>Feature sequence01 322 729 gene locus_tag LOCUS_00010 gene mce 322 729 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 protein_id gnl|my_center|LOCUS_00010 816 1568 gene locus_tag LOCUS_00020 816 1568 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804112.1 protein_id gnl|my_center|LOCUS_00020 1613 2785 gene locus_tag LOCUS_00030 1613 2785 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804113.1 protein_id gnl|my_center|LOCUS_00030 2945 4594 gene locus_tag LOCUS_00040 2945 4594 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281991.1 protein_id gnl|my_center|LOCUS_00040 4694 6340 gene locus_tag LOCUS_00050 4694 6340 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879349.1 protein_id gnl|my_center|LOCUS_00050 6699 7580 gene locus_tag LOCUS_00060 6699 7580 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_00060 7599 8381 gene locus_tag LOCUS_00070 7599 8381 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 protein_id gnl|my_center|LOCUS_00070 8413 9579 gene locus_tag LOCUS_00080 8413 9579 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980503.1 protein_id gnl|my_center|LOCUS_00080 9584 10015 gene locus_tag LOCUS_00090 9584 10015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 10115 11278 gene locus_tag LOCUS_00100 10115 11278 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957928.1 protein_id gnl|my_center|LOCUS_00100 11327 13114 gene locus_tag LOCUS_00110 11327 13114 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902654.1 protein_id gnl|my_center|LOCUS_00110 14170 13271 gene locus_tag LOCUS_00120 14170 13271 CDS product glutaconate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272325.1 protein_id gnl|my_center|LOCUS_00120 15245 14190 gene locus_tag LOCUS_00130 15245 14190 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811552.1 protein_id gnl|my_center|LOCUS_00130 15992 15636 gene locus_tag LOCUS_00140 15992 15636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16361 18325 gene locus_tag LOCUS_00150 16361 18325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 18463 19440 gene locus_tag LOCUS_00160 18463 19440 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_00160 19419 20447 gene locus_tag LOCUS_00170 19419 20447 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_00170 20576 21064 gene locus_tag LOCUS_00180 20576 21064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21081 22307 gene locus_tag LOCUS_00190 21081 22307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 22291 23259 gene locus_tag LOCUS_00200 gene miaA 22291 23259 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759993.1 protein_id gnl|my_center|LOCUS_00200 23948 23235 gene locus_tag LOCUS_00210 23948 23235 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_00210 24712 23951 gene locus_tag LOCUS_00220 24712 23951 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080269.1 protein_id gnl|my_center|LOCUS_00220 25740 24709 gene locus_tag LOCUS_00230 25740 24709 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869389.1 protein_id gnl|my_center|LOCUS_00230 26740 25802 gene locus_tag LOCUS_00240 26740 25802 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869388.1 protein_id gnl|my_center|LOCUS_00240 27914 26778 gene locus_tag LOCUS_00250 27914 26778 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080272.1 protein_id gnl|my_center|LOCUS_00250 28081 28974 gene locus_tag LOCUS_00260 gene xerD 28081 28974 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942464.1 protein_id gnl|my_center|LOCUS_00260 28978 30990 gene locus_tag LOCUS_00270 28978 30990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 31009 31836 gene locus_tag LOCUS_00280 gene kdsA 31009 31836 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_00280 31833 32375 gene locus_tag LOCUS_00290 31833 32375 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942537.1 protein_id gnl|my_center|LOCUS_00290 32537 33088 gene locus_tag LOCUS_00300 32537 33088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 33085 33645 gene locus_tag LOCUS_00310 33085 33645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 33688 34419 gene locus_tag LOCUS_00320 gene lptB 33688 34419 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942533.1 protein_id gnl|my_center|LOCUS_00320 34466 35926 gene locus_tag LOCUS_00330 gene rpoN 34466 35926 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_00330 35999 36538 gene locus_tag LOCUS_00340 gene raiA 35999 36538 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_00340 36552 37019 gene locus_tag LOCUS_00350 36552 37019 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938921.1 protein_id gnl|my_center|LOCUS_00350 37166 37780 gene locus_tag LOCUS_00360 37166 37780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 37777 38646 gene locus_tag LOCUS_00370 gene rapZ 37777 38646 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942529.1 protein_id gnl|my_center|LOCUS_00370 39974 38643 gene locus_tag LOCUS_00380 39974 38643 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939137.1 protein_id gnl|my_center|LOCUS_00380 40323 40144 gene locus_tag LOCUS_00390 40323 40144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 40310 40828 gene locus_tag LOCUS_00400 40310 40828 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545227.1 protein_id gnl|my_center|LOCUS_00400 40857 42053 gene locus_tag LOCUS_00410 gene coaBC 40857 42053 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_00410 42056 42784 gene locus_tag LOCUS_00420 42056 42784 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_00420 42796 44118 gene locus_tag LOCUS_00430 42796 44118 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_00430 44130 44879 gene locus_tag LOCUS_00440 44130 44879 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546761.1 protein_id gnl|my_center|LOCUS_00440 44896 45210 gene locus_tag LOCUS_00450 44896 45210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 45207 45896 gene locus_tag LOCUS_00460 45207 45896 CDS product MtnX-like HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816647.1 protein_id gnl|my_center|LOCUS_00460 47015 45891 gene locus_tag LOCUS_00470 gene hemW 47015 45891 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_00470 48821 47025 gene locus_tag LOCUS_00480 gene lepA 48821 47025 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957093.1 protein_id gnl|my_center|LOCUS_00480 49572 48898 gene locus_tag LOCUS_00490 49572 48898 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939218.1 protein_id gnl|my_center|LOCUS_00490 50572 49679 gene locus_tag LOCUS_00500 50572 49679 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551371.1 protein_id gnl|my_center|LOCUS_00500 50990 52171 gene locus_tag LOCUS_00510 50990 52171 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941722.1 protein_id gnl|my_center|LOCUS_00510 52478 52206 gene locus_tag LOCUS_00520 52478 52206 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143981.1 protein_id gnl|my_center|LOCUS_00520 52799 52527 gene locus_tag LOCUS_00530 52799 52527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 52964 53446 gene locus_tag LOCUS_00540 52964 53446 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583986.1 protein_id gnl|my_center|LOCUS_00540 53455 53940 gene locus_tag LOCUS_00550 53455 53940 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_00550 53942 54277 gene locus_tag LOCUS_00560 53942 54277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 54289 54756 gene locus_tag LOCUS_00570 54289 54756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 55219 54725 gene locus_tag LOCUS_00580 55219 54725 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_00580 57303 55222 gene locus_tag LOCUS_00590 gene fusA 57303 55222 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_00590 57547 59019 gene locus_tag LOCUS_00600 57547 59019 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546372.1 protein_id gnl|my_center|LOCUS_00600 59078 61021 gene locus_tag LOCUS_00610 59078 61021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00610 61875 62039 gene locus_tag LOCUS_00620 61875 62039 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_00620 62236 63291 gene locus_tag LOCUS_00630 62236 63291 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791421.1 protein_id gnl|my_center|LOCUS_00630 63390 65912 gene locus_tag LOCUS_00640 gene secA 63390 65912 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938126.1 protein_id gnl|my_center|LOCUS_00640 65954 67153 gene locus_tag LOCUS_00650 gene argJ 65954 67153 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942692.1 protein_id gnl|my_center|LOCUS_00650 67339 68145 gene locus_tag LOCUS_00660 gene rpsB 67339 68145 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942566.1 protein_id gnl|my_center|LOCUS_00660 68197 68802 gene locus_tag LOCUS_00670 gene tsf 68197 68802 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_00670 68827 69543 gene locus_tag LOCUS_00680 gene pyrH 68827 69543 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904124.1 protein_id gnl|my_center|LOCUS_00680 69548 70105 gene locus_tag LOCUS_00690 gene frr 69548 70105 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_00690 70256 70993 gene locus_tag LOCUS_00700 70256 70993 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_00700 70999 71805 gene locus_tag LOCUS_00710 70999 71805 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_00710 71851 73023 gene locus_tag LOCUS_00720 71851 73023 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942560.1 protein_id gnl|my_center|LOCUS_00720 73020 74087 gene locus_tag LOCUS_00730 gene rseP 73020 74087 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942559.1 protein_id gnl|my_center|LOCUS_00730 74089 74775 gene locus_tag LOCUS_00740 gene tsaB 74089 74775 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966124.1 protein_id gnl|my_center|LOCUS_00740 74884 75108 gene locus_tag LOCUS_00750 74884 75108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 75159 75785 gene locus_tag LOCUS_00760 75159 75785 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531897.1 protein_id gnl|my_center|LOCUS_00760 75782 76600 gene locus_tag LOCUS_00770 gene pssA 75782 76600 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_00770 76696 77715 gene locus_tag LOCUS_00780 76696 77715 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_00780 77717 78265 gene locus_tag LOCUS_00790 gene rsmD 77717 78265 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_00790 78279 78791 gene locus_tag LOCUS_00800 gene coaD 78279 78791 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938824.1 protein_id gnl|my_center|LOCUS_00800 78788 79981 gene locus_tag LOCUS_00810 78788 79981 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941898.1 protein_id gnl|my_center|LOCUS_00810 80163 81254 gene locus_tag LOCUS_00820 gene ispG 80163 81254 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541503.1 protein_id gnl|my_center|LOCUS_00820 81254 82960 gene locus_tag LOCUS_00830 81254 82960 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_00830 82972 85134 gene locus_tag LOCUS_00840 82972 85134 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_00840 85231 85926 gene locus_tag LOCUS_00850 85231 85926 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100934837.1 protein_id gnl|my_center|LOCUS_00850 85973 86665 gene locus_tag LOCUS_00860 gene rph 85973 86665 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942439.1 protein_id gnl|my_center|LOCUS_00860 86662 87255 gene locus_tag LOCUS_00870 86662 87255 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_00870 87279 87355 gene locus_tag LOCUS_t00010 87279 87355 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 87381 87830 gene locus_tag LOCUS_00880 gene dtd 87381 87830 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426448.1 protein_id