>Feature sequence001 56 1330 gene locus_tag LOCUS_00010 56 1330 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_00010 1371 2513 gene locus_tag LOCUS_00020 1371 2513 CDS product DUF2027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203494.1 protein_id gnl|my_center|LOCUS_00020 3945 4124 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4239 4502 gene locus_tag LOCUS_00030 4239 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4611 8273 gene locus_tag LOCUS_00040 gene ileS 4611 8273 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202809.1 protein_id gnl|my_center|LOCUS_00040 8350 8733 gene locus_tag LOCUS_00050 8350 8733 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 protein_id gnl|my_center|LOCUS_00050 8802 9440 gene locus_tag LOCUS_00060 8802 9440 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787678.1 protein_id gnl|my_center|LOCUS_00060 9536 10387 gene locus_tag LOCUS_00070 9536 10387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 10399 10614 gene locus_tag LOCUS_00080 10399 10614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10626 11477 gene locus_tag LOCUS_00090 gene nadC 10626 11477 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_00090 11495 13153 gene locus_tag LOCUS_00100 11495 13153 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_00100 13155 13310 gene locus_tag LOCUS_00110 13155 13310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 13653 13342 gene locus_tag LOCUS_00120 13653 13342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 14111 13626 gene locus_tag LOCUS_00130 14111 13626 CDS product S24/S26 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107087.1 protein_id gnl|my_center|LOCUS_00130 14977 14078 gene locus_tag LOCUS_00140 14977 14078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039948.1 protein_id gnl|my_center|LOCUS_00140 15535 14987 gene locus_tag LOCUS_00150 15535 14987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 16472 15585 gene locus_tag LOCUS_00160 16472 15585 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_00160 18049 16565 gene locus_tag LOCUS_00170 18049 16565 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_00170 18407 18656 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18888 19307 gene locus_tag LOCUS_00180 18888 19307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19553 19771 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20289 20218 gene locus_tag LOCUS_t00010 20289 20218 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 20546 20340 gene locus_tag LOCUS_00190 20546 20340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 22084 20603 gene locus_tag LOCUS_00200 gene proS 22084 20603 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793720.1 protein_id gnl|my_center|LOCUS_00200 22210 22899 gene locus_tag LOCUS_00210 22210 22899 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765906.1 protein_id gnl|my_center|LOCUS_00210 23010 23633 gene locus_tag LOCUS_00220 gene mtgA 23010 23633 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107650.1 protein_id gnl|my_center|LOCUS_00220 23658 26039 gene locus_tag LOCUS_00230 23658 26039 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202910.1 protein_id gnl|my_center|LOCUS_00230 27779 26244 gene locus_tag LOCUS_00240 27779 26244 CDS product DUF4270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202229.1 protein_id gnl|my_center|LOCUS_00240 28638 27835 gene locus_tag LOCUS_00250 28638 27835 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759978.1 protein_id gnl|my_center|LOCUS_00250 28809 29663 gene locus_tag LOCUS_00260 gene panC 28809 29663 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202230.1 protein_id gnl|my_center|LOCUS_00260 29687 30034 gene locus_tag LOCUS_00270 29687 30034 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759980.1 protein_id gnl|my_center|LOCUS_00270 30612 30184 gene locus_tag LOCUS_00280 30612 30184 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763362.1 protein_id gnl|my_center|LOCUS_00280 30801 30652 gene locus_tag LOCUS_00290 30801 30652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 32381 30816 gene locus_tag LOCUS_00300 32381 30816 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780626.1 protein_id gnl|my_center|LOCUS_00300 34927 32558 gene locus_tag LOCUS_00310 34927 32558 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_00310 37277 35052 gene locus_tag LOCUS_00320 37277 35052 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787468.1 protein_id gnl|my_center|LOCUS_00320 37454 38980 gene locus_tag LOCUS_00330 37454 38980 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 protein_id gnl|my_center|LOCUS_00330 39351 39587 gene locus_tag LOCUS_00340 39351 39587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 41592 39694 gene locus_tag LOCUS_00350 gene recQ 41592 39694 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229616.1 protein_id gnl|my_center|LOCUS_00350 41885 44491 gene locus_tag LOCUS_00360 gene gyrA 41885 44491 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787886.1 protein_id gnl|my_center|LOCUS_00360 44526 45749 gene locus_tag LOCUS_00370 44526 45749 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787888.1 protein_id gnl|my_center|LOCUS_00370 46463 45807 gene locus_tag LOCUS_00380 46463 45807 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208150.1 protein_id gnl|my_center|LOCUS_00380 47887 46943 gene locus_tag LOCUS_00390 47887 46943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 49188 47917 gene locus_tag LOCUS_00400 49188 47917 CDS product clostripain-related cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107416.1 protein_id gnl|my_center|LOCUS_00400 51943 49256 gene locus_tag LOCUS_00410 51943 49256 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109217.1 protein_id gnl|my_center|LOCUS_00410 52061 52963 gene locus_tag LOCUS_00420 gene mazG 52061 52963 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_00420 52977 53543 gene locus_tag LOCUS_00430 52977 53543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 53547 54461 gene locus_tag LOCUS_00440 53547 54461 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801215.1 protein_id gnl|my_center|LOCUS_00440 54516 54851 gene locus_tag LOCUS_00450 54516 54851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 54935 56416 gene locus_tag LOCUS_00460 54935 56416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 56492 56965 gene locus_tag LOCUS_00470 56492 56965 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_00470 57011 57388 gene locus_tag LOCUS_00480 57011 57388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785404.1 protein_id gnl|my_center|LOCUS_00480 57404 57853 gene locus_tag LOCUS_00490 57404 57853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785406.1 protein_id gnl|my_center|LOCUS_00490 58002 58077 gene locus_tag LOCUS_t00020 58002 58077 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 59058 58492 gene locus_tag LOCUS_00500 59058 58492 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107938.1 protein_id gnl|my_center|LOCUS_00500 60116 59118 gene locus_tag LOCUS_00510 60116 59118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 60190 60450 gene locus_tag LOCUS_00520 60190 60450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 61224 60646 gene locus_tag LOCUS_00530 61224 60646 CDS product LolA-like putative outer membrane lipoprotein chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795926.1 protein_id gnl|my_center|LOCUS_00530 63870 61291 gene locus_tag LOCUS_00540 63870 61291 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202242.1 protein_id gnl|my_center|LOCUS_00540 63991 64740 gene locus_tag LOCUS_00550 63991 64740 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760005.1 protein_id gnl|my_center|LOCUS_00550 64727 65914 gene locus_tag LOCUS_00560 64727 65914 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760004.1 protein_id gnl|my_center|LOCUS_00560 66056 66805 gene locus_tag LOCUS_00570 66056 66805 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107357.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00570 66839 67063 gene locus_tag LOCUS_00580 66839 67063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 67261 69030 gene locus_tag LOCUS_00590 67261 69030 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202956.1 protein_id gnl|my_center|LOCUS_00590 69054 70130 gene locus_tag LOCUS_00600 gene carA 69054 70130 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788241.1 protein_id gnl|my_center|LOCUS_00600 70185 73412 gene locus_tag LOCUS_00610 gene carB 70185 73412 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107320.1 protein_id gnl|my_center|LOCUS_00610 73675 73845 gene locus_tag LOCUS_00620 73675 73845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 73956 75335 gene locus_tag LOCUS_00630 gene mtaB 73956 75335 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763943.1 protein_id gnl|my_center|LOCUS_00630 75358 76383 gene locus_tag LOCUS_00640 75358 76383 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 protein_id gnl|my_center|LOCUS_00640 76448 77620 gene locus_tag LOCUS_00650 76448 77620 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109160.1 protein_id gnl|my_center|LOCUS_00650 77623 78528 gene locus_tag LOCUS_00660 77623 78528 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761007.1 protein_id gnl|my_center|LOCUS_00660 78792 79517 gene locus_tag LOCUS_00670 78792 79517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 79727 80689 gene locus_tag LOCUS_00680 79727 80689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 80619 81641 gene locus_tag LOCUS_00690 80619 81641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 80650 80657 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 81647 82126 gene locus_tag LOCUS_00700 81647 82126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 82653 82351 gene locus_tag LOCUS_00710 82653 82351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 <84315 82941 gene locus_tag LOCUS_00720 <84315 82941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202231.1:bifunctional dihydroorotate dehydrogenase B NAD binding subunit/NADPH-dependent glutamate synthase >Feature sequence002 <1 734 gene locus_tag LOCUS_00730 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760890.1:helix-turn-helix domain-containing protein 839 1714 gene locus_tag LOCUS_00740 gene pdxS 839 1714 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813582.1 protein_id gnl|my_center|LOCUS_00740 1711 2301 gene locus_tag LOCUS_00750 gene pdxT 1711 2301 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689963.1 protein_id gnl|my_center|LOCUS_00750 2903 3907 gene locus_tag LOCUS_00760 2903 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 5559 3988 gene locus_tag LOCUS_00770 5559 3988 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786352.1 protein_id gnl|my_center|LOCUS_00770 6085 5804 gene locus_tag LOCUS_00780 6085 5804 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_00780 6311 7774 gene locus_tag LOCUS_00790 gene pyk 6311 7774 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791942.1 protein_id gnl|my_center|LOCUS_00790 8153 7923 gene locus_tag LOCUS_00800 8153 7923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 8525 8154 gene locus_tag LOCUS_00810 8525 8154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 8762 8547 gene locus_tag LOCUS_00820 8762 8547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 9020 9472 gene locus_tag LOCUS_00830 9020 9472 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766080.1 protein_id gnl|my_center|LOCUS_00830 9494 9910 gene locus_tag LOCUS_00840 gene ruvX 9494 9910 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786562.1 protein_id gnl|my_center|LOCUS_00840 9957 10514 gene locus_tag LOCUS_00850 gene def 9957 10514 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786565.1 protein_id gnl|my_center|LOCUS_00850 10603 12567 gene locus_tag LOCUS_00860 10603 12567 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202518.1 protein_id gnl|my_center|LOCUS_00860 12641 14608 gene locus_tag LOCUS_00870 gene thrS 12641 14608 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786570.1 protein_id gnl|my_center|LOCUS_00870 14742 15428 gene locus_tag LOCUS_00880 gene infC 14742 15428 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695168.1 protein_id gnl|my_center|LOCUS_00880 15517 15714 gene locus_tag LOCUS_00890 gene rpmI 15517 15714 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297539.1 protein_id gnl|my_center|LOCUS_00890 15752 16096 gene locus_tag LOCUS_00900 gene rplT 15752 16096 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297540.1 protein_id gnl|my_center|LOCUS_00900 18447 16219 gene locus_tag LOCUS_00910 18447 16219 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203147.1 protein_id gnl|my_center|LOCUS_00910 18679 20625 gene locus_tag LOCUS_00920 18679 20625 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_00920 18876 18978 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20839 21024 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21070 22665 gene locus_tag LOCUS_00930 21070 22665 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_00930 23595 23772 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23890 25758 gene locus_tag LOCUS_00940 23890 25758 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202069.1 protein_id gnl|my_center|LOCUS_00940 25766 26713 gene locus_tag LOCUS_00950 25766 26713 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108287.1 protein_id gnl|my_center|LOCUS_00950 26719 26811 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26893 29073 gene locus_tag LOCUS_00960 26893 29073 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303106.1 protein_id gnl|my_center|LOCUS_00960 29375 31678 gene locus_tag LOCUS_00970 29375 31678 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203425.1 protein_id gnl|my_center|LOCUS_00970 31681 33027 gene locus_tag LOCUS_00980 31681 33027 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790680.1 protein_id gnl|my_center|LOCUS_00980 33878 33093 gene locus_tag LOCUS_00990 33878 33093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 35874 33805 gene locus_tag LOCUS_01000 35874 33805 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788960.1 protein_id gnl|my_center|LOCUS_01000 36320 35982 gene locus_tag LOCUS_01010 36320 35982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769696.1 protein_id gnl|my_center|LOCUS_01010 38472 36340 gene locus_tag LOCUS_01020 38472 36340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 38515 38613 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39667 39392 gene locus_tag LOCUS_01030 39667 39392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788933.1 protein_id gnl|my_center|LOCUS_01030 39818 40723 gene locus_tag LOCUS_01040 39818 40723 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766156.1 protein_id gnl|my_center|LOCUS_01040 40945 40873 gene locus_tag LOCUS_t00030 40945 40873 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 41070 40983 gene locus_tag LOCUS_t00040 41070 40983 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 41329 41538 gene locus_tag LOCUS_01050 41329 41538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 41585 43627 gene locus_tag LOCUS_01060 41585 43627 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640383.1 protein_id gnl|my_center|LOCUS_01060 44539 43685 gene locus_tag LOCUS_01070 44539 43685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 44670 45944 gene locus_tag LOCUS_01080 44670 45944 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_01080 45963 46919 gene locus_tag LOCUS_01090 45963 46919 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786931.1 protein_id gnl|my_center|LOCUS_01090 46932 47567 gene locus_tag LOCUS_01100 46932 47567 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776695.1 protein_id gnl|my_center|LOCUS_01100 47840 48982 gene locus_tag LOCUS_01110 47840 48982 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760698.1 protein_id gnl|my_center|LOCUS_01110 49194 50189 gene locus_tag LOCUS_01120 49194 50189 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_01120 50192 51061 gene locus_tag LOCUS_01130 50192 51061 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_01130 51148 52167 gene locus_tag LOCUS_01140 51148 52167 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107515.1 protein_id gnl|my_center|LOCUS_01140 52291 53193 gene locus_tag LOCUS_01150 52291 53193 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_01150 53301 54224 gene locus_tag LOCUS_01160 53301 54224 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_01160 54228 54956 gene locus_tag LOCUS_01170 54228 54956 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461640.1 protein_id gnl|my_center|LOCUS_01170 >Feature sequence003 612 235 gene locus_tag LOCUS_01180 gene crcB 612 235 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764721.1 protein_id gnl|my_center|LOCUS_01180 1276 623 gene locus_tag LOCUS_01190 1276 623 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667095.1 protein_id gnl|my_center|LOCUS_01190 1373 2329 gene locus_tag LOCUS_01200 gene metF 1373 2329 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766920.1 protein_id gnl|my_center|LOCUS_01200 2331 3428 gene locus_tag LOCUS_01210 2331 3428 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799206.1 protein_id gnl|my_center|LOCUS_01210 3432 4745 gene locus_tag LOCUS_01220 gene ricT 3432 4745 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203582.1 protein_id gnl|my_center|LOCUS_01220 4751 5212 gene locus_tag LOCUS_01230 4751 5212 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799202.1 protein_id gnl|my_center|LOCUS_01230 6729 5260 gene locus_tag LOCUS_01240 gene rodA 6729 5260 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792061.1 protein_id gnl|my_center|LOCUS_01240 8560 6710 gene locus_tag LOCUS_01250 gene mrdA 8560 6710 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_01250 9061 8561 gene locus_tag LOCUS_01260 gene mreD 9061 8561 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792054.1 protein_id gnl|my_center|LOCUS_01260 9931 9068 gene locus_tag LOCUS_01270 gene mreC 9931 9068 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766925.1 protein_id gnl|my_center|LOCUS_01270 10958 9936 gene locus_tag LOCUS_01280 10958 9936 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762747.1 protein_id gnl|my_center|LOCUS_01280 11578 10985 gene locus_tag LOCUS_01290 11578 10985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 12236 11820 gene locus_tag LOCUS_01300 12236 11820 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108802.1 protein_id gnl|my_center|LOCUS_01300 12825 12202 gene locus_tag LOCUS_01310 12825 12202 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024668366.1 protein_id gnl|my_center|LOCUS_01310 13785 12829 gene locus_tag LOCUS_01320 13785 12829 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965124.1 protein_id gnl|my_center|LOCUS_01320 14780 13773 gene locus_tag LOCUS_01330 14780 13773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 15865 14783 gene locus_tag LOCUS_01340 15865 14783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 17748 15862 gene locus_tag LOCUS_01350 17748 15862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 18340 17759 gene locus_tag LOCUS_01360 gene nadD 18340 17759 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797930.1 protein_id gnl|my_center|LOCUS_01360 18974 18351 gene locus_tag LOCUS_01370 gene gmk 18974 18351 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048695834.1 protein_id gnl|my_center|LOCUS_01370 19846 18983 gene locus_tag LOCUS_01380 19846 18983 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769918.1 protein_id gnl|my_center|LOCUS_01380 19947 20639 gene locus_tag LOCUS_01390 gene tsaB 19947 20639 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_01390 20662 21261 gene locus_tag LOCUS_01400 20662 21261 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_01400 21267 22577 gene locus_tag LOCUS_01410 gene murA 21267 22577 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_01410 22574 23098 gene locus_tag LOCUS_01420 gene rimM 22574 23098 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761107.1 protein_id gnl|my_center|LOCUS_01420 23095 24255 gene locus_tag LOCUS_01430 23095 24255 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802379.1 protein_id gnl|my_center|LOCUS_01430 24259 25635 gene locus_tag LOCUS_01440 gene rseP 24259 25635 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_01440 25930 30420 gene locus_tag LOCUS_01450 gene gltB 25930 30420 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107318.1 protein_id gnl|my_center|LOCUS_01450 30448 31881 gene locus_tag LOCUS_01460 30448 31881 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964981.1 protein_id gnl|my_center|LOCUS_01460 32014 33060 gene locus_tag LOCUS_01470 32014 33060 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767048.1 protein_id gnl|my_center|LOCUS_01470 33456 33163 gene locus_tag LOCUS_01480 33456 33163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 33539 33958 gene locus_tag LOCUS_01490 33539 33958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 35214 34243 gene locus_tag LOCUS_01500 35214 34243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 35230 35506 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36680 36324 gene locus_tag LOCUS_01510 36680 36324 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763126.1 protein_id gnl|my_center|LOCUS_01510 >Feature sequence004 <1 939 gene locus_tag LOCUS_01520 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789094.1:anaerobic sulfatase-maturation protein 1968 946 gene locus_tag LOCUS_01530 1968 946 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202760.1 protein_id gnl|my_center|LOCUS_01530 3440 2091 gene locus_tag LOCUS_01540 3440 2091 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107402.1 protein_id gnl|my_center|LOCUS_01540 3635 5011 gene locus_tag LOCUS_01550 3635 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 5018 6271 gene locus_tag LOCUS_01560 5018 6271 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202492.1 protein_id gnl|my_center|LOCUS_01560 6386 8671 gene locus_tag LOCUS_01570 6386 8671 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_01570 8674 9360 gene locus_tag LOCUS_01580 8674 9360 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_01580 9531 9747 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10402 12033 gene locus_tag LOCUS_01590 10402 12033 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281991.1 protein_id gnl|my_center|LOCUS_01590 12052 13101 gene locus_tag LOCUS_01600 12052 13101 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964458.1 protein_id gnl|my_center|LOCUS_01600 14354 13068 gene locus_tag LOCUS_01610 14354 13068 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_01610 15036 15638 gene locus_tag LOCUS_01620 15036 15638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 15651 17159 gene locus_tag LOCUS_01630 gene rpoN 15651 17159 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_01630 17783 18292 gene locus_tag LOCUS_01640 gene purE 17783 18292 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797496.1 protein_id gnl|my_center|LOCUS_01640 18299 20182 gene locus_tag LOCUS_01650 18299 20182 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108331.1 protein_id gnl|my_center|LOCUS_01650 20194 21177 gene locus_tag LOCUS_01660 20194 21177 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796125.1 protein_id gnl|my_center|LOCUS_01660 21479 23725 gene locus_tag LOCUS_01670 21479 23725 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766433.1 protein_id gnl|my_center|LOCUS_01670 25213 23795 gene locus_tag LOCUS_01680 25213 23795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 25918 25220 gene locus_tag LOCUS_01690 25918 25220 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762294.1 protein_id gnl|my_center|LOCUS_01690 26046 28904 gene locus_tag LOCUS_01700 gene leuS 26046 28904 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108648.1 protein_id gnl|my_center|LOCUS_01700 28932 29873 gene locus_tag LOCUS_01710 28932 29873 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783550.1 protein_id gnl|my_center|LOCUS_01710 29870 30469 gene locus_tag LOCUS_01720 29870 30469 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108650.1 protein_id gnl|my_center|LOCUS_01720 30549 32519 gene locus_tag LOCUS_01730 30549 32519 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_01730 32534 33832 gene locus_tag LOCUS_01740 32534 33832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 35135 34842 gene locus_tag LOCUS_01750 35135 34842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 35250 35421 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence005 398 27 gene locus_tag LOCUS_01760 398 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 1854 400 gene locus_tag LOCUS_01770 1854 400 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767909.1 protein_id gnl|my_center|LOCUS_01770 1861 2157 gene locus_tag LOCUS_01780 1861 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 2173 2760 gene locus_tag LOCUS_01790 2173 2760 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762117.1 protein_id gnl|my_center|LOCUS_01790 2910 3557 gene locus_tag LOCUS_01800 gene nth 2910 3557 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767855.1 protein_id gnl|my_center|LOCUS_01800 3578 4288 gene locus_tag LOCUS_01810 3578 4288 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787603.1 protein_id gnl|my_center|LOCUS_01810 7259 4347 gene locus_tag LOCUS_01820 7259 4347 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202754.1 protein_id gnl|my_center|LOCUS_01820 10540 7256 gene locus_tag LOCUS_01830 10540 7256 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202755.1 protein_id gnl|my_center|LOCUS_01830 12657 10651 gene locus_tag LOCUS_01840 12657 10651 CDS product DUF5686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109207.1 protein_id gnl|my_center|LOCUS_01840 13654 12782 gene locus_tag LOCUS_01850 13654 12782 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_01850 13857 14192 gene locus_tag LOCUS_01860 13857 14192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 14203 14778 gene locus_tag LOCUS_01870 gene xpt 14203 14778 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760704.1 protein_id gnl|my_center|LOCUS_01870 14783 16135 gene locus_tag LOCUS_01880 14783 16135 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790376.1 protein_id gnl|my_center|LOCUS_01880 16166 16807 gene locus_tag LOCUS_01890 16166 16807 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861240.1 protein_id gnl|my_center|LOCUS_01890 18180 16870 gene locus_tag LOCUS_01900 18180 16870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 18309 18506 gene locus_tag LOCUS_01910 18309 18506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 18470 18478 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18634 20316 gene locus_tag LOCUS_01920 18634 20316 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107667.1 protein_id gnl|my_center|LOCUS_01920 20456 22513 gene locus_tag LOCUS_01930 gene htpG 20456 22513 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202859.1 protein_id gnl|my_center|LOCUS_01930 25089 22585 gene locus_tag LOCUS_01940 25089 22585 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108886.1 protein_id gnl|my_center|LOCUS_01940 27290 25545 gene locus_tag LOCUS_01950 27290 25545 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786230.1 protein_id gnl|my_center|LOCUS_01950 27401 27784 gene locus_tag LOCUS_01960 27401 27784 CDS product DUF4491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767264.1 protein_id gnl|my_center|LOCUS_01960 27784 28254 gene locus_tag LOCUS_01970 gene rlmH 27784 28254 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107863.1 protein_id gnl|my_center|LOCUS_01970 28357 30999 gene locus_tag LOCUS_01980 28357 30999 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_01980 >Feature sequence006 138 1577 gene locus_tag LOCUS_01990 138 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 2989 1967 gene locus_tag LOCUS_02000 2989 1967 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_02000 3783 4496 gene locus_tag LOCUS_02010 3783 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 5316 4477 gene locus_tag LOCUS_02020 5316 4477 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902065.1 protein_id gnl|my_center|LOCUS_02020 5443 6096 gene locus_tag LOCUS_02030 5443 6096 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460780.1 protein_id gnl|my_center|LOCUS_02030 6105 7115 gene locus_tag LOCUS_02040 6105 7115 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004058044.1 protein_id gnl|my_center|LOCUS_02040 7117 7797 gene locus_tag LOCUS_02050 gene rpe 7117 7797 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986839.1 protein_id gnl|my_center|LOCUS_02050 8769 7819 gene locus_tag LOCUS_02060 8769 7819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 9724 8774 gene locus_tag LOCUS_02070 9724 8774 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941294.1 protein_id gnl|my_center|LOCUS_02070 10668 9775 gene locus_tag LOCUS_02080 10668 9775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 12118 10673 gene locus_tag LOCUS_02090 12118 10673 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814097.1 protein_id gnl|my_center|LOCUS_02090 12193 13242 gene locus_tag LOCUS_02100 12193 13242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 13517 13978 gene locus_tag LOCUS_02110 gene rplM 13517 13978 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782434.1 protein_id gnl|my_center|LOCUS_02110 13992 14378 gene locus_tag LOCUS_02120 gene rpsI 13992 14378 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_02120 14579 15388 gene