386 CDS product DUF2931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387039.1 protein_id gnl|my_center|LOCUS_18240 69039 67039 gene locus_tag LOCUS_18250 69039 67039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 69631 69203 gene locus_tag LOCUS_18260 gene uspG 69631 69203 CDS product universal stress protein UspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278499.1 protein_id gnl|my_center|LOCUS_18260 70181 69771 gene locus_tag LOCUS_18270 gene rnk 70181 69771 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089748.1 protein_id gnl|my_center|LOCUS_18270 70432 71262 gene locus_tag LOCUS_18280 70432 71262 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021030.1 protein_id gnl|my_center|LOCUS_18280 71396 72250 gene locus_tag LOCUS_18290 71396 72250 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646835.1 protein_id gnl|my_center|LOCUS_18290 74747 72252 gene locus_tag LOCUS_18300 gene ptsP 74747 72252 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955825.1 protein_id gnl|my_center|LOCUS_18300 75800 74772 gene locus_tag LOCUS_18310 gene ypdE 75800 74772 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366033.1 protein_id gnl|my_center|LOCUS_18310 76878 75790 gene locus_tag LOCUS_18320 gene ypdF 76878 75790 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173284.1 protein_id gnl|my_center|LOCUS_18320 78136 76889 gene locus_tag LOCUS_18330 78136 76889 CDS product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985322.1 protein_id gnl|my_center|LOCUS_18330 78483 78160 gene locus_tag LOCUS_18340 78483 78160 CDS product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038456.1 protein_id gnl|my_center|LOCUS_18340 79532 78786 gene locus_tag LOCUS_18350 gene rna 79532 78786 CDS product ribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097602.1 protein_id gnl|my_center|LOCUS_18350 81073 79703 gene locus_tag LOCUS_18360 gene dcuC 81073 79703 CDS product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958619.1 protein_id gnl|my_center|LOCUS_18360 81435 81842 gene locus_tag LOCUS_18370 81435 81842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817189.1 protein_id gnl|my_center|LOCUS_18370 81895 82215 gene locus_tag LOCUS_18380 81895 82215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 82228 83484 gene locus_tag LOCUS_18390 82228 83484 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817191.1 protein_id gnl|my_center|LOCUS_18390 83481 84716 gene locus_tag LOCUS_18400 83481 84716 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817192.1 protein_id gnl|my_center|LOCUS_18400 84713 87832 gene locus_tag LOCUS_18410 84713 87832 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817193.1 protein_id gnl|my_center|LOCUS_18410 88099 88548 gene locus_tag LOCUS_18420 gene pagP 88099 88548 CDS product lipid IV(A) palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103088.1 protein_id gnl|my_center|LOCUS_18420 88742 88951 gene locus_tag LOCUS_18430 gene cspE 88742 88951 CDS product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012542460.1 protein_id gnl|my_center|LOCUS_18430 89377 89009 gene locus_tag LOCUS_18440 gene crcB 89377 89009 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939753.1 protein_id gnl|my_center|LOCUS_18440 89480 90274 gene locus_tag LOCUS_18450 89480 90274 CDS product deaminated glutathione amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350194.1 protein_id gnl|my_center|LOCUS_18450 90402 90605 gene locus_tag LOCUS_18460 gene tatE 90402 90605 CDS product twin-arginine translocase subunit TatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503931.1 protein_id gnl|my_center|LOCUS_18460 91639 90674 gene locus_tag LOCUS_18470 gene lipA 91639 90674 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042632.1 protein_id gnl|my_center|LOCUS_18470 92795 91851 gene locus_tag LOCUS_18480 92795 91851 CDS product YbeF family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097594.1 protein_id gnl|my_center|LOCUS_18480 93685 93050 gene locus_tag LOCUS_18490 gene lipB 93685 93050 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704733.1 protein_id gnl|my_center|LOCUS_18490 94036 93773 gene locus_tag LOCUS_18500 gene ybeD 94036 93773 CDS product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858718.1 protein_id gnl|my_center|LOCUS_18500 95350 94139 gene locus_tag LOCUS_18510 gene dacA 95350 94139 CDS product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097592.1 protein_id gnl|my_center|LOCUS_18510 96640 95492 gene locus_tag LOCUS_18520 gene rlpA 96640 95492 CDS product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097591.1 protein_id gnl|my_center|LOCUS_18520 97769 96651 gene locus_tag LOCUS_18530 gene mrdB 97769 96651 CDS product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131713.1 protein_id gnl|my_center|LOCUS_18530 99667 97766 gene locus_tag LOCUS_18540 gene mrdA 99667 97766 CDS product peptidoglycan DD-transpeptidase MrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097589.1 protein_id gnl|my_center|LOCUS_18540 100165 99698 gene locus_tag LOCUS_18550 gene rlmH 100165 99698 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776104.1 protein_id gnl|my_center|LOCUS_18550 100486 100169 gene locus_tag LOCUS_18560 gene rsfS 100486 100169 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161670.1 protein_id gnl|my_center|LOCUS_18560 101368 100757 gene locus_tag LOCUS_18570 101368 100757 CDS product adenosylcobalamin/alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241920.1 protein_id gnl|my_center|LOCUS_18570 101466 102560 gene locus_tag LOCUS_18580 gene cobD 101466 102560 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173241.1 protein_id gnl|my_center|LOCUS_18580 103185 102535 gene locus_tag LOCUS_18590 gene nadD 103185 102535 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989126.1 protein_id gnl|my_center|LOCUS_18590 104209 103178 gene locus_tag LOCUS_18600 gene holA 104209 103178 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620539.1 protein_id gnl|my_center|LOCUS_18600 104781 104209 gene locus_tag LOCUS_18610 gene lptE 104781 104209 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097585.1 protein_id gnl|my_center|LOCUS_18610 107378 104796 gene locus_tag LOCUS_18620 gene leuS 107378 104796 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011378592.1 protein_id gnl|my_center|LOCUS_18620 107614 108096 gene locus_tag LOCUS_18630 107614 108096 CDS product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831082.1 protein_id gnl|my_center|LOCUS_18630 108862 108137 gene locus_tag LOCUS_18640 108862 108137 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097581.1 protein_id gnl|my_center|LOCUS_18640 109536 108862 gene locus_tag LOCUS_18650 gene gltK 109536 108862 CDS product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272799.1 protein_id gnl|my_center|LOCUS_18650 110276 109536 gene locus_tag LOCUS_18660 110276 109536 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097579.1 protein_id gnl|my_center|LOCUS_18660 111354 110440 gene locus_tag LOCUS_18670 111354 110440 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588823.1 protein_id gnl|my_center|LOCUS_18670 111560 111985 gene locus_tag LOCUS_18680 111560 111985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 113430 111892 gene locus_tag LOCUS_18690 gene lnt 113430 111892 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367717.1 protein_id gnl|my_center|LOCUS_18690 114328 113450 gene locus_tag LOCUS_18700 gene corC 114328 113450 CDS product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278615.1 protein_id gnl|my_center|LOCUS_18700 114885 114418 gene locus_tag LOCUS_18710 gene ybeY 114885 114418 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858677.1 protein_id gnl|my_center|LOCUS_18710 115928 114882 gene locus_tag LOCUS_18720 115928 114882 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493272.1 protein_id gnl|my_center|LOCUS_18720 117509 116085 gene locus_tag LOCUS_18730 gene miaB 117509 116085 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162748.1 protein_id gnl|my_center|LOCUS_18730 117649 118830 gene locus_tag LOCUS_18740 gene ubiF 117649 118830 CDS product 3-demethoxyubiquinol 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184606.1 protein_id gnl|my_center|LOCUS_18740 118992 118918 gene locus_tag LOCUS_t00160 118992 118918 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 119086 119012 gene locus_tag LOCUS_t00170 119086 119012 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 119207 119131 gene locus_tag LOCUS_t00180 119207 119131 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 119296 119222 gene locus_tag LOCUS_t00190 119296 119222 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 119408 119334 gene locus_tag LOCUS_t00200 119408 119334 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 119515 119431 gene locus_tag LOCUS_t00210 119515 119431 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 119602 119526 gene locus_tag LOCUS_t00220 119602 119526 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 119646 119846 gene locus_tag LOCUS_18750 119646 119846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 121496 119832 gene locus_tag LOCUS_18760 gene asnB 121496 119832 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704746.1 protein_id gnl|my_center|LOCUS_18760 122501 121749 gene locus_tag LOCUS_18770 gene nagD 122501 121749 CDS product ribonucleotide monophosphatase NagD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097571.1 protein_id gnl|my_center|LOCUS_18770 123765 122545 gene locus_tag LOCUS_18780 123765 122545 CDS product N-acetylglucosamine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097570.1 protein_id gnl|my_center|LOCUS_18780 124922 123774 gene locus_tag LOCUS_18790 gene nagA 124922 123774 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097569.1 protein_id gnl|my_center|LOCUS_18790 125789 124989 gene locus_tag LOCUS_18800 gene nagB 125789 124989 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097568.1 protein_id gnl|my_center|LOCUS_18800 126123 128153 gene locus_tag LOCUS_18810 gene nagE 126123 128153 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816827.1 protein_id gnl|my_center|LOCUS_18810 128294 129961 gene locus_tag LOCUS_18820 gene glnS 128294 129961 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287188.1 protein_id gnl|my_center|LOCUS_18820 131303 130011 gene locus_tag LOCUS_18830 131303 130011 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597466.1 protein_id gnl|my_center|LOCUS_18830 133430 131322 gene locus_tag LOCUS_18840 133430 131322 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537441.1 protein_id gnl|my_center|LOCUS_18840 133895 135292 gene locus_tag LOCUS_18850 gene chiP 133895 135292 CDS product chitoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097565.1 protein_id gnl|my_center|LOCUS_18850 135405 136040 gene locus_tag LOCUS_18860 135405 136040 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145474.1 protein_id gnl|my_center|LOCUS_18860 136191 137177 gene locus_tag LOCUS_18870 136191 137177 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267940.1 protein_id gnl|my_center|LOCUS_18870 137697 137248 gene locus_tag LOCUS_18880 gene fur 137697 137248 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428651.1 protein_id gnl|my_center|LOCUS_18880 138518 137988 gene locus_tag LOCUS_18890 gene fldA 138518 137988 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018618.1 protein_id gnl|my_center|LOCUS_18890 138962 138669 gene locus_tag LOCUS_18900 gene ybfE 138962 138669 CDS product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040939.1 protein_id gnl|my_center|LOCUS_18900 139869 139096 gene locus_tag LOCUS_18910 gene ybfF 139869 139096 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773280.1 protein_id gnl|my_center|LOCUS_18910 140055 140588 gene locus_tag LOCUS_18920 gene seqA 140055 140588 CDS product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848387.1 protein_id gnl|my_center|LOCUS_18920 140613 142253 gene locus_tag LOCUS_18930 gene pgm 140613 142253 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097560.1 protein_id gnl|my_center|LOCUS_18930 144476 142314 gene locus_tag LOCUS_18940 gene speF 144476 142314 CDS product ornithine decarboxylase SpeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297242.1 protein_id gnl|my_center|LOCUS_18940 145419 144742 gene locus_tag LOCUS_18950 gene kdpE 145419 144742 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097557.1 protein_id gnl|my_center|LOCUS_18950 148103 145416 gene locus_tag LOCUS_18960 gene kdpD 148103 145416 CDS product two-component system sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097556.1 protein_id gnl|my_center|LOCUS_18960 148682 148104 gene locus_tag LOCUS_18970 gene kdpC 148682 148104 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097555.1 protein_id gnl|my_center|LOCUS_18970 150744 148696 gene locus_tag LOCUS_18980 gene kdpB 150744 148696 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883015.1 protein_id gnl|my_center|LOCUS_18980 152434 150755 gene locus_tag LOCUS_18990 gene kdpA 152434 150755 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097553.1 protein_id gnl|my_center|LOCUS_18990 152830 153036 gene locus_tag LOCUS_19000 152830 153036 CDS product YbfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097552.1 protein_id gnl|my_center|LOCUS_19000 153299 154255 gene locus_tag LOCUS_19010 153299 154255 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418304.1 protein_id gnl|my_center|LOCUS_19010 154268 155686 gene locus_tag LOCUS_19020 gene phrB 154268 155686 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207142.1 protein_id gnl|my_center|LOCUS_19020 155699 156442 gene locus_tag LOCUS_19030 155699 156442 CDS product type 2 GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023621132.1 protein_id gnl|my_center|LOCUS_19030 156457 157113 gene locus_tag LOCUS_19040 gene pxpB 156457 157113 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188343.1 protein_id gnl|my_center|LOCUS_19040 157107 158039 gene locus_tag LOCUS_19050 gene pxpC 157107 158039 CDS product 5-oxoprolinase subunit PxpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912700.1 protein_id gnl|my_center|LOCUS_19050 158029 158763 gene locus_tag LOCUS_19060 gene pxpA 158029 158763 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687174.1 protein_id gnl|my_center|LOCUS_19060 158816 159538 gene locus_tag LOCUS_19070 158816 159538 CDS product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704763.1 protein_id gnl|my_center|LOCUS_19070 159538 160545 gene locus_tag LOCUS_19080 159538 160545 CDS product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704764.1 protein_id gnl|my_center|LOCUS_19080 160554 161198 gene locus_tag LOCUS_19090 gene pcp 160554 161198 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209662.1 protein_id gnl|my_center|LOCUS_19090 161213 162004 gene locus_tag LOCUS_19100 gene nei 161213 162004 CDS product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097546.1 protein_id gnl|my_center|LOCUS_19100 163134 162157 gene locus_tag LOCUS_19110 163134 162157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 165567 163141 gene locus_tag LOCUS_19120 165567 163141 CDS product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129197795.1 protein_id gnl|my_center|LOCUS_19120 166266 165571 gene locus_tag LOCUS_19130 gene fimC 166266 165571 CDS product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095932.1 protein_id gnl|my_center|LOCUS_19130 166869 166345 gene locus_tag LOCUS_19140 166869 166345 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097473.1 protein_id gnl|my_center|LOCUS_19140 168351 167065 gene locus_tag LOCUS_19150 168351 167065 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097545.1 protein_id gnl|my_center|LOCUS_19150 168988 169389 gene locus_tag LOCUS_19160 gene sdhC 168988 169389 CDS product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263355.1 protein_id gnl|my_center|LOCUS_19160 169383 169730 gene locus_tag LOCUS_19170 gene sdhD 169383 169730 CDS product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254356.1 protein_id gnl|my_center|LOCUS_19170 169787 171496 gene locus_tag LOCUS_19180 gene sdhA 169787 171496 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775540.1 protein_id gnl|my_center|LOCUS_19180 171512 172228 gene locus_tag LOCUS_19190 gene sdhB 171512 172228 CDS product succinate dehydrogenase iron-sulfur subunit SdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501090.1 protein_id gnl|my_center|LOCUS_19190 172496 175303 gene locus_tag LOCUS_19200 gene sucA 172496 175303 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023622290.1 protein_id gnl|my_center|LOCUS_19200 175318 176547 gene locus_tag LOCUS_19210 gene odhB 175318 176547 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097540.1 protein_id gnl|my_center|LOCUS_19210 176632 177798 gene locus_tag LOCUS_19220 gene sucC 176632 177798 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367670.1 protein_id gnl|my_center|LOCUS_19220 177798 178667 gene locus_tag LOCUS_19230 gene sucD 177798 178667 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501094.1 protein_id gnl|my_center|LOCUS_19230 179455 178739 gene locus_tag LOCUS_19240 179455 178739 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097539.1 protein_id gnl|my_center|LOCUS_19240 179625 181541 gene locus_tag LOCUS_19250 gene mngA 179625 181541 CDS product PTS 2-O-a-mannosyl-D-glycerate transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097538.1 protein_id gnl|my_center|LOCUS_19250 181558 184176 gene locus_tag LOCUS_19260 gene mngB 181558 184176 CDS product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097537.1 protein_id gnl|my_center|LOCUS_19260 184848 186452 gene locus_tag LOCUS_19270 gene cydA 184848 186452 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884372.1 protein_id gnl|my_center|LOCUS_19270 186468 187607 gene locus_tag LOCUS_19280 gene cydB 186468 187607 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568258.1 protein_id gnl|my_center|LOCUS_19280 187735 188028 gene locus_tag LOCUS_19290 gene ybgE 187735 188028 CDS product cyd operon protein YbgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097534.1 protein_id gnl|my_center|LOCUS_19290 188177 188581 gene locus_tag LOCUS_19300 gene ybgC 188177 188581 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004859689.1 protein_id gnl|my_center|LOCUS_19300 188587 189270 gene locus_tag LOCUS_19310 gene tolQ 188587 189270 CDS product Tol-Pal system protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097532.1 protein_id gnl|my_center|LOCUS_19310 189274 189702 gene locus_tag LOCUS_19320 gene tolR 189274 189702 CDS product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858589.1 protein_id gnl|my_center|LOCUS_19320 189742 191091 gene locus_tag LOCUS_19330 189742 191091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 191178 192473 gene locus_tag LOCUS_19340 gene tolB 191178 192473 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989131.1 protein_id gnl|my_center|LOCUS_19340 192508 193026 gene locus_tag LOCUS_19350 gene pal 192508 193026 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295883.1 protein_id gnl|my_center|LOCUS_19350 193036 193821 gene locus_tag LOCUS_19360 gene cpoB 193036 193821 CDS product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097528.1 protein_id gnl|my_center|LOCUS_19360 194006 194134 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 194187 194262 gene locus_tag LOCUS_t00230 194187 194262 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 194611 195654 gene locus_tag LOCUS_19370 gene nadA 194611 195654 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097527.1 protein_id gnl|my_center|LOCUS_19370 195692 196411 gene locus_tag LOCUS_19380 gene pnuC 195692 196411 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367656.1 protein_id gnl|my_center|LOCUS_19380 197355 196408 gene locus_tag LOCUS_19390 gene zitB 197355 196408 CDS product CDF family zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097525.1 protein_id gnl|my_center|LOCUS_19390 197887 197471 gene locus_tag LOCUS_19400 197887 197471 CDS product YbgS-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784348.1 protein_id gnl|my_center|LOCUS_19400 198206 199258 gene locus_tag LOCUS_19410 gene aroG 198206 199258 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097523.1 protein_id gnl|my_center|LOCUS_19410 200072 199320 gene locus_tag LOCUS_19420 gene gpmA 200072 199320 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367652.1 protein_id gnl|my_center|LOCUS_19420 201327 200287 gene locus_tag LOCUS_19430 gene galM 201327 200287 CDS product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097522.1 protein_id gnl|my_center|LOCUS_19430 202469 201321 gene locus_tag LOCUS_19440 gene galK 202469 201321 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097521.1 protein_id gnl|my_center|LOCUS_19440 203518 202472 gene locus_tag LOCUS_19450 gene galT 203518 202472 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191517.1 protein_id gnl|my_center|LOCUS_19450 204544 203528 gene locus_tag LOCUS_19460 gene galE 204544 203528 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023622345.1 protein_id gnl|my_center|LOCUS_19460 206230 204758 gene locus_tag LOCUS_19470 gene modF 206230 204758 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097518.1 protein_id gnl|my_center|LOCUS_19470 207085 206297 gene locus_tag LOCUS_19480 gene modE 207085 206297 CDS product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147439.1 protein_id gnl|my_center|LOCUS_19480 207214 207363 gene locus_tag LOCUS_19490 207214 207363 CDS product AcrZ family multidrug efflux pump-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045380498.1 protein_id gnl|my_center|LOCUS_19490 207520 208296 gene locus_tag LOCUS_19500 gene modA 207520 208296 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097515.1 protein_id gnl|my_center|LOCUS_19500 208293 208982 gene locus_tag LOCUS_19510 gene modB 208293 208982 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604026.1 protein_id gnl|my_center|LOCUS_19510 208985 210043 gene locus_tag LOCUS_19520 gene modC 208985 210043 CDS product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891667.1 protein_id gnl|my_center|LOCUS_19520 210862 210044 gene locus_tag LOCUS_19530 210862 210044 CDS product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097512.1 protein_id gnl|my_center|LOCUS_19530 211014 212009 gene locus_tag LOCUS_19540 gene pgl 211014 212009 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097511.1 protein_id gnl|my_center|LOCUS_19540 213414 212131 gene locus_tag LOCUS_19550 213414 212131 CDS product putative acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097510.1 protein_id gnl|my_center|LOCUS_19550 214005 213529 gene locus_tag LOCUS_19560 214005 213529 CDS product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097504.1 protein_id gnl|my_center|LOCUS_19560 215358 214069 gene locus_tag LOCUS_19570 gene bioA 215358 214069 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052123603.1 protein_id gnl|my_center|LOCUS_19570 215445 216485 gene locus_tag LOCUS_19580 gene bioB 215445 216485 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097502.1 protein_id gnl|my_center|LOCUS_19580 216482 217630 gene locus_tag LOCUS_19590 gene bioF 216482 217630 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118805.1 protein_id gnl|my_center|LOCUS_19590 217614 218369 gene locus_tag LOCUS_19600 gene bioC 217614 218369 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704796.1 protein_id gnl|my_center|LOCUS_19600 218356 219084 gene locus_tag LOCUS_19610 gene bioD 218356 219084 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097499.1 protein_id gnl|my_center|LOCUS_19610 219748 219026 gene locus_tag LOCUS_19620 219748 219026 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097498.1 protein_id gnl|my_center|LOCUS_19620 220513 222534 gene locus_tag LOCUS_19630 gene uvrB 220513 222534 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097496.1 protein_id gnl|my_center|LOCUS_19630 222959 224140 gene locus_tag LOCUS_19640 222959 224140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 224143 228525 gene locus_tag LOCUS_19650 224143 228525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 228525 229022 gene locus_tag LOCUS_19660 228525 229022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 229278 229562 gene locus_tag LOCUS_19670 229278 229562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 229559 230062 gene locus_tag LOCUS_19680 229559 230062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 230216 230434 gene locus_tag LOCUS_19690 230216 230434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 230466 230969 gene locus_tag LOCUS_19700 230466 230969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 232504 231410 gene locus_tag LOCUS_19710 gene pmrB 232504 231410 CDS product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704800.1 protein_id gnl|my_center|LOCUS_19710 233175 232501 gene locus_tag LOCUS_19720 gene pmrA 233175 232501 CDS product two-component system response regulator PmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704801.1 protein_id gnl|my_center|LOCUS_19720 234784 233180 gene locus_tag LOCUS_19730 gene eptA 234784 233180 CDS product phosphoethanolamine transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704802.1 protein_id gnl|my_center|LOCUS_19730 235949 235041 gene locus_tag LOCUS_19740 gene yvcK 235949 235041 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097495.1 protein_id gnl|my_center|LOCUS_19740 236252 237274 gene locus_tag LOCUS_19750 gene moaA 236252 237274 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704804.1 protein_id gnl|my_center|LOCUS_19750 237295 237807 gene locus_tag LOCUS_19760 gene moaB 237295 237807 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084604.1 protein_id gnl|my_center|LOCUS_19760 237811 238296 gene locus_tag LOCUS_19770 gene moaC 237811 238296 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097492.1 protein_id gnl|my_center|LOCUS_19770 238289 238534 gene locus_tag LOCUS_19780 gene moaD 238289 238534 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705488.1 protein_id gnl|my_center|LOCUS_19780 238536 238988 gene locus_tag LOCUS_19790 gene moaE 238536 238988 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852287.1 protein_id gnl|my_center|LOCUS_19790 239047 239751 gene locus_tag LOCUS_19800 239047 239751 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367602.1 protein_id gnl|my_center|LOCUS_19800 240825 239863 gene locus_tag LOCUS_19810 240825 239863 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129824.1 protein_id gnl|my_center|LOCUS_19810 242072 240825 gene locus_tag LOCUS_19820 gene clsB 242072 240825 CDS product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649638.1 protein_id gnl|my_center|LOCUS_19820 242830 242069 gene locus_tag LOCUS_19830 242830 242069 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113348.1 protein_id gnl|my_center|LOCUS_19830 243016 243372 gene locus_tag LOCUS_19840 243016 243372 CDS product YbhQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014883088.1 protein_id gnl|my_center|LOCUS_19840 244440 243334 gene locus_tag LOCUS_19850 244440 243334 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469048.1 protein_id gnl|my_center|LOCUS_19850 245583 244450 gene locus_tag LOCUS_19860 245583 244450 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045765.1 protein_id gnl|my_center|LOCUS_19860 247312 245573 gene locus_tag LOCUS_19870 247312 245573 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287626.1 protein_id gnl|my_center|LOCUS_19870 248300 247305 gene locus_tag LOCUS_19880 gene hlyD 248300 247305 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097481.1 protein_id gnl|my_center|LOCUS_19880 248974 248297 gene locus_tag LOCUS_19890 gene cecR 248974 248297 CDS product DNA-binding transcriptional regulator CecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296991.1 protein_id gnl|my_center|LOCUS_19890 249204 250541 gene locus_tag LOCUS_19900 gene rhlE 249204 250541 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007058.1 protein_id gnl|my_center|LOCUS_19900 250680 250474 gene locus_tag LOCUS_19910 250680 250474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 250763 251497 gene locus_tag LOCUS_19920 250763 251497 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014894892.1 protein_id gnl|my_center|LOCUS_19920 251664 253268 gene locus_tag LOCUS_19930 251664 253268 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861179.1 protein_id gnl|my_center|LOCUS_19930 253277 254605 gene locus_tag LOCUS_19940 253277 254605 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038001995.1 protein_id gnl|my_center|LOCUS_19940 254734 256878 gene locus_tag LOCUS_19950 gene dinG 254734 256878 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704815.1 protein_id gnl|my_center|LOCUS_19950 256908 257870 gene locus_tag LOCUS_19960 gene ybiB 256908 257870 CDS product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097472.1 protein_id gnl|my_center|LOCUS_19960 258260 258000 gene locus_tag LOCUS_19970 gene ybiJ 258260 258000 CDS product DUF1471 family protein YbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367588.1 protein_id gnl|my_center|LOCUS_19970 258812 258546 gene locus_tag LOCUS_19980 258812 258546 CDS product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097470.1 protein_id gnl|my_center|LOCUS_19980 261778 259112 gene locus_tag LOCUS_19990 261778 259112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258489.1 protein_id gnl|my_center|LOCUS_19990 262423 261794 gene locus_tag LOCUS_20000 262423 261794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 263284 262427 gene locus_tag LOCUS_20010 263284 262427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 263936 263295 gene locus_tag LOCUS_20020 263936 263295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 266948 263970 gene locus_tag LOCUS_20030 266948 263970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 267280 268215 gene locus_tag LOCUS_20040 gene rlmF 267280 268215 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097467.1 protein_id gnl|my_center|LOCUS_20040 270436 268205 gene locus_tag LOCUS_20050 gene ybiO 270436 268205 CDS product mechanosensitive channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267252.1 protein_id gnl|my_center|LOCUS_20050 271338 270616 gene locus_tag LOCUS_20060 gene glnQ 271338 270616 CDS product glutamine ABC transporter ATP-binding protein GlnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569083.1 protein_id gnl|my_center|LOCUS_20060 271994 271335 gene locus_tag LOCUS_20070 gene glnP 271994 271335 CDS product glutamine ABC transporter permease GlnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159076.1 protein_id gnl|my_center|LOCUS_20070 272819 272076 gene locus_tag LOCUS_20080 gene glnH 272819 272076 CDS product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843866.1 protein_id gnl|my_center|LOCUS_20080 273685 273182 gene locus_tag LOCUS_20090 gene dps 273685 273182 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100805.1 protein_id gnl|my_center|LOCUS_20090 274870 273983 gene locus_tag LOCUS_20100 gene rhtA 274870 273983 CDS product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119538.1 protein_id gnl|my_center|LOCUS_20100 275388 275855 gene locus_tag LOCUS_20110 gene ompX 275388 275855 CDS product outer membrane protein OmpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097460.1 protein_id gnl|my_center|LOCUS_20110 277492 275909 gene locus_tag LOCUS_20120 277492 275909 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097459.1 protein_id gnl|my_center|LOCUS_20120 277898 277770 gene locus_tag LOCUS_20130 gene mntS 277898 277770 CDS product manganase accumulation protein MntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097458.1 protein_id gnl|my_center|LOCUS_20130 278061 278534 gene locus_tag LOCUS_20140 gene mntR 278061 278534 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097457.1 protein_id gnl|my_center|LOCUS_20140 278531 279640 gene locus_tag LOCUS_20150 278531 279640 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056450.1 protein_id gnl|my_center|LOCUS_20150 279742 280839 gene locus_tag LOCUS_20160 279742 280839 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097455.1 protein_id gnl|my_center|LOCUS_20160 280836 282407 gene locus_tag LOCUS_20170 280836 282407 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097454.1 protein_id gnl|my_center|LOCUS_20170 282409 283935 gene locus_tag LOCUS_20180 282409 283935 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149366214.1 protein_id gnl|my_center|LOCUS_20180 284044 285090 gene locus_tag LOCUS_20190 284044 285090 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097452.1 protein_id gnl|my_center|LOCUS_20190 285303 285112 gene locus_tag LOCUS_20200 285303 285112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 285406 286782 gene locus_tag LOCUS_20210 285406 286782 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097451.1 protein_id gnl|my_center|LOCUS_20210 286830 288149 gene locus_tag LOCUS_20220 286830 288149 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097450.1 protein_id gnl|my_center|LOCUS_20220 288168 288884 gene locus_tag LOCUS_20230 288168 288884 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704828.1 protein_id gnl|my_center|LOCUS_20230 289041 290099 gene locus_tag LOCUS_20240 289041 290099 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705546.1 protein_id gnl|my_center|LOCUS_20240 290110 292107 gene locus_tag LOCUS_20250 290110 292107 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208782.1 protein_id gnl|my_center|LOCUS_20250 293108 292260 gene locus_tag LOCUS_20260 gene ldtB 293108 292260 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367569.1 protein_id gnl|my_center|LOCUS_20260 293399 294991 gene locus_tag LOCUS_20270 293399 294991 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097447.1 protein_id gnl|my_center|LOCUS_20270 297559 295190 gene locus_tag LOCUS_20280 297559 295190 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097446.1 protein_id gnl|my_center|LOCUS_20280 298878 297577 gene locus_tag LOCUS_20290 298878 297577 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097445.1 protein_id gnl|my_center|LOCUS_20290 299156 300247 gene locus_tag LOCUS_20300 299156 300247 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065355593.1 protein_id gnl|my_center|LOCUS_20300 301509 300244 gene locus_tag LOCUS_20310 301509 300244 CDS product DUF1479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097444.1 protein_id gnl|my_center|LOCUS_20310 302474 301659 gene locus_tag LOCUS_20320 302474 301659 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097443.1 protein_id gnl|my_center|LOCUS_20320 303152 302712 gene locus_tag LOCUS_20330 303152 302712 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017899343.1 protein_id gnl|my_center|LOCUS_20330 303469 303152 gene locus_tag LOCUS_20340 303469 303152 CDS product RcnB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365753.1 protein_id gnl|my_center|LOCUS_20340 304693 303686 gene locus_tag LOCUS_20350 304693 303686 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703848.1 protein_id gnl|my_center|LOCUS_20350 305262 304879 gene locus_tag LOCUS_20360 305262 304879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073493.1 protein_id gnl|my_center|LOCUS_20360 305380 305189 gene locus_tag LOCUS_20370 305380 305189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 305946 305425 gene locus_tag LOCUS_20380 305946 305425 CDS product Ail/Lom family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605048.1 protein_id gnl|my_center|LOCUS_20380 306597 305998 gene locus_tag LOCUS_20390 306597 305998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 306656 306735 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 307582 308370 gene locus_tag LOCUS_20400 gene thiM 307582 308370 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097913.1 protein_id gnl|my_center|LOCUS_20400 308367 309167 gene locus_tag LOCUS_20410 gene thiD 308367 309167 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822268.1 protein_id gnl|my_center|LOCUS_20410 309204 309950 gene locus_tag LOCUS_20420 309204 309950 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434062.1 protein_id gnl|my_center|LOCUS_20420 310883 309924 gene locus_tag LOCUS_20430 310883 309924 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097910.1 protein_id gnl|my_center|LOCUS_20430 311884 310880 gene locus_tag LOCUS_20440 311884 310880 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846192.1 protein_id gnl|my_center|LOCUS_20440 313173 311881 gene locus_tag LOCUS_20450 313173 311881 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858523.1 protein_id gnl|my_center|LOCUS_20450 313384 314436 gene locus_tag LOCUS_20460 gene fbaB 313384 314436 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129551.1 protein_id gnl|my_center|LOCUS_20460 314783 315937 gene locus_tag LOCUS_20470 314783 315937 CDS product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010210634.1 protein_id gnl|my_center|LOCUS_20470 315971 317596 gene locus_tag LOCUS_20480 315971 317596 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104458.1 protein_id gnl|my_center|LOCUS_20480 317593 318633 gene locus_tag LOCUS_20490 317593 318633 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010220797.1 protein_id gnl|my_center|LOCUS_20490 318630 319535 gene locus_tag LOCUS_20500 318630 319535 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245922.1 protein_id gnl|my_center|LOCUS_20500 319507 320370 gene locus_tag LOCUS_20510 319507 320370 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104459.1 protein_id gnl|my_center|LOCUS_20510 320381 321154 gene locus_tag LOCUS_20520 320381 321154 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104460.1 protein_id gnl|my_center|LOCUS_20520 322098 321199 gene locus_tag LOCUS_20530 gene yegS 322098 321199 CDS product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273393.1 protein_id gnl|my_center|LOCUS_20530 322260 322850 gene locus_tag LOCUS_20540 322260 322850 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706131.1 protein_id gnl|my_center|LOCUS_20540 324389 323034 gene locus_tag LOCUS_20550 gene yegQ 324389 323034 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706069.1 protein_id gnl|my_center|LOCUS_20550 325350 324628 gene locus_tag LOCUS_20560 gene baeR 325350 324628 CDS product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137875.1 protein_id gnl|my_center|LOCUS_20560 326750 325347 gene locus_tag LOCUS_20570 gene baeS 326750 325347 CDS product two-component system sensor histidine kinase BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097903.1 protein_id gnl|my_center|LOCUS_20570 328162 326747 gene locus_tag LOCUS_20580 328162 326747 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130817.1 protein_id gnl|my_center|LOCUS_20580 331240 328163 gene locus_tag LOCUS_20590 gene mdtC 331240 328163 CDS product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667528.1 protein_id gnl|my_center|LOCUS_20590 334363 331241 gene locus_tag LOCUS_20600 gene mdtB 334363 331241 CDS product multidrug efflux RND transporter permease subunit MdtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197875.1 protein_id gnl|my_center|LOCUS_20600 335604 334363 gene locus_tag LOCUS_20610 gene mdtA 335604 334363 CDS product multidrug efflux RND transporter subunit MdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678969.1 protein_id gnl|my_center|LOCUS_20610 337246 335894 gene locus_tag LOCUS_20620 gene yegD 337246 335894 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469740.1 protein_id gnl|my_center|LOCUS_20620 337366 338244 gene locus_tag LOCUS_20630 gene alkA 337366 338244 CDS product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097889.1 protein_id gnl|my_center|LOCUS_20630 341532 338203 gene locus_tag LOCUS_20640 341532 338203 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420943.1 protein_id gnl|my_center|LOCUS_20640 341889 342530 gene locus_tag LOCUS_20650 gene udk 341889 342530 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500855.1 protein_id gnl|my_center|LOCUS_20650 342632 343213 gene locus_tag LOCUS_20660 gene dcd 342632 343213 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097886.1 protein_id gnl|my_center|LOCUS_20660 343239 345095 gene locus_tag LOCUS_20670 gene asmA 343239 345095 CDS product outer membrane assembly protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252360.1 protein_id gnl|my_center|LOCUS_20670 346994 345411 gene locus_tag LOCUS_20680 346994 345411 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097884.1 protein_id gnl|my_center|LOCUS_20680 347773 348822 gene locus_tag LOCUS_20690 347773 348822 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978074.1 protein_id gnl|my_center|LOCUS_20690 348826 349269 gene locus_tag LOCUS_20700 gene wzb 348826 349269 CDS product low molecular weight protein-tyrosine-phosphatase Wzb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482225.1 protein_id gnl|my_center|LOCUS_20700 349272 351434 gene locus_tag LOCUS_20710 gene wzc 349272 351434 CDS product tyrosine-protein kinase Wzc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137123.1 protein_id gnl|my_center|LOCUS_20710 351549 352400 gene locus_tag LOCUS_20720 gene wcaA 351549 352400 CDS product colanic acid biosynthesis glycosyltransferase WcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097880.1 protein_id gnl|my_center|LOCUS_20720 352400 352891 gene locus_tag LOCUS_20730 gene wcaB 352400 352891 CDS product colanic acid biosynthesis acetyltransferase WcaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097879.1 protein_id gnl|my_center|LOCUS_20730 352888 354105 gene locus_tag LOCUS_20740 gene wcaC 352888 354105 CDS product colanic acid biosynthesis glycosyltransferase WcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097878.1 protein_id gnl|my_center|LOCUS_20740 354080 355300 gene locus_tag LOCUS_20750 gene wcaD 354080 355300 CDS product colanic acid polymerase WcaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107842.1 protein_id gnl|my_center|LOCUS_20750 355314 356060 gene locus_tag LOCUS_20760 gene wcaE 355314 356060 CDS product colanic acid biosynthesis glycosyltransferase WcaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097876.1 protein_id gnl|my_center|LOCUS_20760 356076 356636 gene locus_tag LOCUS_20770 gene wcaF 356076 356636 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097875.1 protein_id gnl|my_center|LOCUS_20770 356752 357873 gene locus_tag LOCUS_20780 gene gmd 356752 357873 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863514.1 protein_id gnl|my_center|LOCUS_20780 357876 358841 gene locus_tag LOCUS_20790 357876 358841 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097874.1 protein_id gnl|my_center|LOCUS_20790 358844 359320 gene locus_tag LOCUS_20800 gene gmm 358844 359320 CDS product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309580.1 protein_id gnl|my_center|LOCUS_20800 359317 360540 gene locus_tag LOCUS_20810 gene wcaI 359317 360540 CDS product colanic acid biosynthesis fucosyltransferase WcaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097872.1 protein_id gnl|my_center|LOCUS_20810 360546 361982 gene locus_tag LOCUS_20820 gene cpsB 360546 361982 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084309.1 protein_id gnl|my_center|LOCUS_20820 362082 363452 gene locus_tag LOCUS_20830 gene cpsG 362082 363452 CDS product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097871.1 protein_id gnl|my_center|LOCUS_20830 363563 364957 gene locus_tag LOCUS_20840 gene wcaJ 363563 364957 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183160.1 protein_id gnl|my_center|LOCUS_20840 364969 366447 gene locus_tag LOCUS_20850 gene wzxC 364969 366447 CDS product colanic acid undecaprenyl disphosphate flippase WzxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097869.1 protein_id gnl|my_center|LOCUS_20850 366591 367868 gene locus_tag LOCUS_20860 gene wcaK 366591 367868 CDS product colanic acid biosynthesis pyruvyl transferase WcaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097868.1 protein_id gnl|my_center|LOCUS_20860 367865 369085 gene locus_tag LOCUS_20870 gene wcaL 367865 369085 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097867.1 protein_id gnl|my_center|LOCUS_20870 369097 370494 gene locus_tag LOCUS_20880 gene wcaM 369097 370494 CDS product colanic acid biosynthesis protein WcaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097866.1 protein_id gnl|my_center|LOCUS_20880 370667 371557 gene locus_tag LOCUS_20890 gene galF 370667 371557 CDS product GalU regulator GalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981469.1 protein_id gnl|my_center|LOCUS_20890 371904 373211 gene locus_tag LOCUS_20900 371904 373211 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939580.1 protein_id gnl|my_center|LOCUS_20900 373216 375567 gene locus_tag LOCUS_20910 373216 375567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 375569 376786 gene locus_tag LOCUS_20920 375569 376786 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058221.1 protein_id gnl|my_center|LOCUS_20920 376773 377951 gene locus_tag LOCUS_20930 376773 377951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 377948 378694 gene locus_tag LOCUS_20940 377948 378694 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125497.1 protein_id gnl|my_center|LOCUS_20940 378681 379529 gene locus_tag LOCUS_20950 378681 379529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 379533 380651 gene locus_tag LOCUS_20960 gene gmd 379533 380651 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167740.1 protein_id gnl|my_center|LOCUS_20960 380656 381621 gene locus_tag LOCUS_20970 380656 381621 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097874.1 protein_id gnl|my_center|LOCUS_20970 381630 382085 gene locus_tag LOCUS_20980 gene gmm 381630 382085 CDS product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393539.1 protein_id gnl|my_center|LOCUS_20980 382091 383497 gene locus_tag LOCUS_20990 382091 383497 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208590.1 protein_id gnl|my_center|LOCUS_20990 383497 384243 gene locus_tag LOCUS_21000 383497 384243 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208589.1 protein_id gnl|my_center|LOCUS_21000 384249 385667 gene locus_tag LOCUS_21010 384249 385667 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107284302.1 protein_id gnl|my_center|LOCUS_21010 385884 386882 gene locus_tag LOCUS_21020 gene rfbB 385884 386882 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699404.1 protein_id gnl|my_center|LOCUS_21020 386950 387828 gene locus_tag LOCUS_21030 gene rfbA 386950 387828 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857508.1 protein_id gnl|my_center|LOCUS_21030 388011 389417 gene locus_tag LOCUS_21040 gene gndA 388011 389417 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043484.1 protein_id gnl|my_center|LOCUS_21040 389678 390844 gene locus_tag LOCUS_21050 gene ugd 389678 390844 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097850.1 protein_id gnl|my_center|LOCUS_21050 391896 390892 gene locus_tag LOCUS_21060 391896 390892 