gnl|my_center|LOCUS_00880 87827 88363 gene locus_tag LOCUS_00890 87827 88363 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440306.1 protein_id gnl|my_center|LOCUS_00890 88357 89817 gene locus_tag LOCUS_00900 gene guaB 88357 89817 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_00900 89969 93427 gene locus_tag LOCUS_00910 gene dnaE 89969 93427 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_00910 93432 94175 gene locus_tag LOCUS_00920 93432 94175 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583102.1 protein_id gnl|my_center|LOCUS_00920 95188 94244 gene locus_tag LOCUS_00930 95188 94244 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940692.1 protein_id gnl|my_center|LOCUS_00930 95674 95246 gene locus_tag LOCUS_00940 95674 95246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 96611 95679 gene locus_tag LOCUS_00950 96611 95679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 97186 96608 gene locus_tag LOCUS_00960 97186 96608 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942383.1 protein_id gnl|my_center|LOCUS_00960 98991 97189 gene locus_tag LOCUS_00970 gene iorA 98991 97189 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942384.1 protein_id gnl|my_center|LOCUS_00970 99745 99065 gene locus_tag LOCUS_00980 99745 99065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 100319 99918 gene locus_tag LOCUS_00990 100319 99918 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811622.1 protein_id gnl|my_center|LOCUS_00990 101526 100300 gene locus_tag LOCUS_01000 101526 100300 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_01000 102332 101523 gene locus_tag LOCUS_01010 102332 101523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 >Feature sequence02 506 1765 gene locus_tag LOCUS_01020 506 1765 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940819.1 protein_id gnl|my_center|LOCUS_01020 1755 2345 gene locus_tag LOCUS_01030 gene thpR 1755 2345 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876222.1 protein_id gnl|my_center|LOCUS_01030 2468 3481 gene locus_tag LOCUS_01040 gene recA 2468 3481 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_01040 3486 3980 gene locus_tag LOCUS_01050 3486 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 3967 6864 gene locus_tag LOCUS_01060 gene alaS 3967 6864 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940824.1 protein_id gnl|my_center|LOCUS_01060 9526 8078 gene locus_tag LOCUS_01070 9526 8078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 11904 10369 gene locus_tag LOCUS_01080 11904 10369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 12575 11901 gene locus_tag LOCUS_01090 gene pth 12575 11901 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257532.1 protein_id gnl|my_center|LOCUS_01090 13266 12616 gene locus_tag LOCUS_01100 13266 12616 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082103.1 protein_id gnl|my_center|LOCUS_01100 14405 13464 gene locus_tag LOCUS_01110 14405 13464 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_01110 14569 14495 gene locus_tag LOCUS_t00020 14569 14495 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 15456 14623 gene locus_tag LOCUS_01120 gene ispE 15456 14623 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941321.1 protein_id gnl|my_center|LOCUS_01120 15890 15453 gene locus_tag LOCUS_01130 15890 15453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 16678 16037 gene locus_tag LOCUS_01140 16678 16037 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_01140 17592 16720 gene locus_tag LOCUS_01150 gene htpX 17592 16720 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942212.1 protein_id gnl|my_center|LOCUS_01150 20294 17694 gene locus_tag LOCUS_01160 gene clpB 20294 17694 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546043.1 protein_id gnl|my_center|LOCUS_01160 20570 21433 gene locus_tag LOCUS_01170 gene rpoH 20570 21433 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941316.1 protein_id gnl|my_center|LOCUS_01170 22788 21430 gene locus_tag LOCUS_01180 gene dnaB 22788 21430 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_01180 23246 22797 gene locus_tag LOCUS_01190 gene rplI 23246 22797 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_01190 24238 23273 gene locus_tag LOCUS_01200 24238 23273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 24542 24270 gene locus_tag LOCUS_01210 gene rpsR 24542 24270 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669347.1 protein_id gnl|my_center|LOCUS_01210 25014 24547 gene locus_tag LOCUS_01220 gene rpsF 25014 24547 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865739.1 protein_id gnl|my_center|LOCUS_01220 26089 25130 gene locus_tag LOCUS_01230 gene fabD 26089 25130 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017020093.1 protein_id gnl|my_center|LOCUS_01230 27791 26097 gene locus_tag LOCUS_01240 gene phaC 27791 26097 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 protein_id gnl|my_center|LOCUS_01240 28077 27775 gene locus_tag LOCUS_01250 28077 27775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 29030 28050 gene locus_tag LOCUS_01260 29030 28050 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940962.1 protein_id gnl|my_center|LOCUS_01260 29420 29345 gene locus_tag LOCUS_t00030 29420 29345 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 30404 29535 gene locus_tag LOCUS_01270 gene metF 30404 29535 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 protein_id gnl|my_center|LOCUS_01270 30576 32405 gene locus_tag LOCUS_01280 30576 32405 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935814.1 protein_id gnl|my_center|LOCUS_01280 34786 32552 gene locus_tag LOCUS_01290 34786 32552 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942973.1 protein_id gnl|my_center|LOCUS_01290 35891 34857 gene locus_tag LOCUS_01300 35891 34857 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942993.1 protein_id gnl|my_center|LOCUS_01300 37154 35916 gene locus_tag LOCUS_01310 37154 35916 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869050.1 protein_id gnl|my_center|LOCUS_01310 37831 37151 gene locus_tag LOCUS_01320 37831 37151 CDS product DUF5752 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869051.1 protein_id gnl|my_center|LOCUS_01320 38612 37818 gene locus_tag LOCUS_01330 38612 37818 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942939.1 protein_id gnl|my_center|LOCUS_01330 39126 38632 gene locus_tag LOCUS_01340 39126 38632 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942998.1 protein_id gnl|my_center|LOCUS_01340 39627 39382 gene locus_tag LOCUS_01350 39627 39382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 39626 39976 gene locus_tag LOCUS_01360 39626 39976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 40036 41814 gene locus_tag LOCUS_01370 40036 41814 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942999.1 protein_id gnl|my_center|LOCUS_01370 42042 43094 gene locus_tag LOCUS_01380 42042 43094 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813006.1 protein_id gnl|my_center|LOCUS_01380 43103 44152 gene locus_tag LOCUS_01390 gene hisC 43103 44152 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943720.1 protein_id gnl|my_center|LOCUS_01390 44233 44559 gene locus_tag LOCUS_01400 44233 44559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 44784 45029 gene locus_tag LOCUS_01410 44784 45029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 45168 46049 gene locus_tag LOCUS_01420 45168 46049 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393681.1 protein_id gnl|my_center|LOCUS_01420 46217 46531 gene locus_tag LOCUS_01430 46217 46531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 46559 46711 gene locus_tag LOCUS_01440 46559 46711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 48248 46866 gene locus_tag LOCUS_01450 48248 46866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 48827 48327 gene locus_tag LOCUS_01460 48827 48327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 50522 48936 gene locus_tag LOCUS_01470 50522 48936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01470 51018 50503 gene locus_tag LOCUS_01480 51018 50503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01480 51032 51137 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 54694 51638 gene locus_tag LOCUS_01490 54694 51638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 55121 54738 gene locus_tag LOCUS_01500 55121 54738 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_01500 55625 55140 gene locus_tag LOCUS_01510 gene nuoE 55625 55140 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_01510 56247 55696 gene locus_tag LOCUS_01520 56247 55696 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583282.1 protein_id gnl|my_center|LOCUS_01520 56922 56251 gene locus_tag LOCUS_01530 56922 56251 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_01530 57467 57132 gene locus_tag LOCUS_01540 57467 57132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 57922 57488 gene locus_tag LOCUS_01550 57922 57488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 58286 57900 gene locus_tag LOCUS_01560 58286 57900 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869442.1 protein_id gnl|my_center|LOCUS_01560 58688 59362 gene locus_tag LOCUS_01570 58688 59362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 59462 61327 gene locus_tag LOCUS_01580 59462 61327 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974357.1 protein_id gnl|my_center|LOCUS_01580 61406 63823 gene locus_tag LOCUS_01590 61406 63823 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272544.1 protein_id gnl|my_center|LOCUS_01590 63844 65028 gene locus_tag LOCUS_01600 63844 65028 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403964.1 protein_id gnl|my_center|LOCUS_01600 65780 65184 gene locus_tag LOCUS_01610 65780 65184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 66294 66133 gene locus_tag LOCUS_01620 66294 66133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 68093 66588 gene locus_tag LOCUS_01630 68093 66588 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879348.1 protein_id gnl|my_center|LOCUS_01630 69978 68431 gene locus_tag LOCUS_01640 69978 68431 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461055.1 protein_id gnl|my_center|LOCUS_01640 70473 74030 gene locus_tag LOCUS_01650 gene smc 70473 74030 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941791.1 protein_id gnl|my_center|LOCUS_01650 74236 75168 gene locus_tag LOCUS_01660 gene ftsY 74236 75168 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_01660 75176 75823 gene locus_tag LOCUS_01670 75176 75823 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_01670 75820 76710 gene locus_tag LOCUS_01680 gene ftcD 75820 76710 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681237.1 protein_id gnl|my_center|LOCUS_01680 76798 76874 gene locus_tag LOCUS_t00040 76798 76874 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 77204 76980 gene locus_tag LOCUS_01690 77204 76980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 77853 77233 gene locus_tag LOCUS_01700 gene lexA 77853 77233 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140711.1 protein_id gnl|my_center|LOCUS_01700 77995 78291 gene locus_tag LOCUS_01710 77995 78291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 81809 78390 gene locus_tag LOCUS_01720 81809 78390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 84959 82374 gene locus_tag LOCUS_01730 84959 82374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 86733 85600 gene locus_tag LOCUS_01740 86733 85600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 86999 88771 gene locus_tag LOCUS_01750 86999 88771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 92665 89972 gene locus_tag LOCUS_01760 92665 89972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 