locus_tag LOCUS_02130 gene rpsB 14579 15388 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760802.1 protein_id gnl|my_center|LOCUS_02130 15297 15343 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15423 16421 gene locus_tag LOCUS_02140 gene tsf 15423 16421 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791746.1 protein_id gnl|my_center|LOCUS_02140 16546 17163 gene locus_tag LOCUS_02150 16546 17163 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791742.1 protein_id gnl|my_center|LOCUS_02150 17223 20729 gene locus_tag LOCUS_02160 gene porU 17223 20729 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_02160 20875 21963 gene locus_tag LOCUS_02170 gene porV 20875 21963 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_02170 21978 22457 gene locus_tag LOCUS_02180 gene ispF 21978 22457 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764145.1 protein_id gnl|my_center|LOCUS_02180 22833 24107 gene locus_tag LOCUS_02190 22833 24107 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203722.1 protein_id gnl|my_center|LOCUS_02190 24104 24886 gene locus_tag LOCUS_02200 24104 24886 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108544.1 protein_id gnl|my_center|LOCUS_02200 25838 24999 gene locus_tag LOCUS_02210 25838 24999 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770039.1 protein_id gnl|my_center|LOCUS_02210 28318 26216 gene locus_tag LOCUS_02220 gene recG 28318 26216 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791121.1 protein_id gnl|my_center|LOCUS_02220 28990 28325 gene locus_tag LOCUS_02230 28990 28325 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109021.1 protein_id gnl|my_center|LOCUS_02230 29657 29010 gene locus_tag LOCUS_02240 29657 29010 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_02240 29663 30553 gene locus_tag LOCUS_02250 29663 30553 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203537.1 protein_id gnl|my_center|LOCUS_02250 30563 32269 gene locus_tag LOCUS_02260 30563 32269 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107086.1 protein_id gnl|my_center|LOCUS_02260 >Feature sequence007 <1 2802 gene locus_tag LOCUS_02270 <1 2802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107220.1:hybrid sensor histidine kinase/response regulator transcription factor 3068 4885 gene locus_tag LOCUS_02280 3068 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 4894 8031 gene locus_tag LOCUS_02290 4894 8031 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107218.1 protein_id gnl|my_center|LOCUS_02290 8067 9875 gene locus_tag LOCUS_02300 8067 9875 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760650.1 protein_id gnl|my_center|LOCUS_02300 9948 13130 gene locus_tag LOCUS_02310 9948 13130 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107217.1 protein_id gnl|my_center|LOCUS_02310 13149 14942 gene locus_tag LOCUS_02320 13149 14942 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107216.1 protein_id gnl|my_center|LOCUS_02320 15071 15487 gene locus_tag LOCUS_02330 15071 15487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 15492 17792 gene locus_tag LOCUS_02340 15492 17792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 18398 17823 gene locus_tag LOCUS_02350 18398 17823 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_02350 18961 18395 gene locus_tag LOCUS_02360 18961 18395 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763312.1 protein_id gnl|my_center|LOCUS_02360 22714 18968 gene locus_tag LOCUS_02370 gene purL 22714 18968 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767801.1 protein_id gnl|my_center|LOCUS_02370 23331 24182 gene locus_tag LOCUS_02380 23331 24182 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_02380 24277 26703 gene locus_tag LOCUS_02390 24277 26703 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_02390 26717 29053 gene locus_tag LOCUS_02400 26717 29053 CDS product beta-galactosidase GalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036450.1 protein_id gnl|my_center|LOCUS_02400 >Feature sequence008 1084 464 gene locus_tag LOCUS_02410 1084 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 1811 1197 gene locus_tag LOCUS_02420 1811 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 2135 2782 gene locus_tag LOCUS_02430 2135 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 3342 2833 gene locus_tag LOCUS_02440 3342 2833 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760888.1 protein_id gnl|my_center|LOCUS_02440 4192 3347 gene locus_tag LOCUS_02450 gene ispE 4192 3347 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793430.1 protein_id gnl|my_center|LOCUS_02450 4303 5814 gene locus_tag LOCUS_02460 gene dnaB 4303 5814 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761250.1 protein_id gnl|my_center|LOCUS_02460 6182 7681 gene locus_tag LOCUS_02470 6182 7681 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789851.1 protein_id gnl|my_center|LOCUS_02470 7713 9116 gene locus_tag LOCUS_02480 gene leuC 7713 9116 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799043.1 protein_id gnl|my_center|LOCUS_02480 9118 9708 gene locus_tag LOCUS_02490 gene leuD 9118 9708 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_02490 9687 11261 gene locus_tag LOCUS_02500 9687 11261 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763199.1 protein_id gnl|my_center|LOCUS_02500 11279 12340 gene locus_tag LOCUS_02510 gene leuB 11279 12340 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789841.1 protein_id gnl|my_center|LOCUS_02510 12449 13111 gene locus_tag LOCUS_02520 12449 13111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 13164 13238 gene locus_tag LOCUS_t00050 13164 13238 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13267 13341 gene locus_tag LOCUS_t00060 13267 13341 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14860 13376 gene locus_tag LOCUS_02530 14860 13376 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203207.1 protein_id gnl|my_center|LOCUS_02530 15541 14900 gene locus_tag LOCUS_02540 gene ruvC 15541 14900 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199350787.1 protein_id gnl|my_center|LOCUS_02540 16196 15552 gene locus_tag LOCUS_02550 16196 15552 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763490.1 protein_id gnl|my_center|LOCUS_02550 16842 16216 gene locus_tag LOCUS_02560 gene rsmG 16842 16216 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765865.1 protein_id gnl|my_center|LOCUS_02560 16918 17574 gene locus_tag LOCUS_02570 16918 17574 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794216.1 protein_id gnl|my_center|LOCUS_02570 17652 18470 gene locus_tag LOCUS_02580 gene panB 17652 18470 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765576.1 protein_id gnl|my_center|LOCUS_02580 18478 19650 gene locus_tag LOCUS_02590 18478 19650 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761375.1 protein_id gnl|my_center|LOCUS_02590 20293 19655 gene locus_tag LOCUS_02600 20293 19655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 21889 20408 gene locus_tag LOCUS_02610 21889 20408 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761512.1 protein_id gnl|my_center|LOCUS_02610 22818 22006 gene locus_tag LOCUS_02620 22818 22006 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783762.1 protein_id gnl|my_center|LOCUS_02620 24105 22840 gene locus_tag LOCUS_02630 gene uxuA 24105 22840 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766742.1 protein_id gnl|my_center|LOCUS_02630 24316 25731 gene locus_tag LOCUS_02640 gene aspA 24316 25731 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851742.1 protein_id gnl|my_center|LOCUS_02640 26529 25813 gene locus_tag LOCUS_02650 26529 25813 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705781.1 protein_id gnl|my_center|LOCUS_02650 27793 26603 gene locus_tag LOCUS_02660 27793 26603 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787649.1 protein_id gnl|my_center|LOCUS_02660 27926 28528 gene locus_tag LOCUS_02670 27926 28528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 29270 30619 gene locus_tag LOCUS_02680 29270 30619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_02680 >Feature sequence009 369 2318 gene locus_tag LOCUS_02690 369 2318 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769535.1 protein_id gnl|my_center|LOCUS_02690 2320 2949 gene locus_tag LOCUS_02700 2320 2949 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789797.1 protein_id gnl|my_center|LOCUS_02700 3100 3606 gene locus_tag LOCUS_02710 3100 3606 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789793.1 protein_id gnl|my_center|LOCUS_02710 3593 4870 gene locus_tag LOCUS_02720 3593 4870 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789791.1 protein_id gnl|my_center|LOCUS_02720 4975 6351 gene locus_tag LOCUS_02730 gene hisS 4975 6351 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 protein_id gnl|my_center|LOCUS_02730 6353 7351 gene locus_tag LOCUS_02740 6353 7351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 7489 7926 gene locus_tag LOCUS_02750 7489 7926 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815090.1 protein_id gnl|my_center|LOCUS_02750 10531 8180 gene locus_tag LOCUS_02760 gene galB 10531 8180 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202546.1 protein_id gnl|my_center|LOCUS_02760 11905 10691 gene locus_tag LOCUS_02770 11905 10691 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_02770 12089 12595 gene locus_tag LOCUS_02780 12089 12595 CDS product DMP19 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841243.1 protein_id gnl|my_center|LOCUS_02780 12592 13071 gene locus_tag LOCUS_02790 gene smpB 12592 13071 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_02790 13230 15866 gene locus_tag LOCUS_02800 gene metH 13230 15866 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203181.1 protein_id gnl|my_center|LOCUS_02800 15876 16496 gene locus_tag LOCUS_02810 15876 16496 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761607.1 protein_id gnl|my_center|LOCUS_02810 16630 17490 gene locus_tag LOCUS_02820 gene map 16630 17490 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202916.1 protein_id gnl|my_center|LOCUS_02820 17492 18523 gene locus_tag LOCUS_02830 gene tsaD 17492 18523 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107518.1 protein_id gnl|my_center|LOCUS_02830 18525 19028 gene locus_tag LOCUS_02840 18525 19028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 19164 19427 gene locus_tag LOCUS_02850 gene rpmB 19164 19427 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787937.1 protein_id gnl|my_center|LOCUS_02850 19433 19621 gene locus_tag LOCUS_02860 gene rpmG 19433 19621 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002560155.1 protein_id gnl|my_center|LOCUS_02860 19643 19798 gene locus_tag LOCUS_02870 19643 19798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 19889 20845 gene locus_tag LOCUS_02880 gene ftsY 19889 20845 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107516.1 protein_id gnl|my_center|LOCUS_02880 20855 22201 gene locus_tag LOCUS_02890 gene rimO 20855 22201 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787933.1 protein_id gnl|my_center|LOCUS_02890 22228 22536 gene locus_tag LOCUS_02900 22228 22536 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787931.1 protein_id gnl|my_center|LOCUS_02900 22529 23836 gene locus_tag LOCUS_02910 22529 23836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 25079 23958 gene locus_tag LOCUS_02920 25079 23958 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812397.1 protein_id gnl|my_center|LOCUS_02920 25240 25716 gene locus_tag LOCUS_02930 25240 25716 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763774.1 protein_id gnl|my_center|LOCUS_02930 25772 27040 gene locus_tag LOCUS_02940 25772 27040 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840969.1 protein_id gnl|my_center|LOCUS_02940 28003 27134 gene locus_tag LOCUS_02950 gene prmA 28003 27134 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766150.1 protein_id gnl|my_center|LOCUS_02950 28132 29049 gene locus_tag LOCUS_02960 28132 29049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 >Feature sequence010 2609 2079 gene locus_tag LOCUS_02970 2609 2079 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201864.1 protein_id gnl|my_center|LOCUS_02970 2813 2993 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4872 5459 gene locus_tag LOCUS_02980 4872 5459 CDS product succinate dehydrogenase/fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783488.1 protein_id gnl|my_center|LOCUS_02980 6635 6819 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6859 7458 gene locus_tag LOCUS_02990 6859 7458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 7486 8241 gene locus_tag LOCUS_03000 7486 8241 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761731.1 protein_id gnl|my_center|LOCUS_03000 8411 9109 gene locus_tag LOCUS_03010 8411 9109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 9142 10398 gene locus_tag LOCUS_03020 9142 10398 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582782.1 protein_id gnl|my_center|LOCUS_03020 10535 11680 gene locus_tag LOCUS_03030 10535 11680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_03030 11739 13706 gene locus_tag LOCUS_03040 11739 13706 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783474.1 protein_id gnl|my_center|LOCUS_03040 13726 15306 gene locus_tag LOCUS_03050 13726 15306 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303090.1 protein_id gnl|my_center|LOCUS_03050 15782 15354 gene locus_tag LOCUS_03060 gene ybeY 15782 15354 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108739.1 protein_id gnl|my_center|LOCUS_03060 16257 15793 gene locus_tag LOCUS_03070 gene coaD 16257 15793 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761751.1 protein_id gnl|my_center|LOCUS_03070 17294 16260 gene locus_tag LOCUS_03080 gene ruvB 17294 16260 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762892.1 protein_id gnl|my_center|LOCUS_03080 19118 17469 gene locus_tag LOCUS_03090 19118 17469 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108757.1 protein_id gnl|my_center|LOCUS_03090 21477 19243 gene locus_tag LOCUS_03100 21477 19243 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108762.1 protein_id gnl|my_center|LOCUS_03100 22560 21481 gene locus_tag LOCUS_03110 22560 21481 CDS product family 16 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405546.1 protein_id gnl|my_center|LOCUS_03110 23479 22613 gene locus_tag LOCUS_03120 23479 22613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 24012 23491 gene locus_tag LOCUS_03130 24012 23491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 24899 24057 gene locus_tag LOCUS_03140 24899 24057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 24097 24162 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26923 24920 gene locus_tag LOCUS_03150 26923 24920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 28014 26920 gene locus_tag LOCUS_03160 28014 26920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 28256 28439 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence011 345 494 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2337 1648 gene locus_tag LOCUS_03170 gene cmk 2337 1648 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769932.1 protein_id gnl|my_center|LOCUS_03170 3308 2340 gene locus_tag LOCUS_03180 gene porQ 3308 2340 CDS product type IX secretion system protein PorQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_03180 3585 4559 gene locus_tag LOCUS_03190 3585 4559 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108113.1 protein_id gnl|my_center|LOCUS_03190 4563 5381 gene locus_tag LOCUS_03200 4563 5381 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108111.1 protein_id gnl|my_center|LOCUS_03200 5491 5579 gene locus_tag LOCUS_t00070 5491 5579 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5892 6437 gene locus_tag LOCUS_03210 5892 6437 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790644.1 protein_id gnl|my_center|LOCUS_03210 6874 6332 gene locus_tag LOCUS_03220 6874 6332 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766460.1 protein_id gnl|my_center|LOCUS_03220 8310 6895 gene locus_tag LOCUS_03230 8310 6895 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203417.1 protein_id gnl|my_center|LOCUS_03230 10306 8312 gene locus_tag LOCUS_03240 10306 8312 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_03240 12515 10470 gene locus_tag LOCUS_03250 12515 10470 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817457.1 protein_id gnl|my_center|LOCUS_03250 13731 12631 gene locus_tag LOCUS_03260 13731 12631 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795850.1 protein_id gnl|my_center|LOCUS_03260 14678 13734 gene locus_tag LOCUS_03270 14678 13734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963974.1 protein_id gnl|my_center|LOCUS_03270 15090 14665 gene locus_tag LOCUS_03280 15090 14665 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802402.1 protein_id gnl|my_center|LOCUS_03280 16286 15105 gene locus_tag LOCUS_03290 gene purT 16286 15105 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765582.1 protein_id gnl|my_center|LOCUS_03290 16593 16291 gene locus_tag LOCUS_03300 16593 16291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 17743 16577 gene locus_tag LOCUS_03310 gene rfbB 17743 16577 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203413.1 protein_id gnl|my_center|LOCUS_03310 18260 17763 gene locus_tag LOCUS_03320 18260 17763 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766431.1 protein_id gnl|my_center|LOCUS_03320 18880 18257 gene locus_tag LOCUS_03330 18880 18257 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_03330 20243 18870 gene locus_tag LOCUS_03340 20243 18870 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798170.1 protein_id gnl|my_center|LOCUS_03340 20444 21796 gene locus_tag LOCUS_03350 20444 21796 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799138.1 protein_id gnl|my_center|LOCUS_03350 21793 23094 gene locus_tag LOCUS_03360 gene xseA 21793 23094 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_03360 23119 23313 gene locus_tag LOCUS_03370 gene xseB 23119 23313 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760813.1 protein_id gnl|my_center|LOCUS_03370 23410 24426 gene locus_tag LOCUS_03380 23410 24426 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004305537.1 protein_id gnl|my_center|LOCUS_03380 24535 25305 gene locus_tag LOCUS_03390 gene trmB 24535 25305 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840567.1 protein_id gnl|my_center|LOCUS_03390 27809 25302 gene locus_tag LOCUS_03400 27809 25302 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767247.1 protein_id gnl|my_center|LOCUS_03400 27965 29071 gene locus_tag LOCUS_03410 27965 29071 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764152.1 protein_id gnl|my_center|LOCUS_03410 >Feature sequence012 98 583 gene locus_tag LOCUS_03420 98 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 587 970 gene locus_tag LOCUS_03430 587 970 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678599.1 protein_id gnl|my_center|LOCUS_03430 970 1458 gene locus_tag LOCUS_03440 970 1458 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291426.1 protein_id gnl|my_center|LOCUS_03440 2349 1477 gene locus_tag LOCUS_03450 gene bla 2349 1477 CDS product class A beta-lactamase, subclass A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109295.1 protein_id gnl|my_center|LOCUS_03450 2626 2369 gene locus_tag LOCUS_03460 2626 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 5011 2894 gene locus_tag LOCUS_03470 5011 2894 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008002.1 protein_id gnl|my_center|LOCUS_03470 5929 5021 gene locus_tag LOCUS_03480 5929 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 8813 5919 gene locus_tag LOCUS_03490 8813 5919 CDS product Z1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383504.1 protein_id gnl|my_center|LOCUS_03490 10278 8800 gene locus_tag LOCUS_03500 10278 8800 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383503.1 protein_id gnl|my_center|LOCUS_03500 11395 10331 gene locus_tag LOCUS_03510 11395 10331 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 protein_id gnl|my_center|LOCUS_03510 12266 11703 gene locus_tag LOCUS_03520 12266 11703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 12754 12263 gene locus_tag LOCUS_03530 12754 12263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 13811 12831 gene locus_tag LOCUS_03540 13811 12831 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764421.1 protein_id gnl|my_center|LOCUS_03540 14502 15716 gene locus_tag LOCUS_03550 14502 15716 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817724.1 protein_id gnl|my_center|LOCUS_03550 16631 15726 gene locus_tag LOCUS_03560 16631 15726 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262323.1 protein_id gnl|my_center|LOCUS_03560 17264 16638 gene locus_tag LOCUS_03570 17264 16638 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_03570 18048 17374 gene locus_tag LOCUS_03580 18048 17374 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837223.1 protein_id gnl|my_center|LOCUS_03580 20895 18127 gene locus_tag LOCUS_03590 20895 18127 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_03590 21817 21059 gene locus_tag LOCUS_03600 21817 21059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 22514 21798 gene locus_tag LOCUS_03610 22514 21798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 23363 22521 gene locus_tag LOCUS_03620 23363 22521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 24203 23382 gene locus_tag LOCUS_03630 24203 23382 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107699.1 protein_id gnl|my_center|LOCUS_03630 24627 24244 gene locus_tag LOCUS_03640 24627 24244 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804269.1 protein_id gnl|my_center|LOCUS_03640 25170 24655 gene locus_tag LOCUS_03650 25170 24655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 26837 25434 gene locus_tag LOCUS_03660 26837 25434 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 protein_id gnl|my_center|LOCUS_03660 27655 27032 gene locus_tag LOCUS_03670 27655 27032 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762560.1 protein_id gnl|my_center|LOCUS_03670 <28432 27675 gene locus_tag LOCUS_03680 <28432 27675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784203.1:glycine--tRNA ligase >Feature sequence013 2469 1279 gene locus_tag LOCUS_03690 2469 1279 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107980.1 protein_id gnl|my_center|LOCUS_03690 3981 2578 gene locus_tag LOCUS_03700 3981 2578 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_03700 4097 4975 gene locus_tag LOCUS_03710 4097 4975 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767761.1 protein_id gnl|my_center|LOCUS_03710 5655 4981 gene locus_tag LOCUS_03720 gene trmD 5655 4981 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993029.1 protein_id gnl|my_center|LOCUS_03720 6445 5702 gene locus_tag LOCUS_03730 6445 5702 CDS product DUF5020 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109270.1 protein_id gnl|my_center|LOCUS_03730 8636 6513 gene locus_tag LOCUS_03740 gene ligA 8636 6513 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042588.1 protein_id gnl|my_center|LOCUS_03740 8935 9564 gene locus_tag LOCUS_03750 8935 9564 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762736.1 protein_id gnl|my_center|LOCUS_03750 10056 9700 gene locus_tag LOCUS_03760 10056 9700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 10244 10053 gene locus_tag LOCUS_03770 10244 10053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 10365 11222 gene locus_tag LOCUS_03780 10365 11222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 11315 11806 gene locus_tag LOCUS_03790 11315 11806 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555647.1 protein_id gnl|my_center|LOCUS_03790 12952 11912 gene locus_tag LOCUS_03800 gene pheS 12952 11912 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763378.1 protein_id gnl|my_center|LOCUS_03800 13199 13951 gene locus_tag LOCUS_03810 13199 13951 CDS product DUF4348 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769737.1 protein_id gnl|my_center|LOCUS_03810 13973 15004 gene locus_tag LOCUS_03820 gene murB 13973 15004 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788761.1 protein_id gnl|my_center|LOCUS_03820 15009 15782 gene locus_tag LOCUS_03830 15009 15782 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203087.1 protein_id gnl|my_center|LOCUS_03830 16004 15804 gene locus_tag LOCUS_03840 16004 15804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 16149 17081 gene locus_tag LOCUS_03850 16149 17081 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_03850 18252 17119 gene locus_tag LOCUS_03860 gene hemW 18252 17119 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763952.1 protein_id gnl|my_center|LOCUS_03860 18411 20570 gene locus_tag LOCUS_03870 18411 20570 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_03870 20737 22311 gene locus_tag LOCUS_03880 20737 22311 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790953.1 protein_id gnl|my_center|LOCUS_03880 22338 23036 gene locus_tag LOCUS_03890 22338 23036 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790952.1 protein_id gnl|my_center|LOCUS_03890 23277 23618 gene locus_tag LOCUS_03900 gene rpsF 23277 23618 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781453.1 protein_id gnl|my_center|LOCUS_03900 23621 23893 gene locus_tag LOCUS_03910 gene rpsR 23621 23893 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_03910 23914 24447 gene locus_tag LOCUS_03920 gene rplI 23914 24447 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759741.1 protein_id gnl|my_center|LOCUS_03920 24641 25528 gene locus_tag LOCUS_03930 gene fabD 24641 25528 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765648.1 protein_id gnl|my_center|LOCUS_03930 25559 27712 gene locus_tag LOCUS_03940 25559 27712 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765636.1 protein_id gnl|my_center|LOCUS_03940 >Feature sequence014 1743 331 gene locus_tag LOCUS_03950 1743 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 2695 1706 gene locus_tag LOCUS_03960 2695 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 5076 2698 gene locus_tag LOCUS_03970 gene rnr 5076 2698 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761713.1 protein_id gnl|my_center|LOCUS_03970 5213 7219 gene locus_tag LOCUS_03980 5213 7219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 7219 9105 gene locus_tag LOCUS_03990 7219 9105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 9176 10171 gene locus_tag LOCUS_04000 9176 10171 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783520.1 protein_id gnl|my_center|LOCUS_04000 10209 11168 gene locus_tag LOCUS_04010 10209 11168 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783517.1 protein_id gnl|my_center|LOCUS_04010 11208 12542 gene locus_tag LOCUS_04020 gene miaB 11208 12542 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783584.1 protein_id gnl|my_center|LOCUS_04020 12748 14499 gene locus_tag LOCUS_04030 12748 14499 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_04030 14506 15426 gene locus_tag LOCUS_04040 14506 15426 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_04040 16241 15450 gene locus_tag LOCUS_04050 16241 15450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108792.1 protein_id gnl|my_center|LOCUS_04050 17418 16276 gene locus_tag LOCUS_04060 17418 16276 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017013.1 protein_id gnl|my_center|LOCUS_04060 17579 18592 gene locus_tag LOCUS_04070 17579 18592 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016813.1 protein_id gnl|my_center|LOCUS_04070 19529 18633 gene locus_tag LOCUS_04080 19529 18633 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222953.1 protein_id gnl|my_center|LOCUS_04080 20307 19540 gene locus_tag LOCUS_04090 20307 19540 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_04090 20351 21481 gene locus_tag LOCUS_04100 20351 21481 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963743.1 protein_id gnl|my_center|LOCUS_04100 21497 22279 gene locus_tag LOCUS_04110 21497 22279 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767591.1 protein_id gnl|my_center|LOCUS_04110 22276 23217 gene locus_tag LOCUS_04120 22276 23217 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905676.1 protein_id gnl|my_center|LOCUS_04120 23217 23621 gene locus_tag LOCUS_04130 23217 23621 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767594.1 protein_id gnl|my_center|LOCUS_04130 24687 23572 gene locus_tag LOCUS_04140 24687 23572 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963747.1 protein_id gnl|my_center|LOCUS_04140 26833 24839 gene locus_tag LOCUS_04150 26833 24839 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108682.1 protein_id gnl|my_center|LOCUS_04150 >Feature sequence015 1 1416 gene locus_tag LOCUS_04160 1 1416 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203594.1 protein_id gnl|my_center|LOCUS_04160 1704 1534 gene locus_tag LOCUS_04170 1704 1534 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784522.1 protein_id gnl|my_center|LOCUS_04170 1895 2644 gene locus_tag LOCUS_04180 1895 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 3536 2697 gene locus_tag LOCUS_04190 3536 2697 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801566.1 protein_id gnl|my_center|LOCUS_04190 4264 3539 gene locus_tag LOCUS_04200 4264 3539 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763633.1 protein_id gnl|my_center|LOCUS_04200 4493 4855 gene locus_tag LOCUS_04210 gene rplS 4493 4855 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675578.1 protein_id gnl|my_center|LOCUS_04210 5141 4914 gene locus_tag LOCUS_04220 5141 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 5248 6432 gene locus_tag