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097849.1 protein_id gnl|my_center|LOCUS_21060 392097 393077 gene locus_tag LOCUS_21070 gene wzzB 392097 393077 CDS product LPS O-antigen chain length determinant protein WzzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097848.1 protein_id gnl|my_center|LOCUS_21070 393729 393118 gene locus_tag LOCUS_21080 gene hisIE 393729 393118 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954830.1 protein_id gnl|my_center|LOCUS_21080 394499 393723 gene locus_tag LOCUS_21090 gene hisF 394499 393723 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097847.1 protein_id gnl|my_center|LOCUS_21090 395218 394481 gene locus_tag LOCUS_21100 gene hisA 395218 394481 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586453.1 protein_id gnl|my_center|LOCUS_21100 395808 395218 gene locus_tag LOCUS_21110 gene hisH 395808 395218 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103580.1 protein_id gnl|my_center|LOCUS_21110 396875 395808 gene locus_tag LOCUS_21120 gene hisB 396875 395808 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080040.1 protein_id gnl|my_center|LOCUS_21120 397933 396872 gene locus_tag LOCUS_21130 gene hisC 397933 396872 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108967.1 protein_id gnl|my_center|LOCUS_21130 399234 397930 gene locus_tag LOCUS_21140 gene hisD 399234 397930 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009596.1 protein_id gnl|my_center|LOCUS_21140 400138 399239 gene locus_tag LOCUS_21150 gene hisG 400138 399239 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886595.1 protein_id gnl|my_center|LOCUS_21150 400498 401322 gene locus_tag LOCUS_21160 400498 401322 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754712.1 protein_id gnl|my_center|LOCUS_21160 401368 402297 gene locus_tag LOCUS_21170 401368 402297 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097841.1 protein_id gnl|my_center|LOCUS_21170 402564 403925 gene locus_tag LOCUS_21180 402564 403925 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097840.1 protein_id gnl|my_center|LOCUS_21180 405519 404095 gene locus_tag LOCUS_21190 gene sbcB 405519 404095 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645258.1 protein_id gnl|my_center|LOCUS_21190 405727 406890 gene locus_tag LOCUS_21200 gene dacD 405727 406890 CDS product serine-type D-Ala-D-Ala carboxypeptidase DacD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097838.1 protein_id gnl|my_center|LOCUS_21200 406968 407441 gene locus_tag LOCUS_21210 gene sbmC 406968 407441 CDS product DNA gyrase inhibitor SbmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097837.1 protein_id gnl|my_center|LOCUS_21210 407588 408646 gene locus_tag LOCUS_21220 407588 408646 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706020.1 protein_id gnl|my_center|LOCUS_21220 408814 409149 gene locus_tag LOCUS_21230 408814 409149 CDS product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010432067.1 protein_id gnl|my_center|LOCUS_21230 410041 409175 gene locus_tag LOCUS_21240 410041 409175 CDS product L-threonine kinase PduX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201312.1 protein_id gnl|my_center|LOCUS_21240 410629 412002 gene locus_tag LOCUS_21250 410629 412002 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741259.1 protein_id gnl|my_center|LOCUS_21250 411999 412964 gene locus_tag LOCUS_21260 gene cbiB 411999 412964 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153666.1 protein_id gnl|my_center|LOCUS_21260 412970 413602 gene locus_tag LOCUS_21270 412970 413602 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816687.1 protein_id gnl|my_center|LOCUS_21270 413599 414738 gene locus_tag LOCUS_21280 gene cbiD 413599 414738 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292925.1 protein_id gnl|my_center|LOCUS_21280 414732 415337 gene locus_tag LOCUS_21290 414732 415337 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958833.1 protein_id gnl|my_center|LOCUS_21290 415327 415905 gene locus_tag LOCUS_21300 415327 415905 CDS product decarboxylating cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650991.1 protein_id gnl|my_center|LOCUS_21300 415889 416662 gene locus_tag LOCUS_21310 415889 416662 CDS product cobalt-precorrin-4 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004870.1 protein_id gnl|my_center|LOCUS_21310 416643 417698 gene locus_tag LOCUS_21320 gene cbiG 416643 417698 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098913.1 protein_id gnl|my_center|LOCUS_21320 417698 418423 gene locus_tag LOCUS_21330 417698 418423 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953643.1 protein_id gnl|my_center|LOCUS_21330 418420 419205 gene locus_tag LOCUS_21340 418420 419205 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816684.1 protein_id gnl|my_center|LOCUS_21340 419217 420011 gene locus_tag LOCUS_21350 419217 420011 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168485.1 protein_id gnl|my_center|LOCUS_21350 420008 420718 gene locus_tag LOCUS_21360 420008 420718 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013551.1 protein_id gnl|my_center|LOCUS_21360 420715 421458 gene locus_tag LOCUS_21370 gene cbiM 420715 421458 CDS product cobalt ECF transporter S component CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816682.1 protein_id gnl|my_center|LOCUS_21370 421455 421736 gene locus_tag LOCUS_21380 421455 421736 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753216.1 protein_id gnl|my_center|LOCUS_21380 421717 422400 gene locus_tag LOCUS_21390 421717 422400 CDS product energy-coupling factor ABC transporter transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147138.1 protein_id gnl|my_center|LOCUS_21390 422409 423224 gene locus_tag LOCUS_21400 422409 423224 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881535.1 protein_id gnl|my_center|LOCUS_21400 423221 424741 gene locus_tag LOCUS_21410 423221 424741 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189676.1 protein_id gnl|my_center|LOCUS_21410 424738 425283 gene locus_tag LOCUS_21420 gene cobU 424738 425283 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973185.1 protein_id gnl|my_center|LOCUS_21420 425280 426029 gene locus_tag LOCUS_21430 gene cobS 425280 426029 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039987.1 protein_id gnl|my_center|LOCUS_21430 426045 427106 gene locus_tag LOCUS_21440 gene cobT 426045 427106 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706018.1 protein_id gnl|my_center|LOCUS_21440 427306 427659 gene locus_tag LOCUS_21450 427306 427659 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222856.1 protein_id gnl|my_center|LOCUS_21450 427664 427966 gene locus_tag LOCUS_21460 427664 427966 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213446.1 protein_id gnl|my_center|LOCUS_21460 428280 427975 gene locus_tag LOCUS_21470 428280 427975 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365828.1 protein_id gnl|my_center|LOCUS_21470 428483 430585 gene locus_tag LOCUS_21480 gene fusA 428483 430585 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706026.1 protein_id gnl|my_center|LOCUS_21480 430716 430895 gene locus_tag LOCUS_21490 430716 430895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 431090 432121 gene locus_tag LOCUS_21500 431090 432121 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366474.1 protein_id gnl|my_center|LOCUS_21500 432198 433112 gene locus_tag LOCUS_21510 432198 433112 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705514.1 protein_id gnl|my_center|LOCUS_21510 433123 434409 gene locus_tag LOCUS_21520 gene livM 433123 434409 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705513.1 protein_id gnl|my_center|LOCUS_21520 434406 435281 gene locus_tag LOCUS_21530 434406 435281 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366477.1 protein_id gnl|my_center|LOCUS_21530 435278 435994 gene locus_tag LOCUS_21540 435278 435994 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366478.1 protein_id gnl|my_center|LOCUS_21540 436381 437703 gene locus_tag LOCUS_21550 436381 437703 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143830281.1 protein_id gnl|my_center|LOCUS_21550 437703 439217 gene locus_tag LOCUS_21560 437703 439217 CDS product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170951.1 protein_id gnl|my_center|LOCUS_21560 440318 439224 gene locus_tag LOCUS_21570 440318 439224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 442847 440361 gene locus_tag LOCUS_21580 442847 440361 CDS product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129197795.1 protein_id gnl|my_center|LOCUS_21580 443589 442879 gene locus_tag LOCUS_21590 443589 442879 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815806.1 protein_id gnl|my_center|LOCUS_21590 444077 443652 gene locus_tag LOCUS_21600 444077 443652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 444931 446349 gene locus_tag LOCUS_21610 444931 446349 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989199.1 protein_id gnl|my_center|LOCUS_21610 446486 446561 gene locus_tag LOCUS_t00240 446486 446561 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 448113 446659 gene locus_tag LOCUS_21620 448113 446659 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428186.1 protein_id gnl|my_center|LOCUS_21620 448377 449405 gene locus_tag LOCUS_21630 448377 449405 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096845.1 protein_id gnl|my_center|LOCUS_21630 450161 449463 gene locus_tag LOCUS_21640 450161 449463 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168627.1 protein_id gnl|my_center|LOCUS_21640 450353 450835 gene locus_tag LOCUS_21650 450353 450835 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705072.1 protein_id gnl|my_center|LOCUS_21650 450881 451126 gene locus_tag LOCUS_21660 450881 451126 CDS product YmjA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368794.1 protein_id gnl|my_center|LOCUS_21660 451304 451229 gene locus_tag LOCUS_t00250 451304 451229 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence04 1056 160 gene locus_tag LOCUS_21670 gene yafC 1056 160 CDS product DNA-binding transcriptional regulator YafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095682.1 protein_id gnl|my_center|LOCUS_21670 1138 2007 gene locus_tag LOCUS_21680 1138 2007 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230964.1 protein_id gnl|my_center|LOCUS_21680 2083 2853 gene locus_tag LOCUS_21690 2083 2853 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368130.1 protein_id gnl|my_center|LOCUS_21690 4051 2897 gene locus_tag LOCUS_21700 gene mltD 4051 2897 CDS product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644706.1 protein_id gnl|my_center|LOCUS_21700 5092 4337 gene locus_tag LOCUS_21710 gene gloB 5092 4337 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052766.1 protein_id gnl|my_center|LOCUS_21710 5126 5842 gene locus_tag LOCUS_21720 5126 5842 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095688.1 protein_id gnl|my_center|LOCUS_21720 6310 5843 gene locus_tag LOCUS_21730 gene rnhA 6310 5843 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917872.1 protein_id gnl|my_center|LOCUS_21730 6366 7106 gene locus_tag LOCUS_21740 gene dnaQ 6366 7106 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368125.1 protein_id gnl|my_center|LOCUS_21740 7234 7310 gene locus_tag LOCUS_t00260 7234 7310 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 8201 7425 gene locus_tag LOCUS_21750 8201 7425 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111965864.1 protein_id gnl|my_center|LOCUS_21750 10759 8306 gene locus_tag LOCUS_21760 gene fadE 10759 8306 CDS product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973130.1 protein_id gnl|my_center|LOCUS_21760 10999 11580 gene locus_tag LOCUS_21770 gene lpcA 10999 11580 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284051.1 protein_id gnl|my_center|LOCUS_21770 11626 12393 gene locus_tag LOCUS_21780 11626 12393 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095728.1 protein_id gnl|my_center|LOCUS_21780 13104 12364 gene locus_tag LOCUS_21790 gene dpaA 13104 12364 CDS product peptidoglycan meso-diaminopimelic acid protein amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095729.1 protein_id gnl|my_center|LOCUS_21790 13371 14426 gene locus_tag LOCUS_21800 gene dinB 13371 14426 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226164.1 protein_id gnl|my_center|LOCUS_21800 15978 14521 gene locus_tag LOCUS_21810 gene pepD 15978 14521 CDS product cytosol nonspecific dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704477.1 protein_id gnl|my_center|LOCUS_21810 16240 16698 gene locus_tag LOCUS_21820 gene gpt 16240 16698 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863205.1 protein_id gnl|my_center|LOCUS_21820 16812 18059 gene locus_tag LOCUS_21830 gene frsA 16812 18059 CDS product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189584.1 protein_id gnl|my_center|LOCUS_21830 18117 18518 gene locus_tag LOCUS_21840 gene crl 18117 18518 CDS product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025760274.1 protein_id gnl|my_center|LOCUS_21840 19651 18590 gene locus_tag LOCUS_21850 gene phoE 19651 18590 CDS product phosphoporin PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095744.1 protein_id gnl|my_center|LOCUS_21850 19942 21045 gene locus_tag LOCUS_21860 gene proB 19942 21045 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095745.1 protein_id gnl|my_center|LOCUS_21860 21057 22310 gene locus_tag LOCUS_21870 gene proA 21057 22310 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095746.1 protein_id gnl|my_center|LOCUS_21870 22425 22500 gene locus_tag LOCUS_t00270 22425 22500 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 23304 25280 gene locus_tag LOCUS_21880 23304 25280 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963667.1 protein_id gnl|my_center|LOCUS_21880 27505 25595 gene locus_tag LOCUS_21890 27505 25595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 28504 27536 gene locus_tag LOCUS_21900 28504 27536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 29103 28501 gene locus_tag LOCUS_21910 29103 28501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 29245 29430 gene locus_tag LOCUS_21920 29245 29430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 30039 29479 gene locus_tag LOCUS_21930 30039 29479 CDS product Ail/Lom family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605048.1 protein_id gnl|my_center|LOCUS_21930 30775 30230 gene locus_tag LOCUS_21940 30775 30230 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524160.1 protein_id gnl|my_center|LOCUS_21940 31692 30769 gene locus_tag LOCUS_21950 gene paoD 31692 30769 CDS product molybdenum cofactor insertion chaperone PaoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122401.1 protein_id gnl|my_center|LOCUS_21950 33907 31706 gene locus_tag LOCUS_21960 gene paoC 33907 31706 CDS product aldehyde oxidoreductase molybdenum-binding subunit PaoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667026.1 protein_id gnl|my_center|LOCUS_21960 34859 33909 gene locus_tag LOCUS_21970 gene paoB 34859 33909 CDS product aldehyde oxidoreductase FAD-binding subunit PaoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643333.1 protein_id gnl|my_center|LOCUS_21970 35422 34856 gene locus_tag LOCUS_21980 gene paoA 35422 34856 CDS product aldehyde dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070685.1 protein_id gnl|my_center|LOCUS_21980 35682 35975 gene locus_tag LOCUS_21990 gene yafN 35682 35975 CDS product type I toxin-antitoxin system antitoxin YafN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554758.1 protein_id gnl|my_center|LOCUS_21990 35972 36376 gene locus_tag LOCUS_22000 gene yafO 35972 36376 CDS product type II toxin-antitoxin system mRNA interferase toxin YafO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263501.1 protein_id gnl|my_center|LOCUS_22000 37424 36465 gene locus_tag LOCUS_22010 37424 36465 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969953.1 protein_id gnl|my_center|LOCUS_22010 38597 37524 gene locus_tag LOCUS_22020 38597 37524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 39478 38594 gene locus_tag LOCUS_22030 39478 38594 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066594.1 protein_id gnl|my_center|LOCUS_22030 40307 39468 gene locus_tag LOCUS_22040 40307 39468 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537570.1 protein_id gnl|my_center|LOCUS_22040 40578 41900 gene locus_tag LOCUS_22050 40578 41900 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038841.1 protein_id gnl|my_center|LOCUS_22050 42398 43615 gene locus_tag LOCUS_22060 42398 43615 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096959.1 protein_id gnl|my_center|LOCUS_22060 43627 43809 gene locus_tag LOCUS_22070 43627 43809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 44601 43822 gene locus_tag LOCUS_22080 gene eutC 44601 43822 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037405.1 protein_id gnl|my_center|LOCUS_22080 45986 44598 gene locus_tag LOCUS_22090 45986 44598 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541772.1 protein_id gnl|my_center|LOCUS_22090 47375 45999 gene locus_tag LOCUS_22100 gene eat 47375 45999 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267271.1 protein_id gnl|my_center|LOCUS_22100 47827 47856 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 48931 47885 gene locus_tag LOCUS_22110 gene fbpC 48931 47885 CDS product ferric ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078833.1 protein_id gnl|my_center|LOCUS_22110 51014 48936 gene locus_tag LOCUS_22120 51014 48936 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084161.1 protein_id gnl|my_center|LOCUS_22120 52116 51085 gene locus_tag LOCUS_22130 52116 51085 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095789.1 protein_id gnl|my_center|LOCUS_22130 53408 52113 gene locus_tag LOCUS_22140 gene uhpC 53408 52113 CDS product MFS transporter family glucose-6-phosphate receptor UhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543352.1 protein_id gnl|my_center|LOCUS_22140 55035 53494 gene locus_tag LOCUS_22150 55035 53494 CDS product MASE1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095791.1 protein_id gnl|my_center|LOCUS_22150 55664 55035 gene locus_tag LOCUS_22160 55664 55035 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095792.1 protein_id gnl|my_center|LOCUS_22160 55947 55726 gene locus_tag LOCUS_22170 55947 55726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 57607 55919 gene locus_tag LOCUS_22180 57607 55919 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095797.1 protein_id gnl|my_center|LOCUS_22180 57954 59738 gene locus_tag LOCUS_22190 57954 59738 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815979.1 protein_id gnl|my_center|LOCUS_22190 60765 59794 gene locus_tag LOCUS_22200 gene hemB 60765 59794 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095798.1 protein_id gnl|my_center|LOCUS_22200 61306 64221 gene locus_tag LOCUS_22210 61306 64221 CDS product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556513.1 protein_id gnl|my_center|LOCUS_22210 64316 64939 gene locus_tag LOCUS_22220 gene iprA 64316 64939 CDS product hydrogen peroxide resistance inhibitor IprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295817.1 protein_id gnl|my_center|LOCUS_22220 66083 64953 gene locus_tag LOCUS_22230 gene ampH 66083 64953 CDS product D-alanyl-D-alanine-carboxypeptidase/endopeptidase AmpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830774.1 protein_id gnl|my_center|LOCUS_22230 66317 66850 gene locus_tag LOCUS_22240 66317 66850 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095802.1 protein_id gnl|my_center|LOCUS_22240 66983 68203 gene locus_tag LOCUS_22250 gene sbmA 66983 68203 CDS product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095803.1 protein_id gnl|my_center|LOCUS_22250 68217 69308 gene locus_tag LOCUS_22260 gene yaiW 68217 69308 CDS product surface-exposed outer membrane lipoprotein YaiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271423.1 protein_id gnl|my_center|LOCUS_22260 69626 69318 gene locus_tag LOCUS_22270 69626 69318 CDS product YaiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763139.1 protein_id gnl|my_center|LOCUS_22270 69879 70106 gene locus_tag LOCUS_22280 69879 70106 CDS product DUF2754 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095806.1 protein_id gnl|my_center|LOCUS_22280 71212 70103 gene locus_tag LOCUS_22290 gene ddlA 71212 70103 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096588.1 protein_id gnl|my_center|LOCUS_22290 71308 71991 gene locus_tag LOCUS_22300 71308 71991 CDS product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095808.1 protein_id gnl|my_center|LOCUS_22300 72022 73227 gene locus_tag LOCUS_22310 72022 73227 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095809.1 protein_id gnl|my_center|LOCUS_22310 73418 73678 gene locus_tag LOCUS_22320 gene iraP 73418 73678 CDS product anti-adapter protein IraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095810.1 protein_id gnl|my_center|LOCUS_22320 73766 75181 gene locus_tag LOCUS_22330 gene phoA 73766 75181 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814404.1 protein_id gnl|my_center|LOCUS_22330 75275 75595 gene locus_tag LOCUS_22340 gene psiF 75275 75595 CDS product phosphate starvation-inducible protein PsiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295332.1 protein_id gnl|my_center|LOCUS_22340 75863 76801 gene locus_tag LOCUS_22350 gene adrA 75863 76801 CDS product diguanylate cyclase AdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484075.1 protein_id gnl|my_center|LOCUS_22350 77626 76817 gene locus_tag LOCUS_22360 gene proC 77626 76817 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095814.1 protein_id gnl|my_center|LOCUS_22360 77768 78226 gene locus_tag LOCUS_22370 77768 78226 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704544.1 protein_id gnl|my_center|LOCUS_22370 78453 78977 gene locus_tag LOCUS_22380 gene aroL 78453 78977 CDS product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095816.1 protein_id gnl|my_center|LOCUS_22380 79022 79213 gene locus_tag LOCUS_22390 gene yaiA 79022 79213 CDS product protein YaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095817.1 protein_id gnl|my_center|LOCUS_22390 79466 80143 gene locus_tag LOCUS_22400 79466 80143 CDS product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704547.1 protein_id gnl|my_center|LOCUS_22400 80218 80502 gene locus_tag LOCUS_22410 gene ppnP 80218 80502 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368017.1 protein_id gnl|my_center|LOCUS_22410 81551 80628 gene locus_tag LOCUS_22420 gene rdgC 81551 80628 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964305.1 protein_id gnl|my_center|LOCUS_22420 81664 82572 gene locus_tag LOCUS_22430 gene mak 81664 82572 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219315.1 protein_id gnl|my_center|LOCUS_22430 83753 82578 gene locus_tag LOCUS_22440 gene araJ 83753 82578 CDS product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196824.1 protein_id gnl|my_center|LOCUS_22440 86922 83767 gene locus_tag LOCUS_22450 gene sbcC 86922 83767 CDS product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698907.1 protein_id gnl|my_center|LOCUS_22450 88121 86919 gene locus_tag LOCUS_22460 gene sbcD 88121 86919 CDS product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221332.1 protein_id gnl|my_center|LOCUS_22460 88320 89009 gene locus_tag LOCUS_22470 gene phoB 88320 89009 CDS product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428026.1 protein_id gnl|my_center|LOCUS_22470 89031 90326 gene locus_tag LOCUS_22480 gene phoR 89031 90326 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893648.1 protein_id gnl|my_center|LOCUS_22480 90736 92055 gene locus_tag LOCUS_22490 gene brnQ 90736 92055 CDS product branched-chain amino acid transporter carrier protein BrnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149625.1 protein_id gnl|my_center|LOCUS_22490 92129 93499 gene locus_tag LOCUS_22500 gene proY 92129 93499 CDS product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602179.1 protein_id gnl|my_center|LOCUS_22500 93640 95481 gene locus_tag LOCUS_22510 gene malZ 93640 95481 CDS product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297133.1 protein_id gnl|my_center|LOCUS_22510 95509 98187 gene locus_tag LOCUS_22520 95509 98187 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105345.1 protein_id gnl|my_center|LOCUS_22520 98184 99554 gene locus_tag LOCUS_22530 98184 99554 CDS product DUF3999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765555.1 protein_id gnl|my_center|LOCUS_22530 100139 99558 gene locus_tag LOCUS_22540 gene acpH 100139 99558 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009858.1 protein_id gnl|my_center|LOCUS_22540 100356 101426 gene locus_tag LOCUS_22550 100356 101426 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266503.1 protein_id gnl|my_center|LOCUS_22550 101655 102782 gene locus_tag LOCUS_22560 gene tgt 101655 102782 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095832.1 protein_id gnl|my_center|LOCUS_22560 102805 103137 gene locus_tag LOCUS_22570 gene yajC 102805 103137 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859109.1 protein_id gnl|my_center|LOCUS_22570 103165 105012 gene locus_tag LOCUS_22580 gene secD 103165 105012 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934811.1 protein_id gnl|my_center|LOCUS_22580 105023 105994 gene locus_tag LOCUS_22590 gene secF 105023 105994 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095834.1 protein_id gnl|my_center|LOCUS_22590 106109 107509 gene locus_tag LOCUS_22600 106109 107509 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081059.1 protein_id gnl|my_center|LOCUS_22600 108431 107547 gene locus_tag LOCUS_22610 108431 107547 CDS product nucleoside-specific channel-forming protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025756198.1 protein_id gnl|my_center|LOCUS_22610 109243 108701 gene locus_tag LOCUS_22620 109243 108701 CDS product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830864.1 protein_id gnl|my_center|LOCUS_22620 109398 109847 gene locus_tag LOCUS_22630 gene nrdR 109398 109847 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543535.1 protein_id gnl|my_center|LOCUS_22630 109852 110955 gene locus_tag LOCUS_22640 gene ribD 109852 110955 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095839.1 protein_id gnl|my_center|LOCUS_22640 111042 111512 gene locus_tag LOCUS_22650 gene ribE 111042 111512 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021161.1 protein_id gnl|my_center|LOCUS_22650 111534 111953 gene locus_tag LOCUS_22660 gene nusB 111534 111953 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006809908.1 protein_id gnl|my_center|LOCUS_22660 112035 113012 gene locus_tag LOCUS_22670 gene thiL 112035 113012 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742107.1 protein_id gnl|my_center|LOCUS_22670 112999 113505 gene locus_tag LOCUS_22680 gene pgpA 112999 113505 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154063.1 protein_id gnl|my_center|LOCUS_22680 114620 113646 gene locus_tag LOCUS_22690 114620 113646 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095841.1 protein_id gnl|my_center|LOCUS_22690 116547 114685 gene locus_tag LOCUS_22700 gene dxs 116547 114685 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006797.1 protein_id gnl|my_center|LOCUS_22700 117471 116572 gene locus_tag LOCUS_22710 gene ispA 117471 116572 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367988.1 protein_id gnl|my_center|LOCUS_22710 117715 117473 gene locus_tag LOCUS_22720 gene xseB 117715 117473 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503331.1 protein_id gnl|my_center|LOCUS_22720 117912 119360 gene locus_tag LOCUS_22730 gene thiI 117912 119360 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095844.1 protein_id gnl|my_center|LOCUS_22730 119424 120158 gene locus_tag LOCUS_22740 119424 120158 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936183.1 protein_id gnl|my_center|LOCUS_22740 120882 120160 gene locus_tag LOCUS_22750 120882 120160 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932350.1 protein_id gnl|my_center|LOCUS_22750 122207 120879 gene locus_tag LOCUS_22760 122207 120879 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726689.1 protein_id gnl|my_center|LOCUS_22760 123487 122219 gene locus_tag LOCUS_22770 123487 122219 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254437.1 protein_id gnl|my_center|LOCUS_22770 124332 123733 gene locus_tag LOCUS_22780 gene yajL 124332 123733 CDS product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367984.1 protein_id gnl|my_center|LOCUS_22780 125206 124295 gene locus_tag LOCUS_22790 gene panE 125206 124295 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705874.1 protein_id gnl|my_center|LOCUS_22790 125384 125875 gene locus_tag LOCUS_22800 gene yajQ 125384 125875 CDS product nucleotide binding protein YajQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138904.1 protein_id gnl|my_center|LOCUS_22800 127280 125916 gene locus_tag LOCUS_22810 127280 125916 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095847.1 protein_id gnl|my_center|LOCUS_22810 128485 127598 gene locus_tag LOCUS_22820 gene cyoE 128485 127598 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971351.1 protein_id gnl|my_center|LOCUS_22820 128826 128497 gene locus_tag LOCUS_22830 128826 128497 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019869.1 protein_id gnl|my_center|LOCUS_22830 129365 128826 gene locus_tag LOCUS_22840 129365 128826 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061708214.1 protein_id gnl|my_center|LOCUS_22840 131421 129430 gene locus_tag LOCUS_22850 gene cyoB 131421 129430 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704587.1 protein_id gnl|my_center|LOCUS_22850 132389 131442 gene locus_tag LOCUS_22860 gene cyoA 132389 131442 CDS product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095851.1 protein_id gnl|my_center|LOCUS_22860 132919 134619 gene locus_tag LOCUS_22870 132919 134619 CDS product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268782.1 protein_id gnl|my_center|LOCUS_22870 134631 135953 gene locus_tag LOCUS_22880 134631 135953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 137443 135968 gene locus_tag LOCUS_22890 gene ampG 137443 135968 CDS product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095853.1 protein_id gnl|my_center|LOCUS_22890 138117 137485 gene locus_tag LOCUS_22900 138117 137485 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095854.1 protein_id gnl|my_center|LOCUS_22900 138370 138687 gene locus_tag LOCUS_22910 gene bolA 138370 138687 CDS product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095855.1 protein_id gnl|my_center|LOCUS_22910 139022 140320 gene locus_tag LOCUS_22920 gene tig 139022 140320 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367952.1 protein_id gnl|my_center|LOCUS_22920 140607 141230 gene locus_tag LOCUS_22930 gene clpP 140607 141230 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021624.1 protein_id gnl|my_center|LOCUS_22930 141356 142630 gene locus_tag LOCUS_22940 gene clpX 141356 142630 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095858.1 protein_id gnl|my_center|LOCUS_22940 142816 145170 gene locus_tag LOCUS_22950 gene lon 142816 145170 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067728.1 protein_id gnl|my_center|LOCUS_22950 145381 145653 gene locus_tag LOCUS_22960 gene hupB 145381 145653 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002444653.1 protein_id gnl|my_center|LOCUS_22960 145855 147726 gene locus_tag LOCUS_22970 gene ppiD 145855 147726 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095860.1 protein_id gnl|my_center|LOCUS_22970 147872 148246 gene locus_tag LOCUS_22980 147872 148246 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680322.1 protein_id gnl|my_center|LOCUS_22980 148342 148740 gene locus_tag LOCUS_22990 gene fadM 148342 148740 CDS product long-chain acyl-CoA thioesterase FadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194543.1 protein_id gnl|my_center|LOCUS_22990 149635 148943 gene locus_tag LOCUS_23000 gene queC 149635 148943 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095864.1 protein_id gnl|my_center|LOCUS_23000 151401 149701 gene locus_tag LOCUS_23010 151401 149701 CDS product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238179.1 protein_id gnl|my_center|LOCUS_23010 151500 152318 gene locus_tag LOCUS_23020 gene cof 151500 152318 CDS product HMP-PP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095866.1 protein_id gnl|my_center|LOCUS_23020 153153 152395 gene locus_tag LOCUS_23030 153153 152395 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068169.1 protein_id gnl|my_center|LOCUS_23030 154003 153140 gene locus_tag LOCUS_23040 154003 153140 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924650.1 protein_id gnl|my_center|LOCUS_23040 154860 154021 gene locus_tag LOCUS_23050 154860 154021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472332.1 protein_id gnl|my_center|LOCUS_23050 156474 154888 gene locus_tag LOCUS_23060 156474 154888 CDS product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099738.1 protein_id gnl|my_center|LOCUS_23060 157825 156782 gene locus_tag LOCUS_23070 157825 156782 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095867.1 protein_id gnl|my_center|LOCUS_23070 157941 158399 gene locus_tag LOCUS_23080 gene decR 157941 158399 CDS product DNA-binding transcriptional regulator DecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884593.1 protein_id gnl|my_center|LOCUS_23080 158451 160223 gene locus_tag LOCUS_23090 158451 160223 CDS product SmdA family multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235628.1 protein_id gnl|my_center|LOCUS_23090 160216 161994 gene locus_tag LOCUS_23100 160216 161994 CDS product SmdB family multidrug efflux ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256093.1 protein_id gnl|my_center|LOCUS_23100 162250 162588 gene locus_tag LOCUS_23110 gene glnK 162250 162588 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780338.1 protein_id gnl|my_center|LOCUS_23110 162618 163904 gene locus_tag LOCUS_23120 gene amtB 162618 163904 CDS product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000685029.1 protein_id gnl|my_center|LOCUS_23120 165114 164254 gene locus_tag LOCUS_23130 gene tesB 165114 164254 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095873.1 protein_id gnl|my_center|LOCUS_23130 165335 165904 gene locus_tag LOCUS_23140 165335 165904 CDS product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779802.1 protein_id gnl|my_center|LOCUS_23140 166259 165948 gene locus_tag LOCUS_23150 166259 165948 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095875.1 protein_id gnl|my_center|LOCUS_23150 167587 168204 gene locus_tag LOCUS_23160 167587 168204 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620669.1 protein_id gnl|my_center|LOCUS_23160 173761 168194 gene locus_tag LOCUS_23170 173761 168194 CDS product ATP-binding sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095415.1 protein_id gnl|my_center|LOCUS_23170 174144 173758 gene locus_tag LOCUS_23180 174144 173758 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095414.1 protein_id gnl|my_center|LOCUS_23180 174422 174162 gene locus_tag LOCUS_23190 174422 174162 CDS product XapX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095413.1 protein_id gnl|my_center|LOCUS_23190 174646 174425 gene locus_tag LOCUS_23200 174646 174425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23200 175397 174705 gene locus_tag LOCUS_23210 175397 174705 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095411.1 protein_id gnl|my_center|LOCUS_23210 175630 177507 gene locus_tag LOCUS_23220 175630 177507 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095410.1 protein_id gnl|my_center|LOCUS_23220 177512 177943 gene locus_tag LOCUS_23230 177512 177943 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095409.1 protein_id gnl|my_center|LOCUS_23230 177930 179549 gene locus_tag LOCUS_23240 177930 179549 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095408.1 protein_id gnl|my_center|LOCUS_23240 179583 180404 gene locus_tag LOCUS_23250 179583 180404 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095407.1 protein_id gnl|my_center|LOCUS_23250 180673 180924 gene locus_tag LOCUS_23260 180673 180924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095876.1 protein_id gnl|my_center|LOCUS_23260 180921 181136 gene locus_tag LOCUS_23270 180921 181136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367928.1 protein_id gnl|my_center|LOCUS_23270 181337 181609 gene locus_tag LOCUS_23280 181337 181609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069541.1 protein_id gnl|my_center|LOCUS_23280 181609 181977 gene locus_tag LOCUS_23290 181609 181977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 183443 182016 gene locus_tag LOCUS_23300 183443 182016 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704605.1 protein_id gnl|my_center|LOCUS_23300 183530 184129 gene locus_tag LOCUS_23310 183530 184129 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367926.1 protein_id gnl|my_center|LOCUS_23310 184163 185269 gene locus_tag LOCUS_23320 184163 185269 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095880.1 protein_id gnl|my_center|LOCUS_23320 185378 188455 gene locus_tag LOCUS_23330 185378 188455 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095881.1 protein_id gnl|my_center|LOCUS_23330 190251 188659 gene locus_tag LOCUS_23340 190251 188659 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095884.1 protein_id gnl|my_center|LOCUS_23340 190375 191091 gene locus_tag LOCUS_23350 190375 191091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 192287 191088 gene locus_tag LOCUS_23360 192287 191088 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803798.1 protein_id gnl|my_center|LOCUS_23360 192567 193940 gene locus_tag LOCUS_23370 192567 193940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 194072 194332 gene locus_tag LOCUS_23380 194072 194332 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006176933.1 protein_id gnl|my_center|LOCUS_23380 195183 194473 gene locus_tag LOCUS_23390 195183 194473 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704607.1 protein_id gnl|my_center|LOCUS_23390 195747 195271 gene locus_tag LOCUS_23400 195747 195271 CDS product YlaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136192.1 protein_id gnl|my_center|LOCUS_23400 196416 195850 gene locus_tag LOCUS_23410 gene maa 196416 195850 CDS product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095888.1 protein_id gnl|my_center|LOCUS_23410 196805 196587 gene locus_tag LOCUS_23420 196805 196587 CDS product HHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095889.1 protein_id gnl|my_center|LOCUS_23420 197208 196834 gene locus_tag LOCUS_23430 gene tomB 197208 196834 CDS product Hha toxicity modulator TomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344807.1 protein_id gnl|my_center|LOCUS_23430 200868 197719 gene locus_tag LOCUS_23440 gene acrB 200868 197719 CDS product multidrug efflux RND transporter permease subunit AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095890.1 protein_id gnl|my_center|LOCUS_23440 202087 200891 gene locus_tag LOCUS_23450 gene acrA 202087 200891 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020079451.1 protein_id gnl|my_center|LOCUS_23450 202287 202880 gene locus_tag LOCUS_23460 gene acrR 202287 202880 CDS product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095892.1 protein_id gnl|my_center|LOCUS_23460 203088 206363 gene locus_tag LOCUS_23470 gene mscK 203088 206363 CDS product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095893.1 protein_id gnl|my_center|LOCUS_23470 206667 206500 gene locus_tag LOCUS_23480 gene rsmS 206667 206500 CDS product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095894.1 protein_id gnl|my_center|LOCUS_23480 207210 206683 gene locus_tag LOCUS_23490 gene priC 207210 206683 CDS product primosomal replication protein N'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704614.1 protein_id gnl|my_center|LOCUS_23490 207280 207657 gene locus_tag LOCUS_23500 207280 207657 CDS product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095896.1 protein_id gnl|my_center|LOCUS_23500 207809 208360 gene locus_tag LOCUS_23510 gene apt 207809 208360 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127359.1 protein_id gnl|my_center|LOCUS_23510 208473 210407 gene locus_tag LOCUS_23520 gene dnaX 208473 210407 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121969.1 protein_id gnl|my_center|LOCUS_23520 210487 210816 gene locus_tag LOCUS_23530 210487 210816 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 protein_id gnl|my_center|LOCUS_23530 211760 210855 gene locus_tag LOCUS_23540 211760 210855 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811380.1 protein_id gnl|my_center|LOCUS_23540 211869 212738 gene locus_tag LOCUS_23550 211869 212738 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705784.1 protein_id gnl|my_center|LOCUS_23550 212895 213500 gene locus_tag LOCUS_23560 gene recR 212895 213500 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195026.1 protein_id gnl|my_center|LOCUS_23560 213601 215475 gene locus_tag LOCUS_23570 gene htpG 213601 215475 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001682145.1 protein_id gnl|my_center|LOCUS_23570 215751 216395 gene locus_tag LOCUS_23580 gene adk 215751 216395 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220237.1 protein_id gnl|my_center|LOCUS_23580 216519 217481 gene locus_tag LOCUS_23590 gene hemH 216519 217481 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095900.1 protein_id gnl|my_center|LOCUS_23590 217542 218846 gene locus_tag LOCUS_23600 gene gsk 217542 218846 CDS product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671574.1 protein_id gnl|my_center|LOCUS_23600 218906 219088 gene locus_tag LOCUS_23610 218906 219088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 220677 219001 gene locus_tag LOCUS_23620 gene ybaL 220677 219001 CDS product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095902.1 protein_id gnl|my_center|LOCUS_23620 222124 220910 gene locus_tag LOCUS_23630 222124 220910 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095903.1 protein_id gnl|my_center|LOCUS_23630 222303 223955 gene locus_tag LOCUS_23640 gene ushA 222303 223955 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095904.1 protein_id gnl|my_center|LOCUS_23640 224953 224066 gene locus_tag LOCUS_23650 224953 224066 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703507.1 protein_id gnl|my_center|LOCUS_23650 225529 225050 gene locus_tag LOCUS_23660 gene ybaK 225529 225050 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186620.1 protein_id gnl|my_center|LOCUS_23660 226523 225714 gene locus_tag LOCUS_23670 226523 225714 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095905.1 protein_id gnl|my_center|LOCUS_23670 226610 226740 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccctctccctcagggagaggg 229265 226764 gene locus_tag LOCUS_23680 gene copA 229265 226764 CDS product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418822.1 protein_id gnl|my_center|LOCUS_23680 229363 229767 gene locus_tag LOCUS_23690 gene cueR 229363 229767 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095907.1 protein_id gnl|my_center|LOCUS_23690 230275 229817 gene locus_tag LOCUS_23700 230275 229817 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561177.1 protein_id gnl|my_center|LOCUS_23700 231186 230272 gene locus_tag LOCUS_23710 231186 230272 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499312.1 protein_id gnl|my_center|LOCUS_23710 232219 231365 gene locus_tag LOCUS_23720 232219 231365 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095911.1 protein_id gnl|my_center|LOCUS_23720 233169 232402 gene locus_tag LOCUS_23730 233169 232402 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095912.1 protein_id gnl|my_center|LOCUS_23730 233854 233198 gene locus_tag LOCUS_23740 gene tesA 233854 233198 CDS product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095913.1 protein_id gnl|my_center|LOCUS_23740 233792 234478 gene locus_tag LOCUS_23750 233792 234478 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095914.1 protein_id gnl|my_center|LOCUS_23750 234475 236889 gene locus_tag LOCUS_23760 234475 236889 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095915.1 protein_id gnl|my_center|LOCUS_23760 238111 237047 gene locus_tag LOCUS_23770 gene mnmH 238111 237047 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095917.1 protein_id gnl|my_center|LOCUS_23770 238184 238318 gene locus_tag LOCUS_23780 238184 238318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 239382 238315 gene locus_tag LOCUS_23790 gene purK 239382 238315 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815527.1 protein_id gnl|my_center|LOCUS_23790 239888 239379 gene locus_tag LOCUS_23800 gene purE 239888 239379 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295318.1 protein_id gnl|my_center|LOCUS_23800 240849 240127 gene locus_tag LOCUS_23810 gene lpxH 240849 240127 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095922.1 protein_id gnl|my_center|LOCUS_23810 241347 240853 gene locus_tag LOCUS_23820 gene ppiB 241347 240853 CDS product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095923.1 protein_id gnl|my_center|LOCUS_23820 241522 242907 gene locus_tag LOCUS_23830 gene cysS 241522 242907 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704630.1 protein_id gnl|my_center|LOCUS_23830 243510 242989 gene locus_tag LOCUS_23840 243510 242989 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143542.1 protein_id gnl|my_center|LOCUS_23840 244600 243584 gene locus_tag LOCUS_23850 gene malI 244600 243584 CDS product Mal regulon transcriptional regulator MalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095926.1 protein_id gnl|my_center|LOCUS_23850 246145 244691 gene locus_tag LOCUS_23860 246145 244691 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095927.1 protein_id gnl|my_center|LOCUS_23860 246144 246338 gene locus_tag LOCUS_23870 246144 246338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 246768 246556 gene locus_tag LOCUS_23880 gene ybcJ 246768 246556 CDS product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095928.1 protein_id gnl|my_center|LOCUS_23880 247636 246770 gene locus_tag LOCUS_23890 gene folD 247636 246770 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095929.1 protein_id gnl|my_center|LOCUS_23890 247863 247939 gene locus_tag LOCUS_t00280 247863 247939 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 248670 248014 gene locus_tag LOCUS_23900 gene fdnI 248670 248014 CDS product formate dehydrogenase-N subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705520.1 protein_id gnl|my_center|LOCUS_23900 249547 248663 gene locus_tag LOCUS_23910 gene fdnH 249547 248663 CDS product formate dehydrogenase N subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240581.1 protein_id gnl|my_center|LOCUS_23910 252606 249559 gene locus_tag LOCUS_23920 gene fdnG 252606 249559 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154231912.1 transl_except (pos:complement(252019..252021),aa:Sec) note codon on position 196 