92996 92787 gene locus_tag LOCUS_01770 92996 92787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 >Feature sequence03 78 3 gene locus_tag LOCUS_t00050 78 3 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 162 88 gene locus_tag LOCUS_t00060 162 88 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 828 217 gene locus_tag LOCUS_01780 gene pgsA 828 217 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939132.1 protein_id gnl|my_center|LOCUS_01780 1487 840 gene locus_tag LOCUS_01790 gene fsa 1487 840 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880018.1 protein_id gnl|my_center|LOCUS_01790 1785 1531 gene locus_tag LOCUS_01800 1785 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 2291 1785 gene locus_tag LOCUS_01810 2291 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 3438 2272 gene locus_tag LOCUS_01820 3438 2272 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583442.1 protein_id gnl|my_center|LOCUS_01820 4391 3585 gene locus_tag LOCUS_01830 gene dapB 4391 3585 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_01830 5297 4422 gene locus_tag LOCUS_01840 gene dapA 5297 4422 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_01840 6183 5365 gene locus_tag LOCUS_01850 gene dapF 6183 5365 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_01850 7518 6259 gene locus_tag LOCUS_01860 gene lysA 7518 6259 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940834.1 protein_id gnl|my_center|LOCUS_01860 7995 7531 gene locus_tag LOCUS_01870 7995 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 9391 8000 gene locus_tag LOCUS_01880 gene argH 9391 8000 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546455.1 protein_id gnl|my_center|LOCUS_01880 10662 9457 gene locus_tag LOCUS_01890 10662 9457 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545761.1 protein_id gnl|my_center|LOCUS_01890 11587 10670 gene locus_tag LOCUS_01900 gene argF 11587 10670 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_01900 12792 11584 gene locus_tag LOCUS_01910 12792 11584 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_01910 13699 12809 gene locus_tag LOCUS_01920 gene argB 13699 12809 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938759.1 protein_id gnl|my_center|LOCUS_01920 15189 13807 gene locus_tag LOCUS_01930 gene hslU 15189 13807 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_01930 15803 15198 gene locus_tag LOCUS_01940 gene hslV 15803 15198 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_01940 16726 15800 gene locus_tag LOCUS_01950 gene xerC 16726 15800 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545085.1 protein_id gnl|my_center|LOCUS_01950 17051 16827 gene locus_tag LOCUS_01960 17051 16827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 17565 17065 gene locus_tag LOCUS_01970 17565 17065 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583213.1 protein_id gnl|my_center|LOCUS_01970 18902 17577 gene locus_tag LOCUS_01980 gene miaB 18902 17577 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942838.1 protein_id gnl|my_center|LOCUS_01980 19217 21307 gene locus_tag LOCUS_01990 19217 21307 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_01990 21312 22001 gene locus_tag LOCUS_02000 21312 22001 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_02000 22192 23181 gene locus_tag LOCUS_02010 22192 23181 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544949.1 protein_id gnl|my_center|LOCUS_02010 23680 26070 gene locus_tag LOCUS_02020 23680 26070 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 protein_id gnl|my_center|LOCUS_02020 24146 24222 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26190 26462 gene locus_tag LOCUS_02030 26190 26462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 27309 26518 gene locus_tag LOCUS_02040 27309 26518 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940624.1 protein_id gnl|my_center|LOCUS_02040 28316 27324 gene locus_tag LOCUS_02050 gene moaA 28316 27324 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546124.1 protein_id gnl|my_center|LOCUS_02050 29443 28358 gene locus_tag LOCUS_02060 29443 28358 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006523900.1 protein_id gnl|my_center|LOCUS_02060 29630 30814 gene locus_tag LOCUS_02070 gene gpsA 29630 30814 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230566.1 protein_id gnl|my_center|LOCUS_02070 33705 30823 gene locus_tag LOCUS_02080 33705 30823 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257471.1 protein_id gnl|my_center|LOCUS_02080 33981 35081 gene locus_tag LOCUS_02090 gene rfbB 33981 35081 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097852.1 protein_id gnl|my_center|LOCUS_02090 35180 36283 gene locus_tag LOCUS_02100 35180 36283 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020134.1 protein_id gnl|my_center|LOCUS_02100 36762 37592 gene locus_tag LOCUS_02110 36762 37592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 37711 39012 gene locus_tag LOCUS_02120 37711 39012 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942382.1 protein_id gnl|my_center|LOCUS_02120 39028 39459 gene locus_tag LOCUS_02130 39028 39459 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942381.1 protein_id gnl|my_center|LOCUS_02130 43714 39467 gene locus_tag LOCUS_02140 43714 39467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 44795 43701 gene locus_tag LOCUS_02150 44795 43701 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_02150 46184 44916 gene locus_tag LOCUS_02160 46184 44916 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759975.1 protein_id gnl|my_center|LOCUS_02160 48199 46199 gene locus_tag LOCUS_02170 48199 46199 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022589.1 protein_id gnl|my_center|LOCUS_02170 48390 49073 gene locus_tag LOCUS_02180 gene coaE 48390 49073 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 protein_id gnl|my_center|LOCUS_02180 49099 49716 gene locus_tag LOCUS_02190 49099 49716 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022504.1 protein_id gnl|my_center|LOCUS_02190 50796 50032 gene locus_tag LOCUS_02200 50796 50032 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122067.1 protein_id gnl|my_center|LOCUS_02200 51863 50793 gene locus_tag LOCUS_02210 51863 50793 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615432.1 protein_id gnl|my_center|LOCUS_02210 52534 51860 gene locus_tag LOCUS_02220 52534 51860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 53589 52534 gene locus_tag LOCUS_02230 53589 52534 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 protein_id gnl|my_center|LOCUS_02230 54623 53616 gene locus_tag LOCUS_02240 54623 53616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 57350 56403 gene locus_tag LOCUS_02250 57350 56403 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461747.1 protein_id gnl|my_center|LOCUS_02250 58128 57364 gene locus_tag LOCUS_02260 58128 57364 CDS product electron transfer flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692225.1 protein_id gnl|my_center|LOCUS_02260 59372 58233 gene locus_tag LOCUS_02270 gene acdA 59372 58233 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_02270 59688 59404 gene locus_tag LOCUS_02280 59688 59404 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389919.1 protein_id gnl|my_center|LOCUS_02280 60968 59685 gene locus_tag LOCUS_02290 60968 59685 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278481.1 protein_id gnl|my_center|LOCUS_02290 61528 62337 gene locus_tag LOCUS_02300 61528 62337 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_02300 62355 63356 gene locus_tag LOCUS_02310 62355 63356 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986692.1 protein_id gnl|my_center|LOCUS_02310 63377 64504 gene locus_tag LOCUS_02320 63377 64504 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_02320 64501 64710 gene locus_tag LOCUS_02330 64501 64710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 65918 64638 gene locus_tag LOCUS_02340 65918 64638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 67391 66090 gene locus_tag LOCUS_02350 67391 66090 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877874.1 protein_id gnl|my_center|LOCUS_02350 67959 67528 gene locus_tag LOCUS_02360 67959 67528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 69304 68138 gene locus_tag LOCUS_02370 69304 68138 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545883.1 protein_id gnl|my_center|LOCUS_02370 69474 70772 gene locus_tag LOCUS_02380 69474 70772 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940001.1 protein_id gnl|my_center|LOCUS_02380 70789 71244 gene locus_tag LOCUS_02390 70789 71244 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545228.1 protein_id gnl|my_center|LOCUS_02390 71412 71843 gene locus_tag LOCUS_02400 71412 71843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 72519 71995 gene locus_tag LOCUS_02410 72519 71995 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902512.1 protein_id gnl|my_center|LOCUS_02410 73232 72516 gene locus_tag LOCUS_02420 gene mtnP 73232 72516 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879284.1 protein_id gnl|my_center|LOCUS_02420 73392 73724 gene locus_tag LOCUS_02430 gene trxA 73392 73724 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140882.1 protein_id gnl|my_center|LOCUS_02430 73721 74497 gene locus_tag LOCUS_02440 73721 74497 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792195.1 protein_id gnl|my_center|LOCUS_02440 76081 74501 gene locus_tag LOCUS_02450 76081 74501 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546491.1 protein_id gnl|my_center|LOCUS_02450 77095 76085 gene locus_tag LOCUS_02460 gene rlmN 77095 76085 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_02460 78347 77133 gene locus_tag LOCUS_02470 78347 77133 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_02470 80353 78413 gene locus_tag LOCUS_02480 80353 78413 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_02480 80550 80942 gene locus_tag LOCUS_02490 80550 80942 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_02490 80939 83557 gene locus_tag LOCUS_02500 gene mutS 80939 83557 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_02500 85848 83560 gene locus_tag LOCUS_02510 85848 83560 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943246.1 protein_id gnl|my_center|LOCUS_02510 86141 86593 gene locus_tag LOCUS_02520 86141 86593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 86584 87387 gene locus_tag LOCUS_02530 86584 87387 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_02530 88887 87469 gene locus_tag LOCUS_02540 88887 87469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 >Feature sequence04 67 345 gene locus_tag LOCUS_02550 67 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 1556 699 gene locus_tag LOCUS_02560 1556 699 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045033.1 protein_id gnl|my_center|LOCUS_02560 2022 1711 gene locus_tag LOCUS_02570 2022 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 2861 2019 gene locus_tag LOCUS_02580 2861 2019 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477139.1 protein_id gnl|my_center|LOCUS_02580 4636 3185 gene locus_tag LOCUS_02590 gene abfD 4636 3185 CDS product 4-hydroxybutyryl-CoA dehydratase/vinylacetyl-CoA-Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_02590 5970 4750 gene locus_tag LOCUS_02600 5970 4750 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259419.1 protein_id gnl|my_center|LOCUS_02600 7285 6113 gene locus_tag LOCUS_02610 7285 6113 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545883.1 protein_id gnl|my_center|LOCUS_02610 7538 8461 gene locus_tag LOCUS_02620 gene ptb 7538 8461 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869205.1 protein_id gnl|my_center|LOCUS_02620 8489 8920 gene locus_tag LOCUS_02630 8489 8920 