LOCUS_04230 5248 6432 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_04230 6443 6658 gene locus_tag LOCUS_04240 6443 6658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 7506 6727 gene locus_tag LOCUS_04250 gene pgeF 7506 6727 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291723.1 protein_id gnl|my_center|LOCUS_04250 8685 7519 gene locus_tag LOCUS_04260 gene obgE 8685 7519 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109231.1 protein_id gnl|my_center|LOCUS_04260 9113 8709 gene locus_tag LOCUS_04270 9113 8709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 9192 9215 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9817 9275 gene locus_tag LOCUS_04280 gene hpt 9817 9275 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760055.1 protein_id gnl|my_center|LOCUS_04280 9907 11424 gene locus_tag LOCUS_04290 9907 11424 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795889.1 protein_id gnl|my_center|LOCUS_04290 11436 11996 gene locus_tag LOCUS_04300 11436 11996 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202636.1 protein_id gnl|my_center|LOCUS_04300 13184 12171 gene locus_tag LOCUS_04310 13184 12171 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763359.1 protein_id gnl|my_center|LOCUS_04310 14564 13350 gene locus_tag LOCUS_04320 gene fucP 14564 13350 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703668.1 protein_id gnl|my_center|LOCUS_04320 16597 14804 gene locus_tag LOCUS_04330 16597 14804 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765433.1 protein_id gnl|my_center|LOCUS_04330 17318 16827 gene locus_tag LOCUS_04340 gene rplQ 17318 16827 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791577.1 protein_id gnl|my_center|LOCUS_04340 18336 17344 gene locus_tag LOCUS_04350 18336 17344 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782229.1 protein_id gnl|my_center|LOCUS_04350 18957 18349 gene locus_tag LOCUS_04360 gene rpsD 18957 18349 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791575.1 protein_id gnl|my_center|LOCUS_04360 19384 18995 gene locus_tag LOCUS_04370 gene rpsK 19384 18995 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_04370 19783 19403 gene locus_tag LOCUS_04380 gene rpsM 19783 19403 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296328.1 protein_id gnl|my_center|LOCUS_04380 20236 20018 gene locus_tag LOCUS_04390 gene infA 20236 20018 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_04390 21031 20249 gene locus_tag LOCUS_04400 gene map 21031 20249 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791569.1 protein_id gnl|my_center|LOCUS_04400 22378 21041 gene locus_tag LOCUS_04410 gene secY 22378 21041 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762047.1 protein_id gnl|my_center|LOCUS_04410 22829 22383 gene locus_tag LOCUS_04420 gene rplO 22829 22383 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762046.1 protein_id gnl|my_center|LOCUS_04420 23033 22851 gene locus_tag LOCUS_04430 gene rpmD 23033 22851 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296332.1 protein_id gnl|my_center|LOCUS_04430 23553 23041 gene locus_tag LOCUS_04440 gene rpsE 23553 23041 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 protein_id gnl|my_center|LOCUS_04440 23904 23560 gene locus_tag LOCUS_04450 gene rplR 23904 23560 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765430.1 protein_id gnl|my_center|LOCUS_04450 24495 23923 gene locus_tag LOCUS_04460 gene rplF 24495 23923 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765429.1 protein_id gnl|my_center|LOCUS_04460 24905 24510 gene locus_tag LOCUS_04470 gene rpsH 24905 24510 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762043.1 protein_id gnl|my_center|LOCUS_04470 25274 24972 gene locus_tag LOCUS_04480 gene rpsN 25274 24972 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791558.1 protein_id gnl|my_center|LOCUS_04480 25834 25280 gene locus_tag LOCUS_04490 gene rplE 25834 25280 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791556.1 protein_id gnl|my_center|LOCUS_04490 26151 25834 gene locus_tag LOCUS_04500 gene rplX 26151 25834 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_04500 26536 26171 gene locus_tag LOCUS_04510 gene rplN 26536 26171 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296340.1 protein_id gnl|my_center|LOCUS_04510 >Feature sequence016 1018 191 gene locus_tag LOCUS_04520 gene rplB 1018 191 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791545.1 protein_id gnl|my_center|LOCUS_04520 1317 1021 gene locus_tag LOCUS_04530 gene rplW 1317 1021 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007747932.1 protein_id gnl|my_center|LOCUS_04530 1963 1334 gene locus_tag LOCUS_04540 gene rplD 1963 1334 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_04540 2577 1963 gene locus_tag LOCUS_04550 gene rplC 2577 1963 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_04550 2902 2597 gene locus_tag LOCUS_04560 gene rpsJ 2902 2597 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782187.1 protein_id gnl|my_center|LOCUS_04560 5095 2981 gene locus_tag LOCUS_04570 gene fusA 5095 2981 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791539.1 protein_id gnl|my_center|LOCUS_04570 5591 5115 gene locus_tag LOCUS_04580 gene rpsG 5591 5115 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791536.1 protein_id gnl|my_center|LOCUS_04580 6130 5750 gene locus_tag LOCUS_04590 gene rpsL 6130 5750 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 protein_id gnl|my_center|LOCUS_04590 6653 6327 gene locus_tag LOCUS_04600 6653 6327 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_04600 11126 6792 gene locus_tag LOCUS_04610 gene rpoC 11126 6792 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108455.1 protein_id gnl|my_center|LOCUS_04610 14966 11154 gene locus_tag LOCUS_04620 gene rpoB 14966 11154 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762029.1 protein_id gnl|my_center|LOCUS_04620 15448 15074 gene locus_tag LOCUS_04630 gene rplL 15448 15074 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558082.1 protein_id gnl|my_center|LOCUS_04630 16022 15504 gene locus_tag LOCUS_04640 gene rplJ 16022 15504 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762028.1 protein_id gnl|my_center|LOCUS_04640 16733 16035 gene locus_tag LOCUS_04650 gene rplA 16733 16035 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782161.1 protein_id gnl|my_center|LOCUS_04650 17194 16754 gene locus_tag LOCUS_04660 gene rplK 17194 16754 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791514.1 protein_id gnl|my_center|LOCUS_04660 17794 17252 gene locus_tag LOCUS_04670 gene nusG 17794 17252 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296362.1 protein_id gnl|my_center|LOCUS_04670 18001 17804 gene locus_tag LOCUS_04680 gene secE 18001 17804 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782157.1 protein_id gnl|my_center|LOCUS_04680 18089 18016 gene locus_tag LOCUS_t00080 18089 18016 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 19362 18142 gene locus_tag LOCUS_04690 gene tuf 19362 18142 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762026.1 protein_id gnl|my_center|LOCUS_04690 19512 19440 gene locus_tag LOCUS_t00090 19512 19440 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 19593 19520 gene locus_tag LOCUS_t00100 19593 19520 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 19688 19606 gene locus_tag LOCUS_t00110 19688 19606 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 19782 19708 gene locus_tag LOCUS_t00120 19782 19708 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 20183 19884 gene locus_tag LOCUS_04700 gene raiA 20183 19884 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782154.1 protein_id gnl|my_center|LOCUS_04700 21084 20203 gene locus_tag LOCUS_04710 gene xerC 21084 20203 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_04710 21353 21162 gene locus_tag LOCUS_04720 gene rpsU 21353 21162 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782152.1 protein_id gnl|my_center|LOCUS_04720 23289 21478 gene locus_tag LOCUS_04730 23289 21478 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765424.1 protein_id gnl|my_center|LOCUS_04730 23470 24480 gene locus_tag LOCUS_04740 23470 24480 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763609.1 protein_id gnl|my_center|LOCUS_04740 >Feature sequence017 2224 740 gene locus_tag LOCUS_04750 2224 740 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108742.1 protein_id gnl|my_center|LOCUS_04750 3479 2253 gene locus_tag LOCUS_04760 3479 2253 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108740.1 protein_id gnl|my_center|LOCUS_04760 4207 3548 gene locus_tag LOCUS_04770 4207 3548 CDS product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139327955.1 protein_id gnl|my_center|LOCUS_04770 6304 4217 gene locus_tag LOCUS_04780 6304 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 6740 7102 gene locus_tag LOCUS_04790 6740 7102 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681342.1 protein_id gnl|my_center|LOCUS_04790 7126 8229 gene locus_tag LOCUS_04800 7126 8229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 9792 10004 gene locus_tag LOCUS_04810 9792 10004 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202295.1 protein_id gnl|my_center|LOCUS_04810 10025 13279 gene locus_tag LOCUS_04820 10025 13279 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_04820 13282 16668 gene locus_tag LOCUS_04830 13282 16668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 16649 17281 gene locus_tag LOCUS_04840 16649 17281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 17346 17984 gene locus_tag LOCUS_04850 17346 17984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 18114 18377 gene locus_tag LOCUS_04860 18114 18377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 18380 18841 gene locus_tag LOCUS_04870 18380 18841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 20612 19287 gene locus_tag LOCUS_04880 20612 19287 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065247.1 protein_id gnl|my_center|LOCUS_04880 21911 22567 gene locus_tag LOCUS_04890 21911 22567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 22756 23376 gene locus_tag LOCUS_04900 22756 23376 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817347.1 protein_id gnl|my_center|LOCUS_04900 24391 23399 gene locus_tag LOCUS_04910 24391 23399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 24709 24635 gene locus_tag LOCUS_t00130 24709 24635 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence018 68 1240 gene locus_tag LOCUS_04920 68 1240 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_04920 1305 1823 gene locus_tag LOCUS_04930 1305 1823 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814383.1 protein_id gnl|my_center|LOCUS_04930 1852 2037 gene locus_tag LOCUS_04940 gene rpmF 1852 2037 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562387.1 protein_id gnl|my_center|LOCUS_04940 2037 3059 gene locus_tag LOCUS_04950 2037 3059 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760764.1 protein_id gnl|my_center|LOCUS_04950 3151 4032 gene locus_tag LOCUS_04960 gene era 3151 4032 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203581.1 protein_id gnl|my_center|LOCUS_04960 4277 5590 gene locus_tag LOCUS_04970 gene der 4277 5590 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782289.1 protein_id gnl|my_center|LOCUS_04970 5617 5991 gene locus_tag LOCUS_04980 5617 5991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 6789 6013 gene locus_tag LOCUS_04990 6789 6013 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764109.1 protein_id gnl|my_center|LOCUS_04990 7459 6791 gene locus_tag LOCUS_05000 7459 6791 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_05000 7684 8490 gene locus_tag LOCUS_05010 gene lptB 7684 8490 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782293.1 protein_id gnl|my_center|LOCUS_05010 8669 10027 gene locus_tag LOCUS_05020 gene tig 8669 10027 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_05020 10168 10860 gene locus_tag LOCUS_05030 gene clpP 10168 10860 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297164.1 protein_id gnl|my_center|LOCUS_05030 10863 12113 gene locus_tag LOCUS_05040 gene clpX 10863 12113 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764111.1 protein_id gnl|my_center|LOCUS_05040 12146 14374 gene locus_tag LOCUS_05050 gene recQ 12146 14374 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_05050 14595 16079 gene locus_tag LOCUS_05060 gene guaB 14595 16079 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760772.1 protein_id gnl|my_center|LOCUS_05060 16100 17530 gene locus_tag LOCUS_05070 16100 17530 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108995.1 protein_id gnl|my_center|LOCUS_05070 17541 18986 gene locus_tag LOCUS_05080 17541 18986 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760775.1 protein_id gnl|my_center|LOCUS_05080 18983 20650 gene locus_tag LOCUS_05090 18983 20650 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764125.1 protein_id gnl|my_center|LOCUS_05090 20650 22572 gene locus_tag LOCUS_05100 gene mutL 20650 22572 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993641.1 protein_id gnl|my_center|LOCUS_05100 22656 22731 gene locus_tag LOCUS_t00140 22656 22731 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 22887 22978 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23306 23488 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23569 23973 gene locus_tag LOCUS_05110 23569 23973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 >Feature sequence019 <1 663 gene locus_tag LOCUS_05120 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786005.1:peptidase T 682 2964 gene locus_tag LOCUS_05130 682 2964 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786012.1 protein_id gnl|my_center|LOCUS_05130 5814 3013 gene locus_tag LOCUS_05140 5814 3013 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108148.1 protein_id gnl|my_center|LOCUS_05140 6337 5882 gene locus_tag LOCUS_05150 6337 5882 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108149.1 protein_id gnl|my_center|LOCUS_05150 8293 6428 gene locus_tag LOCUS_05160 8293 6428 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794777.1 protein_id gnl|my_center|LOCUS_05160 8872 8393 gene locus_tag LOCUS_05170 gene queF 8872 8393 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786209.1 protein_id gnl|my_center|LOCUS_05170 9595 8879 gene locus_tag LOCUS_05180 9595 8879 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762200.1 protein_id gnl|my_center|LOCUS_05180 9713 10795 gene locus_tag LOCUS_05190 9713 10795 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_05190 11785 10916 gene locus_tag LOCUS_05200 11785 10916 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767386.1 protein_id gnl|my_center|LOCUS_05200 12249 11794 gene locus_tag LOCUS_05210 12249 11794 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785768.1 protein_id gnl|my_center|LOCUS_05210 12903 12274 gene locus_tag LOCUS_05220 gene coaE 12903 12274 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764748.1 protein_id gnl|my_center|LOCUS_05220 13792 12890 gene locus_tag LOCUS_05230 13792 12890 CDS product YbbR-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109340.1 protein_id gnl|my_center|LOCUS_05230 14174 13857 gene locus_tag LOCUS_05240 gene yajC 14174 13857 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_05240 15212 14211 gene locus_tag LOCUS_05250 gene nusB 15212 14211 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760339.1 protein_id gnl|my_center|LOCUS_05250 15443 16075 gene locus_tag LOCUS_05260 15443 16075 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760337.1 protein_id gnl|my_center|LOCUS_05260 16091 16663 gene locus_tag LOCUS_05270 gene pth 16091 16663 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_05270 16678 17091 gene locus_tag LOCUS_05280 16678 17091 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760336.1 protein_id gnl|my_center|LOCUS_05280 17104 17673 gene locus_tag LOCUS_05290 gene purN 17104 17673 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108788.1 protein_id gnl|my_center|LOCUS_05290 20690 17751 gene locus_tag LOCUS_05300 20690 17751 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_05300 21007 22053 gene locus_tag LOCUS_05310 gene aroB 21007 22053 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784805.1 protein_id gnl|my_center|LOCUS_05310 23079 22060 gene locus_tag LOCUS_05320 23079 22060 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786035.1 protein_id gnl|my_center|LOCUS_05320 >Feature sequence020 1036 563 gene locus_tag LOCUS_05330 1036 563 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993802.1 protein_id gnl|my_center|LOCUS_05330 2177 1185 gene locus_tag LOCUS_05340 2177 1185 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761810.1 protein_id gnl|my_center|LOCUS_05340 3131 2256 gene locus_tag LOCUS_05350 3131 2256 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761810.1 protein_id gnl|my_center|LOCUS_05350 3763 3158 gene locus_tag LOCUS_05360 3763 3158 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 protein_id gnl|my_center|LOCUS_05360 3883 4584 gene locus_tag LOCUS_05370 3883 4584 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108550.1 protein_id gnl|my_center|LOCUS_05370 4622 4647 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6382 4739 gene locus_tag LOCUS_05380 6382 4739 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_05380 6551 8212 gene locus_tag LOCUS_05390 6551 8212 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791317.1 protein_id gnl|my_center|LOCUS_05390 8940 8281 gene locus_tag LOCUS_05400 gene upp 8940 8281 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761972.1 protein_id gnl|my_center|LOCUS_05400 9185 10801 gene locus_tag LOCUS_05410 gene pckA 9185 10801 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761973.1 protein_id gnl|my_center|LOCUS_05410 11082 12398 gene locus_tag LOCUS_05420 11082 12398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 12419 13132 gene locus_tag LOCUS_05430 12419 13132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 13136 13891 gene locus_tag LOCUS_05440 13136 13891 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766989.1 protein_id gnl|my_center|LOCUS_05440 13970 16531 gene locus_tag LOCUS_05450 13970 16531 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108949.1 protein_id gnl|my_center|LOCUS_05450 16614 17111 gene locus_tag LOCUS_05460 16614 17111 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_05460 17174 17674 gene locus_tag LOCUS_05470 17174 17674 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536380.1 protein_id gnl|my_center|LOCUS_05470 17678 18181 gene locus_tag LOCUS_05480 17678 18181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 18210 19052 gene locus_tag LOCUS_05490 gene murI 18210 19052 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202028.1 protein_id gnl|my_center|LOCUS_05490 19061 19396 gene locus_tag LOCUS_05500 gene rbfA 19061 19396 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791944.1 protein_id gnl|my_center|LOCUS_05500 19396 20625 gene locus_tag LOCUS_05510 19396 20625 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 protein_id gnl|my_center|LOCUS_05510 21270 20632 gene locus_tag LOCUS_05520 21270 20632 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765299.1 protein_id gnl|my_center|LOCUS_05520 21707 21276 gene locus_tag LOCUS_05530 gene aroQ 21707 21276 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791941.1 protein_id gnl|my_center|LOCUS_05530 21759 22676 gene locus_tag LOCUS_05540 gene xerD 21759 22676 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_05540 >Feature sequence021 656 1321 gene locus_tag LOCUS_05550 656 1321 CDS product DUF3822 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769417.1 protein_id gnl|my_center|LOCUS_05550 1340 1912 gene locus_tag LOCUS_05560 1340 1912 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760894.1 protein_id gnl|my_center|LOCUS_05560 3287 1863 gene locus_tag LOCUS_05570 gene cls 3287 1863 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764220.1 protein_id gnl|my_center|LOCUS_05570 3879 3289 gene locus_tag LOCUS_05580 3879 3289 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840540.1 protein_id gnl|my_center|LOCUS_05580 4198 3866 gene locus_tag LOCUS_05590 4198 3866 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764612.1 protein_id gnl|my_center|LOCUS_05590 6166 4205 gene locus_tag LOCUS_05600 gene dnaG 6166 4205 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802118.1 protein_id gnl|my_center|LOCUS_05600 7849 6212 gene locus_tag LOCUS_05610 7849 6212 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840507.1 protein_id gnl|my_center|LOCUS_05610 8062 8931 gene locus_tag LOCUS_05620 8062 8931 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789703.1 protein_id gnl|my_center|LOCUS_05620 8946 9968 gene locus_tag LOCUS_05630 8946 9968 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763251.1 protein_id gnl|my_center|LOCUS_05630 9973 11706 gene locus_tag LOCUS_05640 9973 11706 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763249.1 protein_id gnl|my_center|LOCUS_05640 12018 11815 gene locus_tag LOCUS_05650 12018 11815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 11957 12295 gene locus_tag LOCUS_05660 11957 12295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 13478 12324 gene locus_tag LOCUS_05670 13478 12324 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789244.1 protein_id gnl|my_center|LOCUS_05670 14734 13451 gene locus_tag LOCUS_05680 14734 13451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 15009 14731 gene locus_tag LOCUS_05690 15009 14731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 15292 16887 gene locus_tag LOCUS_05700 gene nadB 15292 16887 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783573.1 protein_id gnl|my_center|LOCUS_05700 <22732 16914 gene locus_tag LOCUS_05710 <22732 16914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062175791.1:cell surface protein SprA >Feature sequence022 688 939 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 958 1275 gene locus_tag LOCUS_05720 958 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 1365 2360 gene locus_tag LOCUS_05730 1365 2360 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107327.1 protein_id gnl|my_center|LOCUS_05730 2525 2950 gene locus_tag LOCUS_05740 2525 2950 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109028.1 protein_id gnl|my_center|LOCUS_05740 3248 5683 gene locus_tag LOCUS_05750 gene thrA 3248 5683 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_05750 5706 7001 gene locus_tag LOCUS_05760 5706 7001 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763759.1 protein_id gnl|my_center|LOCUS_05760 7006 8334 gene locus_tag LOCUS_05770 gene thrC 7006 8334 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_05770 8491 11445 gene locus_tag LOCUS_05780 8491 11445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 12564 11668 gene locus_tag LOCUS_05790 12564 11668 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765521.1 protein_id gnl|my_center|LOCUS_05790 12635 14251 gene locus_tag LOCUS_05800 12635 14251 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763401.1 protein_id gnl|my_center|LOCUS_05800 14302 14925 gene locus_tag LOCUS_05810 14302 14925 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107672.1 protein_id gnl|my_center|LOCUS_05810 14961 16100 gene locus_tag LOCUS_05820 gene dnaJ 14961 16100 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763399.1 protein_id gnl|my_center|LOCUS_05820 15917 16007 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16163 17479 gene locus_tag LOCUS_05830 16163 17479 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_05830 17656 18741 gene locus_tag LOCUS_05840 17656 18741 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766110.1 protein_id gnl|my_center|LOCUS_05840 18770 20104 gene locus_tag LOCUS_05850 18770 20104 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760657.1 protein_id gnl|my_center|LOCUS_05850 20127 21287 gene locus_tag LOCUS_05860 gene galK 20127 21287 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 protein_id gnl|my_center|LOCUS_05860 21476 22666 gene locus_tag LOCUS_05870 21476 22666 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107212.1 protein_id gnl|my_center|LOCUS_05870 >Feature sequence023 3438 2323 gene locus_tag LOCUS_05880 3438 2323 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203237.1 protein_id gnl|my_center|LOCUS_05880 3687 4760 gene locus_tag LOCUS_05890 3687 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107960.1 protein_id gnl|my_center|LOCUS_05890 4832 6472 gene locus_tag LOCUS_05900 4832 6472 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055228983.1 protein_id gnl|my_center|LOCUS_05900 6475 7944 gene locus_tag LOCUS_05910 6475 7944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 7969 8748 gene locus_tag LOCUS_05920 gene truA 7969 8748 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785168.1 protein_id gnl|my_center|LOCUS_05920 8810 9739 gene locus_tag LOCUS_05930 8810 9739 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109171.1 protein_id gnl|my_center|LOCUS_05930 9843 10733 gene locus_tag LOCUS_05940 gene dapA 9843 10733 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202857.1 protein_id gnl|my_center|LOCUS_05940 10743 11633 gene locus_tag LOCUS_05950 10743 11633 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775503.1 protein_id gnl|my_center|LOCUS_05950 12957 11674 gene locus_tag LOCUS_05960 12957 11674 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761151.1 protein_id gnl|my_center|LOCUS_05960 14148 13084 gene locus_tag LOCUS_05970 14148 13084 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815431.1 protein_id gnl|my_center|LOCUS_05970 14300 15700 gene locus_tag LOCUS_05980 gene uxaC 14300 15700 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_05980 17825 18021 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18047 18667 gene locus_tag LOCUS_05990 18047 18667 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435157.1 protein_id gnl|my_center|LOCUS_05990 18980 21448 gene locus_tag LOCUS_06000 gene pheT 18980 21448 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107364.1 protein_id gnl|my_center|LOCUS_06000 21475 22221 gene locus_tag LOCUS_06010 21475 22221 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761252.1 protein_id gnl|my_center|LOCUS_06010 22548 22330 gene locus_tag LOCUS_06020 22548 22330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 >Feature sequence024 733 26 gene locus_tag LOCUS_06030 733 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 1616 774 gene locus_tag LOCUS_06040 1616 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 3051 1597 gene locus_tag LOCUS_06050 3051 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 3314 3048 gene locus_tag LOCUS_06060 3314 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 4367 3315 gene locus_tag LOCUS_06070 4367 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 4849 4547 gene locus_tag LOCUS_06080 4849 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 5076 4849 gene locus_tag LOCUS_06090 5076 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 6329 5724 gene locus_tag LOCUS_06100 6329 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 6714 6319 gene locus_tag LOCUS_06110 6714 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 7837 7172 gene locus_tag LOCUS_06120 gene radC 7837 7172 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801604.1 protein_id gnl|my_center|LOCUS_06120 8479 7874 gene locus_tag LOCUS_06130 8479 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 10513 8867 gene locus_tag LOCUS_06140 10513 8867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 11084 10503 gene locus_tag LOCUS_06150 11084 10503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 11380 11081 gene locus_tag LOCUS_06160 11380 11081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 11807 11367 gene locus_tag LOCUS_06170 11807 11367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 12792 11839 gene locus_tag LOCUS_06180 12792 11839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 13722 12868 gene locus_tag LOCUS_06190 13722 12868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 14722 13751 gene locus_tag LOCUS_06200 14722 13751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 15838 14738 gene locus_tag LOCUS_06210 15838 14738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 16316 15906 gene locus_tag LOCUS_06220 16316 15906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 16941 16444 gene locus_tag LOCUS_06230 16941 16444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 20686 17408 gene locus_tag LOCUS_06240 20686 17408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 21283 20735 gene locus_tag LOCUS_06250 21283 20735 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107489.1 protein_id gnl|my_center|LOCUS_06250 21480 21271 gene locus_tag LOCUS_06260 21480 21271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 21602 21991 gene locus_tag LOCUS_06270 21602 21991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 >Feature sequence025 3491 1917 gene locus_tag LOCUS_06280 3491 1917 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229316.1 protein_id gnl|my_center|LOCUS_06280 5322 3640 gene locus_tag LOCUS_06290 5322 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 5727 5844 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7821 9335 gene locus_tag LOCUS_06300 7821 9335 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890798.1 protein_id gnl|my_center|LOCUS_06300 9420 12485 gene locus_tag LOCUS_06310 9420 12485 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107218.1 protein_id gnl|my_center|LOCUS_06310 12496 14379 gene locus_tag LOCUS_06320 12496 14379 