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_23920 253767 252787 gene locus_tag LOCUS_23930 253767 252787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 254411 253764 gene locus_tag LOCUS_23940 254411 253764 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965517.1 protein_id gnl|my_center|LOCUS_23940 254776 254408 gene locus_tag LOCUS_23950 254776 254408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 254987 254796 gene locus_tag LOCUS_23960 254987 254796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 256148 255081 gene locus_tag LOCUS_23970 256148 255081 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267673.1 protein_id gnl|my_center|LOCUS_23970 256250 257164 gene locus_tag LOCUS_23980 256250 257164 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103634.1 protein_id gnl|my_center|LOCUS_23980 258270 257161 gene locus_tag LOCUS_23990 258270 257161 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365665.1 protein_id gnl|my_center|LOCUS_23990 258379 258903 gene locus_tag LOCUS_24000 258379 258903 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399415.1 protein_id gnl|my_center|LOCUS_24000 259249 259680 gene locus_tag LOCUS_24010 259249 259680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 260066 260305 gene locus_tag LOCUS_24020 260066 260305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 261102 260323 gene locus_tag LOCUS_24030 261102 260323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 261512 261096 gene locus_tag LOCUS_24040 261512 261096 CDS product DUF1987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_24040 262098 261505 gene locus_tag LOCUS_24050 262098 261505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 263264 262095 gene locus_tag LOCUS_24060 263264 262095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 263723 264811 gene locus_tag LOCUS_24070 263723 264811 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704680.1 protein_id gnl|my_center|LOCUS_24070 264866 267052 gene locus_tag LOCUS_24080 264866 267052 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704681.1 protein_id gnl|my_center|LOCUS_24080 267171 268562 gene locus_tag LOCUS_24090 gene pheP 267171 268562 CDS product phenylalanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786293.1 protein_id gnl|my_center|LOCUS_24090 271201 268598 gene locus_tag LOCUS_24100 271201 268598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 271733 271572 gene locus_tag LOCUS_24110 271733 271572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 271851 273092 gene locus_tag LOCUS_24120 271851 273092 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 protein_id gnl|my_center|LOCUS_24120 273108 274178 gene locus_tag LOCUS_24130 273108 274178 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097690.1 protein_id gnl|my_center|LOCUS_24130 274171 275322 gene locus_tag LOCUS_24140 274171 275322 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_24140 275399 276379 gene locus_tag LOCUS_24150 275399 276379 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097688.1 protein_id gnl|my_center|LOCUS_24150 276399 277262 gene locus_tag LOCUS_24160 276399 277262 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483368.1 protein_id gnl|my_center|LOCUS_24160 277650 277279 gene locus_tag LOCUS_24170 277650 277279 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097681.1 protein_id gnl|my_center|LOCUS_24170 278232 277651 gene locus_tag LOCUS_24180 278232 277651 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097680.1 protein_id gnl|my_center|LOCUS_24180 278458 279525 gene locus_tag LOCUS_24190 278458 279525 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020079396.1 protein_id gnl|my_center|LOCUS_24190 279566 279907 gene locus_tag LOCUS_24200 279566 279907 CDS product RamA family antibiotic efflux transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367806.1 protein_id gnl|my_center|LOCUS_24200 282115 279992 gene locus_tag LOCUS_24210 gene fhuA 282115 279992 CDS product ferrichrome porin FhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124373.1 protein_id gnl|my_center|LOCUS_24210 282231 283880 gene locus_tag LOCUS_24220 282231 283880 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146602274.1 protein_id gnl|my_center|LOCUS_24220 284085 283840 gene locus_tag LOCUS_24230 284085 283840 CDS product DUF1158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682500.1 protein_id gnl|my_center|LOCUS_24230 285430 284312 gene locus_tag LOCUS_24240 285430 284312 CDS product YbdK family carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130659.1 protein_id gnl|my_center|LOCUS_24240 285918 285574 gene locus_tag LOCUS_24250 285918 285574 CDS product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968855.1 protein_id gnl|my_center|LOCUS_24250 286290 287945 gene locus_tag LOCUS_24260 286290 287945 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173726.1 protein_id gnl|my_center|LOCUS_24260 287966 288919 gene locus_tag LOCUS_24270 287966 288919 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090644.1 protein_id gnl|my_center|LOCUS_24270 288922 289815 gene locus_tag LOCUS_24280 288922 289815 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090643.1 protein_id gnl|my_center|LOCUS_24280 289819 290856 gene locus_tag LOCUS_24290 289819 290856 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966121.1 protein_id gnl|my_center|LOCUS_24290 290846 291856 gene locus_tag LOCUS_24300 290846 291856 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090640.1 protein_id gnl|my_center|LOCUS_24300 291872 293041 gene locus_tag LOCUS_24310 291872 293041 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529753.1 protein_id gnl|my_center|LOCUS_24310 293043 294305 gene locus_tag LOCUS_24320 293043 294305 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930854.1 protein_id gnl|my_center|LOCUS_24320 294302 294478 gene locus_tag LOCUS_24330 294302 294478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 295924 294464 gene locus_tag LOCUS_24340 295924 294464 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527998.1 protein_id gnl|my_center|LOCUS_24340 296161 297015 gene locus_tag LOCUS_24350 296161 297015 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167356.1 protein_id gnl|my_center|LOCUS_24350 297060 297701 gene locus_tag LOCUS_24360 297060 297701 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389051.1 protein_id gnl|my_center|LOCUS_24360 297716 298381 gene locus_tag LOCUS_24370 297716 298381 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522302.1 protein_id gnl|my_center|LOCUS_24370 298374 299135 gene locus_tag LOCUS_24380 298374 299135 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389905.1 protein_id gnl|my_center|LOCUS_24380 299179 299301 gene locus_tag LOCUS_24390 299179 299301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 300085 299318 gene locus_tag LOCUS_24400 300085 299318 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389976.1 protein_id gnl|my_center|LOCUS_24400 300267 301604 gene locus_tag LOCUS_24410 300267 301604 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893816.1 protein_id gnl|my_center|LOCUS_24410 302546 301812 gene locus_tag LOCUS_24420 302546 301812 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156927.1 protein_id gnl|my_center|LOCUS_24420 303354 302530 gene locus_tag LOCUS_24430 303354 302530 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132443.1 protein_id gnl|my_center|LOCUS_24430 304180 303347 gene locus_tag LOCUS_24440 304180 303347 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131974.1 protein_id gnl|my_center|LOCUS_24440 305193 304180 gene locus_tag LOCUS_24450 305193 304180 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640254.1 protein_id gnl|my_center|LOCUS_24450 306972 305404 gene locus_tag LOCUS_24460 306972 305404 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592279.1 protein_id gnl|my_center|LOCUS_24460 308796 307294 gene locus_tag LOCUS_24470 308796 307294 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704701.1 protein_id gnl|my_center|LOCUS_24470 310231 308813 gene locus_tag LOCUS_24480 310231 308813 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167413.1 protein_id gnl|my_center|LOCUS_24480 311212 310265 gene locus_tag LOCUS_24490 311212 310265 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704703.1 protein_id gnl|my_center|LOCUS_24490 312035 311205 gene locus_tag LOCUS_24500 312035 311205 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209438.1 protein_id gnl|my_center|LOCUS_24500 312349 313299 gene locus_tag LOCUS_24510 312349 313299 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367784.1 protein_id gnl|my_center|LOCUS_24510 313413 314300 gene locus_tag LOCUS_24520 gene lafA 313413 314300 CDS product lateral flagellin LafA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949083.1 protein_id gnl|my_center|LOCUS_24520 314581 315909 gene locus_tag LOCUS_24530 gene fliD 314581 315909 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609678.1 protein_id gnl|my_center|LOCUS_24530 315939 316331 gene locus_tag LOCUS_24540 gene fliS 315939 316331 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285322.1 protein_id gnl|my_center|LOCUS_24540 316335 316652 gene locus_tag LOCUS_24550 316335 316652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415004.1 protein_id gnl|my_center|LOCUS_24550 316649 317716 gene locus_tag LOCUS_24560 316649 317716 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067489.1 protein_id gnl|my_center|LOCUS_24560 317734 318192 gene locus_tag LOCUS_24570 317734 318192 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725259.1 protein_id gnl|my_center|LOCUS_24570 318220 318942 gene locus_tag LOCUS_24580 318220 318942 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938726.1 protein_id gnl|my_center|LOCUS_24580 318991 319857 gene locus_tag LOCUS_24590 gene motA 318991 319857 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061067339.1 protein_id gnl|my_center|LOCUS_24590 319857 320819 gene locus_tag LOCUS_24600 gene lafU 319857 320819 CDS product putative lateral flagellar export/assembly protein LafU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191775997.1 protein_id gnl|my_center|LOCUS_24600 320826 321566 gene locus_tag LOCUS_24610 320826 321566 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056849.1 protein_id gnl|my_center|LOCUS_24610 322367 322209 gene locus_tag LOCUS_24620 322367 322209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 323322 322909 gene locus_tag LOCUS_24630 323322 322909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 323787 323419 gene locus_tag LOCUS_24640 323787 323419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 324944 323784 gene locus_tag LOCUS_24650 324944 323784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 325878 324937 gene locus_tag LOCUS_24660 325878 324937 CDS product DUF2169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019587.1 protein_id gnl|my_center|LOCUS_24660 >Feature sequence05 125 580 gene locus_tag LOCUS_24670 125 580 CDS product DUF4385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985648.1 protein_id gnl|my_center|LOCUS_24670 701 1630 gene locus_tag LOCUS_24680 gene metA 701 1630 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122765.1 protein_id gnl|my_center|LOCUS_24680 1875 3476 gene locus_tag LOCUS_24690 gene aceB 1875 3476 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095022.1 protein_id gnl|my_center|LOCUS_24690 3507 4811 gene locus_tag LOCUS_24700 gene aceA 3507 4811 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857886.1 protein_id gnl|my_center|LOCUS_24700 4949 6709 gene locus_tag LOCUS_24710 gene aceK 4949 6709 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095024.1 protein_id gnl|my_center|LOCUS_24710 7666 6836 gene locus_tag LOCUS_24720 gene iclR 7666 6836 CDS product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095025.1 protein_id gnl|my_center|LOCUS_24720 7860 11543 gene locus_tag LOCUS_24730 gene metH 7860 11543 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704023.1 protein_id gnl|my_center|LOCUS_24730 11814 13445 gene locus_tag LOCUS_24740 11814 13445 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095027.1 protein_id gnl|my_center|LOCUS_24740 13548 14417 gene locus_tag LOCUS_24750 gene rluF 13548 14417 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936361.1 protein_id gnl|my_center|LOCUS_24750 14686 14414 gene locus_tag LOCUS_24760 14686 14414 CDS product DUF3811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207628.1 protein_id gnl|my_center|LOCUS_24760 15726 14785 gene locus_tag LOCUS_24770 gene panS 15726 14785 CDS product ketopantoate/pantoate/pantothenate transporter PanS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095031.1 protein_id gnl|my_center|LOCUS_24770 17169 15820 gene locus_tag LOCUS_24780 gene lysC 17169 15820 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136394.1 protein_id gnl|my_center|LOCUS_24780 17463 19109 gene locus_tag LOCUS_24790 gene pgi 17463 19109 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095033.1 protein_id gnl|my_center|LOCUS_24790 19826 20464 gene locus_tag LOCUS_24800 19826 20464 CDS product YjbF family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095035.1 protein_id gnl|my_center|LOCUS_24800 20461 21198 gene locus_tag LOCUS_24810 20461 21198 CDS product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095036.1 protein_id gnl|my_center|LOCUS_24810 21198 23294 gene locus_tag LOCUS_24820 21198 23294 CDS product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095037.1 protein_id gnl|my_center|LOCUS_24820 23585 23995 gene locus_tag LOCUS_24830 gene psiE 23585 23995 CDS product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202963.1 protein_id gnl|my_center|LOCUS_24830 24973 24083 gene locus_tag LOCUS_24840 gene malG 24973 24083 CDS product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095043.1 protein_id gnl|my_center|LOCUS_24840 26532 24988 gene locus_tag LOCUS_24850 gene malF 26532 24988 CDS product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095044.1 protein_id gnl|my_center|LOCUS_24850 27908 26718 gene locus_tag LOCUS_24860 gene malE 27908 26718 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095045.1 protein_id gnl|my_center|LOCUS_24860 28260 29369 gene locus_tag LOCUS_24870 gene malK 28260 29369 CDS product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500080.1 protein_id gnl|my_center|LOCUS_24870 29539 30858 gene locus_tag LOCUS_24880 29539 30858 CDS product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095047.1 protein_id gnl|my_center|LOCUS_24880 30973 31929 gene locus_tag LOCUS_24890 gene malM 30973 31929 CDS product maltose operon protein MalM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704037.1 protein_id gnl|my_center|LOCUS_24890 32106 32603 gene locus_tag LOCUS_24900 gene ubiC 32106 32603 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095049.1 protein_id gnl|my_center|LOCUS_24900 32617 33486 gene locus_tag LOCUS_24910 gene ubiA 32617 33486 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455249.1 protein_id gnl|my_center|LOCUS_24910 36011 33591 gene locus_tag LOCUS_24920 gene plsB 36011 33591 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095051.1 protein_id gnl|my_center|LOCUS_24920 36141 36509 gene locus_tag LOCUS_24930 36141 36509 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368764.1 protein_id gnl|my_center|LOCUS_24930 36619 37227 gene locus_tag LOCUS_24940 gene lexA 36619 37227 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646079.1 protein_id gnl|my_center|LOCUS_24940 37298 38617 gene locus_tag LOCUS_24950 gene dinF 37298 38617 CDS product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134711.1 protein_id gnl|my_center|LOCUS_24950 38846 39055 gene locus_tag LOCUS_24960 38846 39055 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020686626.1 protein_id gnl|my_center|LOCUS_24960 39652 39137 gene locus_tag LOCUS_24970 gene zur 39652 39137 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095057.1 protein_id gnl|my_center|LOCUS_24970 39774 40262 gene locus_tag LOCUS_24980 39774 40262 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620296.1 protein_id gnl|my_center|LOCUS_24980 40452 41759 gene locus_tag LOCUS_24990 40452 41759 CDS product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095059.1 protein_id gnl|my_center|LOCUS_24990 41867 42865 gene locus_tag LOCUS_25000 gene dusA 41867 42865 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704043.1 protein_id gnl|my_center|LOCUS_25000 43010 43252 gene locus_tag LOCUS_25010 gene pspG 43010 43252 CDS product envelope stress response protein PspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891396.1 protein_id gnl|my_center|LOCUS_25010 44413 43430 gene locus_tag LOCUS_25020 44413 43430 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235562.1 protein_id gnl|my_center|LOCUS_25020 44477 45883 gene locus_tag LOCUS_25030 gene dnaB 44477 45883 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918353.1 protein_id gnl|my_center|LOCUS_25030 45900 46979 gene locus_tag LOCUS_25040 gene alr 45900 46979 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147297.1 protein_id gnl|my_center|LOCUS_25040 47164 48357 gene locus_tag LOCUS_25050 gene tyrB 47164 48357 CDS product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095065.1 protein_id gnl|my_center|LOCUS_25050 48548 48387 gene locus_tag LOCUS_25060 48548 48387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 48594 49061 gene locus_tag LOCUS_25070 48594 49061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25070 49043 49306 gene locus_tag LOCUS_25080 49043 49306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25080 49407 49760 gene locus_tag LOCUS_25090 49407 49760 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155657.1 protein_id gnl|my_center|LOCUS_25090 50100 49762 gene locus_tag LOCUS_25100 50100 49762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 50532 50110 gene locus_tag LOCUS_25110 50532 50110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 53489 50664 gene locus_tag LOCUS_25120 gene uvrA 53489 50664 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357724.1 protein_id gnl|my_center|LOCUS_25120 53746 54279 gene locus_tag LOCUS_25130 gene ssb1 53746 54279 CDS product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168299.1 protein_id gnl|my_center|LOCUS_25130 54618 54337 gene locus_tag LOCUS_25140 54618 54337 CDS product YjcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719058.1 protein_id gnl|my_center|LOCUS_25140 55258 56751 gene locus_tag LOCUS_25150 55258 56751 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418469.1 protein_id gnl|my_center|LOCUS_25150 57081 56758 gene locus_tag LOCUS_25160 gene soxS 57081 56758 CDS product superoxide response transcriptional regulator SoxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095071.1 protein_id gnl|my_center|LOCUS_25160 57165 57623 gene locus_tag LOCUS_25170 gene soxR 57165 57623 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095072.1 protein_id gnl|my_center|LOCUS_25170 57895 58563 gene locus_tag LOCUS_25180 57895 58563 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095073.1 protein_id gnl|my_center|LOCUS_25180 58904 60253 gene locus_tag LOCUS_25190 gene ghxP 58904 60253 CDS product guanine/hypoxanthine transporter GhxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095074.1 protein_id gnl|my_center|LOCUS_25190 60535 62181 gene locus_tag LOCUS_25200 60535 62181 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402207.1 protein_id gnl|my_center|LOCUS_25200 63221 62334 gene locus_tag LOCUS_25210 63221 62334 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095076.1 protein_id gnl|my_center|LOCUS_25210 63325 63735 gene locus_tag LOCUS_25220 63325 63735 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095077.1 protein_id gnl|my_center|LOCUS_25220 63728 64417 gene locus_tag LOCUS_25230 63728 64417 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095078.1 protein_id gnl|my_center|LOCUS_25230 65720 64443 gene locus_tag LOCUS_25240 65720 64443 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098573.1 protein_id gnl|my_center|LOCUS_25240 67128 65833 gene locus_tag LOCUS_25250 67128 65833 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167274874.1 protein_id gnl|my_center|LOCUS_25250 67177 68736 gene locus_tag LOCUS_25260 67177 68736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703156.1 protein_id gnl|my_center|LOCUS_25260 70604 68952 gene locus_tag LOCUS_25270 gene actP 70604 68952 CDS product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704067.1 protein_id gnl|my_center|LOCUS_25270 70915 70601 gene locus_tag LOCUS_25280 70915 70601 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999620.1 protein_id gnl|my_center|LOCUS_25280 73013 71055 gene locus_tag LOCUS_25290 gene acs 73013 71055 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095081.1 protein_id gnl|my_center|LOCUS_25290 73428 74741 gene locus_tag LOCUS_25300 gene gltP 73428 74741 CDS product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095082.1 protein_id gnl|my_center|LOCUS_25300 74998 74846 gene locus_tag LOCUS_25310 74998 74846 CDS product Hok/Gef family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095084.1 protein_id gnl|my_center|LOCUS_25310 75584 76318 gene locus_tag LOCUS_25320 75584 76318 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095088.1 protein_id gnl|my_center|LOCUS_25320 77286 76315 gene locus_tag LOCUS_25330 77286 76315 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970599.1 protein_id gnl|my_center|LOCUS_25330 78179 77187 gene locus_tag LOCUS_25340 78179 77187 CDS product ketose 1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418474.1 protein_id gnl|my_center|LOCUS_25340 78877 78191 gene locus_tag LOCUS_25350 78877 78191 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095092.1 protein_id gnl|my_center|LOCUS_25350 79934 78993 gene locus_tag LOCUS_25360 79934 78993 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095094.1 protein_id gnl|my_center|LOCUS_25360 80974 79967 gene locus_tag LOCUS_25370 80974 79967 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095095.1 protein_id gnl|my_center|LOCUS_25370 82478 80967 gene locus_tag LOCUS_25380 82478 80967 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095096.1 protein_id gnl|my_center|LOCUS_25380 82837 85140 gene locus_tag LOCUS_25390 82837 85140 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095097.1 protein_id gnl|my_center|LOCUS_25390 85212 85538 gene locus_tag LOCUS_25400 85212 85538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 86083 85535 gene locus_tag LOCUS_25410 gene phnH 86083 85535 CDS product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368697.1 protein_id gnl|my_center|LOCUS_25410 86583 86248 gene locus_tag LOCUS_25420 86583 86248 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056482.1 protein_id gnl|my_center|LOCUS_25420 87152 89503 gene locus_tag LOCUS_25430 gene crfC 87152 89503 CDS product clamp-binding protein CrfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095116.1 protein_id gnl|my_center|LOCUS_25430 89500 90384 gene locus_tag LOCUS_25440 89500 90384 CDS product diguanylate cyclase regulator RdcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882903.1 protein_id gnl|my_center|LOCUS_25440 91420 90422 gene locus_tag LOCUS_25450 gene kdgT 91420 90422 CDS product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095118.1 protein_id gnl|my_center|LOCUS_25450 92103 93605 gene locus_tag LOCUS_25460 gene proP 92103 93605 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919708.1 protein_id gnl|my_center|LOCUS_25460 94658 93705 gene locus_tag LOCUS_25470 94658 93705 CDS product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418498.1 protein_id gnl|my_center|LOCUS_25470 94887 95966 gene locus_tag LOCUS_25480 94887 95966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 98805 96013 gene locus_tag LOCUS_25490 98805 96013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 99159 99845 gene locus_tag LOCUS_25500 99159 99845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103250.1 protein_id gnl|my_center|LOCUS_25500 100439 99888 gene locus_tag LOCUS_25510 100439 99888 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179442.1 protein_id gnl|my_center|LOCUS_25510 100684 101721 gene locus_tag LOCUS_25520 100684 101721 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161578.1 protein_id gnl|my_center|LOCUS_25520 102142 101798 gene locus_tag LOCUS_25530 102142 101798 CDS product DUF1869 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706012.1 protein_id gnl|my_center|LOCUS_25530 102485 102153 gene locus_tag LOCUS_25540 102485 102153 CDS product DUF1971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706013.1 protein_id gnl|my_center|LOCUS_25540 102844 102482 gene locus_tag LOCUS_25550 gene yeaR 102844 102482 CDS product DUF1971 domain-containing protein YeaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939322.1 protein_id gnl|my_center|LOCUS_25550 103157 103082 gene locus_tag LOCUS_t00290 103157 103082 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 103329 104174 gene locus_tag LOCUS_25560 103329 104174 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091026.1 protein_id gnl|my_center|LOCUS_25560 104214 104816 gene locus_tag LOCUS_25570 104214 104816 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114018.1 protein_id gnl|my_center|LOCUS_25570 105394 104819 gene locus_tag LOCUS_25580 105394 104819 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095254.1 protein_id gnl|my_center|LOCUS_25580 107223 105442 gene locus_tag LOCUS_25590 107223 105442 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095255.1 protein_id gnl|my_center|LOCUS_25590 107522 107199 gene locus_tag LOCUS_25600 gene cutA 107522 107199 CDS product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704145.1 protein_id gnl|my_center|LOCUS_25600 108918 107617 gene locus_tag LOCUS_25610 108918 107617 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368669.1 protein_id gnl|my_center|LOCUS_25610 110464 109028 gene locus_tag LOCUS_25620 gene aspA 110464 109028 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368668.1 protein_id gnl|my_center|LOCUS_25620 110803 111270 gene locus_tag LOCUS_25630 gene fxsA 110803 111270 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267448.1 protein_id gnl|my_center|LOCUS_25630 112537 111299 gene locus_tag LOCUS_25640 gene yjeH 112537 111299 CDS product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418505.1 protein_id gnl|my_center|LOCUS_25640 112776 113069 gene locus_tag LOCUS_25650 112776 113069 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027827.1 protein_id gnl|my_center|LOCUS_25650 113113 114759 gene locus_tag LOCUS_25660 gene groL 113113 114759 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729126.1 protein_id gnl|my_center|LOCUS_25660 114918 115271 gene locus_tag LOCUS_25670 114918 115271 CDS product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605289.1 protein_id gnl|my_center|LOCUS_25670 116174 115317 gene locus_tag LOCUS_25680 116174 115317 CDS product YjeJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008027.1 protein_id gnl|my_center|LOCUS_25680 117161 116319 gene locus_tag LOCUS_25690 gene epmB 117161 116319 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940500.1 protein_id gnl|my_center|LOCUS_25690 117389 117955 gene locus_tag LOCUS_25700 gene efp 117389 117955 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855940.1 protein_id gnl|my_center|LOCUS_25700 118123 118269 gene locus_tag LOCUS_25710 gene ecnB 118123 118269 CDS product lipoprotein toxin entericidin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368653.1 protein_id gnl|my_center|LOCUS_25710 118910 118311 gene locus_tag LOCUS_25720 118910 118311 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095267.1 protein_id gnl|my_center|LOCUS_25720 119174 119491 gene locus_tag LOCUS_25730 gene sugE 119174 119491 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118469.1 protein_id gnl|my_center|LOCUS_25730 120018 119488 gene locus_tag LOCUS_25740 120018 119488 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238395.1 protein_id gnl|my_center|LOCUS_25740 120232 121767 gene locus_tag LOCUS_25750 gene ptsG 120232 121767 CDS product glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838205.1 protein_id gnl|my_center|LOCUS_25750 121789 123504 gene locus_tag LOCUS_25760 121789 123504 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202887107.1 protein_id gnl|my_center|LOCUS_25760 123507 124376 gene locus_tag LOCUS_25770 123507 124376 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127403.1 protein_id gnl|my_center|LOCUS_25770 124378 125322 gene locus_tag LOCUS_25780 124378 125322 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868944.1 protein_id gnl|my_center|LOCUS_25780 125736 125377 gene locus_tag LOCUS_25790 gene frdD 125736 125377 CDS product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368650.1 protein_id gnl|my_center|LOCUS_25790 126141 125746 gene locus_tag LOCUS_25800 gene frdC 126141 125746 CDS product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704155.1 protein_id gnl|my_center|LOCUS_25800 126886 126152 gene locus_tag LOCUS_25810 gene frdB 126886 126152 CDS product fumarate reductase iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095274.1 protein_id gnl|my_center|LOCUS_25810 128546 126879 gene locus_tag LOCUS_25820 gene frdA 128546 126879 CDS product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095275.1 protein_id gnl|my_center|LOCUS_25820 128908 129885 gene locus_tag LOCUS_25830 gene epmA 128908 129885 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004789.1 protein_id gnl|my_center|LOCUS_25830 130327 131043 gene locus_tag LOCUS_25840 130327 131043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129713135.1 protein_id gnl|my_center|LOCUS_25840 131134 131355 gene locus_tag LOCUS_25850 131134 131355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 131573 133909 gene locus_tag LOCUS_25860 gene arcB 131573 133909 CDS product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098948.1 protein_id gnl|my_center|LOCUS_25860 134142 134795 gene locus_tag LOCUS_25870 gene elbB 134142 134795 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300411.1 protein_id gnl|my_center|LOCUS_25870 134792 135511 gene locus_tag LOCUS_25880 gene mtgA 134792 135511 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098946.1 protein_id gnl|my_center|LOCUS_25880 135967 135695 gene locus_tag LOCUS_25890 gene npr 135967 135695 CDS product PTS phosphocarrier protein NPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861872.1 protein_id gnl|my_center|LOCUS_25890 136818 135964 gene locus_tag LOCUS_25900 gene rapZ 136818 135964 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098945.1 protein_id gnl|my_center|LOCUS_25900 137355 136864 gene locus_tag LOCUS_25910 gene ptsN 137355 136864 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098944.1 protein_id gnl|my_center|LOCUS_25910 137725 137438 gene locus_tag LOCUS_25920 gene hpf 137725 137438 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176588.1 protein_id gnl|my_center|LOCUS_25920 139181 137748 gene locus_tag LOCUS_25930 gene rpoN 139181 137748 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809059.1 protein_id gnl|my_center|LOCUS_25930 139952 139227 gene locus_tag LOCUS_25940 gene lptB 139952 139227 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098941.1 protein_id gnl|my_center|LOCUS_25940 140513 139959 gene locus_tag LOCUS_25950 gene lptA 140513 139959 CDS product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669785.1 protein_id gnl|my_center|LOCUS_25950 141057 140482 gene locus_tag LOCUS_25960 gene lptC 141057 140482 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098939.1 protein_id gnl|my_center|LOCUS_25960 141620 141054 gene locus_tag LOCUS_25970 gene kdsC 141620 141054 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098938.1 protein_id gnl|my_center|LOCUS_25970 142620 141634 gene locus_tag LOCUS_25980 gene kdsD 142620 141634 CDS product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098937.1 protein_id gnl|my_center|LOCUS_25980 143610 142633 gene locus_tag LOCUS_25990 143610 142633 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098936.1 protein_id gnl|my_center|LOCUS_25990 143828 144640 gene locus_tag LOCUS_26000 gene mlaF 143828 144640 CDS product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098935.1 protein_id gnl|my_center|LOCUS_26000 144648 145430 gene locus_tag LOCUS_26010 gene mlaE 144648 145430 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925795.1 protein_id gnl|my_center|LOCUS_26010 145435 145989 gene locus_tag LOCUS_26020 gene mlaD 145435 145989 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193591.1 protein_id gnl|my_center|LOCUS_26020 146003 146638 gene locus_tag LOCUS_26030 gene mlaC 146003 146638 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476475.1 protein_id gnl|my_center|LOCUS_26030 146638 146931 gene locus_tag LOCUS_26040 gene mlaB 146638 146931 CDS product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098932.1 protein_id gnl|my_center|LOCUS_26040 147057 147311 gene locus_tag LOCUS_26050 gene ibaG 147057 147311 CDS product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501458.1 protein_id gnl|my_center|LOCUS_26050 147365 148624 gene locus_tag LOCUS_26060 gene murA 147365 148624 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369505.1 protein_id gnl|my_center|LOCUS_26060 148978 148703 gene locus_tag LOCUS_26070 gene sfsB 148978 148703 CDS product DNA-binding transcriptional regulator SfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098930.1 protein_id gnl|my_center|LOCUS_26070 150173 149202 gene locus_tag LOCUS_26080 gene ispB 150173 149202 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098929.1 protein_id gnl|my_center|LOCUS_26080 150430 150741 gene locus_tag LOCUS_26090 gene rplU 150430 150741 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025032.1 protein_id gnl|my_center|LOCUS_26090 150762 151019 gene locus_tag LOCUS_26100 gene rpmA 150762 151019 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002434222.1 protein_id gnl|my_center|LOCUS_26100 151113 152078 gene locus_tag LOCUS_26110 151113 152078 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369509.1 protein_id gnl|my_center|LOCUS_26110 152094 153272 gene locus_tag LOCUS_26120 gene cgtA 152094 153272 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369510.1 protein_id gnl|my_center|LOCUS_26120 154664 153318 gene locus_tag LOCUS_26130 gene dacB 154664 153318 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420697.1 protein_id gnl|my_center|LOCUS_26130 154998 155474 gene locus_tag LOCUS_26140 gene greA 154998 155474 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369513.1 protein_id gnl|my_center|LOCUS_26140 155961 155629 gene locus_tag LOCUS_26150 gene yhbY 155961 155629 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196654.1 protein_id gnl|my_center|LOCUS_26150 156046 156675 gene locus_tag LOCUS_26160 gene rlmE 156046 156675 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861812.1 protein_id gnl|my_center|LOCUS_26160 156766 158709 gene locus_tag LOCUS_26170 gene ftsH 156766 158709 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369514.1 protein_id gnl|my_center|LOCUS_26170 158795 159643 gene locus_tag LOCUS_26180 gene folP 158795 159643 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764731.1 protein_id gnl|my_center|LOCUS_26180 159636 160973 gene locus_tag LOCUS_26190 gene glmM 159636 160973 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071169.1 protein_id gnl|my_center|LOCUS_26190 161202 161534 gene locus_tag LOCUS_26200 gene secG 161202 161534 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272680.1 protein_id gnl|my_center|LOCUS_26200 161544 161630 gene locus_tag LOCUS_t00300 161544 161630 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 163096 161750 gene locus_tag LOCUS_26210 gene argG 163096 161750 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098918.1 protein_id gnl|my_center|LOCUS_26210 163566 163642 gene locus_tag LOCUS_t00310 163566 163642 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 163881 164303 gene locus_tag LOCUS_26220 gene rimP 163881 164303 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296446.1 protein_id gnl|my_center|LOCUS_26220 164332 165834 gene locus_tag LOCUS_26230 gene nusA 164332 165834 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098917.1 protein_id gnl|my_center|LOCUS_26230 165859 168570 gene locus_tag LOCUS_26240 gene infB 165859 168570 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098916.1 protein_id gnl|my_center|LOCUS_26240 168714 169118 gene locus_tag LOCUS_26250 gene rbfA 168714 169118 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918248.1 protein_id gnl|my_center|LOCUS_26250 169118 170062 gene locus_tag LOCUS_26260 gene truB 169118 170062 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089698.1 protein_id gnl|my_center|LOCUS_26260 170212 170481 gene locus_tag LOCUS_26270 gene rpsO 170212 170481 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098914.1 protein_id gnl|my_center|LOCUS_26270 170726 172861 gene locus_tag LOCUS_26280 gene pnp 170726 172861 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369529.1 protein_id gnl|my_center|LOCUS_26280 172975 173859 gene locus_tag LOCUS_26290 gene nlpI 172975 173859 CDS product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098912.1 protein_id gnl|my_center|LOCUS_26290 174039 175958 gene locus_tag LOCUS_26300 174039 175958 CDS product DEAD/DEAH family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098911.1 protein_id gnl|my_center|LOCUS_26300 176108 177352 gene locus_tag LOCUS_26310 gene mtr 176108 177352 CDS product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224390.1 protein_id gnl|my_center|LOCUS_26310 178521 177514 gene locus_tag LOCUS_26320 178521 177514 CDS product luciferase-like monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130380.1 protein_id gnl|my_center|LOCUS_26320 179480 178602 gene locus_tag LOCUS_26330 179480 178602 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703594.1 protein_id gnl|my_center|LOCUS_26330 180484 179489 gene locus_tag LOCUS_26340 180484 179489 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098907.1 protein_id gnl|my_center|LOCUS_26340 180725 181249 gene locus_tag LOCUS_26350 180725 181249 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098906.1 protein_id gnl|my_center|LOCUS_26350 181243 181746 gene locus_tag LOCUS_26360 181243 181746 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908562.1 protein_id gnl|my_center|LOCUS_26360 182035 181733 gene locus_tag LOCUS_26370 182035 181733 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928379.1 protein_id gnl|my_center|LOCUS_26370 182090 182527 gene locus_tag LOCUS_26380 182090 182527 CDS product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449030.1 protein_id gnl|my_center|LOCUS_26380 183031 182513 gene locus_tag LOCUS_26390 183031 182513 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098902.1 protein_id gnl|my_center|LOCUS_26390 183163 183810 gene locus_tag LOCUS_26400 183163 183810 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001638995.1 protein_id gnl|my_center|LOCUS_26400 183887 184927 gene locus_tag LOCUS_26410 183887 184927 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147632.1 protein_id gnl|my_center|LOCUS_26410 185643 185068 gene locus_tag LOCUS_26420 gene dolP 185643 185068 CDS product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643280.1 protein_id gnl|my_center|LOCUS_26420 186243 185653 gene locus_tag LOCUS_26430 gene diaA 186243 185653 CDS product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861754.1 protein_id gnl|my_center|LOCUS_26430 186661 186266 gene locus_tag LOCUS_26440 186661 186266 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246847.1 protein_id gnl|my_center|LOCUS_26440 188655 186619 gene locus_tag LOCUS_26450 188655 186619 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249248.1 protein_id gnl|my_center|LOCUS_26450 188766 189629 gene locus_tag LOCUS_26460 gene rsmI 188766 189629 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809263.1 protein_id gnl|my_center|LOCUS_26460 189896 191653 gene locus_tag LOCUS_26470 gene tssD 189896 191653 CDS product type VI secretion system tube protein TssD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502511.1 protein_id gnl|my_center|LOCUS_26470 191658 191948 gene locus_tag LOCUS_26480 191658 191948 CDS product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481663.1 protein_id gnl|my_center|LOCUS_26480 192120 192410 gene locus_tag LOCUS_26490 192120 192410 CDS product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282228.1 protein_id gnl|my_center|LOCUS_26490 193308 192517 gene locus_tag LOCUS_26500 gene agaD 193308 192517 CDS product PTS galactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534347.1 protein_id gnl|my_center|LOCUS_26500 194101 193298 gene locus_tag LOCUS_26510 gene agaC 194101 193298 CDS product PTS galactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544474.1 protein_id gnl|my_center|LOCUS_26510 194632 194156 gene locus_tag LOCUS_26520 gene agaB 194632 194156 CDS product PTS galactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098022.1 protein_id gnl|my_center|LOCUS_26520 195554 194682 gene locus_tag LOCUS_26530 gene kbaY 195554 194682 CDS product tagatose-bisphosphate aldolase subunit KbaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022773.1 protein_id gnl|my_center|LOCUS_26530 196703 195558 gene locus_tag LOCUS_26540 196703 195558 CDS product AgaS family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114873.1 protein_id gnl|my_center|LOCUS_26540 197413 196979 gene locus_tag LOCUS_26550 gene agaF 197413 196979 CDS product PTS galactosamine/N-acetylgalactosamine transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948824.1 protein_id gnl|my_center|LOCUS_26550 198844 197540 gene locus_tag LOCUS_26560 gene kbaZ 198844 197540 CDS product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024130977.1 protein_id gnl|my_center|LOCUS_26560 199091 199900 gene locus_tag LOCUS_26570 199091 199900 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098886.1 protein_id gnl|my_center|LOCUS_26570 200847 199957 gene locus_tag LOCUS_26580 200847 199957 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168564.1 protein_id gnl|my_center|LOCUS_26580 201467 200919 gene locus_tag LOCUS_26590 201467 200919 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390815.1 protein_id gnl|my_center|LOCUS_26590 201636 202643 gene locus_tag LOCUS_26600 201636 202643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 203379 202702 gene locus_tag LOCUS_26610 203379 202702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095762.1 protein_id gnl|my_center|LOCUS_26610 203583 203852 gene locus_tag LOCUS_26620 203583 203852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 205502 203931 gene locus_tag LOCUS_26630 gene garD 205502 203931 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273719.1 protein_id gnl|my_center|LOCUS_26630 205978 206748 gene locus_tag LOCUS_26640 gene garL 205978 206748 CDS product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057715.1 protein_id gnl|my_center|LOCUS_26640 206780 207670 gene locus_tag LOCUS_26650 gene garR 206780 207670 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178106.1 protein_id gnl|my_center|LOCUS_26650 207764 208909 gene locus_tag LOCUS_26660 gene garK 207764 208909 CDS product glycerate 2-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703577.1 protein_id gnl|my_center|LOCUS_26660 209681 209514 gene locus_tag LOCUS_26670 209681 209514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 210405 209704 gene locus_tag LOCUS_26680 210405 209704 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098873.1 protein_id gnl|my_center|LOCUS_26680 210510 211409 gene locus_tag LOCUS_26690 gene yhaJ 210510 211409 CDS product DNA-binding transcriptional regulator YhaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041028.1 protein_id gnl|my_center|LOCUS_26690 211800 211435 gene locus_tag LOCUS_26700 211800 211435 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369567.1 protein_id gnl|my_center|LOCUS_26700 213662 212025 gene locus_tag LOCUS_26710 213662 212025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 213807 214985 gene locus_tag LOCUS_26720 gene ogl 213807 214985 CDS product oligogalacturonate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816209.1 protein_id gnl|my_center|LOCUS_26720 214997 216283 gene locus_tag LOCUS_26730 214997 216283 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170166.1 protein_id gnl|my_center|LOCUS_26730 216340 217155 gene locus_tag LOCUS_26740 gene iolO 216340 217155 CDS product 5-keto-L-gluconate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083268.1 protein_id gnl|my_center|LOCUS_26740 218180 217176 gene locus_tag LOCUS_26750 gene yqjG 218180 217176 CDS product glutathionyl-hydroquinone reductase YqjG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531180.1 protein_id gnl|my_center|LOCUS_26750 218643 218251 gene locus_tag LOCUS_26760 218643 218251 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732240.1 protein_id gnl|my_center|LOCUS_26760 219135 218839 gene locus_tag LOCUS_26770 219135 218839 CDS product YqjK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095496.1 protein_id gnl|my_center|LOCUS_26770 219530 219135 gene locus_tag LOCUS_26780 219530 219135 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785626.1 protein_id gnl|my_center|LOCUS_26780 219840 219532 gene locus_tag LOCUS_26790 219840 219532 CDS product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098866.1 protein_id gnl|my_center|LOCUS_26790 220241 219873 gene locus_tag LOCUS_26800 220241 219873 CDS product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877297.1 protein_id gnl|my_center|LOCUS_26800 220773 220390 gene locus_tag LOCUS_26810 gene mzrA 220773 220390 CDS product EnvZ/OmpR regulon moderator MzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098864.1 protein_id gnl|my_center|LOCUS_26810 221437 220775 gene locus_tag LOCUS_26820 gene yqjA 221437 220775 CDS product DedA family general envelope maintenance protein YqjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369576.1 protein_id gnl|my_center|LOCUS_26820 222544 221768 gene locus_tag LOCUS_26830 gene exuR 222544 221768 CDS product transcriptional regulator ExuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098862.1 protein_id gnl|my_center|LOCUS_26830 223987 222683 gene locus_tag LOCUS_26840 223987 222683 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098861.1 protein_id gnl|my_center|LOCUS_26840 224455 225867 gene locus_tag LOCUS_26850 gene uxaC 224455 225867 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187442.1 protein_id gnl|my_center|LOCUS_26850 225885 227372 gene locus_tag LOCUS_26860 225885 227372 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098859.1 protein_id gnl|my_center|LOCUS_26860 227477 228031 gene locus_tag LOCUS_26870 227477 228031 CDS product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128143.1 protein_id gnl|my_center|LOCUS_26870 229292 228048 gene locus_tag LOCUS_26880 gene sstT 229292 228048 