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942381.1 protein_id gnl|my_center|LOCUS_02630 10054 8942 gene locus_tag LOCUS_02640 10054 8942 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155556.1 protein_id gnl|my_center|LOCUS_02640 10307 10086 gene locus_tag LOCUS_02650 10307 10086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 10584 10309 gene locus_tag LOCUS_02660 10584 10309 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681127.1 protein_id gnl|my_center|LOCUS_02660 10913 10701 gene locus_tag LOCUS_02670 10913 10701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 11348 10929 gene locus_tag LOCUS_02680 11348 10929 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945922.1 protein_id gnl|my_center|LOCUS_02680 11772 11431 gene locus_tag LOCUS_02690 gene mazF9 11772 11431 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414166.1 protein_id gnl|my_center|LOCUS_02690 11983 11762 gene locus_tag LOCUS_02700 11983 11762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 12529 13605 gene locus_tag LOCUS_02710 12529 13605 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942127.1 protein_id gnl|my_center|LOCUS_02710 13630 14106 gene locus_tag LOCUS_02720 13630 14106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02720 14033 15055 gene locus_tag LOCUS_02730 14033 15055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02730 15270 15025 gene locus_tag LOCUS_02740 15270 15025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 15714 17282 gene locus_tag LOCUS_02750 15714 17282 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938119.1 protein_id gnl|my_center|LOCUS_02750 17279 18316 gene locus_tag LOCUS_02760 17279 18316 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023369.1 protein_id gnl|my_center|LOCUS_02760 21155 18525 gene locus_tag LOCUS_02770 21155 18525 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545943.1 protein_id gnl|my_center|LOCUS_02770 21773 21174 gene locus_tag LOCUS_02780 21773 21174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 22460 22044 gene locus_tag LOCUS_02790 22460 22044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 23556 22537 gene locus_tag LOCUS_02800 23556 22537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 24846 23740 gene locus_tag LOCUS_02810 24846 23740 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941162.1 protein_id gnl|my_center|LOCUS_02810 25557 25048 gene locus_tag LOCUS_02820 25557 25048 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014810586.1 protein_id gnl|my_center|LOCUS_02820 26491 25685 gene locus_tag LOCUS_02830 26491 25685 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144685205.1 protein_id gnl|my_center|LOCUS_02830 26680 27264 gene locus_tag LOCUS_02840 26680 27264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 28727 27216 gene locus_tag LOCUS_02850 28727 27216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 30262 28814 gene locus_tag LOCUS_02860 gene cdaA 30262 28814 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941532.1 protein_id gnl|my_center|LOCUS_02860 31183 30344 gene locus_tag LOCUS_02870 31183 30344 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_02870 31424 31975 gene locus_tag LOCUS_02880 31424 31975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 32265 32068 gene locus_tag LOCUS_02890 32265 32068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 33065 32466 gene locus_tag LOCUS_02900 33065 32466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 33284 34552 gene locus_tag LOCUS_02910 33284 34552 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944609.1 protein_id gnl|my_center|LOCUS_02910 34672 34691 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38672 34728 gene locus_tag LOCUS_02920 gene hrpA 38672 34728 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420907.1 protein_id gnl|my_center|LOCUS_02920 38962 39444 gene locus_tag LOCUS_02930 gene moaC 38962 39444 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393624.1 protein_id gnl|my_center|LOCUS_02930 39488 40003 gene locus_tag LOCUS_02940 39488 40003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 40032 40343 gene locus_tag LOCUS_02950 40032 40343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 40455 41024 gene locus_tag LOCUS_02960 gene pdxT 40455 41024 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391559.1 protein_id gnl|my_center|LOCUS_02960 41539 41970 gene locus_tag LOCUS_02970 41539 41970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 41974 43737 gene locus_tag LOCUS_02980 41974 43737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 43984 45345 gene locus_tag LOCUS_02990 43984 45345 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_02990 46081 45593 gene locus_tag LOCUS_03000 46081 45593 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081893.1 protein_id gnl|my_center|LOCUS_03000 46778 46410 gene locus_tag LOCUS_03010 46778 46410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 46948 47733 gene locus_tag LOCUS_03020 46948 47733 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967135.1 protein_id gnl|my_center|LOCUS_03020 47746 48249 gene locus_tag LOCUS_03030 47746 48249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 48274 49086 gene locus_tag LOCUS_03040 48274 49086 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_03040 49067 49495 gene locus_tag LOCUS_03050 49067 49495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 49914 49492 gene locus_tag LOCUS_03060 gene paaI 49914 49492 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391943.1 protein_id gnl|my_center|LOCUS_03060 50084 50713 gene locus_tag LOCUS_03070 50084 50713 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943370.1 protein_id gnl|my_center|LOCUS_03070 50710 51723 gene locus_tag LOCUS_03080 50710 51723 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_03080 51748 52512 gene locus_tag LOCUS_03090 51748 52512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 52493 53248 gene locus_tag LOCUS_03100 52493 53248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 53245 54378 gene locus_tag LOCUS_03110 53245 54378 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_03110 54375 55502 gene locus_tag LOCUS_03120 54375 55502 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_03120 56670 56773 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 57279 58223 gene locus_tag LOCUS_03130 gene fabD 57279 58223 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869845.1 protein_id gnl|my_center|LOCUS_03130 58286 59485 gene locus_tag LOCUS_03140 58286 59485 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480016.1 protein_id gnl|my_center|LOCUS_03140 59487 60479 gene locus_tag LOCUS_03150 59487 60479 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772652.1 protein_id gnl|my_center|LOCUS_03150 60476 61096 gene locus_tag LOCUS_03160 gene fabA 60476 61096 CDS product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770369.1 protein_id gnl|my_center|LOCUS_03160 61141 61635 gene locus_tag LOCUS_03170 61141 61635 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770367.1 protein_id gnl|my_center|LOCUS_03170 61949 63232 gene locus_tag LOCUS_03180 61949 63232 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770365.1 protein_id gnl|my_center|LOCUS_03180 63345 63593 gene locus_tag LOCUS_03190 63345 63593 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770362.1 protein_id gnl|my_center|LOCUS_03190 63601 64425 gene locus_tag LOCUS_03200 63601 64425 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770694.1 protein_id gnl|my_center|LOCUS_03200 64325 64966 gene locus_tag LOCUS_03210 64325 64966 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770360.1 protein_id gnl|my_center|LOCUS_03210 65998 65132 gene locus_tag LOCUS_03220 65998 65132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 67894 66167 gene locus_tag LOCUS_03230 67894 66167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 68940 68164 gene locus_tag LOCUS_03240 68940 68164 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_03240 69811 68933 gene locus_tag LOCUS_03250 69811 68933 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435660.1 protein_id gnl|my_center|LOCUS_03250 70786 70250 gene locus_tag LOCUS_03260 70786 70250 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024220.1 protein_id gnl|my_center|LOCUS_03260 71792 70809 gene locus_tag LOCUS_03270 71792 70809 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_03270 71999 72038 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 72109 72240 gene locus_tag LOCUS_03280 72109 72240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 72921 72310 gene locus_tag LOCUS_03290 gene wrbA 72921 72310 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941470.1 protein_id gnl|my_center|LOCUS_03290 73124 74833 gene locus_tag LOCUS_03300 73124 74833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 75155 76270 gene locus_tag LOCUS_03310 75155 76270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 76298 78835 gene locus_tag LOCUS_03320 76298 78835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 78920 79273 gene locus_tag LOCUS_03330 78920 79273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 79289 80200 gene locus_tag LOCUS_03340 79289 80200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 82253 80256 gene locus_tag LOCUS_03350 82253 80256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 83477 82347 gene locus_tag LOCUS_03360 83477 82347 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552205.1 protein_id gnl|my_center|LOCUS_03360 84025 83486 gene locus_tag LOCUS_03370 84025 83486 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_03370 84479 84096 gene locus_tag LOCUS_03380 84479 84096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 84945 84604 gene locus_tag LOCUS_03390 84945 84604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 85830 85015 gene locus_tag LOCUS_03400 85830 85015 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089047.1 protein_id gnl|my_center|LOCUS_03400 86678 85986 gene locus_tag LOCUS_03410 gene rpiA 86678 85986 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259045.1 protein_id gnl|my_center|LOCUS_03410 88420 86732 gene locus_tag LOCUS_03420 88420 86732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 >Feature sequence05 126 488 gene locus_tag LOCUS_03430 126 488 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123903.1 protein_id gnl|my_center|LOCUS_03430 548 1837 gene locus_tag LOCUS_03440 548 1837 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878693.1 protein_id gnl|my_center|LOCUS_03440 1977 2834 gene locus_tag LOCUS_03450 1977 2834 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816050.1 protein_id gnl|my_center|LOCUS_03450 2858 3640 gene locus_tag LOCUS_03460 2858 3640 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048188.1 protein_id gnl|my_center|LOCUS_03460 3923 5071 gene locus_tag LOCUS_03470 gene acdA 3923 5071 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_03470 5279 6487 gene locus_tag LOCUS_03480 5279 6487 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880318.1 protein_id gnl|my_center|LOCUS_03480 6866 6576 gene locus_tag LOCUS_03490 6866 6576 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216166.1 protein_id gnl|my_center|LOCUS_03490 6907 6981 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7543 7079 gene locus_tag LOCUS_03500 7543 7079 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069385.1 protein_id gnl|my_center|LOCUS_03500 7962 7723 gene locus_tag LOCUS_03510 7962 7723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 9099 8317 gene locus_tag LOCUS_03520 9099 8317 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460483.1 protein_id gnl|my_center|LOCUS_03520 10976 9282 gene locus_tag LOCUS_03530 10976 9282 