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765813.1 protein_id gnl|my_center|LOCUS_06320 14458 17193 gene locus_tag LOCUS_06330 14458 17193 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021929855.1 protein_id gnl|my_center|LOCUS_06330 18398 18724 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18916 19917 gene locus_tag LOCUS_06340 18916 19917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 19923 21602 gene locus_tag LOCUS_06350 19923 21602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 >Feature sequence026 1191 502 gene locus_tag LOCUS_06360 gene radC 1191 502 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801604.1 protein_id gnl|my_center|LOCUS_06360 2283 1246 gene locus_tag LOCUS_06370 2283 1246 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784336.1 protein_id gnl|my_center|LOCUS_06370 2922 2356 gene locus_tag LOCUS_06380 gene efp 2922 2356 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784338.1 protein_id gnl|my_center|LOCUS_06380 3083 3322 gene locus_tag LOCUS_06390 3083 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 3424 4128 gene locus_tag LOCUS_06400 3424 4128 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784340.1 protein_id gnl|my_center|LOCUS_06400 4128 5222 gene locus_tag LOCUS_06410 4128 5222 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762648.1 protein_id gnl|my_center|LOCUS_06410 5241 6236 gene locus_tag LOCUS_06420 5241 6236 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202023.1 protein_id gnl|my_center|LOCUS_06420 6247 7398 gene locus_tag LOCUS_06430 6247 7398 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813548.1 protein_id gnl|my_center|LOCUS_06430 8613 7579 gene locus_tag LOCUS_06440 8613 7579 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456217.1 protein_id gnl|my_center|LOCUS_06440 9633 8671 gene locus_tag LOCUS_06450 9633 8671 CDS product acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762653.1 protein_id gnl|my_center|LOCUS_06450 10924 9674 gene locus_tag LOCUS_06460 10924 9674 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108943.1 protein_id gnl|my_center|LOCUS_06460 12012 10942 gene locus_tag LOCUS_06470 gene proB 12012 10942 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202027.1 protein_id gnl|my_center|LOCUS_06470 13747 12062 gene locus_tag LOCUS_06480 13747 12062 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784390.1 protein_id gnl|my_center|LOCUS_06480 14316 13762 gene locus_tag LOCUS_06490 14316 13762 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784392.1 protein_id gnl|my_center|LOCUS_06490 15258 14476 gene locus_tag LOCUS_06500 gene proC 15258 14476 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796496.1 protein_id gnl|my_center|LOCUS_06500 16402 15260 gene locus_tag LOCUS_06510 16402 15260 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762695.1 protein_id gnl|my_center|LOCUS_06510 17405 16404 gene locus_tag LOCUS_06520 gene argC 17405 16404 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762696.1 protein_id gnl|my_center|LOCUS_06520 17605 17402 gene locus_tag LOCUS_06530 17605 17402 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767912.1 protein_id gnl|my_center|LOCUS_06530 18884 17685 gene locus_tag LOCUS_06540 18884 17685 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_06540 19532 18930 gene locus_tag LOCUS_06550 19532 18930 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_06550 20026 19580 gene locus_tag LOCUS_06560 20026 19580 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762699.1 protein_id gnl|my_center|LOCUS_06560 >Feature sequence027 369 442 gene locus_tag LOCUS_t00150 369 442 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 653 1720 gene locus_tag LOCUS_06570 653 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 3611 1743 gene locus_tag LOCUS_06580 3611 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 8431 3608 gene locus_tag LOCUS_06590 8431 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 9047 8448 gene locus_tag LOCUS_06600 9047 8448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 9581 9054 gene locus_tag LOCUS_06610 9581 9054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 10096 9596 gene locus_tag LOCUS_06620 10096 9596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 10602 10213 gene locus_tag LOCUS_06630 10602 10213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 12258 10606 gene locus_tag LOCUS_06640 12258 10606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 14097 12685 gene locus_tag LOCUS_06650 14097 12685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 15049 14099 gene locus_tag LOCUS_06660 15049 14099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 16134 15046 gene locus_tag LOCUS_06670 16134 15046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 16322 16131 gene locus_tag LOCUS_06680 16322 16131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 17458 16334 gene locus_tag LOCUS_06690 17458 16334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 18852 17455 gene locus_tag LOCUS_06700 18852 17455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 19479 18904 gene locus_tag LOCUS_06710 19479 18904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 >Feature sequence028 735 82 gene locus_tag LOCUS_06720 gene queC 735 82 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972958.1 protein_id gnl|my_center|LOCUS_06720 918 2168 gene locus_tag LOCUS_06730 918 2168 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203214.1 protein_id gnl|my_center|LOCUS_06730 3263 3461 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4907 4113 gene locus_tag LOCUS_06740 4907 4113 CDS product DUF4738 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787724.1 protein_id gnl|my_center|LOCUS_06740 6283 4907 gene locus_tag LOCUS_06750 6283 4907 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107472.1 protein_id gnl|my_center|LOCUS_06750 6827 6276 gene locus_tag LOCUS_06760 gene rfbC 6827 6276 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787720.1 protein_id gnl|my_center|LOCUS_06760 6999 8030 gene locus_tag LOCUS_06770 6999 8030 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107471.1 protein_id gnl|my_center|LOCUS_06770 8037 8576 gene locus_tag LOCUS_06780 8037 8576 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107470.1 protein_id gnl|my_center|LOCUS_06780 8738 9544 gene locus_tag LOCUS_06790 gene purU 8738 9544 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762395.1 protein_id gnl|my_center|LOCUS_06790 9040 9100 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9544 10161 gene locus_tag LOCUS_06800 gene hisH 9544 10161 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107745.1 protein_id gnl|my_center|LOCUS_06800 10165 10905 gene locus_tag LOCUS_06810 gene hisA 10165 10905 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203120.1 protein_id gnl|my_center|LOCUS_06810 10912 11679 gene locus_tag LOCUS_06820 gene hisF 10912 11679 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762398.1 protein_id gnl|my_center|LOCUS_06820 11685 12338 gene locus_tag LOCUS_06830 gene hisIE 11685 12338 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762399.1 protein_id gnl|my_center|LOCUS_06830 12356 13081 gene locus_tag LOCUS_06840 12356 13081 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762400.1 protein_id gnl|my_center|LOCUS_06840 13106 14431 gene locus_tag LOCUS_06850 13106 14431 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764912.1 protein_id gnl|my_center|LOCUS_06850 14447 15604 gene locus_tag LOCUS_06860 gene lysA 14447 15604 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762402.1 protein_id gnl|my_center|LOCUS_06860 15657 16799 gene locus_tag LOCUS_06870 15657 16799 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_06870 16909 17613 gene locus_tag LOCUS_06880 16909 17613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 >Feature sequence029 <1 1752 gene locus_tag LOCUS_06890 <1 1752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765772.1:beta-galactosidase 1773 4574 gene locus_tag LOCUS_06900 1773 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 4798 5562 gene locus_tag LOCUS_06910 4798 5562 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107584.1 protein_id gnl|my_center|LOCUS_06910 5637 7106 gene locus_tag LOCUS_06920 5637 7106 CDS product DUF4992 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765814.1 protein_id gnl|my_center|LOCUS_06920 7133 10477 gene locus_tag LOCUS_06930 7133 10477 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107583.1 protein_id gnl|my_center|LOCUS_06930 10497 12686 gene locus_tag LOCUS_06940 10497 12686 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765815.1 protein_id gnl|my_center|LOCUS_06940 12455 12596 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13553 12882 gene locus_tag LOCUS_06950 13553 12882 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786122.1 protein_id gnl|my_center|LOCUS_06950 14952 13648 gene locus_tag LOCUS_06960 14952 13648 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108918.1 protein_id gnl|my_center|LOCUS_06960 15058 15951 gene locus_tag LOCUS_06970 gene folP 15058 15951 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767053.1 protein_id gnl|my_center|LOCUS_06970 15948 16721 gene locus_tag LOCUS_06980 gene cdaA 15948 16721 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779023.1 protein_id gnl|my_center|LOCUS_06980 16839 17885 gene locus_tag LOCUS_06990 gene pta 16839 17885 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762631.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence030 <1 3087 gene locus_tag LOCUS_07000 <1 3087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963080.1:efflux RND transporter permease subunit 3084 4535 gene locus_tag LOCUS_07010 3084 4535 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_07010 5657 4563 gene locus_tag LOCUS_07020 gene dinB 5657 4563 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768057.1 protein_id gnl|my_center|LOCUS_07020 6470 6586 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6694 7494 gene locus_tag LOCUS_07030 6694 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 7642 7801 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8882 7902 gene locus_tag LOCUS_07040 gene ribD 8882 7902 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784375.1 protein_id gnl|my_center|LOCUS_07040 8941 9816 gene locus_tag LOCUS_07050 gene prmC 8941 9816 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766986.1 protein_id gnl|my_center|LOCUS_07050 9813 10295 gene locus_tag LOCUS_07060 9813 10295 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762666.1 protein_id gnl|my_center|LOCUS_07060 10320 11015 gene locus_tag LOCUS_07070 10320 11015 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_07070 11123 11755 gene locus_tag LOCUS_07080 gene pyrE 11123 11755 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784381.1 protein_id gnl|my_center|LOCUS_07080 11776 12195 gene locus_tag LOCUS_07090 11776 12195 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796501.1 protein_id gnl|my_center|LOCUS_07090 12240 13577 gene locus_tag LOCUS_07100 gene argH 12240 13577 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784384.1 protein_id gnl|my_center|LOCUS_07100 13767 14186 gene locus_tag LOCUS_07110 13767 14186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 14254 14327 gene locus_tag LOCUS_t00160 14254 14327 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 14348 14434 gene locus_tag LOCUS_t00170 14348 14434 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14461 15471 gene locus_tag LOCUS_07120 14461 15471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 15485 17032 gene locus_tag LOCUS_07130 15485 17032 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_07130 17105 17656 gene locus_tag LOCUS_07140 17105 17656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 >Feature sequence031 1113 1443 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1819 3201 gene locus_tag LOCUS_07150 gene rmuC 1819 3201 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478725.1 protein_id gnl|my_center|LOCUS_07150 3666 6254 gene locus_tag LOCUS_07160 gene clpB 3666 6254 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764749.1 protein_id gnl|my_center|LOCUS_07160 8198 6306 gene locus_tag LOCUS_07170 8198 6306 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767043.1 protein_id gnl|my_center|LOCUS_07170 8695 9942 gene locus_tag LOCUS_07180 gene hflX 8695 9942 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759581.1 protein_id gnl|my_center|LOCUS_07180 9966 11795 gene locus_tag LOCUS_07190 9966 11795 CDS product DUF4954 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108193.1 protein_id gnl|my_center|LOCUS_07190 11814 14732 gene locus_tag LOCUS_07200 11814 14732 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303123.1 protein_id gnl|my_center|LOCUS_07200 14762 16414 gene locus_tag LOCUS_07210 14762 16414 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759583.1 protein_id gnl|my_center|LOCUS_07210 >Feature sequence032 241 2823 gene locus_tag LOCUS_07220 241 2823 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202860.1 protein_id gnl|my_center|LOCUS_07220 2933 3006 gene locus_tag LOCUS_t00180 2933 3006 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3015 3088 gene locus_tag LOCUS_t00190 3015 3088 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3611 3093 gene locus_tag LOCUS_07230 3611 3093 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767850.1 protein_id gnl|my_center|LOCUS_07230 4415 3633 gene locus_tag LOCUS_07240 4415 3633 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767849.1 protein_id gnl|my_center|LOCUS_07240 4611 5471 gene locus_tag LOCUS_07250 4611 5471 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767845.1 protein_id gnl|my_center|LOCUS_07250 6537 5437 gene locus_tag LOCUS_07260 6537 5437 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107778.1 protein_id gnl|my_center|LOCUS_07260 7194 6547 gene locus_tag LOCUS_07270 7194 6547 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108448.1 protein_id gnl|my_center|LOCUS_07270 7335 9632 gene locus_tag LOCUS_07280 7335 9632 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790429.1 protein_id gnl|my_center|LOCUS_07280 10034 11053 gene locus_tag LOCUS_07290 10034 11053 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759848.1 protein_id gnl|my_center|LOCUS_07290 11143 11517 gene locus_tag LOCUS_07300 11143 11517 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763504.1 protein_id gnl|my_center|LOCUS_07300 11657 11836 gene locus_tag LOCUS_07310 11657 11836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 13672 12419 gene locus_tag LOCUS_07320 13672 12419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 15447 13957 gene locus_tag LOCUS_07330 15447 13957 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454621.1 protein_id gnl|my_center|LOCUS_07330 16267 15461 gene locus_tag LOCUS_07340 16267 15461 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201882.1 protein_id gnl|my_center|LOCUS_07340 16813 16352 gene locus_tag LOCUS_07350 16813 16352 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107333.1 protein_id gnl|my_center|LOCUS_07350 >Feature sequence033 1243 80 gene locus_tag LOCUS_07360 gene rfbB 1243 80 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766020.1 protein_id gnl|my_center|LOCUS_07360 2125 1247 gene locus_tag LOCUS_07370 gene rfbD 2125 1247 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107282.1 protein_id gnl|my_center|LOCUS_07370 2740 2147 gene locus_tag LOCUS_07380 gene rfbC 2740 2147 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107281.1 protein_id gnl|my_center|LOCUS_07380 3866 2745 gene locus_tag LOCUS_07390 3866 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 4972 3842 gene locus_tag LOCUS_07400 4972 3842 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837186.1 protein_id gnl|my_center|LOCUS_07400 6318 5071 gene locus_tag LOCUS_07410 6318 5071 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928857.1 protein_id gnl|my_center|LOCUS_07410 7645 6323 gene locus_tag LOCUS_07420 7645 6323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 9530 8397 gene locus_tag LOCUS_07430 9530 8397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 11283 9535 gene locus_tag LOCUS_07440 11283 9535 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068374.1 protein_id gnl|my_center|LOCUS_07440 11918 11289 gene locus_tag LOCUS_07450 11918 11289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 12697 11897 gene locus_tag LOCUS_07460 12697 11897 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830355.1 protein_id gnl|my_center|LOCUS_07460 13364 12723 gene locus_tag LOCUS_07470 13364 12723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 13707 13450 gene locus_tag LOCUS_07480 13707 13450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 14786 13710 gene locus_tag LOCUS_07490 14786 13710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 16058 14790 gene locus_tag LOCUS_07500 16058 14790 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739314.1 protein_id gnl|my_center|LOCUS_07500 16664 16062 gene locus_tag LOCUS_07510 16664 16062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 >Feature sequence034 2110 320 gene locus_tag LOCUS_07520 2110 320 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203224.1 protein_id gnl|my_center|LOCUS_07520 4096 2183 gene locus_tag LOCUS_07530 gene pulA 4096 2183 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203210.1 protein_id gnl|my_center|LOCUS_07530 6225 4093 gene locus_tag LOCUS_07540 6225 4093 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_07540 8940 6250 gene locus_tag LOCUS_07550 8940 6250 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203461.1 protein_id gnl|my_center|LOCUS_07550 10358 9057 gene locus_tag LOCUS_07560 10358 9057 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_07560 11398 10397 gene locus_tag LOCUS_07570 11398 10397 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_07570 11741 14971 gene locus_tag LOCUS_07580 11741 14971 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108938.1 protein_id gnl|my_center|LOCUS_07580 14473 14665 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14993 16609 gene locus_tag LOCUS_07590 14993 16609 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789572.1 protein_id gnl|my_center|LOCUS_07590 >Feature sequence035 846 31 gene locus_tag LOCUS_07600 846 31 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762943.1 protein_id gnl|my_center|LOCUS_07600 2711 846 gene locus_tag LOCUS_07610 2711 846 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796864.1 protein_id gnl|my_center|LOCUS_07610 4328 2820 gene locus_tag LOCUS_07620 4328 2820 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_07620 6023 4485 gene locus_tag LOCUS_07630 6023 4485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 8886 6076 gene locus_tag LOCUS_07640 8886 6076 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109087.1 protein_id gnl|my_center|LOCUS_07640 12180 9085 gene locus_tag LOCUS_07650 12180 9085 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_07650 13505 12417 gene locus_tag LOCUS_07660 13505 12417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 14781 13519 gene locus_tag LOCUS_07670 gene fabF 14781 13519 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201893.1 protein_id gnl|my_center|LOCUS_07670 15039 14803 gene locus_tag LOCUS_07680 15039 14803 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_07680 15259 15864 gene locus_tag LOCUS_07690 15259 15864 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_07690 >Feature sequence036 591 322 gene locus_tag LOCUS_07700 gene rpsO 591 322 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791955.1 protein_id gnl|my_center|LOCUS_07700 790 2601 gene locus_tag LOCUS_07710 gene typA 790 2601 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_07710 3129 2650 gene locus_tag LOCUS_07720 3129 2650 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_07720 3898 3215 gene locus_tag LOCUS_07730 gene mtnN 3898 3215 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579275.1 protein_id gnl|my_center|LOCUS_07730 4011 6506 gene locus_tag LOCUS_07740 4011 6506 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_07740 6733 7542 gene locus_tag LOCUS_07750 6733 7542 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764326.1 protein_id gnl|my_center|LOCUS_07750 7563 10037 gene locus_tag LOCUS_07760 7563 10037 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785097.1 protein_id gnl|my_center|LOCUS_07760 10197 11588 gene locus_tag LOCUS_07770 10197 11588 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109102.1 protein_id gnl|my_center|LOCUS_07770 11601 12569 gene locus_tag LOCUS_07780 gene kduI 11601 12569 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109101.1 protein_id gnl|my_center|LOCUS_07780 12587 14068 gene locus_tag LOCUS_07790 12587 14068 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769494.1 protein_id gnl|my_center|LOCUS_07790 15319 14579 gene locus_tag LOCUS_07800 15319 14579 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763940.1 protein_id gnl|my_center|LOCUS_07800 15716 16102 gene locus_tag LOCUS_07810 15716 16102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 >Feature sequence037 429 549 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1001 1651 gene locus_tag LOCUS_07820 1001 1651 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107864.1 protein_id gnl|my_center|LOCUS_07820 1982 2584 gene locus_tag LOCUS_07830 1982 2584 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 protein_id gnl|my_center|LOCUS_07830 2719 4062 gene locus_tag LOCUS_07840 2719 4062 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107656.1 protein_id gnl|my_center|LOCUS_07840 4762 4121 gene locus_tag LOCUS_07850 4762 4121 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_07850 4919 5965 gene locus_tag LOCUS_07860 gene mltG 4919 5965 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_07860 6544 6742 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6752 8122 gene locus_tag LOCUS_07870 6752 8122 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798520.1 protein_id gnl|my_center|LOCUS_07870 8130 9569 gene locus_tag LOCUS_07880 8130 9569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 9590 10231 gene locus_tag LOCUS_07890 9590 10231 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538559.1 protein_id gnl|my_center|LOCUS_07890 11545 10310 gene locus_tag LOCUS_07900 11545 10310 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808880.1 protein_id gnl|my_center|LOCUS_07900 12652 11549 gene locus_tag LOCUS_07910 gene gmd 12652 11549 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107662.1 protein_id gnl|my_center|LOCUS_07910 13727 12660 gene locus_tag LOCUS_07920 13727 12660 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692555.1 protein_id gnl|my_center|LOCUS_07920 14280 13960 gene locus_tag LOCUS_07930 14280 13960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 14649 14386 gene locus_tag LOCUS_07940 14649 14386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 <15651 14810 gene locus_tag LOCUS_07950 <15651 14810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765710.1:aspartate--tRNA ligase >Feature sequence038 750 1622 gene locus_tag LOCUS_07960 750 1622 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779810.1 protein_id gnl|my_center|LOCUS_07960 2205 1663 gene locus_tag LOCUS_07970 gene yfcE 2205 1663 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_07970 2339 3556 gene locus_tag LOCUS_07980 2339 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 3553 4899 gene locus_tag LOCUS_07990 3553 4899 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817866.1 protein_id gnl|my_center|LOCUS_07990 5075 6142 gene locus_tag LOCUS_08000 gene serC 5075 6142 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763483.1 protein_id gnl|my_center|LOCUS_08000 6214 7131 gene locus_tag LOCUS_08010 6214 7131 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292180.1 protein_id gnl|my_center|LOCUS_08010 7303 8550 gene locus_tag LOCUS_08020 7303 8550 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763485.1 protein_id gnl|my_center|LOCUS_08020 8585 9172 gene locus_tag LOCUS_08030 8585 9172 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794496.1 protein_id gnl|my_center|LOCUS_08030 9378 9469 gene locus_tag LOCUS_t00200 9378 9469 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10622 9717 gene locus_tag LOCUS_08040 10622 9717 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767227.1 protein_id gnl|my_center|LOCUS_08040 10801 11862 gene locus_tag LOCUS_08050 gene vmeY 10801 11862 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477351.1 protein_id gnl|my_center|LOCUS_08050 11887 15009 gene locus_tag LOCUS_08060 11887 15009 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479778.1 protein_id gnl|my_center|LOCUS_08060 >Feature sequence039 1698 958 gene locus_tag LOCUS_08070 1698 958 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_08070 2443 1709 gene locus_tag LOCUS_08080 gene ubiE 2443 1709 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785152.1 protein_id gnl|my_center|LOCUS_08080 3399 2449 gene locus_tag LOCUS_08090 3399 2449 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785154.1 protein_id gnl|my_center|LOCUS_08090 3803 3411 gene locus_tag LOCUS_08100 3803 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 3819 4040 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4629 5459 gene locus_tag LOCUS_08110 4629 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 6829 5549 gene locus_tag LOCUS_08120 6829 5549 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107424.1 protein_id gnl|my_center|LOCUS_08120 7420 6965 gene locus_tag LOCUS_08130 gene pyrI 7420 6965 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787546.1 protein_id gnl|my_center|LOCUS_08130 8338 7433 gene locus_tag LOCUS_08140 gene pyrB 8338 7433 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761416.1 protein_id gnl|my_center|LOCUS_08140 8501 10813 gene locus_tag LOCUS_08150 8501 10813 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202791.1 protein_id gnl|my_center|LOCUS_08150 10820 11710 gene locus_tag LOCUS_08160 10820 11710 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439900.1 protein_id gnl|my_center|LOCUS_08160 12853 11723 gene locus_tag LOCUS_08170 12853 11723 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203740.1 protein_id gnl|my_center|LOCUS_08170 15029 12855 gene locus_tag LOCUS_08180 15029 12855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 >Feature sequence040 1729 263 gene locus_tag LOCUS_08190 gene xylE 1729 263 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202803.1 protein_id gnl|my_center|LOCUS_08190 1962 3578 gene locus_tag LOCUS_08200 1962 3578 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202279.1 protein_id gnl|my_center|LOCUS_08200 2220 2291 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4556 3903 gene locus_tag LOCUS_08210 4556 3903 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_08210 6375 4774 gene locus_tag LOCUS_08220 6375 4774 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786793.1 protein_id gnl|my_center|LOCUS_08220 7262 6444 gene locus_tag LOCUS_08230 7262 6444 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948987.1 protein_id gnl|my_center|LOCUS_08230 7494 8414 gene locus_tag LOCUS_08240 7494 8414 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786279.1 protein_id gnl|my_center|LOCUS_08240 8487 9359 gene locus_tag LOCUS_08250 8487 9359 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203645.1 protein_id gnl|my_center|LOCUS_08250 9467 10336 gene locus_tag LOCUS_08260 9467 10336 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762527.1 protein_id gnl|my_center|LOCUS_08260 11079 10351 gene locus_tag LOCUS_08270 11079 10351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 11260 13059 gene locus_tag LOCUS_08280 11260 13059 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203426.1 protein_id gnl|my_center|LOCUS_08280 13070 14419 gene locus_tag LOCUS_08290 13070 14419 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_08290 >Feature sequence041 432 1283 gene locus_tag LOCUS_08300 432 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 2910 1429 gene locus_tag LOCUS_08310 2910 1429 CDS product thiol-activated cytolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816482.1 protein_id gnl|my_center|LOCUS_08310 4064 3009 gene locus_tag LOCUS_08320 4064 3009 CDS product thiol-activated cytolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809735.1 protein_id gnl|my_center|LOCUS_08320 6149 4626 gene locus_tag LOCUS_08330 6149 4626 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766448.1 protein_id gnl|my_center|LOCUS_08330 9302 6195 gene locus_tag LOCUS_08340 9302 6195 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813423.1 protein_id gnl|my_center|LOCUS_08340 11333 9720 gene locus_tag LOCUS_08350 11333 9720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 14590 11357 gene locus_tag LOCUS_08360 14590 11357 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_08360 >Feature sequence042 533 1990 gene locus_tag LOCUS_08370 533 1990 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798918.1 protein_id gnl|my_center|LOCUS_08370 2501 2058 gene locus_tag LOCUS_08380 2501 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785439.1 protein_id gnl|my_center|LOCUS_08380 2707 3135 gene locus_tag LOCUS_08390 2707 3135 CDS product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765125.1 protein_id gnl|my_center|LOCUS_08390 3173 4084 gene locus_tag LOCUS_08400 3173 4084 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788160.1 protein_id gnl|my_center|LOCUS_08400 4085 5434 gene locus_tag LOCUS_08410 gene rsxC 4085 5434 