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235369.1 protein_id gnl|my_center|LOCUS_26880 230489 229521 gene locus_tag LOCUS_26890 230489 229521 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703564.1 protein_id gnl|my_center|LOCUS_26890 231714 230734 gene locus_tag LOCUS_26900 231714 230734 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098856.1 protein_id gnl|my_center|LOCUS_26900 232295 231804 gene locus_tag LOCUS_26910 232295 231804 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202966.1 protein_id gnl|my_center|LOCUS_26910 232380 233516 gene locus_tag LOCUS_26920 gene rlmG 232380 233516 CDS product 23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098854.1 protein_id gnl|my_center|LOCUS_26920 233700 234563 gene locus_tag LOCUS_26930 233700 234563 CDS product DUF3289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059672.1 protein_id gnl|my_center|LOCUS_26930 234599 235087 gene locus_tag LOCUS_26940 234599 235087 CDS product DUF943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837563.1 protein_id gnl|my_center|LOCUS_26940 237142 235124 gene locus_tag LOCUS_26950 237142 235124 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098853.1 protein_id gnl|my_center|LOCUS_26950 238969 237386 gene locus_tag LOCUS_26960 gene lsrK 238969 237386 CDS product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098852.1 protein_id gnl|my_center|LOCUS_26960 239977 239006 gene locus_tag LOCUS_26970 gene lsrR 239977 239006 CDS product transcriptional regulator LsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098851.1 protein_id gnl|my_center|LOCUS_26970 240194 241684 gene locus_tag LOCUS_26980 gene lsrA 240194 241684 CDS product autoinducer 2 ABC transporter ATP-binding protein LsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098850.1 protein_id gnl|my_center|LOCUS_26980 241681 242715 gene locus_tag LOCUS_26990 gene lsrC 241681 242715 CDS product autoinducer 2 ABC transporter permease LsrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098849.1 protein_id gnl|my_center|LOCUS_26990 242716 243708 gene locus_tag LOCUS_27000 gene lsrD 242716 243708 CDS product autoinducer 2 ABC transporter permease LsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703557.1 protein_id gnl|my_center|LOCUS_27000 243710 244711 gene locus_tag LOCUS_27010 gene lsrB 243710 244711 CDS product autoinducer 2 ABC transporter substrate-binding protein LsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098847.1 protein_id gnl|my_center|LOCUS_27010 244723 245610 gene locus_tag LOCUS_27020 gene lsrF 244723 245610 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917724.1 protein_id gnl|my_center|LOCUS_27020 245607 245900 gene locus_tag LOCUS_27030 gene lsrG 245607 245900 CDS product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098845.1 protein_id gnl|my_center|LOCUS_27030 245900 246031 gene locus_tag LOCUS_27040 245900 246031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 >Feature sequence06 409 137 gene locus_tag LOCUS_27050 409 137 CDS product YfiM family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370273.1 protein_id gnl|my_center|LOCUS_27050 1755 517 gene locus_tag LOCUS_27060 gene pssA 1755 517 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949286.1 protein_id gnl|my_center|LOCUS_27060 4647 1993 gene locus_tag LOCUS_27070 gene pat 4647 1993 CDS product protein lysine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098332.1 protein_id gnl|my_center|LOCUS_27070 5207 4680 gene locus_tag LOCUS_27080 gene tapT 5207 4680 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703189.1 protein_id gnl|my_center|LOCUS_27080 5866 5447 gene locus_tag LOCUS_27090 gene trxC 5866 5447 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098330.1 protein_id gnl|my_center|LOCUS_27090 6069 7124 gene locus_tag LOCUS_27100 6069 7124 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098329.1 protein_id gnl|my_center|LOCUS_27100 7847 7158 gene locus_tag LOCUS_27110 gene ung 7847 7158 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098328.1 protein_id gnl|my_center|LOCUS_27110 8163 8546 gene locus_tag LOCUS_27120 gene grcA 8163 8546 CDS product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914084.1 protein_id gnl|my_center|LOCUS_27120 9913 8591 gene locus_tag LOCUS_27130 gene srmB 9913 8591 CDS product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098326.1 protein_id gnl|my_center|LOCUS_27130 10123 10782 gene locus_tag LOCUS_27140 gene trmN 10123 10782 CDS product tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302911.1 protein_id gnl|my_center|LOCUS_27140 12375 10771 gene locus_tag LOCUS_27150 gene nadB 12375 10771 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094491.1 protein_id gnl|my_center|LOCUS_27150 12800 13375 gene locus_tag LOCUS_27160 gene rpoE 12800 13375 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006176728.1 protein_id gnl|my_center|LOCUS_27160 13408 14061 gene locus_tag LOCUS_27170 gene rseA 13408 14061 CDS product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168379.1 protein_id gnl|my_center|LOCUS_27170 14061 15014 gene locus_tag LOCUS_27180 gene rseB 14061 15014 CDS product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098322.1 protein_id gnl|my_center|LOCUS_27180 15011 15490 gene locus_tag LOCUS_27190 gene rseC 15011 15490 CDS product SoxR-reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703183.1 protein_id gnl|my_center|LOCUS_27190 15659 17458 gene locus_tag LOCUS_27200 gene lepA 15659 17458 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370288.1 protein_id gnl|my_center|LOCUS_27200 17474 18448 gene locus_tag LOCUS_27210 gene lepB 17474 18448 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098319.1 protein_id gnl|my_center|LOCUS_27210 18724 19338 gene locus_tag LOCUS_27220 gene rnc 18724 19338 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860711.1 protein_id gnl|my_center|LOCUS_27220 19335 20243 gene locus_tag LOCUS_27230 gene era 19335 20243 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102231.1 protein_id gnl|my_center|LOCUS_27230 20250 20969 gene locus_tag LOCUS_27240 gene recO 20250 20969 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098316.1 protein_id gnl|my_center|LOCUS_27240 21086 21817 gene locus_tag LOCUS_27250 gene pdxJ 21086 21817 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098315.1 protein_id gnl|my_center|LOCUS_27250 21817 22197 gene locus_tag LOCUS_27260 gene acpS 21817 22197 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986023.1 protein_id gnl|my_center|LOCUS_27260 22454 22194 gene locus_tag LOCUS_27270 22454 22194 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370294.1 protein_id gnl|my_center|LOCUS_27270 23359 22511 gene locus_tag LOCUS_27280 23359 22511 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098313.1 protein_id gnl|my_center|LOCUS_27280 23478 24371 gene locus_tag LOCUS_27290 gene murQ 23478 24371 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098312.1 protein_id gnl|my_center|LOCUS_27290 24382 25743 gene locus_tag LOCUS_27300 24382 25743 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098311.1 protein_id gnl|my_center|LOCUS_27300 25747 26379 gene locus_tag LOCUS_27310 gene yfhb 25747 26379 CDS product phosphatidylglycerophosphatase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190651.1 protein_id gnl|my_center|LOCUS_27310 26432 26932 gene locus_tag LOCUS_27320 gene tadA 26432 26932 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134566.1 protein_id gnl|my_center|LOCUS_27320 28479 26929 gene locus_tag LOCUS_27330 gene mltF 28479 26929 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098308.1 protein_id gnl|my_center|LOCUS_27330 28747 32634 gene locus_tag LOCUS_27340 gene purL 28747 32634 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098307.1 protein_id gnl|my_center|LOCUS_27340 33173 34561 gene locus_tag LOCUS_27350 gene qseE 33173 34561 CDS product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420402.1 protein_id gnl|my_center|LOCUS_27350 34558 35292 gene locus_tag LOCUS_27360 gene qseG 34558 35292 CDS product two-component system QseEF-associated lipoprotein QseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098305.1 protein_id gnl|my_center|LOCUS_27360 35289 36626 gene locus_tag LOCUS_27370 gene glrR 35289 36626 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098304.1 protein_id gnl|my_center|LOCUS_27370 36707 37045 gene locus_tag LOCUS_27380 gene glnB 36707 37045 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914032.1 protein_id gnl|my_center|LOCUS_27380 38314 37124 gene locus_tag LOCUS_27390 gene hmpA 38314 37124 CDS product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098303.1 protein_id gnl|my_center|LOCUS_27390 38640 39893 gene locus_tag LOCUS_27400 38640 39893 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919178.1 protein_id gnl|my_center|LOCUS_27400 40552 39953 gene locus_tag LOCUS_27410 40552 39953 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210048.1 protein_id gnl|my_center|LOCUS_27410 42186 40549 gene locus_tag LOCUS_27420 42186 40549 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210047.1 protein_id gnl|my_center|LOCUS_27420 43157 42204 gene locus_tag LOCUS_27430 43157 42204 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210046.1 protein_id gnl|my_center|LOCUS_27430 44148 43159 gene locus_tag LOCUS_27440 44148 43159 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210045.1 protein_id gnl|my_center|LOCUS_27440 45649 44141 gene locus_tag LOCUS_27450 45649 44141 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210044.1 protein_id gnl|my_center|LOCUS_27450 46718 45735 gene locus_tag LOCUS_27460 46718 45735 CDS product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210043.1 protein_id gnl|my_center|LOCUS_27460 47193 48332 gene locus_tag LOCUS_27470 47193 48332 CDS product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173729.1 protein_id gnl|my_center|LOCUS_27470 49540 48329 gene locus_tag LOCUS_27480 gene csiE 49540 48329 CDS product stationary phase inducible protein CsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098299.1 protein_id gnl|my_center|LOCUS_27480 49731 50369 gene locus_tag LOCUS_27490 49731 50369 CDS product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805721.1 protein_id gnl|my_center|LOCUS_27490 50360 51340 gene locus_tag LOCUS_27500 50360 51340 CDS product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098297.1 protein_id gnl|my_center|LOCUS_27500 52194 51346 gene locus_tag LOCUS_27510 52194 51346 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299515.1 protein_id gnl|my_center|LOCUS_27510 53298 52492 gene locus_tag LOCUS_27520 gene suhB 53298 52492 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553464.1 protein_id gnl|my_center|LOCUS_27520 53419 54153 gene locus_tag LOCUS_27530 gene trmJ 53419 54153 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370313.1 protein_id gnl|my_center|LOCUS_27530 54379 54870 gene locus_tag LOCUS_27540 gene iscR 54379 54870 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098294.1 protein_id gnl|my_center|LOCUS_27540 55010 56224 gene locus_tag LOCUS_27550 gene iscS 55010 56224 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703173.1 protein_id gnl|my_center|LOCUS_27550 56252 56638 gene locus_tag LOCUS_27560 gene iscU 56252 56638 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703172.1 protein_id gnl|my_center|LOCUS_27560 56650 56973 gene locus_tag LOCUS_27570 gene iscA 56650 56973 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012540868.1 protein_id gnl|my_center|LOCUS_27570 57050 57565 gene locus_tag LOCUS_27580 gene hscB 57050 57565 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384391.1 protein_id gnl|my_center|LOCUS_27580 57580 59430 gene locus_tag LOCUS_27590 gene hscA 57580 59430 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196613.1 protein_id gnl|my_center|LOCUS_27590 59432 59767 gene locus_tag LOCUS_27600 gene fdx 59432 59767 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124466.1 protein_id gnl|my_center|LOCUS_27600 59769 59969 gene locus_tag LOCUS_27610 gene iscX 59769 59969 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860650.1 protein_id gnl|my_center|LOCUS_27610 60032 61321 gene locus_tag LOCUS_27620 gene pepB 60032 61321 CDS product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098291.1 protein_id gnl|my_center|LOCUS_27620 61472 62248 gene locus_tag LOCUS_27630 gene sseB 61472 62248 CDS product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001337650.1 protein_id gnl|my_center|LOCUS_27630 63037 62267 gene locus_tag LOCUS_27640 63037 62267 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098289.1 protein_id gnl|my_center|LOCUS_27640 63879 63040 gene locus_tag LOCUS_27650 gene sseA 63879 63040 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098288.1 protein_id gnl|my_center|LOCUS_27650 65336 63975 gene locus_tag LOCUS_27660 65336 63975 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098287.1 protein_id gnl|my_center|LOCUS_27660 66895 65348 gene locus_tag LOCUS_27670 66895 65348 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420384.1 protein_id gnl|my_center|LOCUS_27670 67305 67084 gene locus_tag LOCUS_27680 67305 67084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 67401 72137 gene locus_tag LOCUS_27690 67401 72137 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098285.1 protein_id gnl|my_center|LOCUS_27690 72139 74466 gene locus_tag LOCUS_27700 gene pbpC 72139 74466 CDS product peptidoglycan glycosyltransferase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098284.1 protein_id gnl|my_center|LOCUS_27700 75006 77027 gene locus_tag LOCUS_27710 75006 77027 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098283.1 protein_id gnl|my_center|LOCUS_27710 77024 77653 gene locus_tag LOCUS_27720 gene dmsB 77024 77653 CDS product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098282.1 protein_id gnl|my_center|LOCUS_27720 77646 78449 gene locus_tag LOCUS_27730 77646 78449 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098281.1 protein_id gnl|my_center|LOCUS_27730 78449 79309 gene locus_tag LOCUS_27740 78449 79309 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247794.1 protein_id gnl|my_center|LOCUS_27740 79569 80000 gene locus_tag LOCUS_27750 gene ndk 79569 80000 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963846.1 protein_id gnl|my_center|LOCUS_27750 80152 81318 gene locus_tag LOCUS_27760 80152 81318 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098279.1 protein_id gnl|my_center|LOCUS_27760 81614 82618 gene locus_tag LOCUS_27770 gene rodZ 81614 82618 CDS product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098278.1 protein_id gnl|my_center|LOCUS_27770 82645 83763 gene locus_tag LOCUS_27780 gene ispG 82645 83763 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551807.1 protein_id gnl|my_center|LOCUS_27780 83871 85145 gene locus_tag LOCUS_27790 gene hisS 83871 85145 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107167.1 protein_id gnl|my_center|LOCUS_27790 85183 85803 gene locus_tag LOCUS_27800 85183 85803 CDS product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409190.1 protein_id gnl|my_center|LOCUS_27800 85814 86992 gene locus_tag LOCUS_27810 gene bamB 85814 86992 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177072.1 protein_id gnl|my_center|LOCUS_27810 87125 88612 gene locus_tag LOCUS_27820 gene der 87125 88612 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370328.1 protein_id gnl|my_center|LOCUS_27820 88720 88938 gene locus_tag LOCUS_27830 88720 88938 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196896.1 protein_id gnl|my_center|LOCUS_27830 90325 88952 gene locus_tag LOCUS_27840 gene xseA 90325 88952 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937889.1 protein_id gnl|my_center|LOCUS_27840 90484 91950 gene locus_tag LOCUS_27850 gene guaB 90484 91950 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370334.1 protein_id gnl|my_center|LOCUS_27850 92016 93593 gene locus_tag LOCUS_27860 gene guaA 92016 93593 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098264.1 protein_id gnl|my_center|LOCUS_27860 93781 93996 gene locus_tag LOCUS_27870 93781 93996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 94485 96560 gene locus_tag LOCUS_27880 94485 96560 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098245.1 protein_id gnl|my_center|LOCUS_27880 98129 96585 gene locus_tag LOCUS_27890 gene ppx 98129 96585 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832869.1 protein_id gnl|my_center|LOCUS_27890 100193 98133 gene locus_tag LOCUS_27900 gene ppk1 100193 98133 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098243.1 protein_id gnl|my_center|LOCUS_27900 101059 100418 gene locus_tag LOCUS_27910 gene purN 101059 100418 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098242.1 protein_id gnl|my_center|LOCUS_27910 102177 101056 gene locus_tag LOCUS_27920 gene purM 102177 101056 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098241.1 protein_id gnl|my_center|LOCUS_27920 102327 102953 gene locus_tag LOCUS_27930 gene upp 102327 102953 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860560.1 protein_id gnl|my_center|LOCUS_27930 103054 104343 gene locus_tag LOCUS_27940 gene uraA 103054 104343 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098238.1 protein_id gnl|my_center|LOCUS_27940 104364 105140 gene locus_tag LOCUS_27950 104364 105140 CDS product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100388.1 protein_id gnl|my_center|LOCUS_27950 105661 105302 gene locus_tag LOCUS_27960 gene arsC 105661 105302 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365459.1 protein_id gnl|my_center|LOCUS_27960 107137 105674 gene locus_tag LOCUS_27970 gene bepA 107137 105674 CDS product beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489667.1 protein_id gnl|my_center|LOCUS_27970 107336 108397 gene locus_tag LOCUS_27980 107336 108397 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098230.1 protein_id gnl|my_center|LOCUS_27980 108938 108468 gene locus_tag LOCUS_27990 gene bcp 108938 108468 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098229.1 protein_id gnl|my_center|LOCUS_27990 109510 108938 gene locus_tag LOCUS_28000 109510 108938 CDS product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001576288.1 protein_id gnl|my_center|LOCUS_28000 109656 110534 gene locus_tag LOCUS_28010 gene dapA 109656 110534 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098227.1 protein_id gnl|my_center|LOCUS_28010 110551 111585 gene locus_tag LOCUS_28020 gene bamC 110551 111585 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331881.1 protein_id gnl|my_center|LOCUS_28020 111703 112416 gene locus_tag LOCUS_28030 111703 112416 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501631.1 protein_id gnl|my_center|LOCUS_28030 112542 113408 gene locus_tag LOCUS_28040 112542 113408 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267498.1 protein_id gnl|my_center|LOCUS_28040 113421 115436 gene locus_tag LOCUS_28050 gene tmcA 113421 115436 CDS product tRNA cytosine(34) acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829314.1 protein_id gnl|my_center|LOCUS_28050 115514 116212 gene locus_tag LOCUS_28060 gene ypfH 115514 116212 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703146.1 protein_id gnl|my_center|LOCUS_28060 116568 116380 gene locus_tag LOCUS_28070 116568 116380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 117723 116596 gene locus_tag LOCUS_28080 gene dapE 117723 116596 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098221.1 protein_id gnl|my_center|LOCUS_28080 118089 117727 gene locus_tag LOCUS_28090 118089 117727 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631925.1 protein_id gnl|my_center|LOCUS_28090 121919 118803 gene locus_tag LOCUS_28100 gene acrD 121919 118803 CDS product multidrug efflux RND transporter permease AcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273136.1 protein_id gnl|my_center|LOCUS_28100 123780 122089 gene locus_tag LOCUS_28110 gene narQ 123780 122089 CDS product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350312.1 protein_id gnl|my_center|LOCUS_28110 124237 125157 gene locus_tag LOCUS_28120 124237 125157 CDS product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098215.1 protein_id gnl|my_center|LOCUS_28120 127141 125147 gene locus_tag LOCUS_28130 gene tkt 127141 125147 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098214.1 protein_id gnl|my_center|LOCUS_28130 128112 127162 gene locus_tag LOCUS_28140 gene tal 128112 127162 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098213.1 protein_id gnl|my_center|LOCUS_28140 128394 130673 gene locus_tag LOCUS_28150 gene maeB 128394 130673 CDS product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098212.1 protein_id gnl|my_center|LOCUS_28150 131694 130792 gene locus_tag LOCUS_28160 gene hemF 131694 130792 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309639.1 protein_id gnl|my_center|LOCUS_28160 132566 131694 gene locus_tag LOCUS_28170 gene amiA 132566 131694 CDS product N-acetylmuramoyl-L-alanine amidase AmiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102892.1 protein_id gnl|my_center|LOCUS_28170 132776 133201 gene locus_tag LOCUS_28180 132776 133201 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098209.1 protein_id gnl|my_center|LOCUS_28180 133290 133637 gene locus_tag LOCUS_28190 133290 133637 CDS product DUF2919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300381.1 protein_id gnl|my_center|LOCUS_28190 133702 134277 gene locus_tag LOCUS_28200 133702 134277 CDS product RpoE-regulated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838945.1 protein_id gnl|my_center|LOCUS_28200 134370 135269 gene locus_tag LOCUS_28210 gene yfeX 134370 135269 CDS product porphyrinogen peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084583.1 protein_id gnl|my_center|LOCUS_28210 135512 136528 gene locus_tag LOCUS_28220 135512 136528 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365488.1 protein_id gnl|my_center|LOCUS_28220 136528 137361 gene locus_tag LOCUS_28230 gene cysT 136528 137361 CDS product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458420.1 protein_id gnl|my_center|LOCUS_28230 137361 138236 gene locus_tag LOCUS_28240 gene cysW 137361 138236 CDS product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703135.1 protein_id gnl|my_center|LOCUS_28240 138226 139323 gene locus_tag LOCUS_28250 gene cysA 138226 139323 CDS product sulfate/thiosulfate ABC transporter ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021036.1 protein_id gnl|my_center|LOCUS_28250 139436 140347 gene locus_tag LOCUS_28260 gene cysM 139436 140347 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098201.1 protein_id gnl|my_center|LOCUS_28260 140358 141206 gene locus_tag LOCUS_28270 gene pdxK 140358 141206 CDS product pyridoxine/pyridoxal/pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529606.1 protein_id gnl|my_center|LOCUS_28270 141264 141917 gene locus_tag LOCUS_28280 141264 141917 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209852.1 protein_id gnl|my_center|LOCUS_28280 142491 141982 gene locus_tag LOCUS_28290 gene crr 142491 141982 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522253.1 protein_id gnl|my_center|LOCUS_28290 144259 142532 gene locus_tag LOCUS_28300 gene ptsI 144259 142532 CDS product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098199.1 protein_id gnl|my_center|LOCUS_28300 144560 144303 gene locus_tag LOCUS_28310 gene ptsH 144560 144303 CDS product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487600.1 protein_id gnl|my_center|LOCUS_28310 145917 144946 gene locus_tag LOCUS_28320 gene cysK 145917 144946 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098198.1 protein_id gnl|my_center|LOCUS_28320 146820 146059 gene locus_tag LOCUS_28330 gene cysZ 146820 146059 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255008.1 protein_id gnl|my_center|LOCUS_28330 147383 147165 gene locus_tag LOCUS_28340 147383 147165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 147400 147627 gene locus_tag LOCUS_28350 147400 147627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 147675 148076 gene locus_tag LOCUS_28360 147675 148076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 148148 150163 gene locus_tag LOCUS_28370 gene ligA 148148 150163 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433258.1 protein_id gnl|my_center|LOCUS_28370 150165 150380 gene locus_tag LOCUS_28380 150165 150380 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878164.1 protein_id gnl|my_center|LOCUS_28380 151381 150377 gene locus_tag LOCUS_28390 151381 150377 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098194.1 protein_id gnl|my_center|LOCUS_28390 151895 151554 gene locus_tag LOCUS_28400 151895 151554 CDS product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098192.1 protein_id gnl|my_center|LOCUS_28400 152300 152225 gene locus_tag LOCUS_t00320 152300 152225 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 152380 152305 gene locus_tag LOCUS_t00330 152380 152305 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 152491 152416 gene locus_tag LOCUS_t00340 152491 152416 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 152610 152535 gene locus_tag LOCUS_t00350 152610 152535 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 152868 154283 gene locus_tag LOCUS_28410 gene gltX 152868 154283 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695623.1 protein_id gnl|my_center|LOCUS_28410 154729 154337 gene locus_tag LOCUS_28420 154729 154337 CDS product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826500.1 protein_id gnl|my_center|LOCUS_28420 155087 154734 gene locus_tag LOCUS_28430 155087 154734 CDS product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472034.1 protein_id gnl|my_center|LOCUS_28430 155305 155380 gene locus_tag LOCUS_t00360 155305 155380 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 155421 155496 gene locus_tag LOCUS_t00370 155421 155496 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 156690 157901 gene locus_tag LOCUS_28440 156690 157901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 159164 157977 gene locus_tag LOCUS_28450 159164 157977 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098187.1 protein_id gnl|my_center|LOCUS_28450 159515 160750 gene locus_tag LOCUS_28460 159515 160750 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420300.1 protein_id gnl|my_center|LOCUS_28460 161179 160832 gene locus_tag LOCUS_28470 gene ypeC 161179 160832 CDS product DUF2502 domain-containing protein YpeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490091.1 protein_id gnl|my_center|LOCUS_28470 162300 161302 gene locus_tag LOCUS_28480 gene mgrA 162300 161302 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098184.1 protein_id gnl|my_center|LOCUS_28480 162544 163509 gene locus_tag LOCUS_28490 gene glk 162544 163509 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098181.1 protein_id gnl|my_center|LOCUS_28490 164243 163512 gene locus_tag LOCUS_28500 gene ypdB 164243 163512 CDS product two-component system response regulator YpdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091327.1 protein_id gnl|my_center|LOCUS_28500 165955 164258 gene locus_tag LOCUS_28510 gene ypdA 165955 164258 CDS product two-component system sensor histidine kinase YpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544379.1 protein_id gnl|my_center|LOCUS_28510 166343 167557 gene locus_tag LOCUS_28520 gene alaC 166343 167557 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098178.1 protein_id gnl|my_center|LOCUS_28520 168216 170990 gene locus_tag LOCUS_28530 168216 170990 CDS product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287111.1 protein_id gnl|my_center|LOCUS_28530 171094 171516 gene locus_tag LOCUS_28540 171094 171516 CDS product PTS mannose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287112.1 protein_id gnl|my_center|LOCUS_28540 171531 172001 gene locus_tag LOCUS_28550 171531 172001 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287114.1 protein_id gnl|my_center|LOCUS_28550 172017 172796 gene locus_tag LOCUS_28560 172017 172796 CDS product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357107.1 protein_id gnl|my_center|LOCUS_28560 172774 173622 gene locus_tag LOCUS_28570 172774 173622 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002401797.1 protein_id gnl|my_center|LOCUS_28570 173633 174694 gene locus_tag LOCUS_28580 173633 174694 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383119.1 protein_id gnl|my_center|LOCUS_28580 174716 175726 gene locus_tag LOCUS_28590 174716 175726 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236585662.1 protein_id gnl|my_center|LOCUS_28590 175999 178971 gene locus_tag LOCUS_28600 gene fdhF 175999 178971 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037794.1 protein_id gnl|my_center|LOCUS_28600 178971 179450 gene locus_tag LOCUS_28610 178971 179450 CDS product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037793.1 protein_id gnl|my_center|LOCUS_28610 179452 180837 gene locus_tag LOCUS_28620 179452 180837 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037792.1 protein_id gnl|my_center|LOCUS_28620 180830 181813 gene locus_tag LOCUS_28630 gene cydB 180830 181813 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037791.1 protein_id gnl|my_center|LOCUS_28630 183634 181838 gene locus_tag LOCUS_28640 183634 181838 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530887.1 protein_id gnl|my_center|LOCUS_28640 183816 183742 gene locus_tag LOCUS_t00380 183816 183742 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 184833 183892 gene locus_tag LOCUS_28650 184833 183892 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377769.1 protein_id gnl|my_center|LOCUS_28650 185111 185863 gene locus_tag LOCUS_28660 gene mlaA 185111 185863 CDS product phospholipid-binding lipoprotein MlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776787.1 protein_id gnl|my_center|LOCUS_28660 187207 185924 gene locus_tag LOCUS_28670 gene fadL 187207 185924 CDS product long-chain fatty acid transporter FadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350318.1 protein_id gnl|my_center|LOCUS_28670 187570 187854 gene locus_tag LOCUS_28680 187570 187854 CDS product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030904.1 protein_id gnl|my_center|LOCUS_28680 188015 189325 gene locus_tag LOCUS_28690 gene fadI 188015 189325 CDS product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420286.1 protein_id gnl|my_center|LOCUS_28690 189325 191472 gene locus_tag LOCUS_28700 gene fadJ 189325 191472 CDS product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425046.1 protein_id gnl|my_center|LOCUS_28700 191780 192166 gene locus_tag LOCUS_28710 gene sixA 191780 192166 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195808.1 protein_id gnl|my_center|LOCUS_28710 192792 192241 gene locus_tag LOCUS_28720 gene smrB 192792 192241 CDS product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730806.1 protein_id gnl|my_center|LOCUS_28720 192960 193892 gene locus_tag LOCUS_28730 gene prmB 192960 193892 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098152.1 protein_id gnl|my_center|LOCUS_28730 193954 195039 gene locus_tag LOCUS_28740 gene aroC 193954 195039 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297933.1 protein_id gnl|my_center|LOCUS_28740 195043 195867 gene locus_tag LOCUS_28750 gene mepA 195043 195867 CDS product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098150.1 protein_id gnl|my_center|LOCUS_28750 195867 196676 gene locus_tag LOCUS_28760 195867 196676 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098149.1 protein_id gnl|my_center|LOCUS_28760 196676 197224 gene locus_tag LOCUS_28770 196676 197224 CDS product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098148.1 protein_id gnl|my_center|LOCUS_28770 197250 197528 gene locus_tag LOCUS_28780 197250 197528 CDS product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098147.1 protein_id gnl|my_center|LOCUS_28780 198010 198249 gene locus_tag LOCUS_28790 198010 198249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 198621 199547 gene locus_tag LOCUS_28800 198621 199547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 199620 201035 gene locus_tag LOCUS_28810 199620 201035 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817199.1 protein_id gnl|my_center|LOCUS_28810 201052 202191 gene locus_tag LOCUS_28820 201052 202191 CDS product CpaE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213784.1 protein_id gnl|my_center|LOCUS_28820 202228 203517 gene locus_tag LOCUS_28830 202228 203517 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213785.1 protein_id gnl|my_center|LOCUS_28830 203514 204428 gene locus_tag LOCUS_28840 203514 204428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 204430 205287 gene locus_tag LOCUS_28850 204430 205287 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817202.1 protein_id gnl|my_center|LOCUS_28850 205281 206573 gene locus_tag LOCUS_28860 205281 206573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 206669 207028 gene locus_tag LOCUS_28870 206669 207028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 207110 207625 gene locus_tag LOCUS_28880 207110 207625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 207643 208140 gene locus_tag LOCUS_28890 207643 208140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 208218 208649 gene locus_tag LOCUS_28900 208218 208649 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261277.1 protein_id gnl|my_center|LOCUS_28900 208651 209133 gene locus_tag LOCUS_28910 208651 209133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 209149 209763 gene locus_tag LOCUS_28920 209149 209763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 209789 211558 gene locus_tag LOCUS_28930 209789 211558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 211587 212243 gene locus_tag LOCUS_28940 211587 212243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 212499 213044 gene locus_tag LOCUS_28950 212499 213044 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207703.1 protein_id gnl|my_center|LOCUS_28950 213087 213446 gene locus_tag LOCUS_28960 213087 213446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229623.1 protein_id gnl|my_center|LOCUS_28960 213971 216034 gene locus_tag LOCUS_28970 213971 216034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28970 218092 216086 gene locus_tag LOCUS_28980 gene mnmC 218092 216086 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683534.1 protein_id gnl|my_center|LOCUS_28980 218250 219467 gene locus_tag LOCUS_28990 gene fabB 218250 219467 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098145.1 protein_id gnl|my_center|LOCUS_28990 219537 220724 gene locus_tag LOCUS_29000 219537 220724 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098144.1 protein_id gnl|my_center|LOCUS_29000 220797 222227 gene locus_tag LOCUS_29010 220797 222227 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098239.1 protein_id gnl|my_center|LOCUS_29010 223287 222277 gene locus_tag LOCUS_29020 gene flk 223287 222277 CDS product flagella biosynthesis regulator Flk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098143.1 protein_id gnl|my_center|LOCUS_29020 223412 224524 gene locus_tag LOCUS_29030 gene pdxB 223412 224524 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699105.1 protein_id gnl|my_center|LOCUS_29030 224591 225604 gene locus_tag LOCUS_29040 224591 225604 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365551.1 protein_id gnl|my_center|LOCUS_29040 225604 226416 gene locus_tag LOCUS_29050 gene truA 225604 226416 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283586.1 protein_id gnl|my_center|LOCUS_29050 226442 227101 gene locus_tag LOCUS_29060 226442 227101 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365553.1 protein_id gnl|my_center|LOCUS_29060 227205 228119 gene locus_tag LOCUS_29070 gene accD 227205 228119 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118383.1 protein_id gnl|my_center|LOCUS_29070 228273 229454 gene locus_tag LOCUS_29080 gene folC 228273 229454 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098137.1 protein_id gnl|my_center|LOCUS_29080 229471 230091 gene locus_tag LOCUS_29090 gene dedD 229471 230091 CDS product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832787.1 protein_id gnl|my_center|LOCUS_29090 230153 230353 gene locus_tag LOCUS_29100 230153 230353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 230369 230857 gene locus_tag LOCUS_29110 gene cvpA 230369 230857 CDS product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098135.1 protein_id gnl|my_center|LOCUS_29110 230891 232408 gene locus_tag LOCUS_29120 gene purF 230891 232408 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098134.1 protein_id gnl|my_center|LOCUS_29120 >Feature sequence07 1182 118 gene locus_tag LOCUS_29130 gene ugpC 1182 118 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210202.1 protein_id gnl|my_center|LOCUS_29130 2569 1196 gene locus_tag LOCUS_29140 gene cpsG 2569 1196 CDS product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839208.1 protein_id gnl|my_center|LOCUS_29140 3631 2597 gene locus_tag LOCUS_29150 3631 2597 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210200.1 protein_id gnl|my_center|LOCUS_29150 3816 5105 gene locus_tag LOCUS_29160 3816 5105 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210199.1 protein_id gnl|my_center|LOCUS_29160 5115 5981 gene locus_tag LOCUS_29170 5115 5981 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210198.1 protein_id gnl|my_center|LOCUS_29170 5982 6809 gene locus_tag LOCUS_29180 5982 6809 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210197.1 protein_id gnl|my_center|LOCUS_29180 6820 8316 gene locus_tag LOCUS_29190 6820 8316 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989597.1 protein_id gnl|my_center|LOCUS_29190 8300 9358 gene locus_tag LOCUS_29200 8300 9358 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210196.1 protein_id gnl|my_center|LOCUS_29200 9375 9418 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10784 9495 gene locus_tag LOCUS_29210 gene ygjG 10784 9495 CDS product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098827.1 protein_id gnl|my_center|LOCUS_29210 11294 12814 gene locus_tag LOCUS_29220 11294 12814 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098826.1 protein_id gnl|my_center|LOCUS_29220 13271 14830 gene locus_tag LOCUS_29230 13271 14830 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098825.1 protein_id gnl|my_center|LOCUS_29230 15255 14827 gene locus_tag LOCUS_29240 15255 14827 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098824.1 protein_id gnl|my_center|LOCUS_29240 15220 15363 gene locus_tag LOCUS_29250 15220 15363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 15598 16368 gene locus_tag LOCUS_29260 15598 16368 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098823.1 protein_id gnl|my_center|LOCUS_29260 17538 16369 gene locus_tag LOCUS_29270 17538 16369 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098822.1 protein_id gnl|my_center|LOCUS_29270 18170 17727 gene locus_tag LOCUS_29280 gene lysM 18170 17727 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098729.1 protein_id gnl|my_center|LOCUS_29280 18334 20304 gene locus_tag LOCUS_29290 18334 20304 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704237.1 protein_id gnl|my_center|LOCUS_29290 20304 21638 gene locus_tag LOCUS_29300 20304 21638 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704236.1 protein_id gnl|my_center|LOCUS_29300 21657 22286 gene locus_tag LOCUS_29310 21657 22286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 22903 22328 gene locus_tag LOCUS_29320 22903 22328 CDS product phage repressor protein CI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071886413.1 protein_id gnl|my_center|LOCUS_29320 23124 23462 gene locus_tag LOCUS_29330 23124 23462 CDS product DUF5347 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996717.1 protein_id gnl|my_center|LOCUS_29330 23565 23786 gene locus_tag LOCUS_29340 23565 23786 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785510.1 protein_id gnl|my_center|LOCUS_29340 23776 25284 gene locus_tag LOCUS_29350 23776 25284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29350 25281 25796 gene locus_tag LOCUS_29360 25281 25796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29360 25964 26131 gene locus_tag LOCUS_29370 25964 26131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 26337 26540 gene locus_tag LOCUS_29380 26337 26540 CDS product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005917735.1 protein_id gnl|my_center|LOCUS_29380 26531 26767 gene locus_tag LOCUS_29390 26531 26767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 26751 27260 gene locus_tag LOCUS_29400 26751 27260 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069919.1 protein_id gnl|my_center|LOCUS_29400 27257 27682 gene locus_tag LOCUS_29410 27257 27682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 27657 27815 gene locus_tag LOCUS_29420 27657 27815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 27778 28245 gene locus_tag LOCUS_29430 27778 28245 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098790.1 protein_id gnl|my_center|LOCUS_29430 28392 29033 gene locus_tag LOCUS_29440 28392 29033 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048619997.1 protein_id gnl|my_center|LOCUS_29440 29030 29377 gene locus_tag LOCUS_29450 29030 29377 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816097.1 protein_id gnl|my_center|LOCUS_29450 29382 30290 gene locus_tag LOCUS_29460 29382 30290 CDS product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816096.1 protein_id gnl|my_center|LOCUS_29460 30283 30894 gene locus_tag LOCUS_29470 30283 30894 CDS product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816095.1 protein_id gnl|my_center|LOCUS_29470 30891 32057 gene locus_tag LOCUS_29480 30891 32057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 32059 32493 gene locus_tag LOCUS_29490 32059 32493 CDS product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174915.1 protein_id gnl|my_center|LOCUS_29490 32629 32462 gene locus_tag LOCUS_29500 32629 32462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 32812 34002 gene locus_tag LOCUS_29510 32812 34002 CDS product phage tail sheath protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046120.1 protein_id gnl|my_center|LOCUS_29510 34016 34534 gene locus_tag LOCUS_29520 34016 34534 CDS product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007848874.1 protein_id gnl|my_center|LOCUS_29520 34596 34871 gene locus_tag LOCUS_29530 34596 34871 CDS product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048619990.1 protein_id gnl|my_center|LOCUS_29530 34965 37028 gene locus_tag LOCUS_29540 34965 37028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 37044 37511 gene locus_tag LOCUS_29550 37044 37511 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980413.1 protein_id gnl|my_center|LOCUS_29550 37501 38598 gene locus_tag LOCUS_29560 37501 38598 CDS product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011760.1 protein_id gnl|my_center|LOCUS_29560 38666 38863 gene locus_tag LOCUS_29570 gene ogrK 38666 38863 CDS product prophage transcriptional regulator OgrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468310.1 protein_id gnl|my_center|LOCUS_29570 40098 39046 gene locus_tag LOCUS_29580 40098 39046 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098812.1 protein_id gnl|my_center|LOCUS_29580 40454 40101 gene locus_tag LOCUS_29590 40454 40101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 40821 41057 gene locus_tag LOCUS_29600 40821 41057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098810.1 protein_id gnl|my_center|LOCUS_29600 41092 41601 gene locus_tag LOCUS_29610 41092 41601 CDS product phage regulatory CII family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460852.1 protein_id gnl|my_center|LOCUS_29610 41803 42168 gene locus_tag LOCUS_29620 41803 42168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 42238 42477 gene locus_tag LOCUS_29630 42238 42477 CDS product DUF2732 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244240.1 protein_id gnl|my_center|LOCUS_29630 42477 42704 gene locus_tag LOCUS_29640 42477 42704 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098805.1 protein_id gnl|my_center|LOCUS_29640 42713 43555 gene locus_tag LOCUS_29650 42713 43555 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098804.1 protein_id gnl|my_center|LOCUS_29650 43552 45780 gene locus_tag LOCUS_29660 43552 45780 CDS product replication endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816116.1 protein_id gnl|my_center|LOCUS_29660 45914 46102 gene locus_tag LOCUS_29670 45914 46102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154444.1 protein_id gnl|my_center|LOCUS_29670 46113 46346 gene locus_tag LOCUS_29680 46113 46346 CDS product DinI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217561.1 protein_id gnl|my_center|LOCUS_29680 46458 47480 gene locus_tag LOCUS_29690 46458 47480 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 protein_id gnl|my_center|LOCUS_29690 48191 47511 gene locus_tag LOCUS_29700 48191 47511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 49335 48193 gene locus_tag LOCUS_29710 49335 48193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 50655 49690 gene locus_tag LOCUS_29720 50655 49690 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049560050.1 protein_id gnl|my_center|LOCUS_29720 52499 50727 gene locus_tag LOCUS_29730 52499 50727 CDS product terminase ATPase subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098422.1 protein_id gnl|my_center|LOCUS_29730 52668 53522 gene locus_tag LOCUS_29740 52668 53522 CDS product GPO family capsid scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216223.1 protein_id gnl|my_center|LOCUS_29740 53578 54651 gene locus_tag LOCUS_29750 53578 54651 CDS product phage major capsid protein, P2 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098795.1 protein_id gnl|my_center|LOCUS_29750 54655 55401 gene locus_tag LOCUS_29760 54655 55401 CDS product terminase endonuclease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059199.1 protein_id gnl|my_center|LOCUS_29760 55496 55996 gene locus_tag LOCUS_29770 55496 55996 CDS product head completion/stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010835209.1 protein_id gnl|my_center|LOCUS_29770 55996 56199 gene locus_tag LOCUS_29780 55996 56199 CDS product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005917735.1 protein_id gnl|my_center|LOCUS_29780 56190 56411 gene locus_tag LOCUS_29790 56190 56411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 56395 56904 gene locus_tag LOCUS_29800 56395 56904 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069919.1 protein_id gnl|my_center|LOCUS_29800 56901 57326 gene locus_tag LOCUS_29810 56901 57326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 57214 57435 gene locus_tag LOCUS_29820 gene lysC 57214 57435 CDS product Rz1-like lysis system protein LysC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223151184.1 protein_id gnl|my_center|LOCUS_29820 57422 57889 gene locus_tag LOCUS_29830 57422 57889 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039939.1 protein_id gnl|my_center|LOCUS_29830 