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228698.1 protein_id gnl|my_center|LOCUS_03530 13537 11459 gene locus_tag LOCUS_03540 13537 11459 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459849.1 protein_id gnl|my_center|LOCUS_03540 14913 13930 gene locus_tag LOCUS_03550 14913 13930 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816053.1 protein_id gnl|my_center|LOCUS_03550 15709 14939 gene locus_tag LOCUS_03560 15709 14939 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_03560 17894 15924 gene locus_tag LOCUS_03570 gene acs 17894 15924 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546141.1 protein_id gnl|my_center|LOCUS_03570 19010 20374 gene locus_tag LOCUS_03580 19010 20374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 20780 20983 gene locus_tag LOCUS_03590 20780 20983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 21549 21124 gene locus_tag LOCUS_03600 21549 21124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 21511 22824 gene locus_tag LOCUS_03610 21511 22824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 23079 23831 gene locus_tag LOCUS_03620 23079 23831 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_03620 23821 25659 gene locus_tag LOCUS_03630 23821 25659 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_03630 26462 25671 gene locus_tag LOCUS_03640 26462 25671 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_03640 26940 26701 gene locus_tag LOCUS_03650 26940 26701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 26827 28683 gene locus_tag LOCUS_03660 26827 28683 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_03660 29295 29876 gene locus_tag LOCUS_03670 29295 29876 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868483.1 protein_id gnl|my_center|LOCUS_03670 30049 30342 gene locus_tag LOCUS_03680 30049 30342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 30335 31543 gene locus_tag LOCUS_03690 30335 31543 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250930.1 protein_id gnl|my_center|LOCUS_03690 31548 32447 gene locus_tag LOCUS_03700 31548 32447 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846976.1 protein_id gnl|my_center|LOCUS_03700 33862 32540 gene locus_tag LOCUS_03710 33862 32540 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_03710 34008 34745 gene locus_tag LOCUS_03720 34008 34745 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944071.1 protein_id gnl|my_center|LOCUS_03720 34768 35424 gene locus_tag LOCUS_03730 gene rpe 34768 35424 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_03730 36855 35821 gene locus_tag LOCUS_03740 36855 35821 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942440.1 protein_id gnl|my_center|LOCUS_03740 37946 37116 gene locus_tag LOCUS_03750 37946 37116 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869030.1 protein_id gnl|my_center|LOCUS_03750 39153 38134 gene locus_tag LOCUS_03760 39153 38134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03760 40070 39150 gene locus_tag LOCUS_03770 40070 39150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03770 41071 40067 gene locus_tag LOCUS_03780 gene arnC 41071 40067 CDS product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816394.1 protein_id gnl|my_center|LOCUS_03780 42215 41064 gene locus_tag LOCUS_03790 gene arnB 42215 41064 CDS product UDP-4-amino-4-deoxy-L-arabinose aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807509.1 protein_id gnl|my_center|LOCUS_03790 44167 42467 gene locus_tag LOCUS_03800 44167 42467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 44322 44849 gene locus_tag LOCUS_03810 44322 44849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 44966 46666 gene locus_tag LOCUS_03820 44966 46666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 48117 46756 gene locus_tag LOCUS_03830 48117 46756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 48799 48146 gene locus_tag LOCUS_03840 48799 48146 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938821.1 protein_id gnl|my_center|LOCUS_03840 49080 48889 gene locus_tag LOCUS_03850 49080 48889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 50149 49316 gene locus_tag LOCUS_03860 50149 49316 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393437.1 protein_id gnl|my_center|LOCUS_03860 50554 50156 gene locus_tag LOCUS_03870 gene gcvH 50554 50156 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461730.1 protein_id gnl|my_center|LOCUS_03870 51653 50652 gene locus_tag LOCUS_03880 51653 50652 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942664.1 protein_id gnl|my_center|LOCUS_03880 52434 51730 gene locus_tag LOCUS_03890 52434 51730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 52702 53058 gene locus_tag LOCUS_03900 gene queF 52702 53058 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546535.1 protein_id gnl|my_center|LOCUS_03900 54387 53098 gene locus_tag LOCUS_03910 54387 53098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 54725 54384 gene locus_tag LOCUS_03920 54725 54384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 55536 54850 gene locus_tag LOCUS_03930 55536 54850 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942673.1 protein_id gnl|my_center|LOCUS_03930 56085 55540 gene locus_tag LOCUS_03940 56085 55540 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545919.1 protein_id gnl|my_center|LOCUS_03940 57161 56082 gene locus_tag LOCUS_03950 gene pilM 57161 56082 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_03950 57505 57239 gene locus_tag LOCUS_03960 57505 57239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 58812 57628 gene locus_tag LOCUS_03970 58812 57628 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583100.1 protein_id gnl|my_center|LOCUS_03970 59410 58904 gene locus_tag LOCUS_03980 gene dut 59410 58904 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942240.1 protein_id gnl|my_center|LOCUS_03980 60669 59407 gene locus_tag LOCUS_03990 60669 59407 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942239.1 protein_id gnl|my_center|LOCUS_03990 62767 60638 gene locus_tag LOCUS_04000 gene pnp 62767 60638 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_04000 63116 62850 gene locus_tag LOCUS_04010 gene rpsO 63116 62850 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_04010 64080 63154 gene locus_tag LOCUS_04020 gene truB 64080 63154 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986789.1 protein_id gnl|my_center|LOCUS_04020 65032 64085 gene locus_tag LOCUS_04030 65032 64085 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_04030 65390 65025 gene locus_tag LOCUS_04040 65390 65025 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942234.1 protein_id gnl|my_center|LOCUS_04040 65718 65368 gene locus_tag LOCUS_04050 65718 65368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 68364 65827 gene locus_tag LOCUS_04060 gene infB 68364 65827 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942233.1 protein_id gnl|my_center|LOCUS_04060 69625 68399 gene locus_tag LOCUS_04070 gene nusA 69625 68399 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942231.1 protein_id gnl|my_center|LOCUS_04070 70194 69715 gene locus_tag LOCUS_04080 gene rimP 70194 69715 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460396.1 protein_id gnl|my_center|LOCUS_04080 71764 70466 gene locus_tag LOCUS_04090 gene hisD 71764 70466 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943721.1 protein_id gnl|my_center|LOCUS_04090 73045 71795 gene locus_tag LOCUS_04100 gene murA 73045 71795 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_04100 73924 73046 gene locus_tag LOCUS_04110 gene prmC 73924 73046 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122233.1 protein_id gnl|my_center|LOCUS_04110 75060 73990 gene locus_tag LOCUS_04120 gene prfA 75060 73990 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943725.1 protein_id gnl|my_center|LOCUS_04120 75511 75290 gene locus_tag LOCUS_04130 gene rpmE 75511 75290 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_04130 76894 75647 gene locus_tag LOCUS_04140 gene rho 76894 75647 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_04140 77966 77166 gene locus_tag LOCUS_04150 gene pgeF 77966 77166 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940760.1 protein_id gnl|my_center|LOCUS_04150 78917 77994 gene locus_tag LOCUS_04160 78917 77994 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_04160 80419 79013 gene locus_tag LOCUS_04170 gene selA 80419 79013 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943980.1 protein_id gnl|my_center|LOCUS_04170 81692 80445 gene locus_tag LOCUS_04180 81692 80445 CDS product coproporphyrinogen III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074137.1 protein_id gnl|my_center|LOCUS_04180 81822 82388 gene locus_tag LOCUS_04190 gene def 81822 82388 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946799.1 protein_id gnl|my_center|LOCUS_04190 82904 82668 gene locus_tag LOCUS_04200 82904 82668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 >Feature sequence06 737 946 gene locus_tag LOCUS_04210 737 946 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065065.1 protein_id gnl|my_center|LOCUS_04210 1264 2136 gene locus_tag LOCUS_04220 1264 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 2284 2871 gene locus_tag LOCUS_04230 2284 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04230 2802 5318 gene locus_tag LOCUS_04240 gene fdnG 2802 5318 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021760008.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04240 2877 2921 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5330 6136 gene locus_tag LOCUS_04250 gene fdxH 5330 6136 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693893.1 protein_id gnl|my_center|LOCUS_04250 6138 6806 gene locus_tag LOCUS_04260 6138 6806 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880649.1 protein_id gnl|my_center|LOCUS_04260 6995 7795 gene locus_tag LOCUS_04270 gene modA 6995 7795 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918217.1 protein_id gnl|my_center|LOCUS_04270 7795 8445 gene locus_tag LOCUS_04280 gene modB 7795 8445 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879995.1 protein_id gnl|my_center|LOCUS_04280 8450 9163 gene locus_tag LOCUS_04290 8450 9163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 9178 9753 gene locus_tag LOCUS_04300 9178 9753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 10594 9827 gene locus_tag LOCUS_04310 gene larB 10594 9827 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_04310 11403 10591 gene locus_tag LOCUS_04320 gene larE 11403 10591 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357133.1 protein_id gnl|my_center|LOCUS_04320 12599 11403 gene locus_tag LOCUS_04330 gene larC 12599 11403 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947957.1 protein_id gnl|my_center|LOCUS_04330 12759 13175 gene locus_tag LOCUS_04340 gene nikR 12759 13175 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932159.1 protein_id gnl|my_center|LOCUS_04340 13230 13925 gene locus_tag LOCUS_04350 13230 13925 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530095.1 protein_id gnl|my_center|LOCUS_04350 13975 14265 gene locus_tag LOCUS_04360 13975 14265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 14267 15046 gene locus_tag LOCUS_04370 gene cbiQ 14267 15046 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975656.1 protein_id gnl|my_center|LOCUS_04370 15039 15758 gene locus_tag LOCUS_04380 15039 15758 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140293.1 protein_id gnl|my_center|LOCUS_04380 15787 16593 gene locus_tag LOCUS_04390 15787 16593 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926867.1 protein_id gnl|my_center|LOCUS_04390 17208 16606 gene locus_tag LOCUS_04400 17208 16606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 17896 17324 gene locus_tag