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788158.1 protein_id gnl|my_center|LOCUS_08410 4594 4681 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5476 6468 gene locus_tag LOCUS_08420 5476 6468 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788156.1 protein_id gnl|my_center|LOCUS_08420 6509 7156 gene locus_tag LOCUS_08430 6509 7156 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202941.1 protein_id gnl|my_center|LOCUS_08430 7162 7746 gene locus_tag LOCUS_08440 7162 7746 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761246.1 protein_id gnl|my_center|LOCUS_08440 7761 8363 gene locus_tag LOCUS_08450 gene rsxA 7761 8363 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778198.1 protein_id gnl|my_center|LOCUS_08450 8472 9509 gene locus_tag LOCUS_08460 gene galE 8472 9509 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_08460 10615 9617 gene locus_tag LOCUS_08470 10615 9617 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_08470 11242 10760 gene locus_tag LOCUS_08480 gene cdd 11242 10760 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762228.1 protein_id gnl|my_center|LOCUS_08480 12044 11337 gene locus_tag LOCUS_08490 12044 11337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 13389 12151 gene locus_tag LOCUS_08500 13389 12151 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_08500 14250 13396 gene locus_tag LOCUS_08510 14250 13396 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107847.1 protein_id gnl|my_center|LOCUS_08510 >Feature sequence043 <1 1220 gene locus_tag LOCUS_08520 <1 1220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788738.1:tetratricopeptide repeat-containing serine protease family protein 1333 2115 gene locus_tag LOCUS_08530 1333 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292634.1 protein_id gnl|my_center|LOCUS_08530 2378 3175 gene locus_tag LOCUS_08540 2378 3175 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107264.1 protein_id gnl|my_center|LOCUS_08540 3195 4985 gene locus_tag LOCUS_08550 3195 4985 CDS product M6 family metalloprotease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986497.1 protein_id gnl|my_center|LOCUS_08550 5085 5558 gene locus_tag LOCUS_08560 5085 5558 CDS product DUF4494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762440.1 protein_id gnl|my_center|LOCUS_08560 5591 6265 gene locus_tag LOCUS_08570 5591 6265 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_08570 6492 7694 gene locus_tag LOCUS_08580 6492 7694 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 protein_id gnl|my_center|LOCUS_08580 7725 8978 gene locus_tag LOCUS_08590 7725 8978 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762301.1 protein_id gnl|my_center|LOCUS_08590 9078 10736 gene locus_tag LOCUS_08600 9078 10736 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107663.1 protein_id gnl|my_center|LOCUS_08600 10790 12460 gene locus_tag LOCUS_08610 10790 12460 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107663.1 protein_id gnl|my_center|LOCUS_08610 12948 12535 gene locus_tag LOCUS_08620 12948 12535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 >Feature sequence044 1971 1138 gene locus_tag LOCUS_08630 1971 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 2364 2086 gene locus_tag LOCUS_08640 2364 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 2851 2492 gene locus_tag LOCUS_08650 2851 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 2918 4738 gene locus_tag LOCUS_08660 2918 4738 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802867.1 protein_id gnl|my_center|LOCUS_08660 5096 6808 gene locus_tag LOCUS_08670 5096 6808 CDS product calcineurin-like phosphoesterase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766056.1 protein_id gnl|my_center|LOCUS_08670 6920 7113 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7225 10098 gene locus_tag LOCUS_08680 7225 10098 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_08680 10021 10073 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10493 10604 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11470 11602 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11695 12462 gene locus_tag LOCUS_08690 11695 12462 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062694907.1 protein_id gnl|my_center|LOCUS_08690 12946 12734 gene locus_tag LOCUS_08700 12946 12734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 13039 13328 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <14175 13389 gene locus_tag LOCUS_08710 <14175 13389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011815914.1:bifunctional glucose-1-phosphatase/inositol phosphatase >Feature sequence045 584 2107 gene locus_tag LOCUS_08720 584 2107 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048700.1 protein_id gnl|my_center|LOCUS_08720 595 679 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2183 2410 gene locus_tag LOCUS_08730 2183 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 2417 2569 gene locus_tag LOCUS_08740 2417 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 6770 2595 gene locus_tag LOCUS_08750 6770 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 7364 6882 gene locus_tag LOCUS_08760 7364 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 11606 9039 gene locus_tag LOCUS_08770 11606 9039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 12670 11603 gene locus_tag LOCUS_08780 12670 11603 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933236.1 protein_id gnl|my_center|LOCUS_08780 13384 13025 gene locus_tag LOCUS_08790 13384 13025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08790 >Feature sequence046 447 1793 gene locus_tag LOCUS_08800 447 1793 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461086.1 protein_id gnl|my_center|LOCUS_08800 1861 2217 gene locus_tag LOCUS_08810 1861 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 2424 2497 gene locus_tag LOCUS_t00210 2424 2497 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2516 2589 gene locus_tag LOCUS_t00220 2516 2589 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3175 2726 gene locus_tag LOCUS_08820 3175 2726 CDS product DUF6078 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760274.1 protein_id gnl|my_center|LOCUS_08820 3411 3878 gene locus_tag LOCUS_08830 gene greA 3411 3878 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765198.1 protein_id gnl|my_center|LOCUS_08830 4010 4612 gene locus_tag LOCUS_08840 4010 4612 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767596.1 protein_id gnl|my_center|LOCUS_08840 4928 6082 gene locus_tag LOCUS_08850 4928 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 6095 7675 gene locus_tag LOCUS_08860 6095 7675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766136.1 protein_id gnl|my_center|LOCUS_08860 9078 7672 gene locus_tag LOCUS_08870 9078 7672 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107959.1 protein_id gnl|my_center|LOCUS_08870 9283 10812 gene locus_tag LOCUS_08880 9283 10812 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767795.1 protein_id gnl|my_center|LOCUS_08880 11002 11526 gene locus_tag LOCUS_08890 gene recR 11002 11526 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787270.1 protein_id gnl|my_center|LOCUS_08890 11542 11952 gene locus_tag LOCUS_08900 11542 11952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 11949 12998 gene locus_tag LOCUS_08910 11949 12998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 13172 13098 gene locus_tag LOCUS_t00230 13172 13098 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 13272 13196 gene locus_tag LOCUS_t00240 13272 13196 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence047 1 300 gene locus_tag LOCUS_08920 1 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 2764 458 gene locus_tag LOCUS_08930 2764 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139262169.1 protein_id gnl|my_center|LOCUS_08930 3476 5569 gene locus_tag LOCUS_08940 3476 5569 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108964.1 protein_id gnl|my_center|LOCUS_08940 5576 6505 gene locus_tag LOCUS_08950 5576 6505 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108968.1 protein_id gnl|my_center|LOCUS_08950 6579 8783 gene locus_tag LOCUS_08960 6579 8783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108861.1 protein_id gnl|my_center|LOCUS_08960 8870 10921 gene locus_tag LOCUS_08970 8870 10921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 11089 12918 gene locus_tag LOCUS_08980 11089 12918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 >Feature sequence048 360 618 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2202 943 gene locus_tag LOCUS_08990 2202 943 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_08990 3735 2218 gene locus_tag LOCUS_09000 gene gltX 3735 2218 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791502.1 protein_id gnl|my_center|LOCUS_09000 3844 4974 gene locus_tag LOCUS_09010 3844 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09010 5045 5782 gene locus_tag LOCUS_09020 5045 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09020 5819 5847 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5905 7581 gene locus_tag LOCUS_09030 5905 7581 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795325.1 protein_id gnl|my_center|LOCUS_09030 9870 7600 gene locus_tag LOCUS_09040 gene priA 9870 7600 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203607.1 protein_id gnl|my_center|LOCUS_09040 10560 9943 gene locus_tag LOCUS_09050 10560 9943 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108458.1 protein_id gnl|my_center|LOCUS_09050 11515 10592 gene locus_tag LOCUS_09060 11515 10592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 12814 11642 gene locus_tag LOCUS_09070 12814 11642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 >Feature sequence049 918 1913 gene locus_tag LOCUS_09080 918 1913 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760929.1 protein_id gnl|my_center|LOCUS_09080 1923 3386 gene locus_tag LOCUS_09090 1923 3386 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784872.1 protein_id gnl|my_center|LOCUS_09090 3723 4649 gene locus_tag LOCUS_09100 3723 4649 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783972.1 protein_id gnl|my_center|LOCUS_09100 4823 6688 gene locus_tag LOCUS_09110 4823 6688 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202130.1 protein_id gnl|my_center|LOCUS_09110 7580 8776 gene locus_tag LOCUS_09120 7580 8776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 8963 11209 gene locus_tag LOCUS_09130 gene pflB 8963 11209 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289265.1 protein_id gnl|my_center|LOCUS_09130 11255 12004 gene locus_tag LOCUS_09140 gene pflA 11255 12004 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289264.1 protein_id gnl|my_center|LOCUS_09140 12406 12017 gene locus_tag LOCUS_09150 12406 12017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 >Feature sequence050 243 872 gene locus_tag LOCUS_09160 243 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 1039 1974 gene locus_tag LOCUS_09170 1039 1974 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760856.1 protein_id gnl|my_center|LOCUS_09170 1977 3158 gene locus_tag LOCUS_09180 1977 3158 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760855.1 protein_id gnl|my_center|LOCUS_09180 3203 4270 gene locus_tag LOCUS_09190 3203 4270 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760854.1 protein_id gnl|my_center|LOCUS_09190 4290 5066 gene locus_tag LOCUS_09200 4290 5066 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760853.1 protein_id gnl|my_center|LOCUS_09200 5222 5752 gene locus_tag LOCUS_09210 5222 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 5920 7269 gene locus_tag LOCUS_09220 gene ffh 5920 7269 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789195.1 protein_id gnl|my_center|LOCUS_09220 7291 8169 gene locus_tag LOCUS_09230 gene folD 7291 8169 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780414.1 protein_id gnl|my_center|LOCUS_09230 8426 10900 gene locus_tag LOCUS_09240 8426 10900 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108921.1 protein_id gnl|my_center|LOCUS_09240 10897 11451 gene locus_tag LOCUS_09250 gene cobC 10897 11451 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787967.1 protein_id gnl|my_center|LOCUS_09250 12300 11503 gene locus_tag LOCUS_09260 12300 11503 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040560833.1 protein_id gnl|my_center|LOCUS_09260 >Feature sequence051 1417 116 gene locus_tag LOCUS_09270 1417 116 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_09270 2277 1429 gene locus_tag LOCUS_09280 gene nudC 2277 1429 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107851.1 protein_id gnl|my_center|LOCUS_09280 3965 2277 gene locus_tag LOCUS_09290 3965 2277 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107667.1 protein_id gnl|my_center|LOCUS_09290 4110 4832 gene locus_tag LOCUS_09300 4110 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 5821 4874 gene locus_tag LOCUS_09310 5821 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 6062 6206 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7618 6917 gene locus_tag LOCUS_09320 7618 6917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 8928 7618 gene locus_tag LOCUS_09330 8928 7618 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764994.1 protein_id gnl|my_center|LOCUS_09330 10440 8944 gene locus_tag LOCUS_09340 10440 8944 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763047.1 protein_id gnl|my_center|LOCUS_09340 11555 10491 gene locus_tag LOCUS_09350 11555 10491 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793311.1 protein_id gnl|my_center|LOCUS_09350 >Feature sequence052 355 771 gene locus_tag LOCUS_09360 355 771 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007242046.1 protein_id gnl|my_center|LOCUS_09360 1497 2324 gene locus_tag LOCUS_09370 1497 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 2327 3064 gene locus_tag LOCUS_09380 2327 3064 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635457.1 protein_id gnl|my_center|LOCUS_09380 3061 3390 gene locus_tag LOCUS_09390 3061 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 4330 5073 gene locus_tag LOCUS_09400 4330 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 5066 6151 gene locus_tag LOCUS_09410 5066 6151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 6172 7413 gene locus_tag LOCUS_09420 6172 7413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 7416 8297 gene locus_tag LOCUS_09430 7416 8297 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058149.1 protein_id gnl|my_center|LOCUS_09430 8340 8849 gene locus_tag LOCUS_09440 8340 8849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 8842 9945 gene locus_tag LOCUS_09450 8842 9945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 10088 10771 gene locus_tag LOCUS_09460 10088 10771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 10787 11899 gene locus_tag LOCUS_09470 10787 11899 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476092.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence053 <1 815 gene locus_tag LOCUS_09480 <1 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000998260.1:glycosyltransferase 767 1744 gene locus_tag LOCUS_09490 767 1744 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201897.1 protein_id gnl|my_center|LOCUS_09490 1741 2841 gene locus_tag LOCUS_09500 1741 2841 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963970.1 protein_id gnl|my_center|LOCUS_09500 3811 3254 gene locus_tag LOCUS_09510 3811 3254 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202986.1 protein_id gnl|my_center|LOCUS_09510 4431 3940 gene locus_tag LOCUS_09520 4431 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 4437 4570 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6576 4633 gene locus_tag LOCUS_09530 6576 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 8341 7613 gene locus_tag LOCUS_09540 8341 7613 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761509.1 protein_id gnl|my_center|LOCUS_09540 8572 8991 gene locus_tag LOCUS_09550 8572 8991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 11059 8945 gene locus_tag LOCUS_09560 11059 8945 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202810.1 protein_id gnl|my_center|LOCUS_09560 11276 12040 gene locus_tag LOCUS_09570 11276 12040 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_09570 >Feature sequence054 3497 96 gene locus_tag LOCUS_09580 3497 96 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765809.1 protein_id gnl|my_center|LOCUS_09580 4393 3494 gene locus_tag LOCUS_09590 4393 3494 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055217731.1 protein_id gnl|my_center|LOCUS_09590 6153 4399 gene locus_tag LOCUS_09600 6153 4399 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107562.1 protein_id gnl|my_center|LOCUS_09600 8224 6176 gene locus_tag LOCUS_09610 8224 6176 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107563.1 protein_id gnl|my_center|LOCUS_09610 8573 10585 gene locus_tag LOCUS_09620 8573 10585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 11205 10681 gene locus_tag LOCUS_09630 11205 10681 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020219.1 protein_id gnl|my_center|LOCUS_09630 >Feature sequence055 768 1115 gene locus_tag LOCUS_09640 768 1115 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760912.1 protein_id gnl|my_center|LOCUS_09640 2245 1235 gene locus_tag LOCUS_09650 2245 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 2762 2298 gene locus_tag LOCUS_09660 2762 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 4581 2785 gene locus_tag LOCUS_09670 4581 2785 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_09670 7836 4594 gene locus_tag LOCUS_09680 7836 4594 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_09680 9174 8197 gene locus_tag LOCUS_09690 9174 8197 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109103.1 protein_id gnl|my_center|LOCUS_09690 11459 9192 gene locus_tag LOCUS_09700 11459 9192 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796220.1 protein_id gnl|my_center|LOCUS_09700 12046 11474 gene locus_tag LOCUS_09710 12046 11474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 >Feature sequence056 1425 7601 gene locus_tag LOCUS_09720 1425 7601 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220355262.1 protein_id gnl|my_center|LOCUS_09720 8087 8137 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8599 8724 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10307 9996 gene locus_tag LOCUS_09730 10307 9996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 >Feature sequence057 631 882 gene locus_tag LOCUS_09740 631 882 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789565.1 protein_id gnl|my_center|LOCUS_09740 1008 1937 gene locus_tag LOCUS_09750 1008 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 2775 2122 gene locus_tag LOCUS_09760 2775 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 3482 2925 gene locus_tag LOCUS_09770 3482 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 3765 4319 gene locus_tag LOCUS_09780 3765 4319 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_09780 7822 4388 gene locus_tag LOCUS_09790 gene mfd 7822 4388 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203155.1 protein_id gnl|my_center|LOCUS_09790 8590 7844 gene locus_tag LOCUS_09800 8590 7844 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_09800 9400 8642 gene locus_tag LOCUS_09810 9400 8642 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789007.1 protein_id gnl|my_center|LOCUS_09810 10484 9429 gene locus_tag LOCUS_09820 10484 9429 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769686.1 protein_id gnl|my_center|LOCUS_09820 11370 10630 gene locus_tag LOCUS_09830 11370 10630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 >Feature sequence058 2482 488 gene locus_tag LOCUS_09840 2482 488 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_09840 3657 2761 gene locus_tag LOCUS_09850 3657 2761 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_09850 7846 3773 gene locus_tag LOCUS_09860 7846 3773 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109153.1 protein_id gnl|my_center|LOCUS_09860 8474 10723 gene locus_tag LOCUS_09870 8474 10723 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109148.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence059 <1 569 gene locus_tag LOCUS_09880 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793275.1:glycogen/starch synthase 1456 1843 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1904 3085 gene locus_tag LOCUS_09890 1904 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 4100 3159 gene locus_tag LOCUS_09900 4100 3159 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768748.1 protein_id gnl|my_center|LOCUS_09900 4733 4140 gene locus_tag LOCUS_09910 4733 4140 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761321.1 protein_id gnl|my_center|LOCUS_09910 4831 6021 gene locus_tag LOCUS_09920 gene nspC 4831 6021 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107393.1 protein_id gnl|my_center|LOCUS_09920 6176 6249 gene locus_tag LOCUS_t00250 6176 6249 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6298 6380 gene locus_tag LOCUS_t00260 6298 6380 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6404 6488 gene locus_tag LOCUS_t00270 6404 6488 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6510 6583 gene locus_tag LOCUS_t00280 6510 6583 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6612 7166 gene locus_tag LOCUS_09930 6612 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 7173 7595 gene locus_tag LOCUS_09940 gene ssb 7173 7595 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795194.1 protein_id gnl|my_center|LOCUS_09940 7885 7592 gene locus_tag LOCUS_09950 7885 7592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 8106 8930 gene locus_tag LOCUS_09960 8106 8930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 8934 9533 gene locus_tag LOCUS_09970 8934 9533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 10613 9543 gene locus_tag LOCUS_09980 gene hisB 10613 9543 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766230.1 protein_id gnl|my_center|LOCUS_09980 11344 10610 gene locus_tag LOCUS_09990 11344 10610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 >Feature sequence060 601 134 gene locus_tag LOCUS_10000 601 134 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226746.1 protein_id gnl|my_center|LOCUS_10000 2904 760 gene locus_tag LOCUS_10010 2904 760 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084771.1 protein_id gnl|my_center|LOCUS_10010 4063 3620 gene locus_tag LOCUS_10020 4063 3620 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292665.1 protein_id gnl|my_center|LOCUS_10020 5059 4337 gene locus_tag LOCUS_10030 5059 4337 CDS product HmuY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768678.1 protein_id gnl|my_center|LOCUS_10030 7349 5070 gene locus_tag LOCUS_10040 7349 5070 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202740.1 protein_id gnl|my_center|LOCUS_10040 8060 7404 gene locus_tag LOCUS_10050 8060 7404 CDS product DUF4903 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787354.1 protein_id gnl|my_center|LOCUS_10050 8468 8067 gene locus_tag LOCUS_10060 8468 8067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 9878 8511 gene locus_tag LOCUS_10070 9878 8511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794272.1 protein_id gnl|my_center|LOCUS_10070 11342 10101 gene locus_tag LOCUS_10080 11342 10101 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence061 <1 2931 gene locus_tag LOCUS_10090 <1 2931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203588.1:translocation/assembly module TamB domain-containing protein 2998 5373 gene locus_tag LOCUS_10100 2998 5373 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_10100 5462 5764 gene locus_tag LOCUS_10110 5462 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10110 5727 6212 gene locus_tag LOCUS_10120 5727 6212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 6685 6890 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9242 7338 gene locus_tag LOCUS_10130 9242 7338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 9352 9497 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10553 10888 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence062 954 199 gene locus_tag LOCUS_10140 gene dapB 954 199 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762922.1 protein_id gnl|my_center|LOCUS_10140 1404 1473 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1563 2435 gene locus_tag LOCUS_10150 1563 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 2482 2898 gene locus_tag LOCUS_10160 2482 2898 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761720.1 protein_id gnl|my_center|LOCUS_10160 2914 4041 gene locus_tag LOCUS_10170 gene dprA 2914 4041 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769083.1 protein_id gnl|my_center|LOCUS_10170 4161 5153 gene locus_tag LOCUS_10180 gene dusB 4161 5153 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108618.1 protein_id gnl|my_center|LOCUS_10180 7572 5200 gene locus_tag LOCUS_10190 7572 5200 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303124.1 protein_id gnl|my_center|LOCUS_10190 7820 9187 gene locus_tag LOCUS_10200 7820 9187 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890799.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence063 565 2289 gene locus_tag LOCUS_10210 565 2289 CDS product thrombospondin type 3 repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765812.1 protein_id gnl|my_center|LOCUS_10210 2326 2907 gene locus_tag LOCUS_10220 2326 2907 CDS product DUF3826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765811.1 protein_id gnl|my_center|LOCUS_10220 2927 5872 gene locus_tag LOCUS_10230 2927 5872 CDS product DUF6298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765768.1 protein_id gnl|my_center|LOCUS_10230 6037 6597 gene locus_tag LOCUS_10240 6037 6597 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765767.1 protein_id gnl|my_center|LOCUS_10240 6644 8854 gene locus_tag LOCUS_10250 6644 8854 CDS product DUF5703 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765773.1 protein_id gnl|my_center|LOCUS_10250 10920 8869 gene locus_tag LOCUS_10260 10920 8869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence064 247 807 gene locus_tag LOCUS_10270 247 807 CDS product Panacea domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308669.1 protein_id gnl|my_center|LOCUS_10270 809 1273 gene locus_tag LOCUS_10280 809 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1408 1803 gene locus_tag LOCUS_10290 1408 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 1806 6359 gene locus_tag LOCUS_10300 1806 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 6206 6306 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6362 6778 gene locus_tag LOCUS_10310 6362 6778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 7910 6867 gene locus_tag LOCUS_10320 7910 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 8556 7900 gene locus_tag LOCUS_10330 8556 7900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence065 <1 1649 gene locus_tag LOCUS_10340 <1 1649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766122.1:sodium:solute symporter 1745 2422 gene locus_tag LOCUS_10350 1745 2422 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_10350 2429 3130 gene locus_tag LOCUS_10360 2429 3130 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766123.1 protein_id gnl|my_center|LOCUS_10360 3170 4717 gene locus_tag LOCUS_10370 gene araA 3170 4717 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760642.1 protein_id gnl|my_center|LOCUS_10370 5186 5382 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5398 6276 gene locus_tag LOCUS_10380 5398 6276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 6363 7934 gene locus_tag LOCUS_10390 6363 7934 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107210.1 protein_id gnl|my_center|LOCUS_10390 7963 9987 gene locus_tag LOCUS_10400 7963 9987 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766126.1 protein_id gnl|my_center|LOCUS_10400 10045 10497 gene locus_tag LOCUS_10410 gene rpiB 10045 10497 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766127.1 protein_id gnl|my_center|LOCUS_10410 >Feature sequence066 396 623 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1452 2657 gene locus_tag LOCUS_10420 gene pncB 1452 2657 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203338.1 protein_id gnl|my_center|LOCUS_10420 4116 4318 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4332 6359 gene locus_tag LOCUS_10430 4332 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 6162 6352 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6668 8431 gene locus_tag LOCUS_10440 6668 8431 CDS product GH32 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203243.1 protein_id gnl|my_center|LOCUS_10440 7307 7362 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9075 9215 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9225 9530 gene locus_tag LOCUS_10450 9225 9530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 9537 10418 gene locus_tag LOCUS_10460 9537 10418 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence067 759 976 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1332 1443 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3165 2149 gene locus_tag LOCUS_10470 3165 2149 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932918.1 protein_id gnl|my_center|LOCUS_10470 3952 3170 gene locus_tag LOCUS_10480 3952 3170 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932917.1 protein_id gnl|my_center|LOCUS_10480 4409 3945 gene locus_tag LOCUS_10490 4409 3945 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_10490 6425 4422 gene locus_tag LOCUS_10500 6425 4422 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927008.1 protein_id gnl|my_center|LOCUS_10500 7283 6438 gene locus_tag LOCUS_10510 7283 6438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 7840 7292 gene locus_tag LOCUS_10520 7840 7292 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392330.1 protein_id gnl|my_center|LOCUS_10520 8892 8011 gene locus_tag LOCUS_10530 8892 8011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 10205 9870 gene locus_tag LOCUS_10540 10205 9870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 >Feature sequence068 851 4363 gene locus_tag LOCUS_10550 851 4363 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108531.1 protein_id gnl|my_center|LOCUS_10550 4879 4412 gene locus_tag LOCUS_10560 4879 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 4933 5274 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6457 5387 gene locus_tag LOCUS_10570 6457 5387 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796193.1 protein_id gnl|my_center|LOCUS_10570 <9898 6461 gene locus_tag LOCUS_10580 <9898 6461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_072066367.1:alpha-2-macroglobulin family protein >Feature sequence069 786 1292 gene locus_tag LOCUS_10590 786 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 1324 3144 gene locus_tag LOCUS_10600 1324 3144 CDS product DUF6057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202172.1 protein_id gnl|my_center|LOCUS_10600 3154 4563 gene locus_tag LOCUS_10610 3154 4563 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_10610 4308 4431 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4681 5922 gene locus_tag LOCUS_10620 4681 5922 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202166.1 protein_id gnl|my_center|LOCUS_10620 8226 6037 gene locus_tag LOCUS_10630 8226 6037 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202053.1 protein_id gnl|my_center|LOCUS_10630 9697 8246 gene locus_tag LOCUS_10640 9697 8246 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767100.