57882 58334 gene locus_tag LOCUS_29840 57882 58334 CDS product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829122.1 protein_id gnl|my_center|LOCUS_29840 58371 59045 gene locus_tag LOCUS_29850 58371 59045 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048619997.1 protein_id gnl|my_center|LOCUS_29850 59042 59389 gene locus_tag LOCUS_29860 59042 59389 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098787.1 protein_id gnl|my_center|LOCUS_29860 59394 60302 gene locus_tag LOCUS_29870 59394 60302 CDS product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816096.1 protein_id gnl|my_center|LOCUS_29870 60295 60906 gene locus_tag LOCUS_29880 60295 60906 CDS product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816095.1 protein_id gnl|my_center|LOCUS_29880 60903 62387 gene locus_tag LOCUS_29890 60903 62387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 62389 62811 gene locus_tag LOCUS_29900 62389 62811 CDS product tail assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344820.1 protein_id gnl|my_center|LOCUS_29900 63001 64191 gene locus_tag LOCUS_29910 63001 64191 CDS product phage tail sheath protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046120.1 protein_id gnl|my_center|LOCUS_29910 64205 64723 gene locus_tag LOCUS_29920 64205 64723 CDS product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007848874.1 protein_id gnl|my_center|LOCUS_29920 64782 65057 gene locus_tag LOCUS_29930 64782 65057 CDS product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048619990.1 protein_id gnl|my_center|LOCUS_29930 65202 67790 gene locus_tag LOCUS_29940 65202 67790 CDS product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001390260.1 protein_id gnl|my_center|LOCUS_29940 67803 68279 gene locus_tag LOCUS_29950 67803 68279 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098780.1 protein_id gnl|my_center|LOCUS_29950 68282 69430 gene locus_tag LOCUS_29960 68282 69430 CDS product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011760.1 protein_id gnl|my_center|LOCUS_29960 69954 69879 gene locus_tag LOCUS_t00390 69954 69879 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 70080 70586 gene locus_tag LOCUS_29970 gene mug 70080 70586 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098778.1 protein_id gnl|my_center|LOCUS_29970 72572 70728 gene locus_tag LOCUS_29980 gene rpoD 72572 70728 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098777.1 protein_id gnl|my_center|LOCUS_29980 74438 72729 gene locus_tag LOCUS_29990 gene dnaG 74438 72729 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918867.1 protein_id gnl|my_center|LOCUS_29990 74806 74591 gene locus_tag LOCUS_30000 gene rpsU 74806 74591 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 protein_id gnl|my_center|LOCUS_30000 75043 76056 gene locus_tag LOCUS_30010 gene tsaD 75043 76056 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264352.1 protein_id gnl|my_center|LOCUS_30010 76723 76100 gene locus_tag LOCUS_30020 gene plsY 76723 76100 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272784.1 protein_id gnl|my_center|LOCUS_30020 76828 77199 gene locus_tag LOCUS_30030 gene folB 76828 77199 CDS product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295541.1 protein_id gnl|my_center|LOCUS_30030 77305 78123 gene locus_tag LOCUS_30040 gene bacA 77305 78123 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281933.1 protein_id gnl|my_center|LOCUS_30040 79375 78134 gene locus_tag LOCUS_30050 79375 78134 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098762.1 protein_id gnl|my_center|LOCUS_30050 80123 79440 gene locus_tag LOCUS_30060 80123 79440 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125331.1 protein_id gnl|my_center|LOCUS_30060 80299 81600 gene locus_tag LOCUS_30070 gene ygiF 80299 81600 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046287.1 protein_id gnl|my_center|LOCUS_30070 81622 84465 gene locus_tag LOCUS_30080 gene glnE 81622 84465 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098759.1 protein_id gnl|my_center|LOCUS_30080 84519 85949 gene locus_tag LOCUS_30090 gene hldE 84519 85949 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098758.1 protein_id gnl|my_center|LOCUS_30090 87268 85997 gene locus_tag LOCUS_30100 87268 85997 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037404.1 protein_id gnl|my_center|LOCUS_30100 87555 87728 gene locus_tag LOCUS_30110 87555 87728 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928914.1 protein_id gnl|my_center|LOCUS_30110 87784 88203 gene locus_tag LOCUS_30120 87784 88203 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211129.1 protein_id gnl|my_center|LOCUS_30120 88365 89735 gene locus_tag LOCUS_30130 88365 89735 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095438.1 protein_id gnl|my_center|LOCUS_30130 90804 89845 gene locus_tag LOCUS_30140 gene yjiA 90804 89845 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297640.1 protein_id gnl|my_center|LOCUS_30140 91011 90817 gene locus_tag LOCUS_30150 91011 90817 CDS product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856610.1 protein_id gnl|my_center|LOCUS_30150 93289 91139 gene locus_tag LOCUS_30160 gene btsT 93289 91139 CDS product pyruvate/proton symporter BtsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309197.1 protein_id gnl|my_center|LOCUS_30160 94101 93559 gene locus_tag LOCUS_30170 94101 93559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934391.1 protein_id gnl|my_center|LOCUS_30170 94345 96006 gene locus_tag LOCUS_30180 gene tsr 94345 96006 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095457.1 protein_id gnl|my_center|LOCUS_30180 98359 96068 gene locus_tag LOCUS_30190 gene opgB 98359 96068 CDS product phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292715.1 protein_id gnl|my_center|LOCUS_30190 99390 98653 gene locus_tag LOCUS_30200 gene dnaC 99390 98653 CDS product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799923.1 protein_id gnl|my_center|LOCUS_30200 99932 99393 gene locus_tag LOCUS_30210 gene dnaT 99932 99393 CDS product primosomal protein DnaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368405.1 protein_id gnl|my_center|LOCUS_30210 100503 100075 gene locus_tag LOCUS_30220 100503 100075 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095463.1 protein_id gnl|my_center|LOCUS_30220 101038 100583 gene locus_tag LOCUS_30230 101038 100583 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095464.1 protein_id gnl|my_center|LOCUS_30230 101723 101082 gene locus_tag LOCUS_30240 101723 101082 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095465.1 protein_id gnl|my_center|LOCUS_30240 102264 101791 gene locus_tag LOCUS_30250 102264 101791 CDS product threonine/serine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511327.1 protein_id gnl|my_center|LOCUS_30250 102941 102255 gene locus_tag LOCUS_30260 102941 102255 CDS product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368403.1 protein_id gnl|my_center|LOCUS_30260 103489 104226 gene locus_tag LOCUS_30270 103489 104226 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020688833.1 protein_id gnl|my_center|LOCUS_30270 104172 104849 gene locus_tag LOCUS_30280 gene bglJ 104172 104849 CDS product DNA-binding transcriptional activator BglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431550.1 protein_id gnl|my_center|LOCUS_30280 105449 104988 gene locus_tag LOCUS_30290 105449 104988 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368396.1 protein_id gnl|my_center|LOCUS_30290 105787 107130 gene locus_tag LOCUS_30300 105787 107130 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704317.1 protein_id gnl|my_center|LOCUS_30300 107958 107158 gene locus_tag LOCUS_30310 gene fhuF 107958 107158 CDS product siderophore-iron reductase FhuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331596.1 protein_id gnl|my_center|LOCUS_30310 108953 108051 gene locus_tag LOCUS_30320 108953 108051 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418641.1 protein_id gnl|my_center|LOCUS_30320 109370 109609 gene locus_tag LOCUS_30330 109370 109609 CDS product DUF1435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001577669.1 protein_id gnl|my_center|LOCUS_30330 109727 109642 gene locus_tag LOCUS_t00400 109727 109642 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 109845 109760 gene locus_tag LOCUS_t00410 109845 109760 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 109959 109874 gene locus_tag LOCUS_t00420 109959 109874 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 111110 110082 gene locus_tag LOCUS_30340 gene rsmC 111110 110082 CDS product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095479.1 protein_id gnl|my_center|LOCUS_30340 111214 111627 gene locus_tag LOCUS_30350 111214 111627 CDS product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203999.1 protein_id gnl|my_center|LOCUS_30350 111596 112036 gene locus_tag LOCUS_30360 gene rimI 111596 112036 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092461.1 protein_id gnl|my_center|LOCUS_30360 112056 112733 gene locus_tag LOCUS_30370 gene yjjG 112056 112733 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870710.1 protein_id gnl|my_center|LOCUS_30370 112827 114416 gene locus_tag LOCUS_30380 gene prfC 112827 114416 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175968.1 protein_id gnl|my_center|LOCUS_30380 114835 115458 gene locus_tag LOCUS_30390 gene osmY 114835 115458 CDS product molecular chaperone OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095484.1 protein_id gnl|my_center|LOCUS_30390 115574 115735 gene locus_tag LOCUS_30400 115574 115735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 115853 116926 gene locus_tag LOCUS_30410 115853 116926 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531551.1 protein_id gnl|my_center|LOCUS_30410 116923 117717 gene locus_tag LOCUS_30420 116923 117717 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095486.1 protein_id gnl|my_center|LOCUS_30420 118507 117692 gene locus_tag LOCUS_30430 118507 117692 CDS product YjjW family glycine radical enzyme activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088427.1 protein_id gnl|my_center|LOCUS_30430 120077 118527 gene locus_tag LOCUS_30440 120077 118527 CDS product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143253.1 protein_id gnl|my_center|LOCUS_30440 120274 121128 gene locus_tag LOCUS_30450 gene deoC 120274 121128 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368381.1 protein_id gnl|my_center|LOCUS_30450 121195 122517 gene locus_tag LOCUS_30460 gene deoA 121195 122517 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095490.1 protein_id gnl|my_center|LOCUS_30460 122604 123827 gene locus_tag LOCUS_30470 gene deoB 122604 123827 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095491.1 protein_id gnl|my_center|LOCUS_30470 123900 124619 gene locus_tag LOCUS_30480 gene deoD 123900 124619 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002887789.1 protein_id gnl|my_center|LOCUS_30480 125771 124755 gene locus_tag LOCUS_30490 gene lplA 125771 124755 CDS product lipoate--protein ligase LplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105844.1 protein_id gnl|my_center|LOCUS_30490 126440 125793 gene locus_tag LOCUS_30500 126440 125793 CDS product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090060.1 protein_id gnl|my_center|LOCUS_30500 126544 127515 gene locus_tag LOCUS_30510 gene serB 126544 127515 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095495.1 protein_id gnl|my_center|LOCUS_30510 127526 128908 gene locus_tag LOCUS_30520 gene radA 127526 128908 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029720.1 protein_id gnl|my_center|LOCUS_30520 128987 130222 gene locus_tag LOCUS_30530 gene nadR 128987 130222 CDS product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532645.1 protein_id gnl|my_center|LOCUS_30530 132009 130342 gene locus_tag LOCUS_30540 gene ettA 132009 130342 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704325.1 protein_id gnl|my_center|LOCUS_30540 132245 134182 gene locus_tag LOCUS_30550 gene sltY 132245 134182 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409429.1 protein_id gnl|my_center|LOCUS_30550 134237 134566 gene locus_tag LOCUS_30560 gene trpR 134237 134566 CDS product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068678.1 protein_id gnl|my_center|LOCUS_30560 135078 134557 gene locus_tag LOCUS_30570 gene yjjX 135078 134557 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704327.1 protein_id gnl|my_center|LOCUS_30570 135125 135772 gene locus_tag LOCUS_30580 gene gpmB 135125 135772 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704328.1 protein_id gnl|my_center|LOCUS_30580 136638 135769 gene locus_tag LOCUS_30590 gene robA 136638 135769 CDS product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704329.1 protein_id gnl|my_center|LOCUS_30590 136850 137326 gene locus_tag LOCUS_30600 gene creA 136850 137326 CDS product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095506.1 protein_id gnl|my_center|LOCUS_30600 137337 138029 gene locus_tag LOCUS_30610 gene creB 137337 138029 CDS product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368366.1 protein_id gnl|my_center|LOCUS_30610 138029 139453 gene locus_tag LOCUS_30620 gene creC 138029 139453 CDS product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219596.1 protein_id gnl|my_center|LOCUS_30620 139511 140875 gene locus_tag LOCUS_30630 gene creD 139511 140875 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920350.1 protein_id gnl|my_center|LOCUS_30630 141626 140910 gene locus_tag LOCUS_30640 gene arcA 141626 140910 CDS product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856501.1 protein_id gnl|my_center|LOCUS_30640 141823 141632 gene locus_tag LOCUS_30650 141823 141632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 142257 142943 gene locus_tag LOCUS_30660 142257 142943 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223132.1 protein_id gnl|my_center|LOCUS_30660 143301 145763 gene locus_tag LOCUS_30670 gene thrA 143301 145763 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264731.1 protein_id gnl|my_center|LOCUS_30670 145765 146694 gene locus_tag LOCUS_30680 gene thrB 145765 146694 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095510.1 protein_id gnl|my_center|LOCUS_30680 146698 147984 gene locus_tag LOCUS_30690 gene thrC 146698 147984 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781063.1 protein_id gnl|my_center|LOCUS_30690 148913 148140 gene locus_tag LOCUS_30700 gene yaaA 148913 148140 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906171.1 protein_id gnl|my_center|LOCUS_30700 150420 148969 gene locus_tag LOCUS_30710 150420 148969 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113816.1 protein_id gnl|my_center|LOCUS_30710 150613 151566 gene locus_tag LOCUS_30720 gene tal 150613 151566 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095515.1 protein_id gnl|my_center|LOCUS_30720 151678 152265 gene locus_tag LOCUS_30730 gene mog 151678 152265 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095516.1 protein_id gnl|my_center|LOCUS_30730 152390 153697 gene locus_tag LOCUS_30740 152390 153697 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095517.1 protein_id gnl|my_center|LOCUS_30740 154315 153749 gene locus_tag LOCUS_30750 gene satP 154315 153749 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095518.1 protein_id gnl|my_center|LOCUS_30750 154614 156530 gene locus_tag LOCUS_30760 gene dnaK 154614 156530 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516126.1 protein_id gnl|my_center|LOCUS_30760 156616 157755 gene locus_tag LOCUS_30770 gene dnaJ 156616 157755 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118464.1 protein_id gnl|my_center|LOCUS_30770 158091 159044 gene locus_tag LOCUS_30780 158091 159044 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534904.1 protein_id gnl|my_center|LOCUS_30780 159198 159536 gene locus_tag LOCUS_30790 159198 159536 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704339.1 protein_id gnl|my_center|LOCUS_30790 160115 159570 gene locus_tag LOCUS_30800 160115 159570 CDS product glycoside hydrolase family 108 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368347.1 protein_id gnl|my_center|LOCUS_30800 160542 160105 gene locus_tag LOCUS_30810 160542 160105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 160941 163007 gene locus_tag LOCUS_30820 160941 163007 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704340.1 protein_id gnl|my_center|LOCUS_30820 163085 166123 gene locus_tag LOCUS_30830 163085 166123 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704341.1 protein_id gnl|my_center|LOCUS_30830 166289 167449 gene locus_tag LOCUS_30840 gene nhaA 166289 167449 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681337.1 protein_id gnl|my_center|LOCUS_30840 167817 167554 gene locus_tag LOCUS_30850 gene rpsT 167817 167554 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274021.1 protein_id gnl|my_center|LOCUS_30850 168145 169083 gene locus_tag LOCUS_30860 gene ribF 168145 169083 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020688470.1 protein_id gnl|my_center|LOCUS_30860 169121 171937 gene locus_tag LOCUS_30870 gene ileS 169121 171937 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286898.1 protein_id gnl|my_center|LOCUS_30870 171937 172434 gene locus_tag LOCUS_30880 gene lspA 171937 172434 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368327.1 protein_id gnl|my_center|LOCUS_30880 172489 172938 gene locus_tag LOCUS_30890 gene fkpB 172489 172938 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095528.1 protein_id gnl|my_center|LOCUS_30890 172940 173890 gene locus_tag LOCUS_30900 gene ispH 172940 173890 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095529.1 protein_id gnl|my_center|LOCUS_30900 173957 174871 gene locus_tag LOCUS_30910 gene rihC 173957 174871 CDS product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704354.1 protein_id gnl|my_center|LOCUS_30910 177636 174979 gene locus_tag LOCUS_30920 177636 174979 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990052.1 protein_id gnl|my_center|LOCUS_30920 179607 177649 gene locus_tag LOCUS_30930 179607 177649 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990051.1 protein_id gnl|my_center|LOCUS_30930 179830 180390 gene locus_tag LOCUS_30940 179830 180390 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706187.1 protein_id gnl|my_center|LOCUS_30940 180383 181165 gene locus_tag LOCUS_30950 180383 181165 CDS product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811367.1 protein_id gnl|my_center|LOCUS_30950 182140 181325 gene locus_tag LOCUS_30960 182140 181325 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706181.1 protein_id gnl|my_center|LOCUS_30960 182937 182140 gene locus_tag LOCUS_30970 182937 182140 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706182.1 protein_id gnl|my_center|LOCUS_30970 183443 182934 gene locus_tag LOCUS_30980 183443 182934 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706183.1 protein_id gnl|my_center|LOCUS_30980 183881 183453 gene locus_tag LOCUS_30990 183881 183453 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706184.1 protein_id gnl|my_center|LOCUS_30990 185622 183883 gene locus_tag LOCUS_31000 185622 183883 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706185.1 protein_id gnl|my_center|LOCUS_31000 185805 186815 gene locus_tag LOCUS_31010 185805 186815 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819931.1 protein_id gnl|my_center|LOCUS_31010 186953 187774 gene locus_tag LOCUS_31020 gene dapB 186953 187774 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543582.1 protein_id gnl|my_center|LOCUS_31020 188334 189377 gene locus_tag LOCUS_31030 gene carA 188334 189377 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704367.1 protein_id gnl|my_center|LOCUS_31030 189396 192620 gene locus_tag LOCUS_31040 gene carB 189396 192620 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095532.1 protein_id gnl|my_center|LOCUS_31040 192764 192997 gene locus_tag LOCUS_31050 192764 192997 CDS product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095533.1 protein_id gnl|my_center|LOCUS_31050 193143 193673 gene locus_tag LOCUS_31060 gene kefF 193143 193673 CDS product glutathione-regulated potassium-efflux system oxidoreductase KefF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704370.1 protein_id gnl|my_center|LOCUS_31060 193666 195528 gene locus_tag LOCUS_31070 gene kefC 193666 195528 CDS product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377186.1 protein_id gnl|my_center|LOCUS_31070 195703 196182 gene locus_tag LOCUS_31080 gene folA 195703 196182 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624378.1 protein_id gnl|my_center|LOCUS_31080 197148 196300 gene locus_tag LOCUS_31090 gene apaH 197148 196300 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095538.1 protein_id gnl|my_center|LOCUS_31090 197530 197153 gene locus_tag LOCUS_31100 gene apaG 197530 197153 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368292.1 protein_id gnl|my_center|LOCUS_31100 198235 197534 gene locus_tag LOCUS_31110 gene rsmA 198235 197534 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065397.1 protein_id gnl|my_center|LOCUS_31110 198122 198358 gene locus_tag LOCUS_31120 198122 198358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 199338 198352 gene locus_tag LOCUS_31130 gene pdxA 199338 198352 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095541.1 protein_id gnl|my_center|LOCUS_31130 200624 199338 gene locus_tag LOCUS_31140 gene surA 200624 199338 CDS product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095542.1 protein_id gnl|my_center|LOCUS_31140 203155 200678 gene locus_tag LOCUS_31150 gene lptD 203155 200678 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095543.1 protein_id gnl|my_center|LOCUS_31150 203278 204096 gene locus_tag LOCUS_31160 gene djlA 203278 204096 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095544.1 protein_id gnl|my_center|LOCUS_31160 >Feature sequence08 1163 27 gene locus_tag LOCUS_31170 gene hemW 1163 27 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098670.1 protein_id gnl|my_center|LOCUS_31170 1749 1156 gene locus_tag LOCUS_31180 1749 1156 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098669.1 protein_id gnl|my_center|LOCUS_31180 2049 1759 gene locus_tag LOCUS_31190 gene yggU 2049 1759 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277205.1 protein_id gnl|my_center|LOCUS_31190 2612 2046 gene locus_tag LOCUS_31200 2612 2046 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369729.1 protein_id gnl|my_center|LOCUS_31200 3335 2631 gene locus_tag LOCUS_31210 3335 2631 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098666.1 protein_id gnl|my_center|LOCUS_31210 3353 4333 gene locus_tag LOCUS_31220 3353 4333 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883139.1 protein_id gnl|my_center|LOCUS_31220 6588 4330 gene locus_tag LOCUS_31230 6588 4330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 6655 7347 gene locus_tag LOCUS_31240 6655 7347 CDS product global regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098333.1 protein_id gnl|my_center|LOCUS_31240 7890 7474 gene locus_tag LOCUS_31250 gene ruvX 7890 7474 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006811925.1 protein_id gnl|my_center|LOCUS_31250 8453 7890 gene locus_tag LOCUS_31260 8453 7890 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369734.1 protein_id gnl|my_center|LOCUS_31260 9496 8549 gene locus_tag LOCUS_31270 gene gshB 9496 8549 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593260.1 protein_id gnl|my_center|LOCUS_31270 10240 9509 gene locus_tag LOCUS_31280 gene rsmE 10240 9509 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098662.1 protein_id gnl|my_center|LOCUS_31280 11113 10406 gene locus_tag LOCUS_31290 gene endA 11113 10406 CDS product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001327408.1 protein_id gnl|my_center|LOCUS_31290 11666 11208 gene locus_tag LOCUS_31300 11666 11208 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860035.1 protein_id gnl|my_center|LOCUS_31300 13149 11794 gene locus_tag LOCUS_31310 gene galP 13149 11794 CDS product galactose/proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098659.1 protein_id gnl|my_center|LOCUS_31310 14662 13463 gene locus_tag LOCUS_31320 gene metK 14662 13463 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004149807.1 protein_id gnl|my_center|LOCUS_31320 15498 17396 gene locus_tag LOCUS_31330 gene speA 15498 17396 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278580.1 protein_id gnl|my_center|LOCUS_31330 25069 17486 gene locus_tag LOCUS_31340 25069 17486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 26810 25083 gene locus_tag LOCUS_31350 26810 25083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 27245 27024 gene locus_tag LOCUS_31360 27245 27024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 27330 28250 gene locus_tag LOCUS_31370 gene speB 27330 28250 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002434404.1 protein_id gnl|my_center|LOCUS_31370 28449 28267 gene locus_tag LOCUS_31380 28449 28267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 29170 28412 gene locus_tag LOCUS_31390 29170 28412 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703437.1 protein_id gnl|my_center|LOCUS_31390 29449 31440 gene locus_tag LOCUS_31400 gene tkt 29449 31440 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420542.1 protein_id gnl|my_center|LOCUS_31400 31735 32181 gene locus_tag LOCUS_31410 gene cmtB 31735 32181 CDS product PTS mannitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239650.1 protein_id gnl|my_center|LOCUS_31410 32212 33600 gene locus_tag LOCUS_31420 gene cmtA 32212 33600 CDS product PTS mannitol transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428805.1 protein_id gnl|my_center|LOCUS_31420 33614 34891 gene locus_tag LOCUS_31430 33614 34891 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853233.1 protein_id gnl|my_center|LOCUS_31430 34888 35859 gene locus_tag LOCUS_31440 gene glpX 34888 35859 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987303.1 protein_id gnl|my_center|LOCUS_31440 35875 36384 gene locus_tag LOCUS_31450 gene fumE 35875 36384 CDS product fumarase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224135.1 protein_id gnl|my_center|LOCUS_31450 36381 37082 gene locus_tag LOCUS_31460 36381 37082 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687699.1 protein_id gnl|my_center|LOCUS_31460 39688 37121 gene locus_tag LOCUS_31470 39688 37121 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861780.1 protein_id gnl|my_center|LOCUS_31470 41709 39685 gene locus_tag LOCUS_31480 41709 39685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 42928 41714 gene locus_tag LOCUS_31490 42928 41714 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029647.1 protein_id gnl|my_center|LOCUS_31490 44562 42928 gene locus_tag LOCUS_31500 44562 42928 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861822.1 protein_id gnl|my_center|LOCUS_31500 45454 44801 gene locus_tag LOCUS_31510 45454 44801 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956878.1 protein_id gnl|my_center|LOCUS_31510 46125 45448 gene locus_tag LOCUS_31520 46125 45448 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256969.1 protein_id gnl|my_center|LOCUS_31520 46820 46113 gene locus_tag LOCUS_31530 46820 46113 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553215.1 protein_id gnl|my_center|LOCUS_31530 47399 46821 gene locus_tag LOCUS_31540 47399 46821 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124001.1 protein_id gnl|my_center|LOCUS_31540 47845 47426 gene locus_tag LOCUS_31550 47845 47426 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218564.1 protein_id gnl|my_center|LOCUS_31550 48218 49237 gene locus_tag LOCUS_31560 gene epd 48218 49237 CDS product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098636.1 protein_id gnl|my_center|LOCUS_31560 49295 50458 gene locus_tag LOCUS_31570 gene pgk 49295 50458 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098635.1 protein_id gnl|my_center|LOCUS_31570 50553 51629 gene locus_tag LOCUS_31580 gene fbaA 50553 51629 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098634.1 protein_id gnl|my_center|LOCUS_31580 51938 52801 gene locus_tag LOCUS_31590 51938 52801 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389833.1 protein_id gnl|my_center|LOCUS_31590 53009 53599 gene locus_tag LOCUS_31600 gene argO 53009 53599 CDS product arginine exporter ArgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098632.1 protein_id gnl|my_center|LOCUS_31600 53695 54471 gene locus_tag LOCUS_31610 53695 54471 CDS product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098631.1 protein_id gnl|my_center|LOCUS_31610 55399 54506 gene locus_tag LOCUS_31620 gene argP 55399 54506 CDS product DNA-binding transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499727.1 protein_id gnl|my_center|LOCUS_31620 55573 56232 gene locus_tag LOCUS_31630 gene rpiA 55573 56232 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098630.1 protein_id gnl|my_center|LOCUS_31630 56484 57716 gene locus_tag LOCUS_31640 gene serA 56484 57716 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098629.1 protein_id gnl|my_center|LOCUS_31640 58301 57825 gene locus_tag LOCUS_31650 58301 57825 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098628.1 protein_id gnl|my_center|LOCUS_31650 59002 58673 gene locus_tag LOCUS_31660 gene zapA 59002 58673 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006811891.1 protein_id gnl|my_center|LOCUS_31660 59212 59796 gene locus_tag LOCUS_31670 59212 59796 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027229.1 protein_id gnl|my_center|LOCUS_31670 59824 61140 gene locus_tag LOCUS_31680 gene pepP 59824 61140 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193684.1 protein_id gnl|my_center|LOCUS_31680 61137 62315 gene locus_tag LOCUS_31690 gene ubiH 61137 62315 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098625.1 protein_id gnl|my_center|LOCUS_31690 62326 63528 gene locus_tag LOCUS_31700 gene ubiI 62326 63528 CDS product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098624.1 protein_id gnl|my_center|LOCUS_31700 63977 65071 gene locus_tag LOCUS_31710 gene gcvT 63977 65071 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068738.1 protein_id gnl|my_center|LOCUS_31710 65095 65484 gene locus_tag LOCUS_31720 gene gcvH 65095 65484 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098622.1 protein_id gnl|my_center|LOCUS_31720 65670 68543 gene locus_tag LOCUS_31730 gene gcvP 65670 68543 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098621.1 protein_id gnl|my_center|LOCUS_31730 68610 69353 gene locus_tag LOCUS_31740 68610 69353 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098620.1 protein_id gnl|my_center|LOCUS_31740 70808 69375 gene locus_tag LOCUS_31750 gene bglA 70808 69375 CDS product 6-phospho-beta-glucosidase BglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350137.1 protein_id gnl|my_center|LOCUS_31750 71689 70955 gene locus_tag LOCUS_31760 71689 70955 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098618.1 protein_id gnl|my_center|LOCUS_31760 71989 72648 gene locus_tag LOCUS_31770 71989 72648 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250274.1 protein_id gnl|my_center|LOCUS_31770 73807 72716 gene locus_tag LOCUS_31780 gene ygfZ 73807 72716 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886087.1 protein_id gnl|my_center|LOCUS_31780 73941 74207 gene locus_tag LOCUS_31790 gene sdhE 73941 74207 CDS product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369791.1 protein_id gnl|my_center|LOCUS_31790 74188 74604 gene locus_tag LOCUS_31800 74188 74604 CDS product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369792.1 protein_id gnl|my_center|LOCUS_31800 75132 74611 gene locus_tag LOCUS_31810 gene fldB 75132 74611 CDS product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369793.1 protein_id gnl|my_center|LOCUS_31810 75293 76189 gene locus_tag LOCUS_31820 gene xerD 75293 76189 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434302.1 protein_id gnl|my_center|LOCUS_31820 76214 76927 gene locus_tag LOCUS_31830 gene dsbC 76214 76927 CDS product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745614.1 protein_id gnl|my_center|LOCUS_31830 76933 78666 gene locus_tag LOCUS_31840 gene recJ 76933 78666 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813193.1 protein_id gnl|my_center|LOCUS_31840 78812 79855 gene locus_tag LOCUS_31850 gene prfB 78812 79855 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095908218.1 protein_id gnl|my_center|LOCUS_31850 79865 81382 gene locus_tag LOCUS_31860 gene lysS 79865 81382 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098608.1 protein_id gnl|my_center|LOCUS_31860 81560 82258 gene locus_tag LOCUS_31870 gene actS 81560 82258 CDS product amidase activator ActS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369803.1 protein_id gnl|my_center|LOCUS_31870 82349 82422 gene locus_tag LOCUS_t00430 82349 82422 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 82536 83501 gene locus_tag LOCUS_31880 gene uvsE 82536 83501 CDS product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605880.1 protein_id gnl|my_center|LOCUS_31880 84449 83505 gene locus_tag LOCUS_31890 84449 83505 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096538.1 protein_id gnl|my_center|LOCUS_31890 84567 85316 gene locus_tag LOCUS_31900 84567 85316 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619652.1 protein_id gnl|my_center|LOCUS_31900 86258 85350 gene locus_tag LOCUS_31910 86258 85350 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488351.1 protein_id gnl|my_center|LOCUS_31910 86809 86297 gene locus_tag LOCUS_31920 86809 86297 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109977.1 protein_id gnl|my_center|LOCUS_31920 87374 86898 gene locus_tag LOCUS_31930 87374 86898 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038765.1 protein_id gnl|my_center|LOCUS_31930 89947 87767 gene locus_tag LOCUS_31940 gene katG 89947 87767 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108110.1 protein_id gnl|my_center|LOCUS_31940 90089 89934 gene locus_tag LOCUS_31950 90089 89934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 90178 94791 gene locus_tag LOCUS_31960 90178 94791 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310034.1 protein_id gnl|my_center|LOCUS_31960 95059 95997 gene locus_tag LOCUS_31970 95059 95997 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230262.1 protein_id gnl|my_center|LOCUS_31970 96016 97059 gene locus_tag LOCUS_31980 gene fni 96016 97059 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533385.1 protein_id gnl|my_center|LOCUS_31980 97056 98297 gene locus_tag LOCUS_31990 97056 98297 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024453.1 protein_id gnl|my_center|LOCUS_31990 98294 99445 gene locus_tag LOCUS_32000 98294 99445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 99442 100920 gene locus_tag LOCUS_32010 99442 100920 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106515452.1 protein_id gnl|my_center|LOCUS_32010 100917 101846 gene locus_tag LOCUS_32020 100917 101846 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338116.1 protein_id gnl|my_center|LOCUS_32020 102312 101785 gene locus_tag LOCUS_32030 102312 101785 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_32030 102260 102481 gene locus_tag LOCUS_32040 102260 102481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 102592 103614 gene locus_tag LOCUS_32050 102592 103614 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096947.1 protein_id gnl|my_center|LOCUS_32050 103607 104275 gene locus_tag LOCUS_32060 103607 104275 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096946.1 protein_id gnl|my_center|LOCUS_32060 104288 105115 gene locus_tag LOCUS_32070 104288 105115 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096945.1 protein_id gnl|my_center|LOCUS_32070 105272 106453 gene locus_tag LOCUS_32080 105272 106453 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620438.1 protein_id gnl|my_center|LOCUS_32080 106905 107585 gene locus_tag LOCUS_32090 106905 107585 CDS product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098578.1 protein_id gnl|my_center|LOCUS_32090 108973 107798 gene locus_tag LOCUS_32100 108973 107798 CDS product oligogalacturonate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098577.1 protein_id gnl|my_center|LOCUS_32100 109442 110278 gene locus_tag LOCUS_32110 gene kduI 109442 110278 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383248.1 protein_id gnl|my_center|LOCUS_32110 110340 111101 gene locus_tag LOCUS_32120 gene kduD 110340 111101 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703339.1 protein_id gnl|my_center|LOCUS_32120 112370 111240 gene locus_tag LOCUS_32130 gene ogl 112370 111240 CDS product oligogalacturonate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816209.1 protein_id gnl|my_center|LOCUS_32130 113724 112435 gene locus_tag LOCUS_32140 113724 112435 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098573.1 protein_id gnl|my_center|LOCUS_32140 114865 113738 gene locus_tag LOCUS_32150 gene ugpC 114865 113738 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098572.1 protein_id gnl|my_center|LOCUS_32150 115780 114878 gene locus_tag LOCUS_32160 115780 114878 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098571.1 protein_id gnl|my_center|LOCUS_32160 116663 115773 gene locus_tag LOCUS_32170 116663 115773 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098570.1 protein_id gnl|my_center|LOCUS_32170 117471 117145 gene locus_tag LOCUS_32180 117471 117145 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098568.1 protein_id gnl|my_center|LOCUS_32180 117613 118305 gene locus_tag LOCUS_32190 117613 118305 CDS product aspartate/glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098567.1 protein_id gnl|my_center|LOCUS_32190 119228 118302 gene locus_tag LOCUS_32200 119228 118302 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703333.1 protein_id gnl|my_center|LOCUS_32200 119347 120609 gene locus_tag LOCUS_32210 gene lysA 119347 120609 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098565.1 protein_id gnl|my_center|LOCUS_32210 121619 120606 gene locus_tag LOCUS_32220 121619 120606 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098564.1 protein_id gnl|my_center|LOCUS_32220 121941 123278 gene locus_tag LOCUS_32230 121941 123278 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098563.1 protein_id gnl|my_center|LOCUS_32230 123286 124713 gene locus_tag LOCUS_32240 123286 124713 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098562.1 protein_id gnl|my_center|LOCUS_32240 124790 125563 gene locus_tag LOCUS_32250 124790 125563 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098561.1 protein_id gnl|my_center|LOCUS_32250 125560 126009 gene locus_tag LOCUS_32260 125560 126009 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098560.1 protein_id gnl|my_center|LOCUS_32260 127013 126006 gene locus_tag LOCUS_32270 gene galR 127013 126006 CDS product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201064.1 protein_id gnl|my_center|LOCUS_32270 127442 129601 gene locus_tag LOCUS_32280 gene aas 127442 129601 CDS product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098558.1 protein_id gnl|my_center|LOCUS_32280 129594 130784 gene locus_tag LOCUS_32290 gene lplT 129594 130784 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620430.1 protein_id gnl|my_center|LOCUS_32290 131871 130831 gene locus_tag LOCUS_32300 131871 130831 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199295.1 protein_id gnl|my_center|LOCUS_32300 132215 131997 gene locus_tag LOCUS_32310 gene ygdR 132215 131997 CDS product lipoprotein YgdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758655.1 protein_id gnl|my_center|LOCUS_32310 133163 132450 gene locus_tag LOCUS_32320 133163 132450 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895635.1 protein_id gnl|my_center|LOCUS_32320 133921 133226 gene locus_tag LOCUS_32330 gene mutH 133921 133226 CDS product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369924.1 protein_id gnl|my_center|LOCUS_32330 134669 135133 gene locus_tag LOCUS_32340 gene rppH 134669 135133 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098553.1 protein_id gnl|my_center|LOCUS_32340 135146 137392 gene locus_tag LOCUS_32350 gene ptsP 135146 137392 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957883.1 protein_id gnl|my_center|LOCUS_32350 137569 138444 gene locus_tag LOCUS_32360 gene lgt 137569 138444 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204645.1 protein_id gnl|my_center|LOCUS_32360 138451 139245 gene locus_tag LOCUS_32370 gene thyA 138451 139245 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098550.1 protein_id gnl|my_center|LOCUS_32370 139429 139899 gene locus_tag LOCUS_32380 139429 139899 CDS product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857051.1 protein_id gnl|my_center|LOCUS_32380 139890 140453 gene locus_tag LOCUS_32390 139890 140453 CDS product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144322.1 protein_id gnl|my_center|LOCUS_32390 140450 140857 gene locus_tag LOCUS_32400 140450 140857 CDS product DUF2509 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703325.1 protein_id gnl|my_center|LOCUS_32400 140842 141165 gene locus_tag LOCUS_32410 140842 141165 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098547.1 protein_id gnl|my_center|LOCUS_32410 141178 144546 gene locus_tag LOCUS_32420 gene recC 141178 144546 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946942.1 protein_id gnl|my_center|LOCUS_32420 144671 147571 gene locus_tag LOCUS_32430 gene ptrA 144671 147571 CDS product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098545.1 protein_id gnl|my_center|LOCUS_32430 147568 151113 gene locus_tag LOCUS_32440 gene recB 147568 151113 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098544.1 protein_id gnl|my_center|LOCUS_32440 151110 152936 gene locus_tag LOCUS_32450 gene recD 151110 152936 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155175.1 protein_id gnl|my_center|LOCUS_32450 154376 153045 gene locus_tag LOCUS_32460 gene argA 154376 153045 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098542.1 protein_id gnl|my_center|LOCUS_32460 154662 155858 gene locus_tag LOCUS_32470 gene amiC 154662 155858 CDS product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011916.1 protein_id gnl|my_center|LOCUS_32470 155994 155918 gene locus_tag LOCUS_t00440 155994 155918 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 156121 156045 gene locus_tag LOCUS_t00450 156121 156045 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 156245 156169 gene locus_tag LOCUS_t00460 156245 156169 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 156455 157558 gene locus_tag LOCUS_32480 gene mltA 156455 157558 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098540.1 protein_id gnl|my_center|LOCUS_32480 157561 157806 gene locus_tag LOCUS_32490 157561 157806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 157848 158654 gene locus_tag LOCUS_32500 gene tcdA 157848 158654 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117724.1 protein_id gnl|my_center|LOCUS_32500 159088 158645 gene locus_tag LOCUS_32510 gene csdE 159088 158645 CDS product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184261.1 protein_id gnl|my_center|LOCUS_32510 160293 159085 gene locus_tag LOCUS_32520 gene csdA 160293 159085 CDS product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300698.1 protein_id gnl|my_center|LOCUS_32520 160487 160714 gene locus_tag LOCUS_32530 160487 160714 CDS product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750393.1 protein_id gnl|my_center|LOCUS_32530 161125 161979 gene locus_tag LOCUS_32540 gene gcvA 161125 161979 CDS product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369945.1 protein_id gnl|my_center|LOCUS_32540 162020 162415 gene locus_tag LOCUS_32550 162020 162415 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369946.1 protein_id gnl|my_center|LOCUS_32550 162408 163508 gene locus_tag LOCUS_32560 gene rlmM 162408 163508 CDS product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098534.1 protein_id gnl|my_center|LOCUS_32560 >Feature sequence09 185 874 gene locus_tag LOCUS_32570 185 874 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099390.1 protein_id gnl|my_center|LOCUS_32570 890 2287 gene locus_tag LOCUS_32580 gene mdtD 890 2287 CDS product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099391.1 protein_id gnl|my_center|LOCUS_32580 3276 2284 gene locus_tag LOCUS_32590 gene rbsR 3276 2284 CDS product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099392.1 protein_id gnl|my_center|LOCUS_32590 4212 3283 gene locus_tag LOCUS_32600 gene rbsK 4212 3283 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420966.1 protein_id gnl|my_center|LOCUS_32600 5177 4287 gene locus_tag LOCUS_32610 gene rbsB 5177 4287 CDS product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056273.1 protein_id gnl|my_center|LOCUS_32610 6169 5204 gene locus_tag LOCUS_32620 gene rbsC 6169 5204 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099395.1 protein_id gnl|my_center|LOCUS_32620 7680 6166 gene locus_tag LOCUS_32630 gene rbsA 7680 6166 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099396.1 protein_id gnl|my_center|LOCUS_32630 8107 7688 gene locus_tag LOCUS_32640 gene rbsD 8107 7688 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099397.1 protein_id gnl|my_center|LOCUS_32640 10189 8321 gene locus_tag LOCUS_32650 gene kup 10189 8321 CDS product low affinity potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099398.1 protein_id gnl|my_center|LOCUS_32650 10411 11907 gene locus_tag LOCUS_32660 gene ravA 10411 11907 CDS product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099399.1 protein_id gnl|my_center|LOCUS_32660 11901 13352 gene locus_tag LOCUS_32670 gene viaA 11901 13352 CDS product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956591.1 protein_id gnl|my_center|LOCUS_32670 14346 13354 gene locus_tag LOCUS_32680 gene asnA 14346 13354 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099401.1 protein_id gnl|my_center|LOCUS_32680 14497 14955 gene locus_tag LOCUS_32690 gene asnC 14497 14955 CDS product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500198.1 protein_id gnl|my_center|LOCUS_32690 15046 15495 gene locus_tag LOCUS_32700 gene mioC 15046 15495 CDS product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099402.1 protein_id gnl|my_center|LOCUS_32700 15869 17758 gene locus_tag LOCUS_32710 gene mnmG 15869 17758 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499788.1 protein_id gnl|my_center|LOCUS_32710 17859 18482 gene locus_tag LOCUS_32720 gene rsmG 17859 18482 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099403.1 protein_id gnl|my_center|LOCUS_32720 19096 19476 gene locus_tag LOCUS_32730 gene atpI 19096 19476 CDS product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145371.1 protein_id gnl|my_center|LOCUS_32730 19485 20303 gene locus_tag LOCUS_32740 gene atpB 19485 20303 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135618.1 protein_id gnl|my_center|LOCUS_32740 20351 20590 gene locus_tag LOCUS_32750 gene atpE 