LOCUS_04410 17896 17324 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940335.1 protein_id gnl|my_center|LOCUS_04410 19814 17919 gene locus_tag LOCUS_04420 gene aor 19814 17919 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868080.1 protein_id gnl|my_center|LOCUS_04420 21011 19830 gene locus_tag LOCUS_04430 21011 19830 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207481.1 protein_id gnl|my_center|LOCUS_04430 21515 21042 gene locus_tag LOCUS_04440 21515 21042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 21838 22605 gene locus_tag LOCUS_04450 21838 22605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 22602 23102 gene locus_tag LOCUS_04460 gene mobB 22602 23102 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393319.1 protein_id gnl|my_center|LOCUS_04460 23105 23836 gene locus_tag LOCUS_04470 23105 23836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 23931 24899 gene locus_tag LOCUS_04480 gene trxB 23931 24899 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_04480 25133 25324 gene locus_tag LOCUS_04490 25133 25324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 25335 26204 gene locus_tag LOCUS_04500 gene lgt 25335 26204 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932768.1 protein_id gnl|my_center|LOCUS_04500 26246 26764 gene locus_tag LOCUS_04510 26246 26764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 26789 27451 gene locus_tag LOCUS_04520 26789 27451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 27461 28156 gene locus_tag LOCUS_04530 27461 28156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 28336 28668 gene locus_tag LOCUS_04540 gene cutA 28336 28668 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545706.1 protein_id gnl|my_center|LOCUS_04540 28689 29948 gene locus_tag LOCUS_04550 28689 29948 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224618.1 protein_id gnl|my_center|LOCUS_04550 29938 30525 gene locus_tag LOCUS_04560 29938 30525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 30522 32096 gene locus_tag LOCUS_04570 30522 32096 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942447.1 protein_id gnl|my_center|LOCUS_04570 32587 33417 gene locus_tag LOCUS_04580 32587 33417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811766.1 protein_id gnl|my_center|LOCUS_04580 34584 33610 gene locus_tag LOCUS_04590 34584 33610 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_04590 34767 35174 gene locus_tag LOCUS_04600 34767 35174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 36718 35387 gene locus_tag LOCUS_04610 gene rimO 36718 35387 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_04610 39313 37001 gene locus_tag LOCUS_04620 39313 37001 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943733.1 protein_id gnl|my_center|LOCUS_04620 40025 39306 gene locus_tag LOCUS_04630 40025 39306 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_04630 40209 40622 gene locus_tag LOCUS_04640 40209 40622 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_04640 40830 40639 gene locus_tag LOCUS_04650 40830 40639 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943808.1 protein_id gnl|my_center|LOCUS_04650 40972 40841 gene locus_tag LOCUS_04660 40972 40841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 41940 41050 gene locus_tag LOCUS_04670 41940 41050 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812890.1 protein_id gnl|my_center|LOCUS_04670 42114 42941 gene locus_tag LOCUS_04680 42114 42941 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_04680 43279 44649 gene locus_tag LOCUS_04690 gene ablA 43279 44649 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_04690 44646 45662 gene locus_tag LOCUS_04700 44646 45662 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838603.1 protein_id gnl|my_center|LOCUS_04700 45659 46636 gene locus_tag LOCUS_04710 45659 46636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 46640 47185 gene locus_tag LOCUS_04720 46640 47185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 47482 48843 gene locus_tag LOCUS_04730 47482 48843 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931886.1 protein_id gnl|my_center|LOCUS_04730 49043 50437 gene locus_tag LOCUS_04740 49043 50437 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_04740 50557 51318 gene locus_tag LOCUS_04750 gene elyC 50557 51318 CDS product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457224.1 protein_id gnl|my_center|LOCUS_04750 51513 52727 gene locus_tag LOCUS_04760 51513 52727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 52731 56555 gene locus_tag LOCUS_04770 52731 56555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 56559 58097 gene locus_tag LOCUS_04780 gene guaA 56559 58097 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_04780 58117 59727 gene locus_tag LOCUS_04790 58117 59727 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942540.1 protein_id gnl|my_center|LOCUS_04790 59803 60129 gene locus_tag LOCUS_04800 59803 60129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 60966 60139 gene locus_tag LOCUS_04810 60966 60139 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942280.1 protein_id gnl|my_center|LOCUS_04810 64384 61403 gene locus_tag LOCUS_04820 64384 61403 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942279.1 protein_id gnl|my_center|LOCUS_04820 65753 64392 gene locus_tag LOCUS_04830 gene atoC 65753 64392 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125298.1 protein_id gnl|my_center|LOCUS_04830 67729 66218 gene locus_tag LOCUS_04840 67729 66218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 69269 67890 gene locus_tag LOCUS_04850 gene mnmE 69269 67890 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944074.1 protein_id gnl|my_center|LOCUS_04850 70033 69290 gene locus_tag LOCUS_04860 70033 69290 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387430.1 protein_id gnl|my_center|LOCUS_04860 71661 70051 gene locus_tag LOCUS_04870 gene yidC 71661 70051 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_04870 72336 71899 gene locus_tag LOCUS_04880 72336 71899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 72643 73161 gene locus_tag LOCUS_04890 72643 73161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 73783 73139 gene locus_tag LOCUS_04900 73783 73139 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878079.1 protein_id gnl|my_center|LOCUS_04900 74304 73834 gene locus_tag LOCUS_04910 74304 73834 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457113.1 protein_id gnl|my_center|LOCUS_04910 75137 74391 gene locus_tag LOCUS_04920 75137 74391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 75895 75152 gene locus_tag LOCUS_04930 gene kdsB 75895 75152 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_04930 76328 75909 gene locus_tag LOCUS_04940 76328 75909 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681217.1 protein_id gnl|my_center|LOCUS_04940 76524 76315 gene locus_tag LOCUS_04950 76524 76315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 77125 76697 gene locus_tag LOCUS_04960 77125 76697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04960 77159 77208 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 77651 77376 gene locus_tag LOCUS_04970 77651 77376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04970 >Feature sequence07 1950 664 gene locus_tag LOCUS_04980 gene tyrS 1950 664 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963956.1 protein_id gnl|my_center|LOCUS_04980 2777 1992 gene locus_tag LOCUS_04990 2777 1992 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_04990 4500 2944 gene locus_tag LOCUS_05000 gene rny 4500 2944 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_05000 5127 4849 gene locus_tag LOCUS_05010 5127 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 5420 5133 gene locus_tag LOCUS_05020 5420 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 6510 5500 gene locus_tag LOCUS_05030 gene dusB 6510 5500 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941670.1 protein_id gnl|my_center|LOCUS_05030 6731 7141 gene locus_tag LOCUS_05040 6731 7141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 7189 8601 gene locus_tag LOCUS_05050 gene glmM 7189 8601 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_05050 8621 9250 gene locus_tag LOCUS_05060 8621 9250 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546220.1 protein_id gnl|my_center|LOCUS_05060 10037 9267 gene locus_tag LOCUS_05070 10037 9267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 11807 10524 gene locus_tag LOCUS_05080 11807 10524 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_05080 13072 11804 gene locus_tag LOCUS_05090 13072 11804 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_05090 13360 14685 gene locus_tag LOCUS_05100 gene purD 13360 14685 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947400.1 protein_id gnl|my_center|LOCUS_05100 14758 16326 gene locus_tag LOCUS_05110 gene purH 14758 16326 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_05110 16542 17051 gene locus_tag LOCUS_05120 gene purE 16542 17051 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704271.1 protein_id gnl|my_center|LOCUS_05120 17039 17707 gene locus_tag LOCUS_05130 17039 17707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 18647 17649 gene locus_tag LOCUS_05140 18647 17649 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792329.1 protein_id gnl|my_center|LOCUS_05140 19514 18702 gene locus_tag LOCUS_05150 19514 18702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 20058 19534 gene locus_tag LOCUS_05160 gene hpt 20058 19534 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416006.1 protein_id gnl|my_center|LOCUS_05160 21074 20250 gene locus_tag LOCUS_05170 21074 20250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 21235 21711 gene locus_tag LOCUS_05180 21235 21711 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_05180 22506 21730 gene locus_tag LOCUS_05190 22506 21730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 22755 23384 gene locus_tag LOCUS_05200 22755 23384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 23596 23450 gene locus_tag LOCUS_05210 23596 23450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 23602 23696 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23700 24287 gene locus_tag LOCUS_05220 23700 24287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 24259 24492 gene locus_tag LOCUS_05230 24259 24492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 24558 24950 gene locus_tag LOCUS_05240 24558 24950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 25252 24965 gene locus_tag LOCUS_05250 25252 24965 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942007.1 protein_id gnl|my_center|LOCUS_05250 25437 25249 gene locus_tag LOCUS_05260 25437 25249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 28403 25542 gene locus_tag LOCUS_05270 28403 25542 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963680.1 protein_id gnl|my_center|LOCUS_05270 28604 28470 gene locus_tag LOCUS_05280 28604 28470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 28844 28656 gene locus_tag LOCUS_05290 28844 28656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 28761 29696 gene locus_tag LOCUS_05300 gene mdh 28761 29696 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020863.1 protein_id gnl|my_center|LOCUS_05300 29686 32178 gene locus_tag LOCUS_05310 29686 32178 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_05310 32243 33769 gene locus_tag LOCUS_05320 gene rng 32243 33769 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_05320 33840 34151 gene locus_tag LOCUS_05330 gene rplU 33840 34151 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_05330 34164 34418 gene locus_tag LOCUS_05340 gene rpmA 34164 34418 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940618.1 