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence070 288 665 gene locus_tag LOCUS_10650 288 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 684 1007 gene locus_tag LOCUS_10660 684 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1073 1360 gene locus_tag LOCUS_10670 1073 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1372 1533 gene locus_tag LOCUS_10680 1372 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 1541 2947 gene locus_tag LOCUS_10690 gene wzx 1541 2947 CDS product O-unit flippase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208593.1 protein_id gnl|my_center|LOCUS_10690 3188 5131 gene locus_tag LOCUS_10700 3188 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 6684 7835 gene locus_tag LOCUS_10710 6684 7835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 7956 8879 gene locus_tag LOCUS_10720 7956 8879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 >Feature sequence071 1941 694 gene locus_tag LOCUS_10730 1941 694 CDS product glycoside hydrolase family 27 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776921.1 protein_id gnl|my_center|LOCUS_10730 3891 2134 gene locus_tag LOCUS_10740 3891 2134 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791678.1 protein_id gnl|my_center|LOCUS_10740 7166 3900 gene locus_tag LOCUS_10750 7166 3900 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130856111.1 protein_id gnl|my_center|LOCUS_10750 8403 7387 gene locus_tag LOCUS_10760 8403 7387 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_10760 9058 8459 gene locus_tag LOCUS_10770 9058 8459 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765464.1 protein_id gnl|my_center|LOCUS_10770 9576 9271 gene locus_tag LOCUS_10780 9576 9271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 >Feature sequence072 1494 2792 gene locus_tag LOCUS_10790 1494 2792 CDS product glycosyl hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109139.1 protein_id gnl|my_center|LOCUS_10790 2819 4060 gene locus_tag LOCUS_10800 2819 4060 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109136.1 protein_id gnl|my_center|LOCUS_10800 4283 7468 gene locus_tag LOCUS_10810 4283 7468 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108498.1 protein_id gnl|my_center|LOCUS_10810 >Feature sequence073 1079 456 gene locus_tag LOCUS_10820 1079 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 2639 1251 gene locus_tag LOCUS_10830 gene tilS 2639 1251 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202409.1 protein_id gnl|my_center|LOCUS_10830 3393 2650 gene locus_tag LOCUS_10840 gene kdsB 3393 2650 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 protein_id gnl|my_center|LOCUS_10840 3649 4647 gene locus_tag LOCUS_10850 3649 4647 CDS product phosphatidylinositol-4-phosphate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765612.1 protein_id gnl|my_center|LOCUS_10850 4703 5146 gene locus_tag LOCUS_10860 4703 5146 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761472.1 protein_id gnl|my_center|LOCUS_10860 5208 7259 gene locus_tag LOCUS_10870 5208 7259 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_10870 7268 8413 gene locus_tag LOCUS_10880 7268 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 8438 8968 gene locus_tag LOCUS_10890 8438 8968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 >Feature sequence074 407 640 gene locus_tag LOCUS_10900 407 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 678 1739 gene locus_tag LOCUS_10910 gene cls 678 1739 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203419.1 protein_id gnl|my_center|LOCUS_10910 1771 2373 gene locus_tag LOCUS_10920 1771 2373 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763753.1 protein_id gnl|my_center|LOCUS_10920 3344 2388 gene locus_tag LOCUS_10930 3344 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 3936 5240 gene locus_tag LOCUS_10940 3936 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108309.1 protein_id gnl|my_center|LOCUS_10940 5298 6569 gene locus_tag LOCUS_10950 5298 6569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 6588 8336 gene locus_tag LOCUS_10960 6588 8336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 >Feature sequence075 518 670 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 854 1312 gene locus_tag LOCUS_10970 854 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 2528 1503 gene locus_tag LOCUS_10980 2528 1503 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787518.1 protein_id gnl|my_center|LOCUS_10980 3663 2530 gene locus_tag LOCUS_10990 3663 2530 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768087.1 protein_id gnl|my_center|LOCUS_10990 4781 3675 gene locus_tag LOCUS_11000 4781 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 6766 4829 gene locus_tag LOCUS_11010 6766 4829 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202481.1 protein_id gnl|my_center|LOCUS_11010 7881 7042 gene locus_tag LOCUS_11020 7881 7042 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107248.1 protein_id gnl|my_center|LOCUS_11020 >Feature sequence076 1733 1167 gene locus_tag LOCUS_11030 1733 1167 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_11030 3077 2124 gene locus_tag LOCUS_11040 3077 2124 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866892.1 protein_id gnl|my_center|LOCUS_11040 3580 3128 gene locus_tag LOCUS_11050 3580 3128 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080739.1 protein_id gnl|my_center|LOCUS_11050 3756 4859 gene locus_tag LOCUS_11060 gene wecB 3756 4859 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555698.1 protein_id gnl|my_center|LOCUS_11060 4871 6253 gene locus_tag LOCUS_11070 4871 6253 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_11070 6290 6856 gene locus_tag LOCUS_11080 6290 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 8558 6891 gene locus_tag LOCUS_11090 8558 6891 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787533.1 protein_id gnl|my_center|LOCUS_11090 >Feature sequence077 2162 378 gene locus_tag LOCUS_11100 2162 378 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762502.1 protein_id gnl|my_center|LOCUS_11100 2389 3456 gene locus_tag LOCUS_11110 2389 3456 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767146.1 protein_id gnl|my_center|LOCUS_11110 5103 3463 gene locus_tag LOCUS_11120 5103 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 6003 5104 gene locus_tag LOCUS_11130 6003 5104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 7787 6006 gene locus_tag LOCUS_11140 7787 6006 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201932.1 protein_id gnl|my_center|LOCUS_11140 8264 7827 gene locus_tag LOCUS_11150 gene dut 8264 7827 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784036.1 protein_id gnl|my_center|LOCUS_11150 >Feature sequence078 3400 194 gene locus_tag LOCUS_11160 3400 194 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963916.1 protein_id gnl|my_center|LOCUS_11160 4484 3411 gene locus_tag LOCUS_11170 4484 3411 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963917.1 protein_id gnl|my_center|LOCUS_11170 5776 4508 gene locus_tag LOCUS_11180 5776 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 6227 5865 gene locus_tag LOCUS_11190 gene trxA 6227 5865 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107795.1 protein_id gnl|my_center|LOCUS_11190 7625 6762 gene locus_tag LOCUS_11200 gene amrS 7625 6762 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023404.1 protein_id gnl|my_center|LOCUS_11200 <8765 7622 gene locus_tag LOCUS_11210 <8765 7622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941768.1:AmmeMemoRadiSam system protein A >Feature sequence079 1090 1338 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1730 2788 gene locus_tag LOCUS_11220 gene rlmN 1730 2788 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202252.1 protein_id gnl|my_center|LOCUS_11220 2946 3112 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3197 3913 gene locus_tag LOCUS_11230 3197 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 5088 6383 gene locus_tag LOCUS_11240 5088 6383 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760045.1 protein_id gnl|my_center|LOCUS_11240 6361 6894 gene locus_tag LOCUS_11250 6361 6894 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658877.1 protein_id gnl|my_center|LOCUS_11250 6894 7679 gene locus_tag LOCUS_11260 6894 7679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109226.1 protein_id gnl|my_center|LOCUS_11260 7681 8100 gene locus_tag LOCUS_11270 gene secG 7681 8100 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109227.1 protein_id gnl|my_center|LOCUS_11270 8194 8268 gene locus_tag LOCUS_t00290 8194 8268 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence080 1 300 gene locus_tag LOCUS_11280 1 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 297 605 gene locus_tag LOCUS_11290 gene nuoK 297 605 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775579.1 protein_id gnl|my_center|LOCUS_11290 686 2602 gene locus_tag LOCUS_11300 gene nuoL 686 2602 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764299.1 protein_id gnl|my_center|LOCUS_11300 3319 3416 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3438 4046 gene locus_tag LOCUS_11310 3438 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 4071 5540 gene locus_tag LOCUS_11320 4071 5540 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992198.1 protein_id gnl|my_center|LOCUS_11320 6022 6906 gene locus_tag LOCUS_11330 6022 6906 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785776.1 protein_id gnl|my_center|LOCUS_11330 7001 7176 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence081 699 1733 gene locus_tag LOCUS_11340 699 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 2148 1762 gene locus_tag LOCUS_11350 2148 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 3207 2164 gene locus_tag LOCUS_11360 3207 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 3752 3156 gene locus_tag LOCUS_11370 3752 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 5500 4595 gene locus_tag LOCUS_11380 5500 4595 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144321.1 protein_id gnl|my_center|LOCUS_11380 6302 5490 gene locus_tag LOCUS_11390 6302 5490 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174408902.1 protein_id gnl|my_center|LOCUS_11390 7141 6539 gene locus_tag LOCUS_11400 7141 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802421.1 protein_id gnl|my_center|LOCUS_11400 7939 7409 gene locus_tag LOCUS_11410 7939 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence082 3 758 gene locus_tag LOCUS_11420 3 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 745 2139 gene locus_tag LOCUS_11430 745 2139 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767546.1 protein_id gnl|my_center|LOCUS_11430 2161 2943 gene locus_tag LOCUS_11440 gene lpxA 2161 2943 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762937.1 protein_id gnl|my_center|LOCUS_11440 3824 3045 gene locus_tag LOCUS_11450 3824 3045 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108683.1 protein_id gnl|my_center|LOCUS_11450 3993 4934 gene locus_tag LOCUS_11460 3993 4934 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779718.1 protein_id gnl|my_center|LOCUS_11460 4953 5222 gene locus_tag LOCUS_11470 4953 5222 CDS product DUF3098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762818.1 protein_id gnl|my_center|LOCUS_11470 5222 6097 gene locus_tag LOCUS_11480 5222 6097 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964447.1 protein_id gnl|my_center|LOCUS_11480 6097 6798 gene locus_tag LOCUS_11490 gene truB 6097 6798 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762820.1 protein_id gnl|my_center|LOCUS_11490 6823 7989 gene locus_tag LOCUS_11500 gene queA 6823 7989 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783637.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence083 5804 2484 gene locus_tag LOCUS_11510 5804 2484 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_11510 6183 5860 gene locus_tag LOCUS_11520 6183 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 6664 6197 gene locus_tag LOCUS_11530 6664 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence084 3186 1069 gene locus_tag LOCUS_11540 3186 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 5827 3206 gene locus_tag LOCUS_11550 5827 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 6358 5831 gene locus_tag LOCUS_11560 6358 5831 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800526.1 protein_id gnl|my_center|LOCUS_11560 7721 6483 gene locus_tag LOCUS_11570 7721 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence085 2659 3960 gene locus_tag LOCUS_11580 2659 3960 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250265.1 protein_id gnl|my_center|LOCUS_11580 4169 4519 gene locus_tag LOCUS_11590 4169 4519 CDS product type II toxin-antitoxin system MqsR family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461871.1 protein_id gnl|my_center|LOCUS_11590 4524 5504 gene locus_tag LOCUS_11600 4524 5504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 6934 5801 gene locus_tag LOCUS_11610 6934 5801 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546117.1 protein_id gnl|my_center|LOCUS_11610 7715 7089 gene locus_tag LOCUS_11620 7715 7089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence086 901 1104 gene locus_tag LOCUS_11630 901 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1906 1241 gene locus_tag LOCUS_11640 1906 1241 CDS product DUF6198 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107754.1 protein_id gnl|my_center|LOCUS_11640 2087 2779 gene locus_tag LOCUS_11650 2087 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 2863 3282 gene locus_tag LOCUS_11660 2863 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 3288 4367 gene locus_tag LOCUS_11670 3288 4367 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202358.1 protein_id gnl|my_center|LOCUS_11670 4386 6116 gene locus_tag LOCUS_11680 gene menD 4386 6116 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766783.1 protein_id gnl|my_center|LOCUS_11680 6212 7039 gene locus_tag LOCUS_11690 gene menB 6212 7039 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795543.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence087 2597 567 gene locus_tag LOCUS_11700 gene kdpB 2597 567 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763738.1 protein_id gnl|my_center|LOCUS_11700 4338 2632 gene locus_tag LOCUS_11710 gene kdpA 4338 2632 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108291.1 protein_id gnl|my_center|LOCUS_11710 6187 4736 gene locus_tag LOCUS_11720 6187 4736 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763641.1 protein_id gnl|my_center|LOCUS_11720 6796 6203 gene locus_tag LOCUS_11730 6796 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763625.1 protein_id gnl|my_center|LOCUS_11730 7286 6819 gene locus_tag LOCUS_11740 7286 6819 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763624.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence088 1772 603 gene locus_tag LOCUS_11750 1772 603 CDS product DUF4421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107781.1 protein_id gnl|my_center|LOCUS_11750 2825 1842 gene locus_tag LOCUS_11760 2825 1842 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_11760 2893 3495 gene locus_tag LOCUS_11770 gene yihA 2893 3495 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_11770 3498 5279 gene locus_tag LOCUS_11780 3498 5279 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795166.1 protein_id gnl|my_center|LOCUS_11780 5406 7415 gene locus_tag LOCUS_11790 gene rho 5406 7415 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107884.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence089 5224 980 gene locus_tag LOCUS_11800 5224 980 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107519.1 protein_id gnl|my_center|LOCUS_11800 4246 4268 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5446 5601 gene locus_tag LOCUS_11810 5446 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 5612 6964 gene locus_tag LOCUS_11820 5612 6964 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787198.1 protein_id gnl|my_center|LOCUS_11820 >Feature sequence090 272 1627 gene locus_tag LOCUS_11830 gene nhaD 272 1627 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966224.1 protein_id gnl|my_center|LOCUS_11830 2577 1705 gene locus_tag LOCUS_11840 2577 1705 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762705.1 protein_id gnl|my_center|LOCUS_11840 3727 2780 gene locus_tag LOCUS_11850 gene cysK 3727 2780 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_11850 5096 3801 gene locus_tag LOCUS_11860 5096 3801 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_11860 6171 5254 gene locus_tag LOCUS_11870 6171 5254 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764292.1 protein_id gnl|my_center|LOCUS_11870 6322 7140 gene locus_tag LOCUS_11880 6322 7140 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784896.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence091 104 1579 gene locus_tag LOCUS_11890 104 1579 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107572.1 protein_id gnl|my_center|LOCUS_11890 1619 5503 gene locus_tag LOCUS_11900 1619 5503 CDS product family 78 glycoside hydrolase catalytic domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107573.1 protein_id gnl|my_center|LOCUS_11900 4766 4839 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence092 315 40 gene locus_tag LOCUS_11910 315 40 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791188.1 protein_id gnl|my_center|LOCUS_11910 508 1446 gene locus_tag LOCUS_11920 508 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 1771 2544 gene locus_tag LOCUS_11930 1771 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 2673 5720 gene locus_tag LOCUS_11940 gene secDF 2673 5720 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765303.1 protein_id gnl|my_center|LOCUS_11940 5887 5815 gene locus_tag LOCUS_t00300 5887 5815 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6923 5979 gene locus_tag LOCUS_11950 6923 5979 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815003.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence093 1676 2647 gene locus_tag LOCUS_11960 1676 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784416.1 protein_id gnl|my_center|LOCUS_11960 3234 2725 gene locus_tag LOCUS_11970 3234 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 3292 3936 gene locus_tag LOCUS_11980 3292 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 4618 3971 gene locus_tag LOCUS_11990 gene udk 4618 3971 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789145.1 protein_id gnl|my_center|LOCUS_11990 4797 4890 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6267 5269 gene locus_tag LOCUS_12000 6267 5269 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence094 517 720 gene locus_tag LOCUS_12010 517 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 2255 822 gene locus_tag LOCUS_12020 2255 822 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785475.1 protein_id gnl|my_center|LOCUS_12020 3012 2260 gene locus_tag LOCUS_12030 3012 2260 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765085.1 protein_id gnl|my_center|LOCUS_12030 3608 3015 gene locus_tag LOCUS_12040 3608 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 3747 3955 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4275 4997 gene locus_tag LOCUS_12050 4275 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 5023 6621 gene locus_tag LOCUS_12060 5023 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 6441 6575 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence095 2 544 gene locus_tag LOCUS_12070 2 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 2245 722 gene locus_tag LOCUS_12080 2245 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 4379 2253 gene locus_tag LOCUS_12090 4379 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 2264 2373 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6550 4799 gene locus_tag LOCUS_12100 6550 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence096 <1 1230 gene locus_tag LOCUS_12110 <1 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108187.1:MATE family efflux transporter 1335 1535 gene locus_tag LOCUS_12120 1335 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1554 1787 gene locus_tag LOCUS_12130 1554 1787 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760626.1 protein_id gnl|my_center|LOCUS_12130 1789 2874 gene locus_tag LOCUS_12140 1789 2874 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_12140 2871 3641 gene locus_tag LOCUS_12150 2871 3641 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786495.1 protein_id gnl|my_center|LOCUS_12150 3665 4207 gene locus_tag LOCUS_12160 3665 4207 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786493.1 protein_id gnl|my_center|LOCUS_12160 5145 4267 gene locus_tag LOCUS_12170 5145 4267 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796486.1 protein_id gnl|my_center|LOCUS_12170 5895 5218 gene locus_tag LOCUS_12180 5895 5218 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202004.1 protein_id gnl|my_center|LOCUS_12180 >Feature sequence097 668 132 gene locus_tag LOCUS_12190 gene cobU 668 132 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202889.1 protein_id gnl|my_center|LOCUS_12190 863 2011 gene locus_tag LOCUS_12200 863 2011 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461650.1 protein_id gnl|my_center|LOCUS_12200 2174 3295 gene locus_tag LOCUS_12210 2174 3295 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461650.1 protein_id gnl|my_center|LOCUS_12210 3676 5433 gene locus_tag LOCUS_12220 gene ilvD 3676 5433 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203429.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence098 2662 1130 gene locus_tag LOCUS_12230 2662 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108913.1 protein_id gnl|my_center|LOCUS_12230 3875 2760 gene locus_tag LOCUS_12240 3875 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 4408 3899 gene locus_tag LOCUS_12250 4408 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 4890 4492 gene locus_tag LOCUS_12260 4890 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 <6839 4921 gene locus_tag LOCUS_12270 <6839 4921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108915.1:TonB-dependent receptor >Feature sequence099 251 1228 gene locus_tag LOCUS_12280 gene pfkA 251 1228 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295279.1 protein_id gnl|my_center|LOCUS_12280 1452 2978 gene locus_tag LOCUS_12290 gene atpD 1452 2978 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761388.1 protein_id gnl|my_center|LOCUS_12290 3008 3253 gene locus_tag LOCUS_12300 gene atpC 3008 3253 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787478.1 protein_id gnl|my_center|LOCUS_12300 3280 3702 gene locus_tag LOCUS_12310 3280 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 3707 4804 gene locus_tag LOCUS_12320 gene atpB 3707 4804 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787483.1 protein_id gnl|my_center|LOCUS_12320 4885 5124 gene locus_tag LOCUS_12330 gene atpE 4885 5124 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295758.1 protein_id gnl|my_center|LOCUS_12330 5185 5691 gene locus_tag LOCUS_12340 gene atpF 5185 5691 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761391.1 protein_id gnl|my_center|LOCUS_12340 5702 6238 gene locus_tag LOCUS_12350 gene atpH 5702 6238 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964546.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence100 157 594 gene locus_tag LOCUS_12360 157 594 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763145.1 protein_id gnl|my_center|LOCUS_12360 2998 665 gene locus_tag LOCUS_12370 2998 665 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797093.1 protein_id gnl|my_center|LOCUS_12370 5622 3412 gene locus_tag LOCUS_12380 5622 3412 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962686.1 protein_id gnl|my_center|LOCUS_12380 5689 5927 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence101 871 1860 gene locus_tag LOCUS_12390 871 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 3237 1873 gene locus_tag LOCUS_12400 3237 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 3704 3237 gene locus_tag LOCUS_12410 3704 3237 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768302.1 protein_id gnl|my_center|LOCUS_12410 >Feature sequence102 368 943 gene locus_tag LOCUS_12420 368 943 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785730.1 protein_id gnl|my_center|LOCUS_12420 2768 981 gene locus_tag LOCUS_12430 2768 981 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761012.1 protein_id gnl|my_center|LOCUS_12430 5264 2820 gene locus_tag LOCUS_12440 5264 2820 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_12440 6334 5438 gene locus_tag LOCUS_12450 gene miaA 6334 5438 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202192.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence103 774 885 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4045 1031 gene locus_tag LOCUS_12460 4045 1031 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence104 <1 1064 gene locus_tag LOCUS_12470 <1 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784237.1:MFS transporter 2006 1122 gene locus_tag LOCUS_12480 2006 1122 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761543.1 protein_id gnl|my_center|LOCUS_12480 3233 2019 gene locus_tag LOCUS_12490 3233 2019 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765713.1 protein_id gnl|my_center|LOCUS_12490 3627 4439 gene locus_tag LOCUS_12500 3627 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 4474 5316 gene locus_tag LOCUS_12510 4474 5316 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_12510 5753 5809 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence105 1331 159 gene locus_tag LOCUS_12520 1331 159 CDS product DUF4960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763287.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12520 3185 1446 gene locus_tag LOCUS_12530 3185 1446 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_12530 6299 3198 gene locus_tag LOCUS_12540 6299 3198 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016266957.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence106 190 1230 gene locus_tag LOCUS_12550 gene gap 190 1230 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_12550 1324 2250 gene locus_tag LOCUS_12560 gene miaA 1324 2250 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795937.1 protein_id gnl|my_center|LOCUS_12560 2271 3221 gene locus_tag LOCUS_12570 2271 3221 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759992.1 protein_id gnl|my_center|LOCUS_12570 3912 3208 gene locus_tag LOCUS_12580 3912 3208 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_12580 4166 6124 gene locus_tag LOCUS_12590 4166 6124 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202228.1 protein_id gnl|my_center|LOCUS_12590 >Feature sequence107 101 1141 gene locus_tag LOCUS_12600 101 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 1243 2280 gene locus_tag LOCUS_12610 1243 2280 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039183945.1 protein_id gnl|my_center|LOCUS_12610 2311 2547 gene locus_tag LOCUS_12620 2311 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 2672 4606 gene locus_tag LOCUS_12630 2672 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 4881 6074 gene locus_tag LOCUS_12640 4881 6074 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920215.