20351 20590 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429386.1 protein_id gnl|my_center|LOCUS_32750 20649 21119 gene locus_tag LOCUS_32760 gene atpF 20649 21119 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052219.1 protein_id gnl|my_center|LOCUS_32760 21134 21667 gene locus_tag LOCUS_32770 gene atpH 21134 21667 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099407.1 protein_id gnl|my_center|LOCUS_32770 21680 23221 gene locus_tag LOCUS_32780 gene atpA 21680 23221 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862367.1 protein_id gnl|my_center|LOCUS_32780 23272 24135 gene locus_tag LOCUS_32790 gene atpG 23272 24135 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862364.1 protein_id gnl|my_center|LOCUS_32790 24162 25544 gene locus_tag LOCUS_32800 gene atpD 24162 25544 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862362.1 protein_id gnl|my_center|LOCUS_32800 25565 25984 gene locus_tag LOCUS_32810 25565 25984 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006177560.1 protein_id gnl|my_center|LOCUS_32810 28537 26360 gene locus_tag LOCUS_32820 28537 26360 CDS product exopolygalacturonate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482823.1 protein_id gnl|my_center|LOCUS_32820 28933 30249 gene locus_tag LOCUS_32830 gene glmU 28933 30249 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099408.1 protein_id gnl|my_center|LOCUS_32830 30498 32327 gene locus_tag LOCUS_32840 gene glmS 30498 32327 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334049.1 protein_id gnl|my_center|LOCUS_32840 32616 33656 gene locus_tag LOCUS_32850 gene pstS 32616 33656 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099410.1 protein_id gnl|my_center|LOCUS_32850 33784 34743 gene locus_tag LOCUS_32860 gene pstC 33784 34743 CDS product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741630.1 protein_id gnl|my_center|LOCUS_32860 34743 35633 gene locus_tag LOCUS_32870 gene pstA 34743 35633 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099412.1 protein_id gnl|my_center|LOCUS_32870 35682 36455 gene locus_tag LOCUS_32880 gene pstB 35682 36455 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063118.1 protein_id gnl|my_center|LOCUS_32880 36470 37195 gene locus_tag LOCUS_32890 gene phoU 36470 37195 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377800.1 protein_id gnl|my_center|LOCUS_32890 37974 37309 gene locus_tag LOCUS_32900 gene yieH 37974 37309 CDS product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099413.1 protein_id gnl|my_center|LOCUS_32900 38144 39481 gene locus_tag LOCUS_32910 gene adeP 38144 39481 CDS product adenine permease AdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214973.1 protein_id gnl|my_center|LOCUS_32910 39970 39518 gene locus_tag LOCUS_32920 39970 39518 CDS product DUF1198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094815.1 protein_id gnl|my_center|LOCUS_32920 41053 40037 gene locus_tag LOCUS_32930 41053 40037 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213216.1 protein_id gnl|my_center|LOCUS_32930 42371 41025 gene locus_tag LOCUS_32940 gene fucP 42371 41025 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998359.1 protein_id gnl|my_center|LOCUS_32940 43324 42404 gene locus_tag LOCUS_32950 gene rbsK 43324 42404 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350272.1 protein_id gnl|my_center|LOCUS_32950 43510 44298 gene locus_tag LOCUS_32960 43510 44298 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448638.1 protein_id gnl|my_center|LOCUS_32960 44591 44301 gene locus_tag LOCUS_32970 gene ilvN 44591 44301 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171826.1 protein_id gnl|my_center|LOCUS_32970 46283 44595 gene locus_tag LOCUS_32980 gene ilvB 46283 44595 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703882.1 protein_id gnl|my_center|LOCUS_32980 46808 46635 gene locus_tag LOCUS_32990 46808 46635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 46967 47164 gene locus_tag LOCUS_33000 46967 47164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096722.1 protein_id gnl|my_center|LOCUS_33000 47166 47942 gene locus_tag LOCUS_33010 47166 47942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096723.1 protein_id gnl|my_center|LOCUS_33010 48595 48383 gene locus_tag LOCUS_33020 48595 48383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 48610 49443 gene locus_tag LOCUS_33030 48610 49443 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703884.1 protein_id gnl|my_center|LOCUS_33030 49654 50805 gene locus_tag LOCUS_33040 gene emrD 49654 50805 CDS product multidrug efflux MFS transporter EmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828742.1 protein_id gnl|my_center|LOCUS_33040 50893 52212 gene locus_tag LOCUS_33050 gene dsdA 50893 52212 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703886.1 protein_id gnl|my_center|LOCUS_33050 52571 52209 gene locus_tag LOCUS_33060 52571 52209 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113457.1 protein_id gnl|my_center|LOCUS_33060 52908 52561 gene locus_tag LOCUS_33070 52908 52561 CDS product YidH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703959.1 protein_id gnl|my_center|LOCUS_33070 54422 53100 gene locus_tag LOCUS_33080 54422 53100 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094794.1 protein_id gnl|my_center|LOCUS_33080 56035 54419 gene locus_tag LOCUS_33090 56035 54419 CDS product alpha-glucoside-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369051.1 protein_id gnl|my_center|LOCUS_33090 56258 56992 gene locus_tag LOCUS_33100 56258 56992 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094792.1 protein_id gnl|my_center|LOCUS_33100 58633 56972 gene locus_tag LOCUS_33110 58633 56972 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279784.1 protein_id gnl|my_center|LOCUS_33110 58911 59201 gene locus_tag LOCUS_33120 58911 59201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 59692 59264 gene locus_tag LOCUS_33130 gene ibpB 59692 59264 CDS product heat shock chaperone IbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001766501.1 protein_id gnl|my_center|LOCUS_33130 60200 59787 gene locus_tag LOCUS_33140 gene ibpA 60200 59787 CDS product heat shock chaperone IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532742.1 protein_id gnl|my_center|LOCUS_33140 60579 60839 gene locus_tag LOCUS_33150 60579 60839 CDS product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369045.1 protein_id gnl|my_center|LOCUS_33150 62066 60840 gene locus_tag LOCUS_33160 62066 60840 CDS product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094788.1 protein_id gnl|my_center|LOCUS_33160 63409 62117 gene locus_tag LOCUS_33170 63409 62117 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032706561.1 protein_id gnl|my_center|LOCUS_33170 64670 63522 gene locus_tag LOCUS_33180 gene dgoD 64670 63522 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094786.1 protein_id gnl|my_center|LOCUS_33180 65284 64667 gene locus_tag LOCUS_33190 65284 64667 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094785.1 protein_id gnl|my_center|LOCUS_33190 66146 65268 gene locus_tag LOCUS_33200 66146 65268 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094784.1 protein_id gnl|my_center|LOCUS_33200 66832 66143 gene locus_tag LOCUS_33210 gene dgoR 66832 66143 CDS product D-galactonate utilization transcriptional regulator DgoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369039.1 protein_id gnl|my_center|LOCUS_33210 67892 67080 gene locus_tag LOCUS_33220 gene yidA 67892 67080 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985571.1 protein_id gnl|my_center|LOCUS_33220 70619 68205 gene locus_tag LOCUS_33230 gene gyrB 70619 68205 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072047.1 protein_id gnl|my_center|LOCUS_33230 71721 70648 gene locus_tag LOCUS_33240 gene recF 71721 70648 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094779.1 protein_id gnl|my_center|LOCUS_33240 72821 71721 gene locus_tag LOCUS_33250 gene dnaN 72821 71721 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673464.1 protein_id gnl|my_center|LOCUS_33250 74165 72840 gene locus_tag LOCUS_33260 gene dnaA 74165 72840 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014068246.1 protein_id gnl|my_center|LOCUS_33260 75028 75354 gene locus_tag LOCUS_33270 gene rnpA 75028 75354 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703902.1 protein_id gnl|my_center|LOCUS_33270 75578 77224 gene locus_tag LOCUS_33280 gene yidC 75578 77224 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378272.1 protein_id gnl|my_center|LOCUS_33280 77324 78688 gene locus_tag LOCUS_33290 gene mnmE 77324 78688 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282361.1 protein_id gnl|my_center|LOCUS_33290 78902 79114 gene locus_tag LOCUS_33300 gene cspA 78902 79114 CDS product RNA chaperone/antiterminator CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860775.1 protein_id gnl|my_center|LOCUS_33300 79348 80028 gene locus_tag LOCUS_33310 79348 80028 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190678.1 protein_id gnl|my_center|LOCUS_33310 80048 80614 gene locus_tag LOCUS_33320 80048 80614 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369022.1 protein_id gnl|my_center|LOCUS_33320 80740 81921 gene locus_tag LOCUS_33330 gene nepI 80740 81921 CDS product purine ribonucleoside efflux pump NepI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004798.1 protein_id gnl|my_center|LOCUS_33330 83387 82008 gene locus_tag LOCUS_33340 83387 82008 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094819.1 protein_id gnl|my_center|LOCUS_33340 83833 83531 gene locus_tag LOCUS_33350 83833 83531 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171894.1 protein_id gnl|my_center|LOCUS_33350 85233 83836 gene locus_tag LOCUS_33360 85233 83836 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270464.1 protein_id gnl|my_center|LOCUS_33360 86572 85247 gene locus_tag LOCUS_33370 86572 85247 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094821.1 protein_id gnl|my_center|LOCUS_33370 86898 86584 gene locus_tag LOCUS_33380 86898 86584 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094822.1 protein_id gnl|my_center|LOCUS_33380 87192 88139 gene locus_tag LOCUS_33390 87192 88139 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094823.1 protein_id gnl|my_center|LOCUS_33390 88807 88274 gene locus_tag LOCUS_33400 88807 88274 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369089.1 protein_id gnl|my_center|LOCUS_33400 88932 89855 gene locus_tag LOCUS_33410 88932 89855 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703863.1 protein_id gnl|my_center|LOCUS_33410 90505 89852 gene locus_tag LOCUS_33420 90505 89852 CDS product oxygen-insensitive NAD(P)H-dependent nitroreductase NfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073505.1 protein_id gnl|my_center|LOCUS_33420 90622 91530 gene locus_tag LOCUS_33430 90622 91530 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039278.1 protein_id gnl|my_center|LOCUS_33430 91721 91527 gene locus_tag LOCUS_33440 91721 91527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 91791 92552 gene locus_tag LOCUS_33450 91791 92552 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971207.1 protein_id gnl|my_center|LOCUS_33450 92555 93751 gene locus_tag LOCUS_33460 92555 93751 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530113.1 protein_id gnl|my_center|LOCUS_33460 93754 94674 gene locus_tag LOCUS_33470 93754 94674 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850115.1 protein_id gnl|my_center|LOCUS_33470 94831 94737 gene locus_tag LOCUS_t00470 94831 94737 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 95005 94844 gene locus_tag LOCUS_33480 95005 94844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 95120 96514 gene locus_tag LOCUS_33490 95120 96514 CDS product glycoside-pentoside-hexuronide family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834439.1 protein_id gnl|my_center|LOCUS_33490 96526 98844 gene locus_tag LOCUS_33500 gene yicI 96526 98844 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703001.1 protein_id gnl|my_center|LOCUS_33500 100271 98892 gene locus_tag LOCUS_33510 100271 98892 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703822.1 protein_id gnl|my_center|LOCUS_33510 101835 100285 gene locus_tag LOCUS_33520 101835 100285 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703821.1 protein_id gnl|my_center|LOCUS_33520 103757 102042 gene locus_tag LOCUS_33530 103757 102042 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094876.1 protein_id gnl|my_center|LOCUS_33530 105284 103878 gene locus_tag LOCUS_33540 105284 103878 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094877.1 protein_id gnl|my_center|LOCUS_33540 105451 106293 gene locus_tag LOCUS_33550 105451 106293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 108387 106306 gene locus_tag LOCUS_33560 gene recG 108387 106306 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016758.1 protein_id gnl|my_center|LOCUS_33560 109080 108391 gene locus_tag LOCUS_33570 gene trmH 109080 108391 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070177.1 protein_id gnl|my_center|LOCUS_33570 111199 109085 gene locus_tag LOCUS_33580 gene spoT 111199 109085 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094882.1 protein_id gnl|my_center|LOCUS_33580 111493 111218 gene locus_tag LOCUS_33590 gene rpoZ 111493 111218 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 protein_id gnl|my_center|LOCUS_33590 112171 111548 gene locus_tag LOCUS_33600 gene gmk 112171 111548 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046966.1 protein_id gnl|my_center|LOCUS_33600 112431 114122 gene locus_tag LOCUS_33610 gene ligB 112431 114122 CDS product NAD-dependent DNA ligase LigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094885.1 protein_id gnl|my_center|LOCUS_33610 115111 114248 gene locus_tag LOCUS_33620 115111 114248 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621336.1 protein_id gnl|my_center|LOCUS_33620 115236 115952 gene locus_tag LOCUS_33630 gene rph 115236 115952 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369149.1 protein_id gnl|my_center|LOCUS_33630 116018 116659 gene locus_tag LOCUS_33640 gene pyrE 116018 116659 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703811.1 protein_id gnl|my_center|LOCUS_33640 117290 116694 gene locus_tag LOCUS_33650 gene slmA 117290 116694 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369151.1 protein_id gnl|my_center|LOCUS_33650 117872 117414 gene locus_tag LOCUS_33660 gene dut 117872 117414 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015570042.1 protein_id gnl|my_center|LOCUS_33660 119064 117850 gene locus_tag LOCUS_33670 gene coaBC 119064 117850 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703809.1 protein_id gnl|my_center|LOCUS_33670 119232 119894 gene locus_tag LOCUS_33680 gene radC 119232 119894 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380129.1 protein_id gnl|my_center|LOCUS_33680 120113 120349 gene locus_tag LOCUS_33690 gene rpmB 120113 120349 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002436699.1 protein_id gnl|my_center|LOCUS_33690 120370 120537 gene locus_tag LOCUS_33700 gene rpmG 120370 120537 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208990.1 protein_id gnl|my_center|LOCUS_33700 120609 121418 gene locus_tag LOCUS_33710 gene mutM 120609 121418 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094894.1 protein_id gnl|my_center|LOCUS_33710 121991 121512 gene locus_tag LOCUS_33720 gene coaD 121991 121512 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703808.1 protein_id gnl|my_center|LOCUS_33720 122758 121988 gene locus_tag LOCUS_33730 122758 121988 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094896.1 protein_id gnl|my_center|LOCUS_33730 124032 122758 gene locus_tag LOCUS_33740 gene waaA 124032 122758 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094897.1 protein_id gnl|my_center|LOCUS_33740 124221 125324 gene locus_tag LOCUS_33750 124221 125324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 126412 125303 gene locus_tag LOCUS_33760 126412 125303 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703804.1 protein_id gnl|my_center|LOCUS_33760 127512 126409 gene locus_tag LOCUS_33770 gene rfaQ 127512 126409 CDS product putative lipopolysaccharide heptosyltransferase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094901.1 protein_id gnl|my_center|LOCUS_33770 128482 127505 gene locus_tag LOCUS_33780 gene rfaC 128482 127505 CDS product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264584.1 protein_id gnl|my_center|LOCUS_33780 129532 128486 gene locus_tag LOCUS_33790 gene rfaF 129532 128486 CDS product ADP-heptose--LPS heptosyltransferase RfaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094907.1 protein_id gnl|my_center|LOCUS_33790 130592 129612 gene locus_tag LOCUS_33800 gene rfaD 130592 129612 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094908.1 protein_id gnl|my_center|LOCUS_33800 130808 132004 gene locus_tag LOCUS_33810 gene kbl 130808 132004 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094909.1 protein_id gnl|my_center|LOCUS_33810 132014 133039 gene locus_tag LOCUS_33820 gene tdh 132014 133039 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369171.1 protein_id gnl|my_center|LOCUS_33820 133254 134525 gene locus_tag LOCUS_33830 133254 134525 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453199.1 protein_id gnl|my_center|LOCUS_33830 134595 135443 gene locus_tag LOCUS_33840 134595 135443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 135463 136386 gene locus_tag LOCUS_33850 135463 136386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 136487 137443 gene locus_tag LOCUS_33860 136487 137443 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704101.1 protein_id gnl|my_center|LOCUS_33860 138394 137450 gene locus_tag LOCUS_33870 138394 137450 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094917.1 protein_id gnl|my_center|LOCUS_33870 139579 138398 gene locus_tag LOCUS_33880 gene envC 139579 138398 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094918.1 protein_id gnl|my_center|LOCUS_33880 141220 139673 gene locus_tag LOCUS_33890 gene gpmM 141220 139673 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116577.1 protein_id gnl|my_center|LOCUS_33890 141468 141899 gene locus_tag LOCUS_33900 141468 141899 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156179.1 protein_id gnl|my_center|LOCUS_33900 141943 142194 gene locus_tag LOCUS_33910 gene grxC 141943 142194 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010426371.1 protein_id gnl|my_center|LOCUS_33910 142229 142696 gene locus_tag LOCUS_33920 gene secB 142229 142696 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003370.1 protein_id gnl|my_center|LOCUS_33920 142696 143715 gene locus_tag LOCUS_33930 gene gpsA 142696 143715 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076194.1 protein_id gnl|my_center|LOCUS_33930 143784 144605 gene locus_tag LOCUS_33940 gene cysE 143784 144605 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004106845.1 protein_id gnl|my_center|LOCUS_33940 145075 144602 gene locus_tag LOCUS_33950 gene trmL 145075 144602 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094923.1 protein_id gnl|my_center|LOCUS_33950 146432 145248 gene locus_tag LOCUS_33960 gene lldD 146432 145248 CDS product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094925.1 protein_id gnl|my_center|LOCUS_33960 147184 146429 gene locus_tag LOCUS_33970 gene lldR 147184 146429 CDS product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369184.1 protein_id gnl|my_center|LOCUS_33970 147282 147449 gene locus_tag LOCUS_33980 147282 147449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 147794 147432 gene locus_tag LOCUS_33990 147794 147432 CDS product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665677.1 protein_id gnl|my_center|LOCUS_33990 148377 147853 gene locus_tag LOCUS_34000 gene mtlR 148377 147853 CDS product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094931.1 protein_id gnl|my_center|LOCUS_34000 149588 148440 gene locus_tag LOCUS_34010 gene mtlD 149588 148440 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094932.1 protein_id gnl|my_center|LOCUS_34010 151660 149753 gene locus_tag LOCUS_34020 151660 149753 CDS product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094933.1 protein_id gnl|my_center|LOCUS_34020 153841 152162 gene locus_tag LOCUS_34030 153841 152162 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705650.1 protein_id gnl|my_center|LOCUS_34030 155348 153894 gene locus_tag LOCUS_34040 155348 153894 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162184131.1 protein_id gnl|my_center|LOCUS_34040 155791 156399 gene locus_tag LOCUS_34050 155791 156399 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766681.1 protein_id gnl|my_center|LOCUS_34050 156492 157880 gene locus_tag LOCUS_34060 gene selA 156492 157880 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206261.1 protein_id gnl|my_center|LOCUS_34060 157877 159724 gene locus_tag LOCUS_34070 gene selB 157877 159724 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582424.1 protein_id gnl|my_center|LOCUS_34070 160608 159721 gene locus_tag LOCUS_34080 160608 159721 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188270.1 protein_id gnl|my_center|LOCUS_34080 160773 162311 gene locus_tag LOCUS_34090 gene aldB 160773 162311 CDS product aldehyde dehydrogenase AldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183998.1 protein_id gnl|my_center|LOCUS_34090 >Feature sequence10 2283 169 gene locus_tag LOCUS_34100 gene fusA 2283 169 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099032.1 protein_id gnl|my_center|LOCUS_34100 2850 2380 gene locus_tag LOCUS_34110 gene rpsG 2850 2380 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861706.1 protein_id gnl|my_center|LOCUS_34110 3320 2946 gene locus_tag LOCUS_34120 gene rpsL 3320 2946 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246815.1 protein_id gnl|my_center|LOCUS_34120 3732 3445 gene locus_tag LOCUS_34130 gene tusB 3732 3445 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369415.1 protein_id gnl|my_center|LOCUS_34130 4099 3740 gene locus_tag LOCUS_34140 gene tusC 4099 3740 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369414.1 protein_id gnl|my_center|LOCUS_34140 4485 4099 gene locus_tag LOCUS_34150 gene tusD 4485 4099 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209689.1 protein_id gnl|my_center|LOCUS_34150 5207 4485 gene locus_tag LOCUS_34160 5207 4485 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861697.1 protein_id gnl|my_center|LOCUS_34160 6200 5379 gene locus_tag LOCUS_34170 gene fkpA 6200 5379 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099036.1 protein_id gnl|my_center|LOCUS_34170 6431 6649 gene locus_tag LOCUS_34180 6431 6649 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861693.1 protein_id gnl|my_center|LOCUS_34180 7288 6704 gene locus_tag LOCUS_34190 gene slyD 7288 6704 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099037.1 protein_id gnl|my_center|LOCUS_34190 7583 7383 gene locus_tag LOCUS_34200 7583 7383 CDS product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004106389.1 protein_id gnl|my_center|LOCUS_34200 9398 7593 gene locus_tag LOCUS_34210 gene kefB 9398 7593 CDS product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099039.1 protein_id gnl|my_center|LOCUS_34210 9949 9398 gene locus_tag LOCUS_34220 gene kefG 9949 9398 CDS product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297514.1 protein_id gnl|my_center|LOCUS_34220 10102 12003 gene locus_tag LOCUS_34230 10102 12003 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099041.1 protein_id gnl|my_center|LOCUS_34230 13542 12052 gene locus_tag LOCUS_34240 13542 12052 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206821.1 protein_id gnl|my_center|LOCUS_34240 14416 13556 gene locus_tag LOCUS_34250 gene prs 14416 13556 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072072.1 protein_id gnl|my_center|LOCUS_34250 14614 15333 gene locus_tag LOCUS_34260 14614 15333 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072071.1 protein_id gnl|my_center|LOCUS_34260 15414 16430 gene locus_tag LOCUS_34270 15414 16430 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703647.1 protein_id gnl|my_center|LOCUS_34270 16431 16649 gene locus_tag LOCUS_34280 16431 16649 CDS product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907085.1 protein_id gnl|my_center|LOCUS_34280 16694 17563 gene locus_tag LOCUS_34290 16694 17563 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274680.1 protein_id gnl|my_center|LOCUS_34290 18076 17672 gene locus_tag LOCUS_34300 18076 17672 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703648.1 protein_id gnl|my_center|LOCUS_34300 18375 19007 gene locus_tag LOCUS_34310 gene crp 18375 19007 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242758.1 protein_id gnl|my_center|LOCUS_34310 19060 21138 gene locus_tag LOCUS_34320 19060 21138 CDS product YccS/YhfK family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099057.1 protein_id gnl|my_center|LOCUS_34320 22355 21135 gene locus_tag LOCUS_34330 22355 21135 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833535.1 protein_id gnl|my_center|LOCUS_34330 23005 22442 gene locus_tag LOCUS_34340 gene pabA 23005 22442 CDS product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099059.1 protein_id gnl|my_center|LOCUS_34340 23707 23105 gene locus_tag LOCUS_34350 23707 23105 CDS product putative adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280679.1 protein_id gnl|my_center|LOCUS_34350 23867 23697 gene locus_tag LOCUS_34360 23867 23697 CDS product YhfG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519136.1 protein_id gnl|my_center|LOCUS_34360 24452 23976 gene locus_tag LOCUS_34370 gene ppiA 24452 23976 CDS product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920482.1 protein_id gnl|my_center|LOCUS_34370 24828 26012 gene locus_tag LOCUS_34380 gene tsgA 24828 26012 CDS product MFS transporter TsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185249.1 protein_id gnl|my_center|LOCUS_34380 27329 26031 gene locus_tag LOCUS_34390 27329 26031 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703651.1 protein_id gnl|my_center|LOCUS_34390 27713 27468 gene locus_tag LOCUS_34400 27713 27468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 27606 30113 gene locus_tag LOCUS_34410 gene nirB 27606 30113 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099064.1 protein_id gnl|my_center|LOCUS_34410 30110 30436 gene locus_tag LOCUS_34420 gene nirD 30110 30436 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099065.1 protein_id gnl|my_center|LOCUS_34420 30585 31391 gene locus_tag LOCUS_34430 gene nirC 30585 31391 CDS product nitrite transporter NirC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493575.1 protein_id gnl|my_center|LOCUS_34430 31410 32783 gene locus_tag LOCUS_34440 gene cysG 31410 32783 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349908.1 protein_id gnl|my_center|LOCUS_34440 33837 32833 gene locus_tag LOCUS_34450 gene trpS 33837 32833 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099067.1 protein_id gnl|my_center|LOCUS_34450 34591 33830 gene locus_tag LOCUS_34460 gene gph 34591 33830 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099068.1 protein_id gnl|my_center|LOCUS_34460 35261 34584 gene locus_tag LOCUS_34470 gene rpe 35261 34584 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816280.1 protein_id gnl|my_center|LOCUS_34470 36113 35301 gene locus_tag LOCUS_34480 gene dam 36113 35301 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742132.1 protein_id gnl|my_center|LOCUS_34480 37476 36181 gene locus_tag LOCUS_34490 gene damX 37476 36181 CDS product cell division protein DamX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099070.1 protein_id gnl|my_center|LOCUS_34490 38550 37579 gene locus_tag LOCUS_34500 gene aroB 38550 37579 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439848.1 protein_id gnl|my_center|LOCUS_34500 39238 38717 gene locus_tag LOCUS_34510 gene aroK 39238 38717 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861630.1 protein_id gnl|my_center|LOCUS_34510 40791 39574 gene locus_tag LOCUS_34520 gene hofQ 40791 39574 CDS product DNA uptake porin HofQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832818.1 protein_id gnl|my_center|LOCUS_34520 41137 40730 gene locus_tag LOCUS_34530 41137 40730 CDS product HofP DNA utilization family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868832.1 protein_id gnl|my_center|LOCUS_34530 41591 41127 gene locus_tag LOCUS_34540 41591 41127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 42114 41575 gene locus_tag LOCUS_34550 42114 41575 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951390.1 protein_id gnl|my_center|LOCUS_34550 42905 42114 gene locus_tag LOCUS_34560 gene hofM 42905 42114 CDS product DNA utilization protein HofM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296474.1 protein_id gnl|my_center|LOCUS_34560 43167 45578 gene locus_tag LOCUS_34570 gene mrcA 43167 45578 CDS product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099079.1 protein_id gnl|my_center|LOCUS_34570 46281 45721 gene locus_tag LOCUS_34580 gene nudE 46281 45721 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099080.1 protein_id gnl|my_center|LOCUS_34580 46739 48739 gene locus_tag LOCUS_34590 gene igaA 46739 48739 CDS product intracellular growth attenuator protein IgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104086.1 protein_id gnl|my_center|LOCUS_34590 48797 49480 gene locus_tag LOCUS_34600 gene yrfG 48797 49480 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099082.1 protein_id gnl|my_center|LOCUS_34600 49477 49878 gene locus_tag LOCUS_34610 gene hslR 49477 49878 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099083.1 protein_id gnl|my_center|LOCUS_34610 49903 50781 gene locus_tag LOCUS_34620 gene hslO 49903 50781 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001775502.1 protein_id gnl|my_center|LOCUS_34620 52553 50823 gene locus_tag LOCUS_34630 52553 50823 CDS product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446446.1 protein_id gnl|my_center|LOCUS_34630 52825 52658 gene locus_tag LOCUS_34640 52825 52658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 52929 54548 gene locus_tag LOCUS_34650 gene pckA 52929 54548 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265689.1 protein_id gnl|my_center|LOCUS_34650 56102 54759 gene locus_tag LOCUS_34660 gene envZ 56102 54759 CDS product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253694.1 protein_id gnl|my_center|LOCUS_34660 56827 56108 gene locus_tag LOCUS_34670 gene ompR 56827 56108 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157751.1 protein_id gnl|my_center|LOCUS_34670 56986 57459 gene locus_tag LOCUS_34680 gene greB 56986 57459 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703675.1 protein_id gnl|my_center|LOCUS_34680 57560 59890 gene locus_tag LOCUS_34690 57560 59890 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703676.1 protein_id gnl|my_center|LOCUS_34690 60310 60537 gene locus_tag LOCUS_34700 gene feoA 60310 60537 CDS product ferrous iron transporter A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160955.1 protein_id gnl|my_center|LOCUS_34700 60568 62889 gene locus_tag LOCUS_34710 gene feoB 60568 62889 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099092.1 protein_id gnl|my_center|LOCUS_34710 62900 63136 gene locus_tag LOCUS_34720 gene feoC 62900 63136 CDS product [Fe-S]-dependent transcriptional repressor FeoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099093.1 protein_id gnl|my_center|LOCUS_34720 63906 63133 gene locus_tag LOCUS_34730 gene bioH 63906 63133 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703680.1 protein_id gnl|my_center|LOCUS_34730 63790 64149 gene locus_tag LOCUS_34740 63790 64149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 64142 64627 gene locus_tag LOCUS_34750 64142 64627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 64686 65261 gene locus_tag LOCUS_34760 gene nfuA 64686 65261 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619389.1 protein_id gnl|my_center|LOCUS_34760 65580 66896 gene locus_tag LOCUS_34770 gene gntT 65580 66896 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369355.1 protein_id gnl|my_center|LOCUS_34770 69140 67056 gene locus_tag LOCUS_34780 gene malQ 69140 67056 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444342.1 protein_id gnl|my_center|LOCUS_34780 71542 69149 gene locus_tag LOCUS_34790 gene malP 71542 69149 CDS product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099099.1 protein_id gnl|my_center|LOCUS_34790 72179 74884 gene locus_tag LOCUS_34800 gene malT 72179 74884 CDS product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420753.1 protein_id gnl|my_center|LOCUS_34800 75639 74881 gene locus_tag LOCUS_34810 75639 74881 CDS product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099103.1 protein_id gnl|my_center|LOCUS_34810 76486 75656 gene locus_tag LOCUS_34820 gene glpG 76486 75656 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928705.1 protein_id gnl|my_center|LOCUS_34820 76869 76540 gene locus_tag LOCUS_34830 gene glpE 76869 76540 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369349.1 protein_id gnl|my_center|LOCUS_34830 77235 78740 gene locus_tag LOCUS_34840 gene glpD 77235 78740 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448178.1 protein_id gnl|my_center|LOCUS_34840 78913 78707 gene locus_tag LOCUS_34850 78913 78707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 81447 79000 gene locus_tag LOCUS_34860 gene glgP 81447 79000 CDS product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993423.1 protein_id gnl|my_center|LOCUS_34860 82900 81467 gene locus_tag LOCUS_34870 gene glgA 82900 81467 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197646.1 protein_id gnl|my_center|LOCUS_34870 84275 82992 gene locus_tag LOCUS_34880 gene glgC 84275 82992 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099110.1 protein_id gnl|my_center|LOCUS_34880 86266 84290 gene locus_tag LOCUS_34890 gene glgX 86266 84290 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099111.1 protein_id gnl|my_center|LOCUS_34890 88449 86263 gene locus_tag LOCUS_34900 gene glgB 88449 86263 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283723.1 protein_id gnl|my_center|LOCUS_34900 89834 88728 gene locus_tag LOCUS_34910 gene asd 89834 88728 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703691.1 protein_id gnl|my_center|LOCUS_34910 90009 90602 gene locus_tag LOCUS_34920 gene yhgN 90009 90602 CDS product NAAT family transporter YhgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002551.1 protein_id gnl|my_center|LOCUS_34920 90644 91351 gene locus_tag LOCUS_34930 90644 91351 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905450.1 protein_id gnl|my_center|LOCUS_34930 92749 91505 gene locus_tag LOCUS_34940 gene gntU 92749 91505 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833577.1 protein_id gnl|my_center|LOCUS_34940 93381 92860 gene locus_tag LOCUS_34950 gene gntK 93381 92860 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420757.1 protein_id gnl|my_center|LOCUS_34950 94503 93508 gene locus_tag LOCUS_34960 gene gntR 94503 93508 CDS product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730239.1 protein_id gnl|my_center|LOCUS_34960 95302 94607 gene locus_tag LOCUS_34970 95302 94607 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639789.1 protein_id gnl|my_center|LOCUS_34970 96462 95425 gene locus_tag LOCUS_34980 96462 95425 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099119.1 protein_id gnl|my_center|LOCUS_34980 96419 96607 gene locus_tag LOCUS_34990 96419 96607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 96775 97263 gene locus_tag LOCUS_35000 gene yhhY 96775 97263 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099120.1 protein_id gnl|my_center|LOCUS_35000 99151 97400 gene locus_tag LOCUS_35010 gene ggt 99151 97400 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 protein_id gnl|my_center|LOCUS_35010 99267 99722 gene locus_tag LOCUS_35020 99267 99722 CDS product DUF2756 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826133.1 protein_id gnl|my_center|LOCUS_35020 100459 99719 gene locus_tag LOCUS_35030 gene ugpQ 100459 99719 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703700.1 protein_id gnl|my_center|LOCUS_35030 101529 100456 gene locus_tag LOCUS_35040 101529 100456 CDS product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099124.1 protein_id gnl|my_center|LOCUS_35040 102376 101531 gene locus_tag LOCUS_35050 gene ugpE 102376 101531 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703702.1 protein_id gnl|my_center|LOCUS_35050 103272 102373 gene locus_tag LOCUS_35060 gene ugpA 103272 102373 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099126.1 protein_id gnl|my_center|LOCUS_35060 104816 103500 gene locus_tag LOCUS_35070 gene ugpB 104816 103500 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028113.1 protein_id gnl|my_center|LOCUS_35070 105010 106173 gene locus_tag LOCUS_35080 105010 106173 CDS product DUF1996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705141.1 protein_id gnl|my_center|LOCUS_35080 106973 106260 gene locus_tag LOCUS_35090 gene livF 106973 106260 CDS product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099128.1 protein_id gnl|my_center|LOCUS_35090 107742 106975 gene locus_tag LOCUS_35100 gene livG 107742 106975 CDS product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369325.1 protein_id gnl|my_center|LOCUS_35100 109016 107739 gene locus_tag LOCUS_35110 gene livM 109016 107739 CDS product branched chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369324.1 protein_id gnl|my_center|LOCUS_35110 109939 109013 gene locus_tag LOCUS_35120 gene livH 109939 109013 CDS product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099131.1 protein_id gnl|my_center|LOCUS_35120 111082 109994 gene locus_tag LOCUS_35130 gene livK 111082 109994 CDS product high-affinity branched-chain amino acid ABC transporter substrate-binding protein LivK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301528.1 protein_id gnl|my_center|LOCUS_35130 111584 111967 gene locus_tag LOCUS_35140 gene panM 111584 111967 CDS product aspartate 1-decarboxylase autocleavage activator PanM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099135.1 protein_id gnl|my_center|LOCUS_35140 113170 112073 gene locus_tag LOCUS_35150 gene livJ 113170 112073 CDS product branched chain amino acid ABC transporter substrate-binding protein LivJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021986.1 protein_id gnl|my_center|LOCUS_35150 114707 113442 gene locus_tag LOCUS_35160 114707 113442 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099137.1 protein_id gnl|my_center|LOCUS_35160 115782 114928 gene locus_tag LOCUS_35170 gene rpoH 115782 114928 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159621.1 protein_id gnl|my_center|LOCUS_35170 117104 116049 gene locus_tag LOCUS_35180 gene ftsX 117104 116049 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099139.1 protein_id gnl|my_center|LOCUS_35180 117765 117097 gene locus_tag LOCUS_35190 gene ftsE 117765 117097 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099140.1 protein_id gnl|my_center|LOCUS_35190 119216 117768 gene locus_tag LOCUS_35200 gene ftsY 119216 117768 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040649.1 protein_id gnl|my_center|LOCUS_35200 119421 120017 gene locus_tag LOCUS_35210 gene rsmD 119421 120017 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883606.1 protein_id gnl|my_center|LOCUS_35210 120007 120282 gene locus_tag LOCUS_35220 120007 120282 CDS product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099143.1 protein_id gnl|my_center|LOCUS_35220 120409 121035 gene locus_tag LOCUS_35230 120409 121035 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964735.1 protein_id gnl|my_center|LOCUS_35230 121108 123315 gene locus_tag LOCUS_35240 gene zntA 121108 123315 CDS product Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106499.1 protein_id gnl|my_center|LOCUS_35240 123666 123424 gene locus_tag LOCUS_35250 gene tusA 123666 123424 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833603.1 protein_id gnl|my_center|LOCUS_35250 123834 124499 gene locus_tag LOCUS_35260 123834 124499 CDS product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100467.1 protein_id gnl|my_center|LOCUS_35260 124572 125129 gene locus_tag LOCUS_35270 124572 125129 CDS product DcrB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099152.1 protein_id gnl|my_center|LOCUS_35270 126340 125141 gene locus_tag LOCUS_35280 126340 125141 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240225.1 protein_id gnl|my_center|LOCUS_35280 126486 127535 gene locus_tag LOCUS_35290 126486 127535 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361522.1 protein_id gnl|my_center|LOCUS_35290 127805 128194 gene locus_tag LOCUS_35300 127805 128194 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301470.1 protein_id gnl|my_center|LOCUS_35300 128264 129322 gene locus_tag LOCUS_35310 128264 129322 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273200.1 protein_id gnl|my_center|LOCUS_35310 129375 130097 gene locus_tag LOCUS_35320 129375 130097 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301843.1 protein_id gnl|my_center|LOCUS_35320 130094 130891 gene locus_tag LOCUS_35330 130094 130891 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302735.1 protein_id gnl|my_center|LOCUS_35330 130891 131148 gene locus_tag LOCUS_35340 130891 131148 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369304.1 protein_id gnl|my_center|LOCUS_35340 131163 131414 gene locus_tag LOCUS_35350 131163 131414 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139646.1 protein_id gnl|my_center|LOCUS_35350 131421 132002 gene locus_tag LOCUS_35360 131421 132002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014366.1 protein_id gnl|my_center|LOCUS_35360 131999 133357 gene locus_tag LOCUS_35370 131999 133357 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815059.1 protein_id gnl|my_center|LOCUS_35370 133344 133697 gene locus_tag LOCUS_35380 133344 133697 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703718.1 protein_id gnl|my_center|LOCUS_35380 133688 135382 gene locus_tag LOCUS_35390 133688 135382 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115628.1 protein_id gnl|my_center|LOCUS_35390 135385 135807 gene locus_tag LOCUS_35400 135385 135807 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369298.1 protein_id gnl|my_center|LOCUS_35400 135804 136409 gene locus_tag LOCUS_35410 135804 136409 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670562.1 protein_id gnl|my_center|LOCUS_35410 136378 138696 gene locus_tag LOCUS_35420 136378 138696 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149367168.1 protein_id gnl|my_center|LOCUS_35420 138693 139280 gene locus_tag LOCUS_35430 138693 139280 CDS product DUF3261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595147.1 protein_id gnl|my_center|LOCUS_35430 139282 140451 gene locus_tag LOCUS_35440 139282 140451 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703723.1 protein_id gnl|my_center|LOCUS_35440 140448 140924 gene locus_tag LOCUS_35450 140448 140924 CDS product 3-hydroxy-fatty acyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020249.1 protein_id gnl|my_center|LOCUS_35450 140921 141652 gene locus_tag LOCUS_35460 140921 141652 CDS product 3-ketoacyl-ACP reductase FabG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091664.1 protein_id gnl|my_center|LOCUS_35460 141649 142878 gene locus_tag LOCUS_35470 141649 142878 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198470.1 protein_id gnl|my_center|LOCUS_35470 142881 143459 gene locus_tag LOCUS_35480 gene acpT 142881 143459 CDS product 4'-phosphopantetheinyl transferase AcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285785.1 protein_id gnl|my_center|LOCUS_35480 143532 144326 gene locus_tag LOCUS_35490 143532 144326 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099180.1 protein_id gnl|my_center|LOCUS_35490 146251 144419 gene locus_tag LOCUS_35500 gene tssF 146251 144419 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602701.1 protein_id gnl|my_center|LOCUS_35500 >Feature sequence11 617 99 gene locus_tag LOCUS_35510 gene mobB 617 99 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989262.1 protein_id gnl|my_center|LOCUS_35510 1183 599 gene locus_tag LOCUS_35520 gene mobA 1183 599 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052181.1 protein_id gnl|my_center|LOCUS_35520 1254 1523 gene locus_tag LOCUS_35530 1254 1523 CDS product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099387.1 protein_id gnl|my_center|LOCUS_35530 1600 2586 gene locus_tag LOCUS_35540 1600 2586 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099386.1 protein_id gnl|my_center|LOCUS_35540 2614 3237 gene locus_tag LOCUS_35550 gene dsbA 2614 3237 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099385.1 protein_id gnl|my_center|LOCUS_35550 3622 3251 gene locus_tag LOCUS_35560 3622 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 4574 7360 gene locus_tag LOCUS_35570 gene polA 4574 7360 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249956.1 protein_id gnl|my_center|LOCUS_35570 8282 7656 gene locus_tag LOCUS_35580 gene yihA 8282 7656 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703927.1 protein_id gnl|my_center|LOCUS_35580 8730 8530 gene locus_tag LOCUS_35590 8730 8530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 8868 9386 gene locus_tag LOCUS_35600 gene yihI 8868 9386 CDS product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099380.1 protein_id gnl|my_center|LOCUS_35600 9573 10946 gene locus_tag LOCUS_35610 gene hemN 9573 10946 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116087.1 protein_id gnl|my_center|LOCUS_35610 12751 11342 gene locus_tag LOCUS_35620 gene glnG 12751 11342 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602497.1 protein_id gnl|my_center|LOCUS_35620 13809 12760 gene locus_tag LOCUS_35630 gene glnL 13809 12760 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501857.1 protein_id gnl|my_center|LOCUS_35630 15483 14074 gene locus_tag LOCUS_35640 gene glnA 15483 14074 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099376.1 protein_id gnl|my_center|LOCUS_35640 15864 17687 gene locus_tag LOCUS_35650 gene typA 15864 17687 CDS product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099375.1 protein_id gnl|my_center|LOCUS_35650 17820 18092 gene locus_tag LOCUS_35660 17820 18092 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041497.1 protein_id gnl|my_center|LOCUS_35660 18082 18390 gene locus_tag LOCUS_35670 18082 18390 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971265.1 protein_id gnl|my_center|LOCUS_35670 19755 18373 gene locus_tag LOCUS_35680 19755 18373 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420847.1 protein_id gnl|my_center|LOCUS_35680 21183 19798 gene locus_tag LOCUS_35690 21183 19798 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099372.1 protein_id gnl|my_center|LOCUS_35690 23265 21229 gene locus_tag LOCUS_35700 23265 21229 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087028.1 