protein_id gnl|my_center|LOCUS_05340 34699 34911 gene locus_tag LOCUS_05350 34699 34911 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082372.1 protein_id gnl|my_center|LOCUS_05350 35223 36428 gene locus_tag LOCUS_05360 35223 36428 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582561.1 protein_id gnl|my_center|LOCUS_05360 36681 37967 gene locus_tag LOCUS_05370 36681 37967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 38043 40184 gene locus_tag LOCUS_05380 38043 40184 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_05380 40371 41498 gene locus_tag LOCUS_05390 40371 41498 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024104.1 protein_id gnl|my_center|LOCUS_05390 41495 43444 gene locus_tag LOCUS_05400 gene iorA 41495 43444 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250594.1 protein_id gnl|my_center|LOCUS_05400 43446 44102 gene locus_tag LOCUS_05410 43446 44102 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868412.1 protein_id gnl|my_center|LOCUS_05410 44086 44466 gene locus_tag LOCUS_05420 gene queD 44086 44466 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942365.1 protein_id gnl|my_center|LOCUS_05420 44467 45114 gene locus_tag LOCUS_05430 gene queE 44467 45114 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120697.1 protein_id gnl|my_center|LOCUS_05430 45126 45815 gene locus_tag LOCUS_05440 gene queC 45126 45815 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_05440 45894 46865 gene locus_tag LOCUS_05450 45894 46865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 47963 46944 gene locus_tag LOCUS_05460 47963 46944 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680714.1 protein_id gnl|my_center|LOCUS_05460 48164 48691 gene locus_tag LOCUS_05470 48164 48691 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037416754.1 protein_id gnl|my_center|LOCUS_05470 48732 49523 gene locus_tag LOCUS_05480 gene lsrF 48732 49523 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219792.1 protein_id gnl|my_center|LOCUS_05480 49524 50579 gene locus_tag LOCUS_05490 49524 50579 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545362.1 protein_id gnl|my_center|LOCUS_05490 50721 51725 gene locus_tag LOCUS_05500 gene obgE 50721 51725 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943831.1 protein_id gnl|my_center|LOCUS_05500 51743 52885 gene locus_tag LOCUS_05510 gene proB 51743 52885 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_05510 53470 52889 gene locus_tag LOCUS_05520 53470 52889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 54143 53490 gene locus_tag LOCUS_05530 54143 53490 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932773.1 protein_id gnl|my_center|LOCUS_05530 56011 54140 gene locus_tag LOCUS_05540 gene uvrC 56011 54140 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943890.1 protein_id gnl|my_center|LOCUS_05540 58321 56321 gene locus_tag LOCUS_05550 gene uvrB 58321 56321 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_05550 58486 59304 gene locus_tag LOCUS_05560 58486 59304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 59301 61169 gene locus_tag LOCUS_05570 59301 61169 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943958.1 protein_id gnl|my_center|LOCUS_05570 61504 62340 gene locus_tag LOCUS_05580 gene fdhE 61504 62340 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880651.1 protein_id gnl|my_center|LOCUS_05580 62607 63263 gene locus_tag LOCUS_05590 62607 63263 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256674.1 protein_id gnl|my_center|LOCUS_05590 65713 63404 gene locus_tag LOCUS_05600 65713 63404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 66215 65775 gene locus_tag LOCUS_05610 66215 65775 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394735.1 protein_id gnl|my_center|LOCUS_05610 66411 66487 gene locus_tag LOCUS_t00070 66411 66487 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 67794 66589 gene locus_tag LOCUS_05620 67794 66589 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_05620 68522 67845 gene locus_tag LOCUS_05630 gene rlmB 68522 67845 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357423.1 protein_id gnl|my_center|LOCUS_05630 69448 68699 gene locus_tag LOCUS_05640 gene pyrF 69448 68699 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942107.1 protein_id gnl|my_center|LOCUS_05640 69710 69441 gene locus_tag LOCUS_05650 69710 69441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 70354 69743 gene locus_tag LOCUS_05660 gene gmk 70354 69743 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942878.1 protein_id gnl|my_center|LOCUS_05660 71372 70488 gene locus_tag LOCUS_05670 71372 70488 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_05670 71823 71599 gene locus_tag LOCUS_05680 71823 71599 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_05680 72535 71942 gene locus_tag LOCUS_05690 72535 71942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 74292 72559 gene locus_tag LOCUS_05700 gene ispH 74292 72559 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011417689.1 protein_id gnl|my_center|LOCUS_05700 75255 74509 gene locus_tag LOCUS_05710 75255 74509 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_05710 <75978 75263 gene locus_tag LOCUS_05720 <75978 75263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941346.1:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence08 603 2246 gene locus_tag LOCUS_05730 603 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 3274 2258 gene locus_tag LOCUS_05740 gene gap 3274 2258 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937869.1 protein_id gnl|my_center|LOCUS_05740 3852 3289 gene locus_tag LOCUS_05750 3852 3289 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937870.1 protein_id gnl|my_center|LOCUS_05750 4686 3880 gene locus_tag LOCUS_05760 4686 3880 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_05760 5297 4812 gene locus_tag LOCUS_05770 gene ybaK 5297 4812 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943709.1 protein_id gnl|my_center|LOCUS_05770 6386 5466 gene locus_tag LOCUS_05780 6386 5466 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941035.1 protein_id gnl|my_center|LOCUS_05780 6624 8525 gene locus_tag LOCUS_05790 gene mnmG 6624 8525 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_05790 8900 11026 gene locus_tag LOCUS_05800 8900 11026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 11023 13320 gene locus_tag LOCUS_05810 11023 13320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 13988 13296 gene locus_tag LOCUS_05820 13988 13296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 14305 15087 gene locus_tag LOCUS_05830 14305 15087 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545754.1 protein_id gnl|my_center|LOCUS_05830 15094 15774 gene locus_tag LOCUS_05840 15094 15774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 15782 16654 gene locus_tag LOCUS_05850 15782 16654 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930730.1 protein_id gnl|my_center|LOCUS_05850 16666 17604 gene locus_tag LOCUS_05860 16666 17604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 17967 18794 gene locus_tag LOCUS_05870 17967 18794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 20355 18784 gene locus_tag LOCUS_05880 20355 18784 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943319.1 protein_id gnl|my_center|LOCUS_05880 21265 20363 gene locus_tag LOCUS_05890 21265 20363 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943320.1 protein_id gnl|my_center|LOCUS_05890 22064 21408 gene locus_tag LOCUS_05900 22064 21408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 22629 22375 gene locus_tag LOCUS_05910 22629 22375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 24444 22861 gene locus_tag LOCUS_05920 24444 22861 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546113.1 protein_id gnl|my_center|LOCUS_05920 25941 24493 gene locus_tag LOCUS_05930 25941 24493 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545017.1 protein_id gnl|my_center|LOCUS_05930 26174 26824 gene locus_tag LOCUS_05940 26174 26824 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931872.1 protein_id gnl|my_center|LOCUS_05940 26857 28239 gene locus_tag LOCUS_05950 26857 28239 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924851.1 protein_id gnl|my_center|LOCUS_05950 28552 28343 gene locus_tag LOCUS_05960 28552 28343 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065065.1 protein_id gnl|my_center|LOCUS_05960 30219 28654 gene locus_tag LOCUS_05970 30219 28654 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_05970 31407 30295 gene locus_tag LOCUS_05980 31407 30295 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391617.1 protein_id gnl|my_center|LOCUS_05980 32102 31404 gene locus_tag LOCUS_05990 32102 31404 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391616.1 protein_id gnl|my_center|LOCUS_05990 32987 32115 gene locus_tag LOCUS_06000 32987 32115 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391615.1 protein_id gnl|my_center|LOCUS_06000 33917 33057 gene locus_tag LOCUS_06010 33917 33057 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545230.1 protein_id gnl|my_center|LOCUS_06010 34883 33966 gene locus_tag LOCUS_06020 34883 33966 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791454.1 protein_id gnl|my_center|LOCUS_06020 36410 35040 gene locus_tag LOCUS_06030 36410 35040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 36890 39592 gene locus_tag LOCUS_06040 36890 39592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 40382 39585 gene locus_tag LOCUS_06050 40382 39585 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897311.1 protein_id gnl|my_center|LOCUS_06050 40551 41159 gene locus_tag LOCUS_06060 40551 41159 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 protein_id gnl|my_center|LOCUS_06060 41752 41309 gene locus_tag LOCUS_06070 41752 41309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 43496 41817 gene locus_tag LOCUS_06080 43496 41817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 45064 43790 gene locus_tag LOCUS_06090 45064 43790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 46393 45083 gene locus_tag LOCUS_06100 46393 45083 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114807.1 protein_id gnl|my_center|LOCUS_06100 47545 46778 gene locus_tag LOCUS_06110 47545 46778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 48538 47756 gene locus_tag LOCUS_06120 48538 47756 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174479.1 protein_id gnl|my_center|LOCUS_06120 48905 50143 gene locus_tag LOCUS_06130 48905 50143 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403144.1 protein_id gnl|my_center|LOCUS_06130 51771 50311 gene locus_tag LOCUS_06140 51771 50311 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401293.1 protein_id gnl|my_center|LOCUS_06140 51973 52173 gene locus_tag LOCUS_06150 51973 52173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 52170 52736 gene locus_tag LOCUS_06160 52170 52736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 52700 52870 gene locus_tag LOCUS_06170 52700 52870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 52894 53418 gene locus_tag LOCUS_06180 52894 53418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 53497 55314 gene locus_tag LOCUS_06190 53497 55314 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943122.1 protein_id gnl|my_center|LOCUS_06190 55516 56835 gene locus_tag LOCUS_06200 55516 56835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 56839 57531 gene locus_tag LOCUS_06210 56839 57531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 57560 58399 gene locus_tag LOCUS_06220 57560 58399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 59216 58434 gene locus_tag LOCUS_06230 gene surE 59216 58434 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404579.1 