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence108 2338 161 gene locus_tag LOCUS_12650 2338 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 6125 2340 gene locus_tag LOCUS_12660 6125 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 >Feature sequence109 1275 457 gene locus_tag LOCUS_12670 1275 457 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797170.1 protein_id gnl|my_center|LOCUS_12670 2828 1440 gene locus_tag LOCUS_12680 2828 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 5526 2866 gene locus_tag LOCUS_12690 5526 2866 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_12690 5803 5994 gene locus_tag LOCUS_12700 5803 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 5996 6223 gene locus_tag LOCUS_12710 5996 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 >Feature sequence110 2767 1124 gene locus_tag LOCUS_12720 2767 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 3043 2780 gene locus_tag LOCUS_12730 3043 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 4391 3003 gene locus_tag LOCUS_12740 4391 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 5379 4399 gene locus_tag LOCUS_12750 5379 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 5599 5450 gene locus_tag LOCUS_12760 5599 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 5687 5914 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence111 1075 1326 gene locus_tag LOCUS_12770 1075 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1323 1595 gene locus_tag LOCUS_12780 1323 1595 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665928.1 protein_id gnl|my_center|LOCUS_12780 2241 1783 gene locus_tag LOCUS_12790 2241 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 2573 3055 gene locus_tag LOCUS_12800 2573 3055 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786485.1 protein_id gnl|my_center|LOCUS_12800 3187 3654 gene locus_tag LOCUS_12810 3187 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 3726 4265 gene locus_tag LOCUS_12820 3726 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence112 1287 388 gene locus_tag LOCUS_12830 gene rfbD 1287 388 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107282.1 protein_id gnl|my_center|LOCUS_12830 1852 1289 gene locus_tag LOCUS_12840 1852 1289 CDS product DUF4924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786016.1 protein_id gnl|my_center|LOCUS_12840 2542 1868 gene locus_tag LOCUS_12850 2542 1868 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767802.1 protein_id gnl|my_center|LOCUS_12850 2689 3669 gene locus_tag LOCUS_12860 2689 3669 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763623.1 protein_id gnl|my_center|LOCUS_12860 3676 3918 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5258 5443 gene locus_tag LOCUS_12870 5258 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 6156 5578 gene locus_tag LOCUS_12880 6156 5578 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770002.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence113 2818 230 gene locus_tag LOCUS_12890 gene clpB 2818 230 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764749.1 protein_id gnl|my_center|LOCUS_12890 4661 3279 gene locus_tag LOCUS_12900 gene rmuC 4661 3279 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478725.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence114 1435 821 gene locus_tag LOCUS_12910 1435 821 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705781.1 protein_id gnl|my_center|LOCUS_12910 4841 1761 gene locus_tag LOCUS_12920 4841 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 6050 5013 gene locus_tag LOCUS_12930 gene asnA 6050 5013 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790904.1 protein_id gnl|my_center|LOCUS_12930 6325 6399 gene locus_tag LOCUS_t00310 6325 6399 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence115 4239 361 gene locus_tag LOCUS_12940 4239 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 4552 6231 gene locus_tag LOCUS_12950 4552 6231 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108692.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence116 54 1742 gene locus_tag LOCUS_12960 54 1742 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040060.1 protein_id gnl|my_center|LOCUS_12960 1955 1779 gene locus_tag LOCUS_12970 1955 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 2292 2086 gene locus_tag LOCUS_12980 2292 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 2215 6021 gene locus_tag LOCUS_12990 2215 6021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence117 343 894 gene locus_tag LOCUS_13000 343 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 980 1378 gene locus_tag LOCUS_13010 980 1378 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766716.1 protein_id gnl|my_center|LOCUS_13010 1563 1832 gene locus_tag LOCUS_13020 1563 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 3218 2355 gene locus_tag LOCUS_13030 3218 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 3403 3245 gene locus_tag LOCUS_13040 3403 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 5510 3450 gene locus_tag LOCUS_13050 5510 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 6280 6206 gene locus_tag LOCUS_t00320 6280 6206 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence118 1106 72 gene locus_tag LOCUS_13060 gene hisC 1106 72 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789125.1 protein_id gnl|my_center|LOCUS_13060 2397 1111 gene locus_tag LOCUS_13070 gene hisD 2397 1111 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766232.1 protein_id gnl|my_center|LOCUS_13070 2535 2709 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2985 3223 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3665 4795 gene locus_tag LOCUS_13080 3665 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 4889 6271 gene locus_tag LOCUS_13090 4889 6271 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286021.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence119 <1 932 gene locus_tag LOCUS_13100 <1 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162303078.1:acetylxylan esterase 1003 2022 gene locus_tag LOCUS_13110 1003 2022 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_13110 2019 3212 gene locus_tag LOCUS_13120 2019 3212 CDS product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202169.1 protein_id gnl|my_center|LOCUS_13120 3214 4593 gene locus_tag LOCUS_13130 3214 4593 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032496674.1 protein_id gnl|my_center|LOCUS_13130 4596 5777 gene locus_tag LOCUS_13140 4596 5777 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_13140 >Feature sequence120 205 1068 gene locus_tag LOCUS_13150 205 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 1247 1477 gene locus_tag LOCUS_13160 1247 1477 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_13160 1474 1797 gene locus_tag LOCUS_13170 1474 1797 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_13170 1830 2741 gene locus_tag LOCUS_13180 1830 2741 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_13180 2887 3243 gene locus_tag LOCUS_13190 2887 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 3298 5367 gene locus_tag LOCUS_13200 3298 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence121 <1 549 gene locus_tag LOCUS_13210 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762826.1:methionine adenosyltransferase 551 1582 gene locus_tag LOCUS_13220 551 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 1593 2342 gene locus_tag LOCUS_13230 1593 2342 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_13230 2347 2748 gene locus_tag LOCUS_13240 gene rnpA 2347 2748 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783651.1 protein_id gnl|my_center|LOCUS_13240 2745 2996 gene locus_tag LOCUS_13250 gene yidD 2745 2996 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779696.1 protein_id gnl|my_center|LOCUS_13250 3070 4368 gene locus_tag LOCUS_13260 gene tyrS 3070 4368 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_13260 4454 4525 gene locus_tag LOCUS_t00330 4454 4525 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4600 4836 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5091 5867 gene locus_tag LOCUS_13270 5091 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 5929 6174 gene locus_tag LOCUS_13280 5929 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence122 1244 2248 gene locus_tag LOCUS_13290 1244 2248 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_13290 2921 2265 gene locus_tag LOCUS_13300 2921 2265 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202815.1 protein_id gnl|my_center|LOCUS_13300 3117 5585 gene locus_tag LOCUS_13310 gene lon 3117 5585 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793926.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence123 <1 3171 gene locus_tag LOCUS_13320 <1 3171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759576.1:SusC/RagA family TonB-linked outer membrane protein 3185 4651 gene locus_tag LOCUS_13330 3185 4651 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759577.1 protein_id gnl|my_center|LOCUS_13330 4704 5405 gene locus_tag LOCUS_13340 4704 5405 CDS product DUF5012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108196.1 protein_id gnl|my_center|LOCUS_13340 5419 5934 gene locus_tag LOCUS_13350 5419 5934 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759578.1 protein_id gnl|my_center|LOCUS_13350 >Feature sequence124 1276 383 gene locus_tag LOCUS_13360 1276 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1164 1469 gene locus_tag LOCUS_13370 1164 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 2697 1543 gene locus_tag LOCUS_13380 2697 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 4289 3351 gene locus_tag LOCUS_13390 4289 3351 CDS product tyrosine-type DNA invertase cluster 3b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536539.1 protein_id gnl|my_center|LOCUS_13390 4532 5341 gene locus_tag LOCUS_13400 4532 5341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546359.1 protein_id gnl|my_center|LOCUS_13400 5467 5688 gene locus_tag LOCUS_13410 5467 5688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 >Feature sequence125 446 3946 gene locus_tag LOCUS_13420 446 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 3933 4658 gene locus_tag LOCUS_13430 3933 4658 CDS product DUF5932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761423.1 protein_id gnl|my_center|LOCUS_13430 <6028 5306 gene locus_tag LOCUS_13440 <6028 5306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109211.1:30S ribosomal protein S1 >Feature sequence126 176 1165 gene locus_tag LOCUS_13450 176 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 2542 1178 gene locus_tag LOCUS_13460 2542 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 3009 2542 gene locus_tag LOCUS_13470 3009 2542 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768302.1 protein_id gnl|my_center|LOCUS_13470 >Feature sequence127 287 3529 gene locus_tag LOCUS_13480 287 3529 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_13480 3705 3772 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3912 5225 gene locus_tag LOCUS_13490 3912 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 5290 5760 gene locus_tag LOCUS_13500 5290 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 >Feature sequence128 58 741 gene locus_tag LOCUS_13510 58 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 738 3974 gene locus_tag LOCUS_13520 gene cas3f 738 3974 CDS product type I-F CRISPR-associated helicase Cas3f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 protein_id gnl|my_center|LOCUS_13520 4056 5657 gene locus_tag LOCUS_13530 4056 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence129 2748 847 gene locus_tag LOCUS_13540 2748 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1192 1354 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4355 2745 gene locus_tag LOCUS_13550 4355 2745 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763175.1 protein_id gnl|my_center|LOCUS_13550 4485 5804 gene locus_tag LOCUS_13560 4485 5804 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788166.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence130 1750 404 gene locus_tag LOCUS_13570 gene purB 1750 404 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760796.1 protein_id gnl|my_center|LOCUS_13570 2042 1967 gene locus_tag LOCUS_t00340 2042 1967 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3723 2227 gene locus_tag LOCUS_13580 3723 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 5050 4052 gene locus_tag LOCUS_13590 5050 4052 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203440.1 protein_id gnl|my_center|LOCUS_13590 5692 5135 gene locus_tag LOCUS_13600 5692 5135 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992764.1 protein_id gnl|my_center|LOCUS_13600 >Feature sequence131 <1 2567 gene locus_tag LOCUS_13610 <1 2567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108183.1:DNA polymerase III subunit alpha 2291 2500 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2733 3047 gene locus_tag LOCUS_13620 gene trxA 2733 3047 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784741.1 protein_id gnl|my_center|LOCUS_13620 3517 3104 gene locus_tag LOCUS_13630 gene tsaE 3517 3104 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_13630 5120 3546 gene locus_tag LOCUS_13640 5120 3546 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence132 310 1557 gene locus_tag LOCUS_13650 gene glf 310 1557 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272526.1 protein_id gnl|my_center|LOCUS_13650 1561 3558 gene locus_tag LOCUS_13660 1561 3558 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962780.1 protein_id gnl|my_center|LOCUS_13660 4084 3687 gene locus_tag LOCUS_tm00010 4084 3687 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 4822 4367 gene locus_tag LOCUS_13670 4822 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 5626 4853 gene locus_tag LOCUS_13680 5626 4853 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648604.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence133 1123 398 gene locus_tag LOCUS_13690 1123 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1826 1203 gene locus_tag LOCUS_13700 1826 1203 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920512.1 protein_id gnl|my_center|LOCUS_13700 2060 3766 gene locus_tag LOCUS_13710 2060 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 3780 4517 gene locus_tag LOCUS_13720 3780 4517 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783729.1 protein_id gnl|my_center|LOCUS_13720 4953 5116 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence134 4078 5259 gene locus_tag LOCUS_13730 4078 5259 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191309483.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence135 <1 933 gene locus_tag LOCUS_13740 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032555756.1:deoxyguanosinetriphosphate triphosphohydrolase 2016 1024 gene locus_tag LOCUS_13750 2016 1024 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784031.1 protein_id gnl|my_center|LOCUS_13750 2901 2071 gene locus_tag LOCUS_13760 2901 2071 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_13760 3506 4012 gene locus_tag LOCUS_13770 gene mraZ 3506 4012 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763721.1 protein_id gnl|my_center|LOCUS_13770 4020 4976 gene locus_tag LOCUS_13780 gene rsmH 4020 4976 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784016.1 protein_id gnl|my_center|LOCUS_13780 4973 5458 gene locus_tag LOCUS_13790 4973 5458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 >Feature sequence136 <1 1332 gene locus_tag LOCUS_13800 <1 1332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103036562.1:TonB-dependent receptor 1356 2921 gene locus_tag LOCUS_13810 1356 2921 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766873.1 protein_id gnl|my_center|LOCUS_13810 2982 3851 gene locus_tag LOCUS_13820 2982 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 4314 5360 gene locus_tag LOCUS_13830 4314 5360 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703911.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence137 392 1795 gene locus_tag LOCUS_13840 392 1795 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 protein_id gnl|my_center|LOCUS_13840 2084 2572 gene locus_tag LOCUS_13850 2084 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 2599 2982 gene locus_tag LOCUS_13860 2599 2982 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804269.1 protein_id gnl|my_center|LOCUS_13860 3023 3844 gene locus_tag LOCUS_13870 3023 3844 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107699.1 protein_id gnl|my_center|LOCUS_13870 3863 4705 gene locus_tag LOCUS_13880 3863 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 4712 5428 gene locus_tag LOCUS_13890 4712 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 >Feature sequence138 1173 4505 gene locus_tag LOCUS_13900 1173 4505 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764381.1 protein_id gnl|my_center|LOCUS_13900 >Feature sequence139 374 490 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 565 3660 gene locus_tag LOCUS_13910 565 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 2019 2208 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3681 5273 gene locus_tag LOCUS_13920 3681 5273 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence140 1315 671 gene locus_tag LOCUS_13930 1315 671 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801226.1 protein_id gnl|my_center|LOCUS_13930 2689 1319 gene locus_tag LOCUS_13940 2689 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 3446 2715 gene locus_tag LOCUS_13950 3446 2715 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202238.1 protein_id gnl|my_center|LOCUS_13950 4016 3450 gene locus_tag LOCUS_13960 4016 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 5354 4029 gene locus_tag LOCUS_13970 5354 4029 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760003.1 protein_id gnl|my_center|LOCUS_13970 4206 4290 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence141 1497 88 gene locus_tag LOCUS_13980 1497 88 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796345.1 protein_id gnl|my_center|LOCUS_13980 4718 1617 gene locus_tag LOCUS_13990 4718 1617 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108255.1 protein_id gnl|my_center|LOCUS_13990 2283 2436 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence142 2257 1493 gene locus_tag LOCUS_14000 2257 1493 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109092.1 protein_id gnl|my_center|LOCUS_14000 2598 2248 gene locus_tag LOCUS_14010 2598 2248 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775585.1 protein_id gnl|my_center|LOCUS_14010 3692 2787 gene locus_tag LOCUS_14020 3692 2787 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767088.1 protein_id gnl|my_center|LOCUS_14020 3983 4744 gene locus_tag LOCUS_14030 gene kdsA 3983 4744 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879994.1 protein_id gnl|my_center|LOCUS_14030 >Feature sequence143 2116 188 gene locus_tag LOCUS_14040 2116 188 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767847.1 protein_id gnl|my_center|LOCUS_14040 <5313 2187 gene locus_tag LOCUS_14050 <5313 2187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767846.1:TonB-dependent receptor >Feature sequence144 1192 1884 gene locus_tag LOCUS_14060 1192 1884 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759606.1 protein_id gnl|my_center|LOCUS_14060 1884 2588 gene locus_tag LOCUS_14070 gene pssA 1884 2588 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759605.1 protein_id gnl|my_center|LOCUS_14070 2799 2901 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4317 3580 gene locus_tag LOCUS_14080 4317 3580 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_14080 4688 4314 gene locus_tag LOCUS_14090 4688 4314 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764002.1 protein_id gnl|my_center|LOCUS_14090 4780 5235 gene locus_tag LOCUS_14100 4780 5235 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784733.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence145 <1 1581 gene locus_tag LOCUS_14110 <1 1581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003234692.1:alpha-amylase 2094 1588 gene locus_tag LOCUS_14120 2094 1588 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922234.1 protein_id gnl|my_center|LOCUS_14120 2383 2958 gene locus_tag LOCUS_14130 2383 2958 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391428.1 protein_id gnl|my_center|LOCUS_14130 3586 3131 gene locus_tag LOCUS_14140 3586 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 4048 4770 gene locus_tag LOCUS_14150 4048 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 >Feature sequence146 1072 1160 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1176 4967 gene locus_tag LOCUS_14160 1176 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14160 >Feature sequence147 4567 1814 gene locus_tag LOCUS_14170 4567 1814 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107553.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence148 4651 1814 gene locus_tag LOCUS_14180 4651 1814 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107553.1 protein_id gnl|my_center|LOCUS_14180 >Feature sequence149 <1 564 gene locus_tag LOCUS_14190 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203428.1:thioesterase 708 1748 gene locus_tag LOCUS_14200 gene ilvC 708 1748 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761037.1 protein_id gnl|my_center|LOCUS_14200 4445 2550 gene locus_tag LOCUS_14210 4445 2550 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_14210 <5059 4466 gene locus_tag LOCUS_14220 <5059 4466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760859.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence150 4307 291 gene locus_tag LOCUS_14230 4307 291 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108364.1 protein_id gnl|my_center|LOCUS_14230 >Feature sequence151 107 910 gene locus_tag LOCUS_14240 107 910 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785272.1 protein_id gnl|my_center|LOCUS_14240 904 1710 gene locus_tag LOCUS_14250 904 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1737 2243 gene locus_tag LOCUS_14260 1737 2243 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964325.1 protein_id gnl|my_center|LOCUS_14260 2522 2286 gene locus_tag LOCUS_14270 2522 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 3570 2602 gene locus_tag LOCUS_14280 3570 2602 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393683.1 protein_id gnl|my_center|LOCUS_14280 4299 3583 gene locus_tag LOCUS_14290 4299 3583 CDS product aromatic aminobenezylarsenical efflux permease ArsG family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107453.1 protein_id gnl|my_center|LOCUS_14290 4680 4309 gene locus_tag LOCUS_14300 4680 4309 CDS product nitrophenyl compound nitroreductase subunit ArsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292399.1 protein_id gnl|my_center|LOCUS_14300 4994 4734 gene locus_tag LOCUS_14310 4994 4734 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292400.1 protein_id gnl|my_center|LOCUS_14310 >Feature sequence152 925 1039 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1212 2489 gene locus_tag LOCUS_14320 1212 2489 CDS product DUF4302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767466.1 protein_id gnl|my_center|LOCUS_14320 3010 3155 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3255 3653 gene locus_tag LOCUS_14330 3255 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 4110 4712 gene locus_tag LOCUS_14340 4110 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107867.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence153 168 299 gene locus_tag LOCUS_14350 168 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 1809 523 gene locus_tag LOCUS_14360 1809 523 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174705273.1 protein_id gnl|my_center|LOCUS_14360 3584 1827 gene locus_tag LOCUS_14370 3584 1827 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083683.1 protein_id gnl|my_center|LOCUS_14370 >Feature sequence154 80 4 gene locus_tag LOCUS_t00350 80 4 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 180 104 gene locus_tag LOCUS_t00360 180 104 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1363 848 gene locus_tag LOCUS_14380 1363 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 2679 1489 gene locus_tag LOCUS_14390 2679 1489 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765564.1 protein_id gnl|my_center|LOCUS_14390 3361 2681 gene locus_tag LOCUS_14400 3361 2681 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660145.1 protein_id gnl|my_center|LOCUS_14400 4086 3514 gene locus_tag LOCUS_14410 4086 3514 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_14410 4632 4090 gene locus_tag LOCUS_14420 4632 4090 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802804.1 protein_id gnl|my_center|LOCUS_14420 >Feature sequence155 <1 3438 gene locus_tag LOCUS_14430 <1 3438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_072066367.1:alpha-2-macroglobulin family protein 3442 4512 gene locus_tag LOCUS_14440 3442 4512 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796193.1 protein_id gnl|my_center|LOCUS_14440 >Feature sequence156 595 287 gene locus_tag LOCUS_14450 595 287 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082849.1 protein_id gnl|my_center|LOCUS_14450 1319 693 gene locus_tag LOCUS_14460 1319 693 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_14460 1962 1336 gene locus_tag LOCUS_14470 1962 1336 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_14470 2923 1991 gene locus_tag LOCUS_14480 gene rsgA 2923 1991 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202106.1 protein_id gnl|my_center|LOCUS_14480 3495 2935 gene locus_tag LOCUS_14490 gene frr 3495 2935 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764014.1 protein_id gnl|my_center|LOCUS_14490 4064 3585 gene locus_tag LOCUS_14500 4064 3585 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794873.1 protein_id gnl|my_center|LOCUS_14500 4401 4066 gene locus_tag LOCUS_14510 4401 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 4411 4695 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence157 115 2124 gene locus_tag LOCUS_14520 115 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 2039 3040 gene locus_tag LOCUS_14530 2039 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 2043 2120 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3062 4693 gene locus_tag LOCUS_14540 3062 4693 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768282.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence158 <1 682 gene locus_tag LOCUS_14550 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202182.1:DEAD/DEAH box helicase 1038 1508 gene locus_tag LOCUS_14560 gene greA 1038 1508 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765198.1 protein_id gnl|my_center|LOCUS_14560 1551 1952 gene locus_tag LOCUS_14570 1551 1952 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_14570 3100 2012 gene locus_tag LOCUS_14580 3100 2012 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_14580 3236 3317 gene locus_tag LOCUS_t00370 3236 3317 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 <4857 3586 gene locus_tag LOCUS_14590 <4857 3586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202802.1:FGGY-family carbohydrate kinase >Feature sequence159 <1 1248 gene locus_tag LOCUS_14600 <1 1248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764528.1:preprotein translocase subunit SecA 1265 2026 gene locus_tag LOCUS_14610 1265 2026 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_14610 2184 4604 gene locus_tag LOCUS_14620 2184 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 3554 3653 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence160 <1 2127 gene locus_tag LOCUS_14630 <1 2127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919026.1:TonB-dependent receptor 2220 2894 gene locus_tag LOCUS_14640 2220 2894 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107524.1 protein_id gnl|my_center|LOCUS_14640 2882 3964 gene locus_tag LOCUS_14650 2882 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 >Feature sequence161 2299 41 gene locus_tag LOCUS_14660 2299 41 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203216.1 protein_id gnl|my_center|LOCUS_14660 3211 2303 gene locus_tag LOCUS_14670 3211 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 3211 4695 gene locus_tag LOCUS_14680 gene radA 3211 4695 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784538.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence162 277 1389 gene locus_tag LOCUS_14690 gene prfA 277 1389 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785133.1 protein_id gnl|my_center|LOCUS_14690 1409 1549 gene locus_tag LOCUS_14700 1409 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1549 2370 gene locus_tag LOCUS_14710 gene pyrF 1549 2370 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202194.1 protein_id gnl|my_center|LOCUS_14710 2570 3619 gene locus_tag LOCUS_14720 gene lpxD 2570 3619 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764416.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence163 2540 1113 gene locus_tag LOCUS_14730 2540 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 3585 4184 gene locus_tag LOCUS_14740 3585 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 >Feature sequence164 3548 333 gene locus_tag LOCUS_14750 3548 333 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764385.