protein_id gnl|my_center|LOCUS_35700 24529 23288 gene locus_tag LOCUS_35710 gene yihS 24529 23288 CDS product sulfoquinovose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099370.1 protein_id gnl|my_center|LOCUS_35710 25418 24543 gene locus_tag LOCUS_35720 gene yihT 25418 24543 CDS product sulfofructosephosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046464.1 protein_id gnl|my_center|LOCUS_35720 26336 25440 gene locus_tag LOCUS_35730 gene yihU 26336 25440 CDS product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099368.1 protein_id gnl|my_center|LOCUS_35730 26504 27400 gene locus_tag LOCUS_35740 26504 27400 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520529.1 protein_id gnl|my_center|LOCUS_35740 27436 28224 gene locus_tag LOCUS_35750 27436 28224 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099366.1 protein_id gnl|my_center|LOCUS_35750 28973 28221 gene locus_tag LOCUS_35760 28973 28221 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113827.1 protein_id gnl|my_center|LOCUS_35760 29070 29999 gene locus_tag LOCUS_35770 29070 29999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868990.1 protein_id gnl|my_center|LOCUS_35770 30136 30735 gene locus_tag LOCUS_35780 gene yihX 30136 30735 CDS product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099365.1 protein_id gnl|my_center|LOCUS_35780 30729 31601 gene locus_tag LOCUS_35790 30729 31601 CDS product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920762.1 protein_id gnl|my_center|LOCUS_35790 31598 32035 gene locus_tag LOCUS_35800 gene dtd 31598 32035 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368967.1 protein_id gnl|my_center|LOCUS_35800 32080 33021 gene locus_tag LOCUS_35810 gene fabY 32080 33021 CDS product fatty acid biosynthesis protein FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099362.1 protein_id gnl|my_center|LOCUS_35810 33489 33037 gene locus_tag LOCUS_35820 33489 33037 CDS product type II toxin-antitoxin system HigA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259009.1 protein_id gnl|my_center|LOCUS_35820 34193 34411 gene locus_tag LOCUS_35830 34193 34411 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001523745.1 protein_id gnl|my_center|LOCUS_35830 34405 34542 gene locus_tag LOCUS_35840 34405 34542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 35506 34577 gene locus_tag LOCUS_35850 gene fdhE 35506 34577 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027727.1 protein_id gnl|my_center|LOCUS_35850 36138 35503 gene locus_tag LOCUS_35860 gene fdoI 36138 35503 CDS product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099357.1 protein_id gnl|my_center|LOCUS_35860 37037 36135 gene locus_tag LOCUS_35870 gene fdxH 37037 36135 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368961.1 protein_id gnl|my_center|LOCUS_35870 40094 37044 gene locus_tag LOCUS_35880 gene fdnG 40094 37044 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989259.1 transl_except (pos:complement(39507..39509),aa:Sec) note codon on position 196 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_35880 40279 41085 gene locus_tag LOCUS_35890 gene fdhD 40279 41085 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753617.1 protein_id gnl|my_center|LOCUS_35890 41210 41422 gene locus_tag LOCUS_35900 41210 41422 CDS product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099352.1 protein_id gnl|my_center|LOCUS_35900 41822 42802 gene locus_tag LOCUS_35910 gene pfkA 41822 42802 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429132.1 protein_id gnl|my_center|LOCUS_35910 42814 43128 gene locus_tag LOCUS_35920 42814 43128 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292534.1 protein_id gnl|my_center|LOCUS_35920 43121 44488 gene locus_tag LOCUS_35930 43121 44488 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296769.1 protein_id gnl|my_center|LOCUS_35930 44475 45317 gene locus_tag LOCUS_35940 44475 45317 CDS product class II fructose-bisphosphate aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294699.1 protein_id gnl|my_center|LOCUS_35940 45376 45645 gene locus_tag LOCUS_35950 45376 45645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 45655 46092 gene locus_tag LOCUS_35960 45655 46092 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050067.1 protein_id gnl|my_center|LOCUS_35960 46089 46652 gene locus_tag LOCUS_35970 46089 46652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 48402 46684 gene locus_tag LOCUS_35980 48402 46684 CDS product putative frv operon regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931299.1 protein_id gnl|my_center|LOCUS_35980 49472 48411 gene locus_tag LOCUS_35990 49472 48411 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019480.1 protein_id gnl|my_center|LOCUS_35990 50907 49462 gene locus_tag LOCUS_36000 50907 49462 CDS product PTS fructose-like transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446023.1 protein_id gnl|my_center|LOCUS_36000 51364 50918 gene locus_tag LOCUS_36010 51364 50918 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729611.1 protein_id gnl|my_center|LOCUS_36010 51908 53305 gene locus_tag LOCUS_36020 51908 53305 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749944.1 protein_id gnl|my_center|LOCUS_36020 53511 54506 gene locus_tag LOCUS_36030 53511 54506 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099344.1 protein_id gnl|my_center|LOCUS_36030 54619 56742 gene locus_tag LOCUS_36040 54619 56742 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420832.1 protein_id gnl|my_center|LOCUS_36040 56785 58047 gene locus_tag LOCUS_36050 56785 58047 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099342.1 protein_id gnl|my_center|LOCUS_36050 58477 58271 gene locus_tag LOCUS_36060 58477 58271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 58805 59119 gene locus_tag LOCUS_36070 58805 59119 CDS product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161265.1 protein_id gnl|my_center|LOCUS_36070 59112 60227 gene locus_tag LOCUS_36080 59112 60227 CDS product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722978.1 protein_id gnl|my_center|LOCUS_36080 60314 62899 gene locus_tag LOCUS_36090 gene mngB 60314 62899 CDS product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648976.1 protein_id gnl|my_center|LOCUS_36090 62915 64072 gene locus_tag LOCUS_36100 62915 64072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 64021 64440 gene locus_tag LOCUS_36110 64021 64440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 64463 66448 gene locus_tag LOCUS_36120 64463 66448 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969597.1 protein_id gnl|my_center|LOCUS_36120 66585 67580 gene locus_tag LOCUS_36130 66585 67580 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938996.1 protein_id gnl|my_center|LOCUS_36130 67939 67625 gene locus_tag LOCUS_36140 gene rhaM 67939 67625 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619478.1 protein_id gnl|my_center|LOCUS_36140 69084 67936 gene locus_tag LOCUS_36150 gene fucO 69084 67936 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009255.1 protein_id gnl|my_center|LOCUS_36150 70311 69307 gene locus_tag LOCUS_36160 70311 69307 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968717.1 protein_id gnl|my_center|LOCUS_36160 71312 70308 gene locus_tag LOCUS_36170 71312 70308 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973085.1 protein_id gnl|my_center|LOCUS_36170 72823 71312 gene locus_tag LOCUS_36180 72823 71312 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391991.1 protein_id gnl|my_center|LOCUS_36180 74100 73114 gene locus_tag LOCUS_36190 gene rhaS 74100 73114 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327310.1 protein_id gnl|my_center|LOCUS_36190 75013 74183 gene locus_tag LOCUS_36200 gene rhaD 75013 74183 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099339.1 protein_id gnl|my_center|LOCUS_36200 76412 75153 gene locus_tag LOCUS_36210 gene rhaA 76412 75153 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311268.1 protein_id gnl|my_center|LOCUS_36210 77863 76409 gene locus_tag LOCUS_36220 gene rhaB 77863 76409 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099337.1 protein_id gnl|my_center|LOCUS_36220 78152 79000 gene locus_tag LOCUS_36230 gene rhaS 78152 79000 CDS product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217112.1 protein_id gnl|my_center|LOCUS_36230 79085 79963 gene locus_tag LOCUS_36240 gene rhaR 79085 79963 CDS product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368942.1 protein_id gnl|my_center|LOCUS_36240 80130 80750 gene locus_tag LOCUS_36250 gene sodA 80130 80750 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861999.1 protein_id gnl|my_center|LOCUS_36250 81226 81897 gene locus_tag LOCUS_36260 81226 81897 CDS product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378721.1 protein_id gnl|my_center|LOCUS_36260 82037 82711 gene locus_tag LOCUS_36270 gene yiiM 82037 82711 CDS product 6-hydroxyaminopurine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099332.1 protein_id gnl|my_center|LOCUS_36270 84225 82861 gene locus_tag LOCUS_36280 gene cpxA 84225 82861 CDS product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580417.1 protein_id gnl|my_center|LOCUS_36280 84932 84234 gene locus_tag LOCUS_36290 gene cpxR 84932 84234 CDS product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862004.1 protein_id gnl|my_center|LOCUS_36290 85081 85584 gene locus_tag LOCUS_36300 gene cpxP 85081 85584 CDS product cell-envelope stress modulator CpxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233466.1 protein_id gnl|my_center|LOCUS_36300 85752 86657 gene locus_tag LOCUS_36310 gene fieF 85752 86657 CDS product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099328.1 protein_id gnl|my_center|LOCUS_36310 86838 87800 gene locus_tag LOCUS_36320 gene pfkA 86838 87800 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099327.1 protein_id gnl|my_center|LOCUS_36320 87946 88935 gene locus_tag LOCUS_36330 87946 88935 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099326.1 protein_id gnl|my_center|LOCUS_36330 89029 89784 gene locus_tag LOCUS_36340 89029 89784 CDS product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369135.1 protein_id gnl|my_center|LOCUS_36340 89858 91162 gene locus_tag LOCUS_36350 89858 91162 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703817.1 protein_id gnl|my_center|LOCUS_36350 92025 91258 gene locus_tag LOCUS_36360 gene tpiA 92025 91258 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862019.1 protein_id gnl|my_center|LOCUS_36360 92732 92133 gene locus_tag LOCUS_36370 92732 92133 CDS product DUF1454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369137.1 protein_id gnl|my_center|LOCUS_36370 92846 93268 gene locus_tag LOCUS_36380 92846 93268 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155261.1 protein_id gnl|my_center|LOCUS_36380 94015 93269 gene locus_tag LOCUS_36390 gene fpr 94015 93269 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796310.1 protein_id gnl|my_center|LOCUS_36390 95122 94112 gene locus_tag LOCUS_36400 gene glpX 95122 94112 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703815.1 protein_id gnl|my_center|LOCUS_36400 96891 95383 gene locus_tag LOCUS_36410 gene glpK 96891 95383 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099318.1 protein_id gnl|my_center|LOCUS_36410 97761 96913 gene locus_tag LOCUS_36420 97761 96913 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099317.1 protein_id gnl|my_center|LOCUS_36420 98161 98400 gene locus_tag LOCUS_36430 gene zapB 98161 98400 CDS product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099316.1 protein_id gnl|my_center|LOCUS_36430 98426 98448 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 98947 98462 gene locus_tag LOCUS_36440 gene rraA 98947 98462 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872918.1 protein_id gnl|my_center|LOCUS_36440 99969 99040 gene locus_tag LOCUS_36450 gene menA 99969 99040 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139635.1 protein_id gnl|my_center|LOCUS_36450 101371 100037 gene locus_tag LOCUS_36460 gene hslU 101371 100037 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368931.1 protein_id gnl|my_center|LOCUS_36460 101911 101381 gene locus_tag LOCUS_36470 gene hslV 101911 101381 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368930.1 protein_id gnl|my_center|LOCUS_36470 102856 102002 gene locus_tag LOCUS_36480 gene ftsN 102856 102002 CDS product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099312.1 protein_id gnl|my_center|LOCUS_36480 104080 103055 gene locus_tag LOCUS_36490 gene cytR 104080 103055 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099311.1 protein_id gnl|my_center|LOCUS_36490 106423 104228 gene locus_tag LOCUS_36500 gene priA 106423 104228 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109394.1 protein_id gnl|my_center|LOCUS_36500 106636 106848 gene locus_tag LOCUS_36510 gene rpmE 106636 106848 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368925.1 protein_id gnl|my_center|LOCUS_36510 107278 106961 gene locus_tag LOCUS_36520 gene metJ 107278 106961 CDS product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862042.1 protein_id gnl|my_center|LOCUS_36520 107555 108715 gene locus_tag LOCUS_36530 gene metB 107555 108715 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099309.1 protein_id gnl|my_center|LOCUS_36530 108718 111150 gene locus_tag LOCUS_36540 gene metL 108718 111150 CDS product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110774.1 protein_id gnl|my_center|LOCUS_36540 111448 112338 gene locus_tag LOCUS_36550 gene metF 111448 112338 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007523.1 protein_id gnl|my_center|LOCUS_36550 113475 112372 gene locus_tag LOCUS_36560 113475 112372 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374033.1 protein_id gnl|my_center|LOCUS_36560 114149 113487 gene locus_tag LOCUS_36570 gene fsa 114149 113487 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703953.1 protein_id gnl|my_center|LOCUS_36570 116666 114153 gene locus_tag LOCUS_36580 gene ptsP 116666 114153 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174088.1 protein_id gnl|my_center|LOCUS_36580 116970 118046 gene locus_tag LOCUS_36590 116970 118046 CDS product PTS fructose transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004442.1 protein_id gnl|my_center|LOCUS_36590 118061 118381 gene locus_tag LOCUS_36600 118061 118381 CDS product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161265.1 protein_id gnl|my_center|LOCUS_36600 118430 120727 gene locus_tag LOCUS_36610 118430 120727 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184828.1 protein_id gnl|my_center|LOCUS_36610 120693 121547 gene locus_tag LOCUS_36620 120693 121547 CDS product [formate-C-acetyltransferase]-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204139.1 protein_id gnl|my_center|LOCUS_36620 121549 121905 gene locus_tag LOCUS_36630 121549 121905 CDS product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323846.1 protein_id gnl|my_center|LOCUS_36630 122743 121892 gene locus_tag LOCUS_36640 122743 121892 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274636.1 protein_id gnl|my_center|LOCUS_36640 125476 122825 gene locus_tag LOCUS_36650 gene ppc 125476 122825 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099302.1 protein_id gnl|my_center|LOCUS_36650 125674 125802 gene locus_tag LOCUS_36660 125674 125802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 126970 125819 gene locus_tag LOCUS_36670 gene argE 126970 125819 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099301.1 protein_id gnl|my_center|LOCUS_36670 127059 128063 gene locus_tag LOCUS_36680 gene argC 127059 128063 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099300.1 protein_id gnl|my_center|LOCUS_36680 128076 128852 gene locus_tag LOCUS_36690 gene argB 128076 128852 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020686923.1 protein_id gnl|my_center|LOCUS_36690 128924 130297 gene locus_tag LOCUS_36700 gene argH 128924 130297 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368911.1 protein_id gnl|my_center|LOCUS_36700 130713 131630 gene locus_tag LOCUS_36710 gene oxyR 130713 131630 CDS product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025919.1 protein_id gnl|my_center|LOCUS_36710 133013 131613 gene locus_tag LOCUS_36720 gene sthA 133013 131613 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833741.1 protein_id gnl|my_center|LOCUS_36720 133212 133847 gene locus_tag LOCUS_36730 gene fabR 133212 133847 CDS product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501784.1 protein_id gnl|my_center|LOCUS_36730 133858 134217 gene locus_tag LOCUS_36740 133858 134217 CDS product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501783.1 protein_id gnl|my_center|LOCUS_36740 135435 134332 gene locus_tag LOCUS_36750 gene trmA 135435 134332 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187008.1 protein_id gnl|my_center|LOCUS_36750 135796 137664 gene locus_tag LOCUS_36760 gene btuB 135796 137664 CDS product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815316.1 protein_id gnl|my_center|LOCUS_36760 137609 138460 gene locus_tag LOCUS_36770 gene murI 137609 138460 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201825.1 protein_id gnl|my_center|LOCUS_36770 >Feature sequence12 138 704 gene locus_tag LOCUS_36780 gene yqaB 138 704 CDS product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098435.1 protein_id gnl|my_center|LOCUS_36780 1211 2755 gene locus_tag LOCUS_36790 gene gshA 1211 2755 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098433.1 protein_id gnl|my_center|LOCUS_36790 2907 3422 gene locus_tag LOCUS_36800 gene luxS 2907 3422 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098432.1 protein_id gnl|my_center|LOCUS_36800 3501 4271 gene locus_tag LOCUS_36810 3501 4271 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098431.1 protein_id gnl|my_center|LOCUS_36810 5917 4268 gene locus_tag LOCUS_36820 gene leuA 5917 4268 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703237.1 protein_id gnl|my_center|LOCUS_36820 7831 6293 gene locus_tag LOCUS_36830 gene emrB 7831 6293 CDS product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295176.1 protein_id gnl|my_center|LOCUS_36830 9020 7848 gene locus_tag LOCUS_36840 gene emrA 9020 7848 CDS product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098428.1 protein_id gnl|my_center|LOCUS_36840 9681 9151 gene locus_tag LOCUS_36850 gene mprA 9681 9151 CDS product transcriptional repressor MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098427.1 protein_id gnl|my_center|LOCUS_36850 10107 9772 gene locus_tag LOCUS_36860 gene ygaH 10107 9772 CDS product L-valine transporter subunit YgaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119763.1 protein_id gnl|my_center|LOCUS_36860 10831 10097 gene locus_tag LOCUS_36870 gene ygaZ 10831 10097 CDS product L-valine exporter subunit YgaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445658.1 protein_id gnl|my_center|LOCUS_36870 12140 10956 gene locus_tag LOCUS_36880 12140 10956 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098426.1 protein_id gnl|my_center|LOCUS_36880 13413 12418 gene locus_tag LOCUS_36890 gene proX 13413 12418 CDS product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098425.1 protein_id gnl|my_center|LOCUS_36890 14545 13481 gene locus_tag LOCUS_36900 gene proW 14545 13481 CDS product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370072.1 protein_id gnl|my_center|LOCUS_36900 15740 14538 gene locus_tag LOCUS_36910 gene proV 15740 14538 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098423.1 protein_id gnl|my_center|LOCUS_36910 17140 16178 gene locus_tag LOCUS_36920 gene nrdF 17140 16178 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098422.1 protein_id gnl|my_center|LOCUS_36920 19268 17151 gene locus_tag LOCUS_36930 gene nrdE 19268 17151 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098421.1 protein_id gnl|my_center|LOCUS_36930 19678 19268 gene locus_tag LOCUS_36940 gene nrdI 19678 19268 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098420.1 protein_id gnl|my_center|LOCUS_36940 19860 19675 gene locus_tag LOCUS_36950 gene nrdH 19860 19675 CDS product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028873.1 protein_id gnl|my_center|LOCUS_36950 20532 20101 gene locus_tag LOCUS_36960 20532 20101 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209797.1 protein_id gnl|my_center|LOCUS_36960 20621 21967 gene locus_tag LOCUS_36970 20621 21967 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138430.1 protein_id gnl|my_center|LOCUS_36970 22330 22004 gene locus_tag LOCUS_36980 22330 22004 CDS product DUF883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519557.1 protein_id gnl|my_center|LOCUS_36980 22492 22836 gene locus_tag LOCUS_36990 22492 22836 CDS product DUF2002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281304.1 protein_id gnl|my_center|LOCUS_36990 23302 22853 gene locus_tag LOCUS_37000 gene alaE 23302 22853 CDS product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098416.1 protein_id gnl|my_center|LOCUS_37000 23783 23604 gene locus_tag LOCUS_37010 23783 23604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098412.1 protein_id gnl|my_center|LOCUS_37010 24016 24174 gene locus_tag LOCUS_37020 24016 24174 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705362.1 protein_id gnl|my_center|LOCUS_37020 25875 24217 gene locus_tag LOCUS_37030 25875 24217 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096858.1 protein_id gnl|my_center|LOCUS_37030 27433 26009 gene locus_tag LOCUS_37040 27433 26009 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223883297.1 protein_id gnl|my_center|LOCUS_37040 27611 29413 gene locus_tag LOCUS_37050 27611 29413 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095767.1 protein_id gnl|my_center|LOCUS_37050 29522 31123 gene locus_tag LOCUS_37060 29522 31123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 31445 33067 gene locus_tag LOCUS_37070 31445 33067 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704284.1 protein_id gnl|my_center|LOCUS_37070 33067 33615 gene locus_tag LOCUS_37080 33067 33615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 33608 41971 gene locus_tag LOCUS_37090 33608 41971 CDS product hemagglutinin repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224144836.1 protein_id gnl|my_center|LOCUS_37090 41980 42342 gene locus_tag LOCUS_37100 41980 42342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 42495 42665 gene locus_tag LOCUS_37110 42495 42665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 44032 43169 gene locus_tag LOCUS_37120 44032 43169 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267248.1 protein_id gnl|my_center|LOCUS_37120 44107 45039 gene locus_tag LOCUS_37130 44107 45039 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104668.1 protein_id gnl|my_center|LOCUS_37130 46239 45058 gene locus_tag LOCUS_37140 gene nhaA 46239 45058 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095215.1 protein_id gnl|my_center|LOCUS_37140 46901 48427 gene locus_tag LOCUS_37150 46901 48427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 48746 51319 gene locus_tag LOCUS_37160 48746 51319 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096775.1 protein_id gnl|my_center|LOCUS_37160 51655 53193 gene locus_tag LOCUS_37170 51655 53193 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816617.1 protein_id gnl|my_center|LOCUS_37170 53577 53954 gene locus_tag LOCUS_37180 53577 53954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 54349 54573 gene locus_tag LOCUS_37190 54349 54573 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975469.1 protein_id gnl|my_center|LOCUS_37190 55216 54620 gene locus_tag LOCUS_37200 55216 54620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 56384 55209 gene locus_tag LOCUS_37210 56384 55209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 57410 56385 gene locus_tag LOCUS_37220 57410 56385 CDS product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210713.1 protein_id gnl|my_center|LOCUS_37220 58272 57952 gene locus_tag LOCUS_37230 gene ypjF 58272 57952 CDS product type IV toxin-antitoxin system toxin YpjF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094400.1 protein_id gnl|my_center|LOCUS_37230 58627 58304 gene locus_tag LOCUS_37240 58627 58304 CDS product type IV toxin-antitoxin system YeeU family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878136.1 protein_id gnl|my_center|LOCUS_37240 58869 58648 gene locus_tag LOCUS_37250 58869 58648 CDS product DUF987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691994.1 protein_id gnl|my_center|LOCUS_37250 59351 58878 gene locus_tag LOCUS_37260 gene radC 59351 58878 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703840.1 protein_id gnl|my_center|LOCUS_37260 60202 59384 gene locus_tag LOCUS_37270 60202 59384 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101824524.1 protein_id gnl|my_center|LOCUS_37270 60633 61397 gene locus_tag LOCUS_37280 60633 61397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 63392 64204 gene locus_tag LOCUS_37290 63392 64204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 64896 64534 gene locus_tag LOCUS_37300 64896 64534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 65372 64932 gene locus_tag LOCUS_37310 65372 64932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 66070 65384 gene locus_tag LOCUS_37320 66070 65384 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189409.1 protein_id gnl|my_center|LOCUS_37320 66827 66090 gene locus_tag LOCUS_37330 66827 66090 CDS product DUF3944 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323695.1 protein_id gnl|my_center|LOCUS_37330 67546 66968 gene locus_tag LOCUS_37340 67546 66968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 69226 68168 gene locus_tag LOCUS_37350 69226 68168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098167.1 protein_id gnl|my_center|LOCUS_37350 69870 69655 gene locus_tag LOCUS_37360 gene alpA 69870 69655 CDS product DNA-binding transcriptional activator AlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065343.1 protein_id gnl|my_center|LOCUS_37360 70062 70862 gene locus_tag LOCUS_37370 70062 70862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 74193 70990 gene locus_tag LOCUS_37380 74193 70990 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053708.1 protein_id gnl|my_center|LOCUS_37380 74561 75877 gene locus_tag LOCUS_37390 74561 75877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 75870 76565 gene locus_tag LOCUS_37400 75870 76565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 76549 78900 gene locus_tag LOCUS_37410 76549 78900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 80384 79143 gene locus_tag LOCUS_37420 80384 79143 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101723.1 protein_id gnl|my_center|LOCUS_37420 80950 80588 gene locus_tag LOCUS_tm00010 80950 80588 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 82015 82242 gene locus_tag LOCUS_37430 82015 82242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 82269 93860 gene locus_tag LOCUS_37440 82269 93860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 93939 95279 gene locus_tag LOCUS_37450 93939 95279 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090493.1 protein_id gnl|my_center|LOCUS_37450 95303 97435 gene locus_tag LOCUS_37460 95303 97435 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096691.1 protein_id gnl|my_center|LOCUS_37460 97446 98615 gene locus_tag LOCUS_37470 97446 98615 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208471.1 protein_id gnl|my_center|LOCUS_37470 99350 98823 gene locus_tag LOCUS_37480 gene smpB 99350 98823 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518569.1 protein_id gnl|my_center|LOCUS_37480 99461 99898 gene locus_tag LOCUS_37490 99461 99898 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502504.1 protein_id gnl|my_center|LOCUS_37490 99888 100184 gene locus_tag LOCUS_37500 99888 100184 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117838.1 protein_id gnl|my_center|LOCUS_37500 100596 100255 gene locus_tag LOCUS_37510 gene bamE 100596 100255 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703201.1 protein_id gnl|my_center|LOCUS_37510 102533 100872 gene locus_tag LOCUS_37520 gene recN 102533 100872 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880915.1 protein_id gnl|my_center|LOCUS_37520 103497 102619 gene locus_tag LOCUS_37530 gene nadK 103497 102619 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059176.1 protein_id gnl|my_center|LOCUS_37530 103459 103626 gene locus_tag LOCUS_37540 103459 103626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 103619 104212 gene locus_tag LOCUS_37550 gene grpE 103619 104212 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098354.1 protein_id gnl|my_center|LOCUS_37550 105580 104294 gene locus_tag LOCUS_37560 105580 104294 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028086.1 protein_id gnl|my_center|LOCUS_37560 106389 105598 gene locus_tag LOCUS_37570 106389 105598 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001537507.1 protein_id gnl|my_center|LOCUS_37570 106555 107916 gene locus_tag LOCUS_37580 gene ffh 106555 107916 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098351.1 protein_id gnl|my_center|LOCUS_37580 108031 108279 gene locus_tag LOCUS_37590 gene rpsP 108031 108279 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256453.1 protein_id gnl|my_center|LOCUS_37590 108298 108846 gene locus_tag LOCUS_37600 gene rimM 108298 108846 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043266.1 protein_id gnl|my_center|LOCUS_37600 108891 109631 gene locus_tag LOCUS_37610 gene trmD 108891 109631 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264777.1 protein_id gnl|my_center|LOCUS_37610 109699 110046 gene locus_tag LOCUS_37620 gene rplS 109699 110046 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914145.1 protein_id gnl|my_center|LOCUS_37620 110165 110590 gene locus_tag LOCUS_37630 110165 110590 CDS product DUF2946 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098349.1 protein_id gnl|my_center|LOCUS_37630 110647 112005 gene locus_tag LOCUS_37640 110647 112005 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098348.1 protein_id gnl|my_center|LOCUS_37640 112943 112002 gene locus_tag LOCUS_37650 112943 112002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 113463 113089 gene locus_tag LOCUS_37660 113463 113089 CDS product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098344.1 protein_id gnl|my_center|LOCUS_37660 113681 114751 gene locus_tag LOCUS_37670 gene aroF 113681 114751 CDS product 3-deoxy-7-phosphoheptulonate synthase AroF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098343.1 protein_id gnl|my_center|LOCUS_37670 114761 115882 gene locus_tag LOCUS_37680 gene tyrA 114761 115882 CDS product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098342.1 protein_id gnl|my_center|LOCUS_37680 115952 116824 gene locus_tag LOCUS_37690 115952 116824 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098341.1 protein_id gnl|my_center|LOCUS_37690 117981 116821 gene locus_tag LOCUS_37700 gene pheA 117981 116821 CDS product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098340.1 protein_id gnl|my_center|LOCUS_37700 118595 118257 gene locus_tag LOCUS_37710 gene raiA 118595 118257 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178449.1 protein_id gnl|my_center|LOCUS_37710 119602 118865 gene locus_tag LOCUS_37720 gene bamD 119602 118865 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197686.1 protein_id gnl|my_center|LOCUS_37720 119736 120716 gene locus_tag LOCUS_37730 gene rluD 119736 120716 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370269.1 protein_id gnl|my_center|LOCUS_37730 120713 121444 gene locus_tag LOCUS_37740 gene yfiH 120713 121444 CDS product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992642.1 protein_id gnl|my_center|LOCUS_37740 121578 124151 gene locus_tag LOCUS_37750 gene clpB 121578 124151 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235094.1 protein_id gnl|my_center|LOCUS_37750 >Feature sequence13 29 104 gene locus_tag LOCUS_t00480 29 104 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1036 215 gene locus_tag LOCUS_37760 gene hdfR 1036 215 CDS product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379246.1 protein_id gnl|my_center|LOCUS_37760 1155 1493 gene locus_tag LOCUS_37770 gene maoP 1155 1493 CDS product macrodomain Ori organization protein MaoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841001.1 protein_id gnl|my_center|LOCUS_37770 3040 1520 gene locus_tag LOCUS_37780 3040 1520 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099289.1 protein_id gnl|my_center|LOCUS_37780 3618 5264 gene locus_tag LOCUS_37790 gene ilvG 3618 5264 CDS product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099288.1 protein_id gnl|my_center|LOCUS_37790 5261 5524 gene locus_tag LOCUS_37800 gene ilvM 5261 5524 CDS product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860184.1 protein_id gnl|my_center|LOCUS_37800 5542 6471 gene locus_tag LOCUS_37810 gene ilvE 5542 6471 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208528.1 protein_id gnl|my_center|LOCUS_37810 6625 8475 gene locus_tag LOCUS_37820 gene ilvD 6625 8475 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127391.1 protein_id gnl|my_center|LOCUS_37820 8475 10022 gene locus_tag LOCUS_37830 gene ilvA 8475 10022 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833732.1 protein_id gnl|my_center|LOCUS_37830 11794 10076 gene locus_tag LOCUS_37840 11794 10076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 12926 11775 gene locus_tag LOCUS_37850 12926 11775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 13356 12964 gene locus_tag LOCUS_37860 13356 12964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 14633 13353 gene locus_tag LOCUS_37870 14633 13353 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021211.1 protein_id gnl|my_center|LOCUS_37870 15789 14890 gene locus_tag LOCUS_37880 gene ilvY 15789 14890 CDS product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099284.1 protein_id gnl|my_center|LOCUS_37880 15945 17420 gene locus_tag LOCUS_37890 gene ilvC 15945 17420 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703965.1 protein_id gnl|my_center|LOCUS_37890 17821 17561 gene locus_tag LOCUS_37900 gene ppiC 17821 17561 CDS product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096806.1 protein_id gnl|my_center|LOCUS_37900 17928 19949 gene locus_tag LOCUS_37910 gene rep 17928 19949 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099281.1 protein_id gnl|my_center|LOCUS_37910 21535 20051 gene locus_tag LOCUS_37920 gene gppA 21535 20051 CDS product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099280.1 protein_id gnl|my_center|LOCUS_37920 22815 21547 gene locus_tag LOCUS_37930 gene rhlB 22815 21547 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047509.1 protein_id gnl|my_center|LOCUS_37930 22960 23289 gene locus_tag LOCUS_37940 gene trxA 22960 23289 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004386384.1 protein_id gnl|my_center|LOCUS_37940 23635 24894 gene locus_tag LOCUS_37950 gene rho 23635 24894 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054528.1 protein_id gnl|my_center|LOCUS_37950 25139 26242 gene locus_tag LOCUS_37960 gene wecA 25139 26242 CDS product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050960.1 protein_id gnl|my_center|LOCUS_37960 26256 27302 gene locus_tag LOCUS_37970 gene wzzE 26256 27302 CDS product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099277.1 protein_id gnl|my_center|LOCUS_37970 27360 28490 gene locus_tag LOCUS_37980 gene wecB 27360 28490 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306792.1 protein_id gnl|my_center|LOCUS_37980 28487 29749 gene locus_tag LOCUS_37990 gene wecC 28487 29749 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099275.1 protein_id gnl|my_center|LOCUS_37990 29749 30420 gene locus_tag LOCUS_38000 gene rffC 29749 30420 CDS product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145189.1 protein_id gnl|my_center|LOCUS_38000 30425 31555 gene locus_tag LOCUS_38010 gene rffA 30425 31555 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099273.1 protein_id gnl|my_center|LOCUS_38010 31557 32807 gene locus_tag LOCUS_38020 gene wzxE 31557 32807 CDS product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050302.1 protein_id gnl|my_center|LOCUS_38020 32804 33880 gene locus_tag LOCUS_38030 32804 33880 CDS product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099271.1 protein_id gnl|my_center|LOCUS_38030 33877 35229 gene locus_tag LOCUS_38040 gene wzyE 33877 35229 CDS product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099270.1 protein_id gnl|my_center|LOCUS_38040 35244 35984 gene locus_tag LOCUS_38050 gene wecG 35244 35984 CDS product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064040.1 protein_id gnl|my_center|LOCUS_38050 36236 37621 gene locus_tag LOCUS_38060 36236 37621 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774735.1 protein_id gnl|my_center|LOCUS_38060 37734 37810 gene locus_tag LOCUS_t00490 37734 37810 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 37877 37952 gene locus_tag LOCUS_t00500 37877 37952 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 37978 38063 gene locus_tag LOCUS_t00510 37978 38063 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 38101 38177 gene locus_tag LOCUS_t00520 38101 38177 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 40034 38838 gene locus_tag LOCUS_38070 gene hemY 40034 38838 CDS product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921791.1 protein_id gnl|my_center|LOCUS_38070 41206 40037 gene locus_tag LOCUS_38080 gene hemX 41206 40037 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138976.1 protein_id gnl|my_center|LOCUS_38080 41968 41228 gene locus_tag LOCUS_38090 gene hemD 41968 41228 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025500.1 protein_id gnl|my_center|LOCUS_38090 42906 41965 gene locus_tag LOCUS_38100 gene hemC 42906 41965 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099264.1 protein_id gnl|my_center|LOCUS_38100 43249 45795 gene locus_tag LOCUS_38110 gene cyaA 43249 45795 CDS product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281718.1 protein_id gnl|my_center|LOCUS_38110 46145 45825 gene locus_tag LOCUS_38120 gene cyaY 46145 45825 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999940.1 protein_id gnl|my_center|LOCUS_38120 46282 46485 gene locus_tag LOCUS_38130 46282 46485 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799903.1 protein_id gnl|my_center|LOCUS_38130 46522 47346 gene locus_tag LOCUS_38140 gene dapF 46522 47346 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160654.1 protein_id gnl|my_center|LOCUS_38140 47343 48050 gene locus_tag LOCUS_38150 47343 48050 CDS product DUF484 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099258.1 protein_id gnl|my_center|LOCUS_38150 48047 48949 gene locus_tag LOCUS_38160 gene xerC 48047 48949 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703983.1 protein_id gnl|my_center|LOCUS_38160 48949 49665 gene locus_tag LOCUS_38170 gene yigB 48949 49665 CDS product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099256.1 protein_id gnl|my_center|LOCUS_38170 49753 51915 gene locus_tag LOCUS_38180 gene uvrD 49753 51915 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383407.1 protein_id gnl|my_center|LOCUS_38180 52270 53220 gene locus_tag LOCUS_38190 gene corA 52270 53220 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501540.1 protein_id gnl|my_center|LOCUS_38190 54262 53366 gene locus_tag LOCUS_38200 gene rarD 54262 53366 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368860.1 protein_id gnl|my_center|LOCUS_38200 54787 54320 gene locus_tag LOCUS_38210 gene yigI 54787 54320 CDS product acyl-CoA thioesterase YigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099253.1 protein_id gnl|my_center|LOCUS_38210 54946 55815 gene locus_tag LOCUS_38220 gene pldA 54946 55815 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099252.1 protein_id gnl|my_center|LOCUS_38220 55883 57709 gene locus_tag LOCUS_38230 gene recQ 55883 57709 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420793.1 protein_id gnl|my_center|LOCUS_38230 57771 58391 gene locus_tag LOCUS_38240 gene rhtC 57771 58391 CDS product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703986.1 protein_id gnl|my_center|LOCUS_38240 59347 58427 gene locus_tag LOCUS_38250 59347 58427 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136031866.1 protein_id gnl|my_center|LOCUS_38250 60127 59507 gene locus_tag LOCUS_38260 gene rhtB 60127 59507 CDS product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099249.1 protein_id gnl|my_center|LOCUS_38260 60212 61228 gene locus_tag LOCUS_38270 gene pldB 60212 61228 CDS product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099248.1 protein_id gnl|my_center|LOCUS_38270 61268 62068 gene locus_tag LOCUS_38280 gene yigL 61268 62068 CDS product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099247.1 protein_id gnl|my_center|LOCUS_38280 62140 63039 gene locus_tag LOCUS_38290 gene bioP 62140 63039 CDS product biotin transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196238.1 protein_id gnl|my_center|LOCUS_38290 63880 62927 gene locus_tag LOCUS_38300 gene metR 63880 62927 CDS product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573621.1 protein_id gnl|my_center|LOCUS_38300 64116 66377 gene locus_tag LOCUS_38310 gene metE 64116 66377 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153917.1 protein_id gnl|my_center|LOCUS_38310 66856 67833 gene locus_tag LOCUS_38320 66856 67833 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173509960.1 protein_id gnl|my_center|LOCUS_38320 67846 69549 gene locus_tag LOCUS_38330 67846 69549 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971998.1 protein_id gnl|my_center|LOCUS_38330 69537 70565 gene locus_tag LOCUS_38340 69537 70565 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180938249.1 protein_id gnl|my_center|LOCUS_38340 70562 71602 gene locus_tag LOCUS_38350 70562 71602 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529322.1 protein_id gnl|my_center|LOCUS_38350 71812 73215 gene locus_tag LOCUS_38360 71812 73215 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711305.1 protein_id gnl|my_center|LOCUS_38360 73240 74985 gene locus_tag LOCUS_38370 73240 74985 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202887107.1 protein_id gnl|my_center|LOCUS_38370 75051 75776 gene locus_tag LOCUS_38380 75051 75776 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940940.1 protein_id gnl|my_center|LOCUS_38380 75793 77094 gene locus_tag LOCUS_38390 75793 77094 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017936.1 protein_id gnl|my_center|LOCUS_38390 77938 77126 gene locus_tag LOCUS_38400 77938 77126 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703993.1 protein_id gnl|my_center|LOCUS_38400 78198 78959 gene locus_tag LOCUS_38410 gene udp 78198 78959 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004181652.1 protein_id gnl|my_center|LOCUS_38410 79488 79051 gene locus_tag LOCUS_38420 79488 79051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 79973 81430 gene locus_tag LOCUS_38430 gene rmuC 79973 81430 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368848.1 protein_id gnl|my_center|LOCUS_38430 81497 82264 gene locus_tag LOCUS_38440 gene ubiE 81497 82264 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099241.1 protein_id gnl|my_center|LOCUS_38440 82278 82883 gene locus_tag LOCUS_38450 gene ubiJ 82278 82883 CDS product ubiquinone biosynthesis protein UbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099240.1 protein_id gnl|my_center|LOCUS_38450 82880 84526 gene locus_tag LOCUS_38460 gene ubiB 82880 84526 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099239.1 protein_id gnl|my_center|LOCUS_38460 84599 84850 gene locus_tag LOCUS_38470 gene tatA 84599 84850 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099238.1 protein_id gnl|my_center|LOCUS_38470 84854 85375 gene locus_tag LOCUS_38480 gene tatB 84854 85375 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459611.1 protein_id gnl|my_center|LOCUS_38480 85378 86142 gene locus_tag LOCUS_38490 gene tatC 85378 86142 CDS product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257554.1 protein_id gnl|my_center|LOCUS_38490 86185 86967 gene locus_tag LOCUS_38500 gene tatD 86185 86967 CDS product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099235.1 protein_id gnl|my_center|LOCUS_38500 87461 86973 gene locus_tag LOCUS_38510 gene rfaH 87461 86973 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099234.1 protein_id gnl|my_center|LOCUS_38510 87631 89127 gene locus_tag LOCUS_38520 gene ubiD 87631 89127 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161496900.1 protein_id gnl|my_center|LOCUS_38520 89186 89887 gene locus_tag LOCUS_38530 gene fre 89186 89887 CDS product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099232.1 protein_id gnl|my_center|LOCUS_38530 91267 90104 gene locus_tag LOCUS_38540 gene fadA 91267 90104 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438702.1 protein_id gnl|my_center|LOCUS_38540 93466 91277 gene locus_tag LOCUS_38550 gene fadB 93466 91277 CDS product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703999.1 protein_id gnl|my_center|LOCUS_38550 93655 94986 gene locus_tag LOCUS_38560 gene pepQ 93655 94986 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444529.1 protein_id gnl|my_center|LOCUS_38560 94986 95600 gene locus_tag LOCUS_38570 94986 95600 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295262.1 protein_id gnl|my_center|LOCUS_38570 95640 97091 gene locus_tag LOCUS_38580 gene trkH 95640 97091 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545686.1 protein_id gnl|my_center|LOCUS_38580 97103 97654 gene locus_tag LOCUS_38590 gene hemG 97103 97654 CDS product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099226.1 protein_id gnl|my_center|LOCUS_38590 >Feature sequence14 117 25 gene locus_tag LOCUS_t00530 117 25 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 650 465 gene locus_tag LOCUS_38600 gene csrA 650 465 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906486.1 protein_id gnl|my_center|LOCUS_38600 3520 893 gene locus_tag LOCUS_38610 gene alaS 3520 893 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098436.1 protein_id gnl|my_center|LOCUS_38610 4151 3651 gene locus_tag LOCUS_38620 gene recX 4151 3651 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703240.1 protein_id gnl|my_center|LOCUS_38620 5288 4224 gene locus_tag LOCUS_38630 gene recA 5288 4224 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963150.1 protein_id gnl|my_center|LOCUS_38630 5874 5377 gene locus_tag LOCUS_38640 gene pncC 5874 5377 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132231.1 protein_id gnl|my_center|LOCUS_38640 7110 6025 gene locus_tag LOCUS_38650 gene mltB 7110 6025 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476820.1 protein_id gnl|my_center|LOCUS_38650 7323 8288 gene locus_tag LOCUS_38660 gene gutQ 7323 8288 CDS product arabinose-5-phosphate isomerase GutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287442.1 protein_id gnl|my_center|LOCUS_38660 9799 8285 gene