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence165 961 608 gene locus_tag LOCUS_14760 961 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 2283 1018 gene locus_tag LOCUS_14770 2283 1018 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203354.1 protein_id gnl|my_center|LOCUS_14770 3596 2325 gene locus_tag LOCUS_14780 3596 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 <4575 3598 gene locus_tag LOCUS_14790 <4575 3598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203355.1:efflux RND transporter permease subunit 3790 3838 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence166 260 919 gene locus_tag LOCUS_14800 gene lptC 260 919 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764532.1 protein_id gnl|my_center|LOCUS_14800 991 2190 gene locus_tag LOCUS_14810 991 2190 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_14810 2281 4425 gene locus_tag LOCUS_14820 2281 4425 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658876.1 protein_id gnl|my_center|LOCUS_14820 >Feature sequence167 2888 786 gene locus_tag LOCUS_14830 gene recG 2888 786 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791121.1 protein_id gnl|my_center|LOCUS_14830 3672 2968 gene locus_tag LOCUS_14840 3672 2968 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791123.1 protein_id gnl|my_center|LOCUS_14840 4270 3692 gene locus_tag LOCUS_14850 4270 3692 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence168 219 416 gene locus_tag LOCUS_14860 219 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 423 3449 gene locus_tag LOCUS_14870 423 3449 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence169 1423 575 gene locus_tag LOCUS_14880 1423 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 2336 1425 gene locus_tag LOCUS_14890 2336 1425 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_14890 3122 2349 gene locus_tag LOCUS_14900 3122 2349 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_14900 3364 3654 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence170 <1 1863 gene locus_tag LOCUS_14910 <1 1863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765808.1:glycoside hydrolase family 78 protein >Feature sequence171 199 657 gene locus_tag LOCUS_14920 199 657 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071200.1 protein_id gnl|my_center|LOCUS_14920 667 1335 gene locus_tag LOCUS_14930 667 1335 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291724.1 protein_id gnl|my_center|LOCUS_14930 3063 1351 gene locus_tag LOCUS_14940 3063 1351 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202063.1 protein_id gnl|my_center|LOCUS_14940 4190 3066 gene locus_tag LOCUS_14950 4190 3066 CDS product sensor protein KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784495.1 protein_id gnl|my_center|LOCUS_14950 >Feature sequence172 <1 582 gene locus_tag LOCUS_14960 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763745.1:LptF/LptG family permease 602 1066 gene locus_tag LOCUS_14970 602 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 1083 1454 gene locus_tag LOCUS_14980 1083 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1597 2790 gene locus_tag LOCUS_14990 1597 2790 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796424.1 protein_id gnl|my_center|LOCUS_14990 3045 3884 gene locus_tag LOCUS_15000 3045 3884 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763543.1 protein_id gnl|my_center|LOCUS_15000 >Feature sequence173 1232 138 gene locus_tag LOCUS_15010 gene trpS 1232 138 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_15010 1446 2486 gene locus_tag LOCUS_15020 1446 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 3983 2592 gene locus_tag LOCUS_15030 gene asnS 3983 2592 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203550.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence174 <1 2887 gene locus_tag LOCUS_15040 <1 2887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963637.1:type II CRISPR RNA-guided endonuclease Cas9 2884 3819 gene locus_tag LOCUS_15050 gene cas1 2884 3819 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_15050 3846 4151 gene locus_tag LOCUS_15060 gene cas2 3846 4151 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence175 1432 1607 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1658 1894 gene locus_tag LOCUS_15070 1658 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1915 3252 gene locus_tag LOCUS_15080 1915 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 4034 3750 gene locus_tag LOCUS_15090 4034 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 >Feature sequence176 968 246 gene locus_tag LOCUS_15100 968 246 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798173.1 protein_id gnl|my_center|LOCUS_15100 1392 970 gene locus_tag LOCUS_15110 1392 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1441 1732 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2518 2267 gene locus_tag LOCUS_15120 2518 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15120 3228 2512 gene locus_tag LOCUS_15130 3228 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15130 2573 2620 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <4217 3267 gene locus_tag LOCUS_15140 <4217 3267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759776.1:lysine--tRNA ligase >Feature sequence177 448 1602 gene locus_tag LOCUS_15150 gene fucO 448 1602 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783906.1 protein_id gnl|my_center|LOCUS_15150 2414 1662 gene locus_tag LOCUS_15160 2414 1662 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_15160 3114 2425 gene locus_tag LOCUS_15170 3114 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 3226 3401 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence178 241 1548 gene locus_tag LOCUS_15180 241 1548 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108106.1 protein_id gnl|my_center|LOCUS_15180 1603 2397 gene locus_tag LOCUS_15190 1603 2397 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761063.1 protein_id gnl|my_center|LOCUS_15190 2459 2944 gene locus_tag LOCUS_15200 2459 2944 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797943.1 protein_id gnl|my_center|LOCUS_15200 3642 3139 gene locus_tag LOCUS_15210 3642 3139 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790644.1 protein_id gnl|my_center|LOCUS_15210 3988 3900 gene locus_tag LOCUS_t00380 3988 3900 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence179 2275 113 gene locus_tag LOCUS_15220 2275 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 3428 2313 gene locus_tag LOCUS_15230 gene tnpB 3428 2313 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861290.1 protein_id gnl|my_center|LOCUS_15230 >Feature sequence180 >Feature sequence181 579 2486 gene locus_tag LOCUS_15240 579 2486 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201875.1 protein_id gnl|my_center|LOCUS_15240 3051 2620 gene locus_tag LOCUS_15250 3051 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15250 3057 3134 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence182 250 1353 gene locus_tag LOCUS_15260 gene aroC 250 1353 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802245.1 protein_id gnl|my_center|LOCUS_15260 2440 1532 gene locus_tag LOCUS_15270 2440 1532 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765720.1 protein_id gnl|my_center|LOCUS_15270 3204 2428 gene locus_tag LOCUS_15280 3204 2428 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793749.1 protein_id gnl|my_center|LOCUS_15280 3699 3244 gene locus_tag LOCUS_15290 3699 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 >Feature sequence183 804 22 gene locus_tag LOCUS_15300 804 22 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087251.1 protein_id gnl|my_center|LOCUS_15300 1596 871 gene locus_tag LOCUS_15310 1596 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 2634 1822 gene locus_tag LOCUS_15320 2634 1822 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761827.1 protein_id gnl|my_center|LOCUS_15320 3188 2673 gene locus_tag LOCUS_15330 3188 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 3618 3250 gene locus_tag LOCUS_15340 3618 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 >Feature sequence184 30 482 gene locus_tag LOCUS_15350 30 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 941 1498 gene locus_tag LOCUS_15360 941 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 1495 1893 gene locus_tag LOCUS_15370 1495 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 1977 2618 gene locus_tag LOCUS_15380 1977 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 2892 3170 gene locus_tag LOCUS_15390 2892 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 3109 3534 gene locus_tag LOCUS_15400 3109 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 3515 3718 gene locus_tag LOCUS_15410 3515 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence185 716 144 gene locus_tag LOCUS_15420 716 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1444 1223 gene locus_tag LOCUS_15430 1444 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 3159 1669 gene locus_tag LOCUS_15440 3159 1669 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_15440 3474 3166 gene locus_tag LOCUS_15450 3474 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 >Feature sequence186 1980 1750 gene locus_tag LOCUS_15460 1980 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 3045 2008 gene locus_tag LOCUS_15470 3045 2008 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039183945.1 protein_id gnl|my_center|LOCUS_15470 >Feature sequence187 411 67 gene locus_tag LOCUS_15480 411 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 677 411 gene locus_tag LOCUS_15490 677 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 826 686 gene locus_tag LOCUS_15500 826 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 1017 823 gene locus_tag LOCUS_15510 1017 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 1240 1004 gene locus_tag LOCUS_15520 1240 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 3759 1252 gene locus_tag LOCUS_15530 3759 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence188 113 880 gene locus_tag LOCUS_15540 gene cbpA 113 880 CDS product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368684.1 protein_id gnl|my_center|LOCUS_15540 1004 3259 gene locus_tag LOCUS_15550 gene clpA 1004 3259 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383724.1 protein_id gnl|my_center|LOCUS_15550 3268 3621 gene locus_tag LOCUS_15560 3268 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 >Feature sequence189 815 564 gene locus_tag LOCUS_15570 815 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 1263 1625 gene locus_tag LOCUS_15580 1263 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 1612 1923 gene locus_tag LOCUS_15590 1612 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 2335 3519 gene locus_tag LOCUS_15600 2335 3519 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203374.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence190 731 1636 gene locus_tag LOCUS_15610 731 1636 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107322.1 protein_id gnl|my_center|LOCUS_15610 <3796 1760 gene locus_tag LOCUS_15620 <3796 1760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107551.1:magnesium-translocating P-type ATPase >Feature sequence191 <3790 1596 gene locus_tag LOCUS_15630 <3790 1596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765337.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence192 631 1518 gene locus_tag LOCUS_15640 631 1518 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769713.1 protein_id gnl|my_center|LOCUS_15640 1539 2978 gene locus_tag LOCUS_15650 1539 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 <3788 3054 gene locus_tag LOCUS_15660 <3788 3054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107145.1:tRNA 2-thiouridine(34) synthase MnmA >Feature sequence193 2639 330 gene locus_tag LOCUS_15670 2639 330 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108600.1 protein_id gnl|my_center|LOCUS_15670 3257 2892 gene locus_tag LOCUS_15680 3257 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence194 1171 41 gene locus_tag LOCUS_15690 1171 41 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929836.1 protein_id gnl|my_center|LOCUS_15690 2195 1194 gene locus_tag LOCUS_15700 2195 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 2922 2203 gene locus_tag LOCUS_15710 2922 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 3308 3030 gene locus_tag LOCUS_15720 3308 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence195 460 810 gene locus_tag LOCUS_15730 460 810 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932186.1 protein_id gnl|my_center|LOCUS_15730 841 2373 gene locus_tag LOCUS_15740 841 2373 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986845.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence196 179 1237 gene locus_tag LOCUS_15750 179 1237 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909134.1 protein_id gnl|my_center|LOCUS_15750 1234 1899 gene locus_tag LOCUS_15760 1234 1899 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_15760 2712 3020 gene locus_tag LOCUS_15770 2712 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence197 36 364 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctcttagaggatcatccattacaacaaggattaagac 789 1634 gene locus_tag LOCUS_15780 789 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 2355 2492 gene locus_tag LOCUS_15790 2355 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 2485 2619 gene locus_tag LOCUS_15800 2485 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 >Feature sequence198 3189 328 gene locus_tag LOCUS_15810 3189 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 859 1004 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence199 167 1063 gene locus_tag LOCUS_15820 167 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 1086 2537 gene locus_tag LOCUS_15830 gene gldK 1086 2537 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_15830 2537 3328 gene locus_tag LOCUS_15840 2537 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 >Feature sequence200 1151 555 gene locus_tag LOCUS_15850 1151 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 1623 1703 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1806 3179 gene locus_tag LOCUS_15860 1806 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 3043 3158 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence201 <1 545 gene locus_tag LOCUS_15870 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162303160.1:malectin domain-containing carbohydrate-binding protein 1443 1580 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence202 470 1213 gene locus_tag LOCUS_15880 470 1213 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292113.1 protein_id gnl|my_center|LOCUS_15880 3052 1292 gene locus_tag LOCUS_15890 3052 1292 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107752.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence203 603 712 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1368 1748 gene locus_tag LOCUS_15900 1368 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1750 2304 gene locus_tag LOCUS_15910 1750 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 2340 2822 gene locus_tag LOCUS_15920 2340 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 2803 3435 gene locus_tag LOCUS_15930 2803 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 >Feature sequence204 105 1286 gene locus_tag LOCUS_15940 105 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 1425 3464 gene locus_tag LOCUS_15950 1425 3464 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233883.1 protein_id gnl|my_center|LOCUS_15950 >Feature sequence205 214 2994 gene locus_tag LOCUS_15960 214 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 2852 2983 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3053 3331 gene locus_tag LOCUS_15970 3053 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 >Feature sequence206 1558 401 gene locus_tag LOCUS_15980 1558 401 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785925.1 protein_id gnl|my_center|LOCUS_15980 1997 3232 gene locus_tag LOCUS_15990 1997 3232 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344468.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence207 2555 111 gene locus_tag LOCUS_16000 2555 111 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_16000 <3458 2729 gene locus_tag LOCUS_16010 <3458 2729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202192.1:tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA >Feature sequence208 767 42 gene locus_tag LOCUS_16020 767 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 2649 2893 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence209 1117 494 gene locus_tag LOCUS_16030 1117 494 CDS product YiiX family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797352.1 protein_id gnl|my_center|LOCUS_16030 2986 1322 gene locus_tag LOCUS_16040 gene hcp 2986 1322 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761363.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence210 2593 434 gene locus_tag LOCUS_16050 gene cas3 2593 434 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932807.1 protein_id gnl|my_center|LOCUS_16050 3231 2890 gene locus_tag LOCUS_16060 3231 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 >Feature sequence211 1348 329 gene locus_tag LOCUS_16070 1348 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 1521 1901 gene locus_tag LOCUS_16080 1521 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 3056 1998 gene locus_tag LOCUS_16090 3056 1998 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029699.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence212 <1 1023 gene locus_tag LOCUS_16100 <1 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203395.1:O-antigen translocase 1016 2005 gene locus_tag LOCUS_16110 1016 2005 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107732.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence213 509 291 gene locus_tag LOCUS_16120 509 291 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202295.1 protein_id gnl|my_center|LOCUS_16120 1484 717 gene locus_tag LOCUS_16130 1484 717 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295276.1 protein_id gnl|my_center|LOCUS_16130 <3319 1851 gene locus_tag LOCUS_16140 <3319 1851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814533.1:M13 family metallopeptidase >Feature sequence214 495 678 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <3313 1302 gene locus_tag LOCUS_16150 <3313 1302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005796729.1:penicillin-binding protein >Feature sequence215 820 167 gene locus_tag LOCUS_16160 820 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16160 2623 914 gene locus_tag LOCUS_16170 2623 914 CDS product calcineurin-like phosphoesterase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766056.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence216 <1 1326 gene locus_tag LOCUS_16180 <1 1326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037393182.1:glycoside hydrolase family 28 protein 2504 1782 gene locus_tag LOCUS_16190 2504 1782 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428846.1 protein_id gnl|my_center|LOCUS_16190 2619 2993 gene locus_tag LOCUS_16200 2619 2993 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787945.1 protein_id gnl|my_center|LOCUS_16200 >Feature sequence217 729 1901 gene locus_tag LOCUS_16210 729 1901 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_16210 2223 1909 gene locus_tag LOCUS_16220 2223 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 2435 2860 gene locus_tag LOCUS_16230 2435 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 >Feature sequence218 1379 1005 gene locus_tag LOCUS_16240 gene rsfS 1379 1005 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764242.1 protein_id gnl|my_center|LOCUS_16240 1600 1671 gene locus_tag LOCUS_t00390 1600 1671 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2112 1720 gene locus_tag LOCUS_16250 2112 1720 CDS product DUF1634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980460.1 protein_id gnl|my_center|LOCUS_16250 2945 2112 gene locus_tag LOCUS_16260 2945 2112 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932424.1 protein_id gnl|my_center|LOCUS_16260 >Feature sequence219 <1 1463 gene locus_tag LOCUS_16270 <1 1463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_172461661.1:substrate-binding domain-containing protein >Feature sequence220 1796 1242 gene locus_tag LOCUS_16280 gene nqrE 1796 1242 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787208.1 protein_id gnl|my_center|LOCUS_16280 2525 1893 gene locus_tag LOCUS_16290 2525 1893 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 protein_id gnl|my_center|LOCUS_16290 3165 2545 gene locus_tag LOCUS_16300 3165 2545 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 protein_id gnl|my_center|LOCUS_16300 >Feature sequence221 <1 889 gene locus_tag LOCUS_16310 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784898.1:DUF4435 domain-containing protein 1923 961 gene locus_tag LOCUS_16320 1923 961 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_16320 <3189 2321 gene locus_tag LOCUS_16330 <3189 2321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764325.1:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence222 1130 420 gene locus_tag LOCUS_16340 1130 420 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107248.1 protein_id gnl|my_center|LOCUS_16340 2347 1256 gene locus_tag LOCUS_16350 2347 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 2392 2655 gene locus_tag LOCUS_16360 2392 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 <3187 2688 gene locus_tag LOCUS_16370 <3187 2688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002379416.1:heavy metal translocating P-type ATPase >Feature sequence223 192 872 gene locus_tag LOCUS_16380 192 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 2813 897 gene locus_tag LOCUS_16390 2813 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 >Feature sequence224 2868 1639 gene locus_tag LOCUS_16400 2868 1639 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence225 <1 1826 gene locus_tag LOCUS_16410 <1 1826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813448.1:TonB-dependent receptor 1950 2444 gene locus_tag LOCUS_16420 gene pnuC 1950 2444 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence226 146 1360 gene locus_tag LOCUS_16430 146 1360 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817724.1 protein_id gnl|my_center|LOCUS_16430 2319 1369 gene locus_tag LOCUS_16440 2319 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 2879 2340 gene locus_tag LOCUS_16450 2879 2340 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837223.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence227 2900 234 gene locus_tag LOCUS_16460 gene mutS 2900 234 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108646.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence228 278 640 gene locus_tag LOCUS_16470 gene dtd 278 640 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796976.1 protein_id gnl|my_center|LOCUS_16470 647 982 gene locus_tag LOCUS_16480 647 982 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762871.1 protein_id gnl|my_center|LOCUS_16480 1010 1972 gene locus_tag LOCUS_16490 gene deoC 1010 1972 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762870.1 protein_id gnl|my_center|LOCUS_16490 <3038 2203 gene locus_tag LOCUS_16500 <3038 2203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108724.1:polyprenyl synthetase family protein >Feature sequence229 <1 836 gene locus_tag LOCUS_16510 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108724.1:polyprenyl synthetase family protein 2029 1067 gene locus_tag LOCUS_16520 gene deoC 2029 1067 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762870.1 protein_id gnl|my_center|LOCUS_16520 2392 2060 gene locus_tag LOCUS_16530 2392 2060 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762871.1 protein_id gnl|my_center|LOCUS_16530 2761 2399 gene locus_tag LOCUS_16540 gene dtd 2761 2399 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796976.1 protein_id gnl|my_center|LOCUS_16540 >Feature sequence230 450 1646 gene locus_tag LOCUS_16550 gene trpB 450 1646 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788278.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence231 <1 1629 gene locus_tag LOCUS_16560 <1 1629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769973.1:adenosylcobalamin-dependent ribonucleoside-diphosphate reductase 1635 2018 gene locus_tag LOCUS_16570 gene folB 1635 2018 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759754.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence232 7 1134 gene locus_tag LOCUS_16580 7 1134 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794507.1 protein_id gnl|my_center|LOCUS_16580 1251 2099 gene locus_tag LOCUS_16590 1251 2099 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202730.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence233 <1 687 gene locus_tag LOCUS_16600 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759975.1:glycosyltransferase family 4 protein 726 2090 gene locus_tag LOCUS_16610 726 2090 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785317.1 protein_id gnl|my_center|LOCUS_16610 >Feature sequence234 118 609 gene locus_tag LOCUS_16620 118 609 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785783.1 protein_id gnl|my_center|LOCUS_16620 606 1094 gene locus_tag LOCUS_16630 606 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 1098 1550 gene locus_tag LOCUS_16640 1098 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 2875 1607 gene locus_tag LOCUS_16650 2875 1607 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890799.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence235 283 447 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2238 2308 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2397 2879 gene locus_tag LOCUS_16660 2397 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence236 381 2894 gene locus_tag LOCUS_16670 381 2894 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164979579.1 protein_id gnl|my_center|LOCUS_16670 410 564 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence237 <1 2150 gene locus_tag LOCUS_16680 <1 2150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082478.1:beta-glucosidase >Feature sequence238 <1 756 gene locus_tag LOCUS_16690 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108203.1:AI-2E family transporter 819 892 gene locus_tag LOCUS_t00400 819 892 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1238 1786 gene locus_tag LOCUS_16700 1238 1786 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963355.1 protein_id gnl|my_center|LOCUS_16700 2294 2926 gene locus_tag LOCUS_16710 2294 2926 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108273.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence239 1960 599 gene locus_tag LOCUS_16720 1960 599 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796577.1 protein_id gnl|my_center|LOCUS_16720 2589 2092 gene locus_tag LOCUS_16730 2589 2092 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_16730 2743 2594 gene locus_tag LOCUS_16740 2743 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence240 <1 1134 gene locus_tag LOCUS_16750 <1 1134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202911.1:pyruvate, phosphate dikinase 1282 2787 gene locus_tag LOCUS_16760 1282 2787 CDS product phage integrase SAM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108551.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence241 2198 351 gene locus_tag LOCUS_16770 2198 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16770 2222 2319 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence242 1032 235 gene locus_tag LOCUS_16780 1032 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 2296 2610 gene locus_tag LOCUS_16790 2296 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 >Feature sequence243 >Feature sequence244 2494 785 gene locus_tag LOCUS_16800 gene cas8c 2494 785 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926986.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence245 336 767 gene locus_tag LOCUS_16810 gene mscL 336 767 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785250.1 protein_id gnl|my_center|LOCUS_16810 2648 1104 gene locus_tag LOCUS_16820 gene guaA 2648 1104 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785252.1 protein_id gnl|my_center|LOCUS_16820 >Feature sequence246 610 1725 gene locus_tag LOCUS_16830 610 1725 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813038.1 protein_id gnl|my_center|LOCUS_16830 1722 2075 gene locus_tag LOCUS_16840 1722 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 >Feature sequence247 576 790 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 871 2052 gene locus_tag LOCUS_16850 gene sufD 871 2052 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767608.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence248 <1 1259 gene locus_tag LOCUS_16860 <1 1259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761665.1:TonB-dependent receptor 1096 1187 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1256 2449 gene locus_tag LOCUS_16870 1256 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 2290 2400 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence249 1202 708 gene locus_tag LOCUS_16880 1202 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 1503 1195 gene locus_tag LOCUS_16890 1503 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 <2666 1906 gene locus_tag LOCUS_16900 <2666 1906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208070.1:DUF4435 domain-containing protein >Feature sequence250 <1 2097 gene locus_tag LOCUS_16910 <1 2097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005796991.1:DNA polymerase I >Feature sequence251 >Feature sequence252 631 152 gene locus_tag LOCUS_16920 631 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 >Feature sequence253 1387 791 gene locus_tag LOCUS_16930 1387 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 1750 1574 gene locus_tag LOCUS_16940 1750 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 >Feature sequence254 2 469 gene locus_tag LOCUS_16950 2 469 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768302.1 protein_id gnl|my_center|LOCUS_16950 <2551 577 gene locus_tag LOCUS_16960 <2551 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108407.1:response regulator >Feature sequence255 283 2442 gene locus_tag LOCUS_16970 283 2442 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584086.1 protein_id gnl|my_center|LOCUS_16970