locus_tag LOCUS_38670 gene norR 9799 8285 CDS product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098451.1 protein_id gnl|my_center|LOCUS_38670 9986 11434 gene locus_tag LOCUS_38680 gene norV 9986 11434 CDS product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098452.1 protein_id gnl|my_center|LOCUS_38680 11431 12561 gene locus_tag LOCUS_38690 gene norW 11431 12561 CDS product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064713.1 protein_id gnl|my_center|LOCUS_38690 13680 12631 gene locus_tag LOCUS_38700 13680 12631 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420952.1 protein_id gnl|my_center|LOCUS_38700 13920 15374 gene locus_tag LOCUS_38710 gene ascF 13920 15374 CDS product PTS cellobiose/arbutin/salicin transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098459.1 protein_id gnl|my_center|LOCUS_38710 15392 16813 gene locus_tag LOCUS_38720 15392 16813 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098460.1 protein_id gnl|my_center|LOCUS_38720 17275 16931 gene locus_tag LOCUS_38730 17275 16931 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015479.1 protein_id gnl|my_center|LOCUS_38730 17454 18371 gene locus_tag LOCUS_38740 17454 18371 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703268.1 protein_id gnl|my_center|LOCUS_38740 18368 19207 gene locus_tag LOCUS_38750 gene sitB 18368 19207 CDS product iron/manganese ABC transporter ATP-binding protein SitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083163.1 protein_id gnl|my_center|LOCUS_38750 19204 20064 gene locus_tag LOCUS_38760 gene sitC 19204 20064 CDS product iron/manganese ABC transporter permease subunit SitC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370015.1 protein_id gnl|my_center|LOCUS_38760 20061 20891 gene locus_tag LOCUS_38770 gene sitD 20061 20891 CDS product iron/manganese ABC transporter permease subunit SitD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477918.1 protein_id gnl|my_center|LOCUS_38770 21187 22458 gene locus_tag LOCUS_38780 21187 22458 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097093.1 protein_id gnl|my_center|LOCUS_38780 23467 22502 gene locus_tag LOCUS_38790 23467 22502 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705307.1 protein_id gnl|my_center|LOCUS_38790 24994 23666 gene locus_tag LOCUS_38800 24994 23666 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158904.1 protein_id gnl|my_center|LOCUS_38800 25190 25984 gene locus_tag LOCUS_38810 25190 25984 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307144.1 protein_id gnl|my_center|LOCUS_38810 25992 26660 gene locus_tag LOCUS_38820 25992 26660 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243465.1 protein_id gnl|my_center|LOCUS_38820 26673 27404 gene locus_tag LOCUS_38830 26673 27404 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243284.1 protein_id gnl|my_center|LOCUS_38830 27527 28309 gene locus_tag LOCUS_38840 27527 28309 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095418.1 protein_id gnl|my_center|LOCUS_38840 28697 29314 gene locus_tag LOCUS_38850 28697 29314 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268606.1 protein_id gnl|my_center|LOCUS_38850 29478 29311 gene locus_tag LOCUS_38860 29478 29311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 29743 30729 gene locus_tag LOCUS_38870 29743 30729 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045231753.1 protein_id gnl|my_center|LOCUS_38870 30738 33227 gene locus_tag LOCUS_38880 30738 33227 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974867.1 protein_id gnl|my_center|LOCUS_38880 35004 33331 gene locus_tag LOCUS_38890 35004 33331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 36696 35266 gene locus_tag LOCUS_38900 36696 35266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 38362 37250 gene locus_tag LOCUS_38910 38362 37250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 38675 38475 gene locus_tag LOCUS_38920 38675 38475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 39038 39442 gene locus_tag LOCUS_38930 39038 39442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 40382 39486 gene locus_tag LOCUS_38940 40382 39486 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073632.1 protein_id gnl|my_center|LOCUS_38940 40797 40462 gene locus_tag LOCUS_38950 40797 40462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 40723 40908 gene locus_tag LOCUS_38960 40723 40908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 41455 40916 gene locus_tag LOCUS_38970 41455 40916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 41919 41497 gene locus_tag LOCUS_38980 41919 41497 CDS product DUF2787 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041081.1 protein_id gnl|my_center|LOCUS_38980 42164 41916 gene locus_tag LOCUS_38990 42164 41916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 42984 42496 gene locus_tag LOCUS_39000 42984 42496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 43387 43914 gene locus_tag LOCUS_39010 43387 43914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 43929 44288 gene locus_tag LOCUS_39020 43929 44288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 44319 44654 gene locus_tag LOCUS_39030 44319 44654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 44976 45719 gene locus_tag LOCUS_39040 44976 45719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 45754 47052 gene locus_tag LOCUS_39050 45754 47052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 48178 47510 gene locus_tag LOCUS_39060 48178 47510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 48609 48280 gene locus_tag LOCUS_39070 48609 48280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 49193 50458 gene locus_tag LOCUS_39080 49193 50458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 52375 51095 gene locus_tag LOCUS_39090 52375 51095 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045419493.1 protein_id gnl|my_center|LOCUS_39090 52593 55154 gene locus_tag LOCUS_39100 gene mutS 52593 55154 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703281.1 protein_id gnl|my_center|LOCUS_39100 55252 55680 gene locus_tag LOCUS_39110 gene osmC 55252 55680 CDS product peroxiredoxin OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152305.1 protein_id gnl|my_center|LOCUS_39110 56851 55859 gene locus_tag LOCUS_39120 gene rpoS 56851 55859 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081498.1 protein_id gnl|my_center|LOCUS_39120 57877 56972 gene locus_tag LOCUS_39130 gene nlpD 57877 56972 CDS product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272624.1 protein_id gnl|my_center|LOCUS_39130 57948 58130 gene locus_tag LOCUS_39140 57948 58130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 58852 58226 gene locus_tag LOCUS_39150 58852 58226 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098496.1 protein_id gnl|my_center|LOCUS_39150 59607 58846 gene locus_tag LOCUS_39160 gene surE 59607 58846 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221538.1 protein_id gnl|my_center|LOCUS_39160 60637 59588 gene locus_tag LOCUS_39170 gene truD 60637 59588 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134253.1 protein_id gnl|my_center|LOCUS_39170 61113 60634 gene locus_tag LOCUS_39180 gene ispF 61113 60634 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703296.1 protein_id gnl|my_center|LOCUS_39180 61763 61113 gene locus_tag LOCUS_39190 gene ispD 61763 61113 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098500.1 protein_id gnl|my_center|LOCUS_39190 62155 61844 gene locus_tag LOCUS_39200 gene ftsB 62155 61844 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369983.1 protein_id gnl|my_center|LOCUS_39200 62636 62313 gene locus_tag LOCUS_39210 62636 62313 CDS product DUF3561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098502.1 protein_id gnl|my_center|LOCUS_39210 63291 62686 gene locus_tag LOCUS_39220 gene cysC 63291 62686 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098503.1 protein_id gnl|my_center|LOCUS_39220 64718 63291 gene locus_tag LOCUS_39230 gene cysN 64718 63291 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098504.1 protein_id gnl|my_center|LOCUS_39230 65636 64728 gene locus_tag LOCUS_39240 gene cysD 65636 64728 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369979.1 protein_id gnl|my_center|LOCUS_39240 67061 65646 gene locus_tag LOCUS_39250 gene cysG 67061 65646 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162184003.1 protein_id gnl|my_center|LOCUS_39250 67300 68346 gene locus_tag LOCUS_39260 67300 68346 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098506.1 protein_id gnl|my_center|LOCUS_39260 68403 70203 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggtttatccccgctctcgcggggaacac 70593 70300 gene locus_tag LOCUS_39270 gene cas2e 70593 70300 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063176.1 protein_id gnl|my_center|LOCUS_39270 71513 70593 gene locus_tag LOCUS_39280 gene cas1e 71513 70593 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144875.1 protein_id gnl|my_center|LOCUS_39280 72154 71510 gene locus_tag LOCUS_39290 gene cas6e 72154 71510 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281463.1 protein_id gnl|my_center|LOCUS_39290 72888 72136 gene locus_tag LOCUS_39300 gene cas5e 72888 72136 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085058.1 protein_id gnl|my_center|LOCUS_39300 73953 72898 gene locus_tag LOCUS_39310 gene cas7e 73953 72898 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206435.1 protein_id gnl|my_center|LOCUS_39310 74533 73964 gene locus_tag LOCUS_39320 gene casB 74533 73964 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029331.1 protein_id gnl|my_center|LOCUS_39320 76099 74534 gene locus_tag LOCUS_39330 gene casA 76099 74534 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084082.1 protein_id gnl|my_center|LOCUS_39330 76220 76011 gene locus_tag LOCUS_39340 76220 76011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 78846 76615 gene locus_tag LOCUS_39350 78846 76615 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233978.1 protein_id gnl|my_center|LOCUS_39350 80203 79439 gene locus_tag LOCUS_39360 gene cysH 80203 79439 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098507.1 protein_id gnl|my_center|LOCUS_39360 82036 80324 gene locus_tag LOCUS_39370 gene cysI 82036 80324 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420501.1 protein_id gnl|my_center|LOCUS_39370 83841 82036 gene locus_tag LOCUS_39380 gene cysJ 83841 82036 CDS product NADPH-dependent assimilatory sulfite reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098509.1 protein_id gnl|my_center|LOCUS_39380 84147 84509 gene locus_tag LOCUS_39390 gene queD 84147 84509 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010434567.1 protein_id gnl|my_center|LOCUS_39390 >Feature sequence15 1064 69 gene locus_tag LOCUS_39400 1064 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 1552 1073 gene locus_tag LOCUS_39410 1552 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 5599 1556 gene locus_tag LOCUS_39420 5599 1556 CDS product cellulose biosynthesis protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994102.1 protein_id gnl|my_center|LOCUS_39420 7913 5616 gene locus_tag LOCUS_39430 gene bcsB 7913 5616 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263700.1 protein_id gnl|my_center|LOCUS_39430 10021 7910 gene locus_tag LOCUS_39440 gene bcsA 10021 7910 CDS product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770918.1 protein_id gnl|my_center|LOCUS_39440 10841 10038 gene locus_tag LOCUS_39450 10841 10038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 11380 10832 gene locus_tag LOCUS_39460 11380 10832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 12891 11857 gene locus_tag LOCUS_39470 12891 11857 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694624.1 protein_id gnl|my_center|LOCUS_39470 13202 12891 gene locus_tag LOCUS_39480 13202 12891 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005672747.1 protein_id gnl|my_center|LOCUS_39480 13510 13187 gene locus_tag LOCUS_39490 13510 13187 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661200.1 protein_id gnl|my_center|LOCUS_39490 14693 13674 gene locus_tag LOCUS_39500 gene dppF 14693 13674 CDS product dipeptide ABC transporter ATP-binding subunit DppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103568.1 protein_id gnl|my_center|LOCUS_39500 15672 14680 gene locus_tag LOCUS_39510 gene dppD 15672 14680 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094994.1 protein_id gnl|my_center|LOCUS_39510 16587 15685 gene locus_tag LOCUS_39520 gene dppC 16587 15685 CDS product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084677.1 protein_id gnl|my_center|LOCUS_39520 17616 16597 gene locus_tag LOCUS_39530 gene dppB 17616 16597 CDS product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830232.1 protein_id gnl|my_center|LOCUS_39530 19368 17788 gene locus_tag LOCUS_39540 19368 17788 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418419.1 protein_id gnl|my_center|LOCUS_39540 20253 20177 gene locus_tag LOCUS_t00540 20253 20177 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 20893 20360 gene locus_tag LOCUS_39550 gene lpfE 20893 20360 CDS product long polar fimbrial protein LpfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314219.1 protein_id gnl|my_center|LOCUS_39550 21957 20899 gene locus_tag LOCUS_39560 gene lpfD 21957 20899 CDS product long polar fimbrial protein LpfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694926.1 protein_id gnl|my_center|LOCUS_39560 24503 21975 gene locus_tag LOCUS_39570 gene lpfC 24503 21975 CDS product outer membrane usher protein LpfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558680.1 protein_id gnl|my_center|LOCUS_39570 25221 24526 gene locus_tag LOCUS_39580 gene lpfB 25221 24526 CDS product long polar fimbrial biogenesis chaperone LpfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836900.1 protein_id gnl|my_center|LOCUS_39580 25727 25305 gene locus_tag LOCUS_39590 gene lpfA1 25727 25305 CDS product long polar fimbria major subunit LpfA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758167.1 protein_id gnl|my_center|LOCUS_39590 27809 26139 gene locus_tag LOCUS_39600 gene eptB 27809 26139 CDS product kdo(2)-lipid A phosphoethanolamine 7''-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069557.1 protein_id gnl|my_center|LOCUS_39600 28478 28047 gene locus_tag LOCUS_39610 28478 28047 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095463.1 protein_id gnl|my_center|LOCUS_39610 29764 28550 gene locus_tag LOCUS_39620 29764 28550 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094986.1 protein_id gnl|my_center|LOCUS_39620 30690 29998 gene locus_tag LOCUS_39630 30690 29998 CDS product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637074.1 protein_id gnl|my_center|LOCUS_39630 30843 31424 gene locus_tag LOCUS_39640 gene tag 30843 31424 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094984.1 protein_id gnl|my_center|LOCUS_39640 31402 31842 gene locus_tag LOCUS_39650 31402 31842 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094983.1 protein_id gnl|my_center|LOCUS_39650 33898 31811 gene locus_tag LOCUS_39660 gene bisC 33898 31811 CDS product biotin sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185340.1 protein_id gnl|my_center|LOCUS_39660 34299 34961 gene locus_tag LOCUS_39670 34299 34961 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747548.1 protein_id gnl|my_center|LOCUS_39670 35201 36220 gene locus_tag LOCUS_39680 35201 36220 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094979.1 protein_id gnl|my_center|LOCUS_39680 36322 37071 gene locus_tag LOCUS_39690 36322 37071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703772.1 protein_id gnl|my_center|LOCUS_39690 37076 38017 gene locus_tag LOCUS_39700 37076 38017 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094977.1 protein_id gnl|my_center|LOCUS_39700 38166 39446 gene locus_tag LOCUS_39710 38166 39446 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094976.1 protein_id gnl|my_center|LOCUS_39710 39482 40456 gene locus_tag LOCUS_39720 gene ghrB 39482 40456 CDS product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369217.1 protein_id gnl|my_center|LOCUS_39720 40530 41255 gene locus_tag LOCUS_39730 40530 41255 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703823.1 protein_id gnl|my_center|LOCUS_39730 42595 41186 gene locus_tag LOCUS_39740 42595 41186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 44217 42595 gene locus_tag LOCUS_39750 44217 42595 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861822.1 protein_id gnl|my_center|LOCUS_39750 45260 44550 gene locus_tag LOCUS_39760 45260 44550 CDS product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094974.1 protein_id gnl|my_center|LOCUS_39760 45636 45929 gene locus_tag LOCUS_39770 45636 45929 CDS product HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455790.1 protein_id gnl|my_center|LOCUS_39770 48085 46016 gene locus_tag LOCUS_39780 gene glyS 48085 46016 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703776.1 protein_id gnl|my_center|LOCUS_39780 49006 48095 gene locus_tag LOCUS_39790 gene glyQ 49006 48095 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168544.1 protein_id gnl|my_center|LOCUS_39790 49434 49132 gene locus_tag LOCUS_39800 49434 49132 CDS product YsaB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094969.1 protein_id gnl|my_center|LOCUS_39800 49576 50613 gene locus_tag LOCUS_39810 49576 50613 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094968.1 protein_id gnl|my_center|LOCUS_39810 51526 50606 gene locus_tag LOCUS_39820 51526 50606 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094967.1 protein_id gnl|my_center|LOCUS_39820 52065 51523 gene locus_tag LOCUS_39830 52065 51523 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094966.1 protein_id gnl|my_center|LOCUS_39830 52144 52308 gene locus_tag LOCUS_39840 52144 52308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 53781 52327 gene locus_tag LOCUS_39850 gene xylB 53781 52327 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275378.1 protein_id gnl|my_center|LOCUS_39850 55158 53836 gene locus_tag LOCUS_39860 gene xylA 55158 53836 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830210.1 protein_id gnl|my_center|LOCUS_39860 55613 56518 gene locus_tag LOCUS_39870 gene xylF 55613 56518 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094963.1 protein_id gnl|my_center|LOCUS_39870 56735 58276 gene locus_tag LOCUS_39880 56735 58276 CDS product xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094962.1 protein_id gnl|my_center|LOCUS_39880 58254 59435 gene locus_tag LOCUS_39890 gene gguB 58254 59435 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094961.1 protein_id gnl|my_center|LOCUS_39890 59550 60728 gene locus_tag LOCUS_39900 59550 60728 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094960.1 protein_id gnl|my_center|LOCUS_39900 61333 60761 gene locus_tag LOCUS_39910 61333 60761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 61901 63931 gene locus_tag LOCUS_39920 61901 63931 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418400.1 protein_id gnl|my_center|LOCUS_39920 64177 65433 gene locus_tag LOCUS_39930 gene avtA 64177 65433 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094957.1 protein_id gnl|my_center|LOCUS_39930 65963 66235 gene locus_tag LOCUS_39940 65963 66235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 66190 67101 gene locus_tag LOCUS_39950 66190 67101 CDS product collagen-like triple helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815467.1 protein_id gnl|my_center|LOCUS_39950 67192 68907 gene locus_tag LOCUS_39960 67192 68907 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175308.1 protein_id gnl|my_center|LOCUS_39960 69742 68927 gene locus_tag LOCUS_39970 69742 68927 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891824.1 protein_id gnl|my_center|LOCUS_39970 69998 71395 gene locus_tag LOCUS_39980 69998 71395 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204802.1 protein_id gnl|my_center|LOCUS_39980 71406 73361 gene locus_tag LOCUS_39990 71406 73361 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026861.1 protein_id gnl|my_center|LOCUS_39990 73465 73776 gene locus_tag LOCUS_40000 73465 73776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 74176 73760 gene locus_tag LOCUS_40010 74176 73760 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094943.1 protein_id gnl|my_center|LOCUS_40010 74434 74192 gene locus_tag LOCUS_40020 74434 74192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 >Feature sequence16 1983 304 gene locus_tag LOCUS_40030 gene bcsG 1983 304 CDS product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099223.1 protein_id gnl|my_center|LOCUS_40030 2173 1976 gene locus_tag LOCUS_40040 gene bcsF 2173 1976 CDS product cellulose biosynthesis protein BcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988321.1 protein_id gnl|my_center|LOCUS_40040 3729 2170 gene locus_tag LOCUS_40050 gene bcsE 3729 2170 CDS product cellulose biosynthesis c-di-GMP-binding protein BcsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099221.1 protein_id gnl|my_center|LOCUS_40050 3901 4089 gene locus_tag LOCUS_40060 gene bcsR 3901 4089 CDS product cellulose biosynthesis protein BcsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099220.1 protein_id gnl|my_center|LOCUS_40060 4101 4850 gene locus_tag LOCUS_40070 gene bcsQ 4101 4850 CDS product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996130.1 protein_id gnl|my_center|LOCUS_40070 4847 7465 gene locus_tag LOCUS_40080 gene bcsA 4847 7465 CDS product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099218.1 protein_id gnl|my_center|LOCUS_40080 7476 9902 gene locus_tag LOCUS_40090 gene bcsB 7476 9902 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099217.1 protein_id gnl|my_center|LOCUS_40090 9909 11006 gene locus_tag LOCUS_40100 gene bcsZ 9909 11006 CDS product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988805.1 protein_id gnl|my_center|LOCUS_40100 10994 14521 gene locus_tag LOCUS_40110 gene bcsC 10994 14521 CDS product cellulose synthase complex outer membrane protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225112.1 protein_id gnl|my_center|LOCUS_40110 14647 16653 gene locus_tag LOCUS_40120 gene hmsP 14647 16653 CDS product biofilm formation regulator HmsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099214.1 protein_id gnl|my_center|LOCUS_40120 16810 18096 gene locus_tag LOCUS_40130 gene dctA 16810 18096 CDS product C4-dicarboxylate transporter DctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858232.1 protein_id gnl|my_center|LOCUS_40130 18284 19777 gene locus_tag LOCUS_40140 18284 19777 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099212.1 protein_id gnl|my_center|LOCUS_40140 20878 19949 gene locus_tag LOCUS_40150 gene kdgK 20878 19949 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306595.1 protein_id gnl|my_center|LOCUS_40150 21114 21884 gene locus_tag LOCUS_40160 gene pdeH 21114 21884 CDS product cyclic-guanylate-specific phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099209.1 protein_id gnl|my_center|LOCUS_40160 21978 24038 gene locus_tag LOCUS_40170 21978 24038 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296794.1 protein_id gnl|my_center|LOCUS_40170 24136 24002 gene locus_tag LOCUS_40180 24136 24002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 25570 24248 gene locus_tag LOCUS_40190 25570 24248 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149006.1 protein_id gnl|my_center|LOCUS_40190 26866 25832 gene locus_tag LOCUS_40200 gene yhjD 26866 25832 CDS product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099206.1 protein_id gnl|my_center|LOCUS_40200 27821 26919 gene locus_tag LOCUS_40210 27821 26919 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099205.1 protein_id gnl|my_center|LOCUS_40210 27941 28699 gene locus_tag LOCUS_40220 27941 28699 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099204.1 protein_id gnl|my_center|LOCUS_40220 29444 28758 gene locus_tag LOCUS_40230 29444 28758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 31429 29441 gene locus_tag LOCUS_40240 31429 29441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 31966 31565 gene locus_tag LOCUS_40250 gene ydeI 31966 31565 CDS product YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671737.1 protein_id gnl|my_center|LOCUS_40250 32599 32042 gene locus_tag LOCUS_40260 32599 32042 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703751.1 protein_id gnl|my_center|LOCUS_40260 32707 34302 gene locus_tag LOCUS_40270 32707 34302 CDS product STY4199 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099200.1 protein_id gnl|my_center|LOCUS_40270 35987 34338 gene locus_tag LOCUS_40280 35987 34338 CDS product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099199.1 protein_id gnl|my_center|LOCUS_40280 36373 37452 gene locus_tag LOCUS_40290 36373 37452 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047054668.1 protein_id gnl|my_center|LOCUS_40290 37911 37486 gene locus_tag LOCUS_40300 37911 37486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 39360 38032 gene locus_tag LOCUS_40310 39360 38032 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948070.1 protein_id gnl|my_center|LOCUS_40310 40910 39372 gene locus_tag LOCUS_40320 40910 39372 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948069.1 protein_id gnl|my_center|LOCUS_40320 41174 41872 gene locus_tag LOCUS_40330 41174 41872 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094792.1 protein_id gnl|my_center|LOCUS_40330 43273 41921 gene locus_tag LOCUS_40340 gene gorA 43273 41921 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099198.1 protein_id gnl|my_center|LOCUS_40340 44189 43347 gene locus_tag LOCUS_40350 44189 43347 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703746.1 protein_id gnl|my_center|LOCUS_40350 44151 44336 gene locus_tag LOCUS_40360 44151 44336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 44363 46405 gene locus_tag LOCUS_40370 gene prlC 44363 46405 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099196.1 protein_id gnl|my_center|LOCUS_40370 46413 47165 gene locus_tag LOCUS_40380 gene rsmJ 46413 47165 CDS product 16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686620.1 protein_id gnl|my_center|LOCUS_40380 47755 47318 gene locus_tag LOCUS_40390 gene uspA 47755 47318 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004145166.1 protein_id gnl|my_center|LOCUS_40390 48149 48484 gene locus_tag LOCUS_40400 gene uspB 48149 48484 CDS product universal stress protein UspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861224.1 protein_id gnl|my_center|LOCUS_40400 50044 48548 gene locus_tag LOCUS_40410 gene pitA 50044 48548 CDS product inorganic phosphate transporter PitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099193.1 protein_id gnl|my_center|LOCUS_40410 50275 51471 gene locus_tag LOCUS_40420 50275 51471 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420964.1 protein_id gnl|my_center|LOCUS_40420 51796 51491 gene locus_tag LOCUS_40430 51796 51491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 52610 51798 gene locus_tag LOCUS_40440 52610 51798 CDS product DUF4225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211601.1 protein_id gnl|my_center|LOCUS_40440 54586 53477 gene locus_tag LOCUS_40450 54586 53477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 55029 54607 gene locus_tag LOCUS_40460 55029 54607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 56056 55010 gene locus_tag LOCUS_40470 56056 55010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 >Feature sequence17 336 1253 gene locus_tag LOCUS_40480 gene nac 336 1253 CDS product nitrogen assimilation transcriptional regulator NAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010432103.1 protein_id gnl|my_center|LOCUS_40480 1354 2304 gene locus_tag LOCUS_40490 gene cbl 1354 2304 CDS product HTH-type transcriptional regulator Cbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705998.1 protein_id gnl|my_center|LOCUS_40490 4783 2342 gene locus_tag LOCUS_40500 gene glgP 4783 2342 CDS product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993423.1 protein_id gnl|my_center|LOCUS_40500 6219 4936 gene locus_tag LOCUS_40510 gene glgC 6219 4936 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253975.1 protein_id gnl|my_center|LOCUS_40510 6842 6767 gene locus_tag LOCUS_t00550 6842 6767 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 7740 6943 gene locus_tag LOCUS_40520 gene mtfA 7740 6943 CDS product DgsA anti-repressor MtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029881844.1 protein_id gnl|my_center|LOCUS_40520 7834 7923 gene locus_tag LOCUS_t00560 7834 7923 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9006 8017 gene locus_tag LOCUS_40530 9006 8017 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533600.1 protein_id gnl|my_center|LOCUS_40530 9237 9010 gene locus_tag LOCUS_40540 9237 9010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 10127 9300 gene locus_tag LOCUS_40550 10127 9300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 10798 10124 gene locus_tag LOCUS_40560 10798 10124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011011060.1 protein_id gnl|my_center|LOCUS_40560 11087 10791 gene locus_tag LOCUS_40570 11087 10791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 11662 11132 gene locus_tag LOCUS_40580 11662 11132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 12189 11659 gene locus_tag LOCUS_40590 gene yfdR 12189 11659 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001603282.1 protein_id gnl|my_center|LOCUS_40590 13149 12325 gene locus_tag LOCUS_40600 13149 12325 CDS product DUF2303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081287.1 protein_id gnl|my_center|LOCUS_40600 13550 13188 gene locus_tag LOCUS_40610 gene yfdP 13550 13188 CDS product protein YfdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135680.1 protein_id gnl|my_center|LOCUS_40610 14932 14636 gene locus_tag LOCUS_40620 14932 14636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 15962 15264 gene locus_tag LOCUS_40630 15962 15264 CDS product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768035.1 protein_id gnl|my_center|LOCUS_40630 16031 16261 gene locus_tag LOCUS_40640 16031 16261 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067727.1 protein_id gnl|my_center|LOCUS_40640 16281 16742 gene locus_tag LOCUS_40650 gene ymfL 16281 16742 CDS product protein YmfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515837.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40650 16982 17149 gene locus_tag LOCUS_40660 16982 17149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 17146 18006 gene locus_tag LOCUS_40670 17146 18006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 18003 19253 gene locus_tag LOCUS_40680 18003 19253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 19250 19570 gene locus_tag LOCUS_40690 19250 19570 CDS product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210170.1 protein_id gnl|my_center|LOCUS_40690 19567 19959 gene locus_tag LOCUS_40700 19567 19959 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767129.1 protein_id gnl|my_center|LOCUS_40700 19972 20664 gene locus_tag LOCUS_40710 19972 20664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 20709 21650 gene locus_tag LOCUS_40720 20709 21650 CDS product DUF968 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001360050.1 protein_id gnl|my_center|LOCUS_40720 21671 22501 gene locus_tag LOCUS_40730 21671 22501 CDS product antitermination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705710.1 protein_id gnl|my_center|LOCUS_40730 22909 23337 gene locus_tag LOCUS_40740 22909 23337 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466957.1 protein_id gnl|my_center|LOCUS_40740 23337 23489 gene locus_tag LOCUS_40750 23337 23489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 23767 23843 gene locus_tag LOCUS_t00570 23767 23843 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 23965 24153 gene locus_tag LOCUS_40760 23965 24153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 24363 24743 gene locus_tag LOCUS_40770 24363 24743 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294876.1 protein_id gnl|my_center|LOCUS_40770 24730 25014 gene locus_tag LOCUS_40780 24730 25014 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705707.1 protein_id gnl|my_center|LOCUS_40780 25011 25637 gene locus_tag LOCUS_40790 25011 25637 CDS product glycoside hydrolase family 19 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403797.1 protein_id gnl|my_center|LOCUS_40790 25634 25984 gene locus_tag LOCUS_40800 25634 25984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 25959 26099 gene locus_tag LOCUS_40810 25959 26099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 26245 26595 gene locus_tag LOCUS_40820 26245 26595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 26935 26735 gene locus_tag LOCUS_40830 26935 26735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 27904 28242 gene locus_tag LOCUS_40840 27904 28242 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072872.1 protein_id gnl|my_center|LOCUS_40840 28366 28830 gene locus_tag LOCUS_40850 28366 28830 CDS product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938796.1 protein_id gnl|my_center|LOCUS_40850 28784 30529 gene locus_tag LOCUS_40860 28784 30529 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443313.1 protein_id gnl|my_center|LOCUS_40860 30529 31860 gene locus_tag LOCUS_40870 30529 31860 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072869.1 protein_id gnl|my_center|LOCUS_40870 31866 32714 gene locus_tag LOCUS_40880 31866 32714 CDS product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337208.1 protein_id gnl|my_center|LOCUS_40880 32724 33941 gene locus_tag LOCUS_40890 32724 33941 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072867.1 protein_id gnl|my_center|LOCUS_40890 33988 34272 gene locus_tag LOCUS_40900 33988 34272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 34282 34611 gene locus_tag LOCUS_40910 34282 34611 CDS product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927711.1 protein_id gnl|my_center|LOCUS_40910 34613 35002 gene locus_tag LOCUS_40920 34613 35002 CDS product phage head closure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702391.1 protein_id gnl|my_center|LOCUS_40920 34995 35501 gene locus_tag LOCUS_40930 34995 35501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224835.1 protein_id gnl|my_center|LOCUS_40930 35498 36058 gene locus_tag LOCUS_40940 35498 36058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779294.1 protein_id gnl|my_center|LOCUS_40940 36062 36250 gene locus_tag LOCUS_40950 36062 36250 CDS product DUF2635 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497751.1 protein_id gnl|my_center|LOCUS_40950 36250 37743 gene locus_tag LOCUS_40960 36250 37743 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155695.1 protein_id gnl|my_center|LOCUS_40960 37743 38099 gene locus_tag LOCUS_40970 37743 38099 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090992.1 protein_id gnl|my_center|LOCUS_40970 38096 38359 gene locus_tag LOCUS_40980 38096 38359 CDS product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571713.1 protein_id gnl|my_center|LOCUS_40980 38504 40402 gene locus_tag LOCUS_40990 38504 40402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 40421 40915 gene locus_tag LOCUS_41000 40421 40915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 40961 42358 gene locus_tag LOCUS_41010 40961 42358 CDS product DNA circularization N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208631158.1 protein_id gnl|my_center|LOCUS_41010 42355 43428 gene locus_tag LOCUS_41020 42355 43428 CDS product baseplate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999486.1 protein_id gnl|my_center|LOCUS_41020 43428 43982 gene locus_tag LOCUS_41030 43428 43982 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259080.1 protein_id gnl|my_center|LOCUS_41030 43982 44395 gene locus_tag LOCUS_41040 43982 44395 CDS product phage GP46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424732.1 protein_id gnl|my_center|LOCUS_41040 44388 45455 gene locus_tag LOCUS_41050 44388 45455 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785298.1 protein_id gnl|my_center|LOCUS_41050 45446 46027 gene locus_tag LOCUS_41060 45446 46027 CDS product YmfQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383564.1 protein_id gnl|my_center|LOCUS_41060 >Feature sequence18 252 635 gene locus_tag LOCUS_41070 gene secE 252 635 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275691.1 protein_id gnl|my_center|LOCUS_41070 637 1182 gene locus_tag LOCUS_41080 gene nusG 637 1182 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862341.1 protein_id gnl|my_center|LOCUS_41080 1339 1767 gene locus_tag LOCUS_41090 gene rplK 1339 1767 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085926.1 protein_id gnl|my_center|LOCUS_41090 1771 2475 gene locus_tag LOCUS_41100 gene rplA 1771 2475 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096676.1 protein_id gnl|my_center|LOCUS_41100 2747 3244 gene locus_tag LOCUS_41110 gene rplJ 2747 3244 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207203.1 protein_id gnl|my_center|LOCUS_41110 3311 3676 gene locus_tag LOCUS_41120 gene rplL 3311 3676 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028882.1 protein_id gnl|my_center|LOCUS_41120 3998 8026 gene locus_tag LOCUS_41130 gene rpoB 3998 8026 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503453.1 protein_id gnl|my_center|LOCUS_41130 8103 12326 gene locus_tag LOCUS_41140 gene rpoC 8103 12326 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095003.1 protein_id gnl|my_center|LOCUS_41140 12737 12420 gene locus_tag LOCUS_41150 12737 12420 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095004.1 protein_id gnl|my_center|LOCUS_41150 13047 12742 gene locus_tag LOCUS_41160 13047 12742 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023334100.1 protein_id gnl|my_center|LOCUS_41160 14291 13164 gene locus_tag LOCUS_41170 gene thiH 14291 13164 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847474.1 protein_id gnl|my_center|LOCUS_41170 15058 14291 gene locus_tag LOCUS_41180 gene thiG 15058 14291 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944065.1 protein_id gnl|my_center|LOCUS_41180 15260 15060 gene locus_tag LOCUS_41190 gene thiS 15260 15060 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704010.1 protein_id gnl|my_center|LOCUS_41190 15999 15244 gene locus_tag LOCUS_41200 15999 15244 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095010.1 protein_id gnl|my_center|LOCUS_41200 16627 15992 gene locus_tag LOCUS_41210 gene thiE 16627 15992 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284602.1 protein_id gnl|my_center|LOCUS_41210 18522 16627 gene locus_tag LOCUS_41220 gene thiC 18522 16627 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276897.1 protein_id gnl|my_center|LOCUS_41220 19980 18787 gene locus_tag LOCUS_41230 19980 18787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 22385 19995 gene locus_tag LOCUS_41240 22385 19995 CDS product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129197795.1 protein_id gnl|my_center|LOCUS_41240 23245 22532 gene locus_tag LOCUS_41250 23245 22532 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815806.1 protein_id gnl|my_center|LOCUS_41250 23903 23328 gene locus_tag LOCUS_41260 23903 23328 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244646.1 protein_id gnl|my_center|LOCUS_41260 25062 24559 gene locus_tag LOCUS_41270 25062 24559 CDS product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095013.1 protein_id gnl|my_center|LOCUS_41270 25161 25934 gene locus_tag LOCUS_41280 gene nudC 25161 25934 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373941.1 protein_id gnl|my_center|LOCUS_41280 25975 27039 gene locus_tag LOCUS_41290 gene hemE 25975 27039 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137652.1 protein_id gnl|my_center|LOCUS_41290 27049 27720 gene locus_tag LOCUS_41300 gene nfi 27049 27720 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362359.1 protein_id gnl|my_center|LOCUS_41300 27763 28353 gene locus_tag LOCUS_41310 27763 28353 CDS product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704016.1 protein_id gnl|my_center|LOCUS_41310 28540 28812 gene locus_tag LOCUS_41320 gene hupA 28540 28812 CDS product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002445246.1 protein_id gnl|my_center|LOCUS_41320 28852 29517 gene locus_tag LOCUS_41330 28852 29517 CDS product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023621286.1 protein_id gnl|my_center|LOCUS_41330 30966 29677 gene locus_tag LOCUS_41340 gene purD 30966 29677 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095019.1 protein_id gnl|my_center|LOCUS_41340 32631 30982 gene locus_tag LOCUS_41350 gene purH 32631 30982 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095020.1 protein_id gnl|my_center|LOCUS_41350 >Feature sequence19 1342 200 gene locus_tag LOCUS_41360 1342 200 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098521.1 protein_id gnl|my_center|LOCUS_41360 2761 1421 gene locus_tag LOCUS_41370 gene gudD 2761 1421 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098237.1 protein_id gnl|my_center|LOCUS_41370 4125 2782 gene locus_tag LOCUS_41380 4125 2782 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211753.1 protein_id gnl|my_center|LOCUS_41380 5477 4125 gene locus_tag LOCUS_41390 gene gudP 5477 4125 CDS product galactarate/glucarate/glycerate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097011.1 protein_id gnl|my_center|LOCUS_41390 6414 5965 gene locus_tag LOCUS_41400 6414 5965 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807756.1 protein_id gnl|my_center|LOCUS_41400 7214 6432 gene locus_tag LOCUS_41410 gene truC 7214 6432 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703313.1 protein_id gnl|my_center|LOCUS_41410 7543 7214 gene locus_tag LOCUS_41420 7543 7214 CDS product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098527.1 protein_id gnl|my_center|LOCUS_41420 7801 7562 gene locus_tag LOCUS_41430 7801 7562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 8726 8181 gene locus_tag LOCUS_41440 gene syd 8726 8181 CDS product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343990.1 protein_id gnl|my_center|LOCUS_41440 8795 9640 gene locus_tag LOCUS_41450 gene queF 8795 9640 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100402.1 protein_id gnl|my_center|LOCUS_41450 9757 11121 gene locus_tag LOCUS_41460 gene ppnN 9757 11121 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098530.1 protein_id gnl|my_center|LOCUS_41460 11569 12858 gene locus_tag LOCUS_41470 gene sdaC 11569 12858 CDS product HAAAP family serine/threonine permease SdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859030.1 protein_id gnl|my_center|LOCUS_41470 12914 14281 gene locus_tag LOCUS_41480 12914 14281 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098532.1 protein_id gnl|my_center|LOCUS_41480 14411 15166 gene locus_tag LOCUS_41490 gene xni 14411 15166 CDS product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268232.1 protein_id gnl|my_center|LOCUS_41490 >Feature sequence20 2784 28 gene locus_tag LOCUS_41500 gene barA 2784 28 CDS product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186405.1 protein_id gnl|my_center|LOCUS_41500 2842 4155 gene locus_tag LOCUS_41510 gene rlmD 2842 4155 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098519.1 protein_id gnl|my_center|LOCUS_41510 4203 6446 gene locus_tag LOCUS_41520 4203 6446 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226815.1 protein_id gnl|my_center|LOCUS_41520 6588 7379 gene locus_tag LOCUS_41530 gene mazG 6588 7379 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703306.1 protein_id gnl|my_center|LOCUS_41530 7607 9244 gene locus_tag LOCUS_41540 gene pyrG 7607 9244 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703305.1 protein_id gnl|my_center|LOCUS_41540 9323 10618 gene locus_tag LOCUS_41550 gene eno 9323 10618 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098515.1 protein_id gnl|my_center|LOCUS_41550 11498 10674 gene locus_tag LOCUS_41560 11498 10674 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098513.1 protein_id gnl|my_center|LOCUS_41560 11670 13226 gene locus_tag LOCUS_41570 11670 13226 CDS product maltose/glucose-specific PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098512.1 protein_id gnl|my_center|LOCUS_41570 13223 13930 gene locus_tag LOCUS_41580 13223 13930 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859648.1 protein_id gnl|my_center|LOCUS_41580 13986 14657 gene locus_tag LOCUS_41590 gene queE 13986 14657 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098510.1 protein_id gnl|my_center|LOCUS_41590 >Feature sequence21 131 577 gene locus_tag LOCUS_41600 gene fliJ 131 577 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248917.1 protein_id gnl|my_center|LOCUS_41600 577 969 gene locus_tag LOCUS_41610 577 969 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859527.1 protein_id gnl|my_center|LOCUS_41610 2421 1084 gene locus_tag LOCUS_41620 gene fliI 2421 1084 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279402.1 protein_id gnl|my_center|LOCUS_41620 3118 2414 gene locus_tag LOCUS_41630 gene fliH 3118 2414 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151516.1 protein_id gnl|my_center|LOCUS_41630 4146 3130 gene locus_tag LOCUS_41640 4146 3130 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293168.1 protein_id gnl|my_center|LOCUS_41640 5797 4124 gene locus_tag LOCUS_41650 gene fliF 5797 4124 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993674.1 protein_id gnl|my_center|LOCUS_41650 6089 5802 gene locus_tag LOCUS_41660 6089 5802 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029087.1 protein_id gnl|my_center|LOCUS_41660 7165 6173 gene locus_tag LOCUS_41670 7165 6173 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292195.1 protein_id gnl|my_center|LOCUS_41670 7628 8497 gene locus_tag LOCUS_41680 7628 8497 CDS product FliM/FliN family flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922504.1 protein_id gnl|my_center|LOCUS_41680 8490 8861 gene locus_tag LOCUS_41690 8490 8861 CDS product FliM/FliN family flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043127.1 protein_id gnl|my_center|LOCUS_41690 8858 9613 gene locus_tag LOCUS_41700 gene fliP 8858 9613 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830282.1 protein_id gnl|my_center|LOCUS_41700 9627 9899 gene locus_tag LOCUS_41710 9627 9899 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958542.1 protein_id gnl|my_center|LOCUS_41710 9901 10680 gene locus_tag LOCUS_41720 gene fliR 9901 10680 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260504.1 protein_id gnl|my_center|LOCUS_41720 10673 11812 gene locus_tag LOCUS_41730 10673 11812 CDS product flagellar type III secretion system protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785648.1 protein_id gnl|my_center|LOCUS_41730 11796 13889 gene locus_tag LOCUS_41740 gene flhA 11796 13889 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140817.1 protein_id gnl|my_center|LOCUS_41740 13922 14137 gene locus_tag LOCUS_41750 13922 14137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750