protein_id gnl|my_center|LOCUS_06230 61245 59326 gene locus_tag LOCUS_06240 gene dnaK 61245 59326 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_06240 61875 61267 gene locus_tag LOCUS_06250 61875 61267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 62562 61969 gene locus_tag LOCUS_06260 62562 61969 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546496.1 protein_id gnl|my_center|LOCUS_06260 64764 62749 gene locus_tag LOCUS_06270 gene nrdD 64764 62749 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869385.1 protein_id gnl|my_center|LOCUS_06270 65019 65783 gene locus_tag LOCUS_06280 gene hisF 65019 65783 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964259.1 protein_id gnl|my_center|LOCUS_06280 65893 66180 gene locus_tag LOCUS_06290 65893 66180 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869619.1 protein_id gnl|my_center|LOCUS_06290 66170 66511 gene locus_tag LOCUS_06300 66170 66511 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_06300 66789 67259 gene locus_tag LOCUS_06310 66789 67259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 67299 67556 gene locus_tag LOCUS_06320 67299 67556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 69153 67702 gene locus_tag LOCUS_06330 69153 67702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 69819 69157 gene locus_tag LOCUS_06340 69819 69157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 >Feature sequence09 280 810 gene locus_tag LOCUS_06350 gene nusG 280 810 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_06350 876 1301 gene locus_tag LOCUS_06360 gene rplK 876 1301 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012548197.1 protein_id gnl|my_center|LOCUS_06360 1319 2026 gene locus_tag LOCUS_06370 gene rplA 1319 2026 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_06370 2221 2739 gene locus_tag LOCUS_06380 gene rplJ 2221 2739 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943495.1 protein_id gnl|my_center|LOCUS_06380 2766 3161 gene locus_tag LOCUS_06390 gene rplL 2766 3161 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943494.1 protein_id gnl|my_center|LOCUS_06390 3373 7467 gene locus_tag LOCUS_06400 gene rpoB 3373 7467 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943493.1 protein_id gnl|my_center|LOCUS_06400 7534 11682 gene locus_tag LOCUS_06410 gene rpoC 7534 11682 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_06410 11746 12117 gene locus_tag LOCUS_06420 gene rpsL 11746 12117 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057584.1 protein_id gnl|my_center|LOCUS_06420 12133 12603 gene locus_tag LOCUS_06430 gene rpsG 12133 12603 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385326.1 protein_id gnl|my_center|LOCUS_06430 12684 14726 gene locus_tag LOCUS_06440 gene fusA 12684 14726 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_06440 14767 15966 gene locus_tag LOCUS_06450 gene tuf 14767 15966 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_06450 15987 16298 gene locus_tag LOCUS_06460 gene rpsJ 15987 16298 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_06460 16374 17006 gene locus_tag LOCUS_06470 gene rplC 16374 17006 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943486.1 protein_id gnl|my_center|LOCUS_06470 17027 17650 gene locus_tag LOCUS_06480 gene rplD 17027 17650 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943485.1 protein_id gnl|my_center|LOCUS_06480 17650 17937 gene locus_tag LOCUS_06490 17650 17937 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_06490 17955 18776 gene locus_tag LOCUS_06500 gene rplB 17955 18776 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_06500 18779 19060 gene locus_tag LOCUS_06510 gene rpsS 18779 19060 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943482.1 protein_id gnl|my_center|LOCUS_06510 19106 19438 gene locus_tag LOCUS_06520 gene rplV 19106 19438 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173710.1 protein_id gnl|my_center|LOCUS_06520 19458 20111 gene locus_tag LOCUS_06530 gene rpsC 19458 20111 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_06530 20229 20603 gene locus_tag LOCUS_06540 gene rplP 20229 20603 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943479.1 protein_id gnl|my_center|LOCUS_06540 20593 20787 gene locus_tag LOCUS_06550 gene rpmC 20593 20787 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869921.1 protein_id gnl|my_center|LOCUS_06550 20792 21049 gene locus_tag LOCUS_06560 gene rpsQ 20792 21049 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943477.1 protein_id gnl|my_center|LOCUS_06560 21096 21464 gene locus_tag LOCUS_06570 gene rplN 21096 21464 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943476.1 protein_id gnl|my_center|LOCUS_06570 21478 21798 gene locus_tag LOCUS_06580 gene rplX 21478 21798 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938609.1 protein_id gnl|my_center|LOCUS_06580 21813 22352 gene locus_tag LOCUS_06590 gene rplE 21813 22352 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_06590 22378 22563 gene locus_tag LOCUS_06600 22378 22563 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943473.1 protein_id gnl|my_center|LOCUS_06600 22588 22989 gene locus_tag LOCUS_06610 gene rpsH 22588 22989 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943472.1 protein_id gnl|my_center|LOCUS_06610 23029 23568 gene locus_tag LOCUS_06620 gene rplF 23029 23568 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943471.1 protein_id gnl|my_center|LOCUS_06620 23649 24020 gene locus_tag LOCUS_06630 gene rplR 23649 24020 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_06630 24048 24545 gene locus_tag LOCUS_06640 gene rpsE 24048 24545 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943469.1 protein_id gnl|my_center|LOCUS_06640 24564 24758 gene locus_tag LOCUS_06650 gene rpmD 24564 24758 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096577.1 protein_id gnl|my_center|LOCUS_06650 24758 25192 gene locus_tag LOCUS_06660 gene rplO 24758 25192 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943467.1 protein_id gnl|my_center|LOCUS_06660 25194 26501 gene locus_tag LOCUS_06670 gene secY 25194 26501 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_06670 26531 27280 gene locus_tag LOCUS_06680 gene map 26531 27280 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943464.1 protein_id gnl|my_center|LOCUS_06680 27317 27535 gene locus_tag LOCUS_06690 gene infA 27317 27535 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942395.1 protein_id gnl|my_center|LOCUS_06690 27761 28129 gene locus_tag LOCUS_06700 gene rpsM 27761 28129 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943462.1 protein_id gnl|my_center|LOCUS_06700 28148 28540 gene locus_tag LOCUS_06710 gene rpsK 28148 28540 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943461.1 protein_id gnl|my_center|LOCUS_06710 28690 29316 gene locus_tag LOCUS_06720 gene rpsD 28690 29316 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_06720 29350 30363 gene locus_tag LOCUS_06730 29350 30363 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_06730 30399 30800 gene locus_tag LOCUS_06740 30399 30800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 31016 31276 gene locus_tag LOCUS_06750 31016 31276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 31517 32290 gene locus_tag LOCUS_06760 31517 32290 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_06760 32294 33592 gene locus_tag LOCUS_06770 32294 33592 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_06770 33615 35864 gene locus_tag LOCUS_06780 gene lptD 33615 35864 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943003.1 protein_id gnl|my_center|LOCUS_06780 35957 36388 gene locus_tag LOCUS_06790 gene rplM 35957 36388 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943505.1 protein_id gnl|my_center|LOCUS_06790 36455 36847 gene locus_tag LOCUS_06800 gene rpsI 36455 36847 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943504.1 protein_id gnl|my_center|LOCUS_06800 36906 37943 gene locus_tag LOCUS_06810 gene argC 36906 37943 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_06810 38021 39502 gene locus_tag LOCUS_06820 gene cysS 38021 39502 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943976.1 protein_id gnl|my_center|LOCUS_06820 40040 39534 gene locus_tag LOCUS_06830 40040 39534 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957925.1 protein_id gnl|my_center|LOCUS_06830 40838 40515 gene locus_tag LOCUS_06840 40838 40515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 41611 41075 gene locus_tag LOCUS_06850 41611 41075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 42022 41612 gene locus_tag LOCUS_06860 42022 41612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 44474 42111 gene locus_tag LOCUS_06870 44474 42111 CDS product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478344.1 protein_id gnl|my_center|LOCUS_06870 45319 44498 gene locus_tag LOCUS_06880 45319 44498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 45773 45288 gene locus_tag LOCUS_06890 45773 45288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 46288 45845 gene locus_tag LOCUS_06900 46288 45845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 48085 46601 gene locus_tag LOCUS_06910 48085 46601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 49122 48082 gene locus_tag LOCUS_06920 49122 48082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06920 49523 49050 gene locus_tag LOCUS_06930 49523 49050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06930 50750 49578 gene locus_tag LOCUS_06940 50750 49578 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443885.1 protein_id gnl|my_center|LOCUS_06940 51441 50761 gene locus_tag LOCUS_06950 51441 50761 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958456.1 protein_id gnl|my_center|LOCUS_06950 53187 51451 gene locus_tag LOCUS_06960 53187 51451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 54767 53193 gene locus_tag LOCUS_06970 54767 53193 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103137.1 protein_id gnl|my_center|LOCUS_06970 54853 55044 gene locus_tag LOCUS_06980 54853 55044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 55794 55084 gene locus_tag LOCUS_06990 55794 55084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 56250 55810 gene locus_tag LOCUS_07000 56250 55810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 56738 56394 gene locus_tag LOCUS_07010 56738 56394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 58319 58125 gene locus_tag LOCUS_07020 58319 58125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 58632 58285 gene locus_tag LOCUS_07030 58632 58285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 59847 60107 gene locus_tag LOCUS_07040 59847 60107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 60086 60376 gene locus_tag LOCUS_07050 60086 60376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 60448 61440 gene locus_tag LOCUS_07060 60448 61440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 61412 62407 gene locus_tag LOCUS_07070 61412 62407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 63068 63448 gene locus_tag LOCUS_07080 63068 63448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 63500 63985 gene locus_tag LOCUS_07090 63500 63985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 63982 65139 gene locus_tag LOCUS_07100 63982 65139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 66051 65167 gene locus_tag LOCUS_07110 66051 65167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119549.1 protein_id gnl|my_center|LOCUS_07110 >Feature sequence10 <1 712 gene locus_tag LOCUS_07120 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257052.1:adenylosuccinate lyase 722 1741 gene locus_tag LOCUS_07130 722 1741 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978244.1 protein_id gnl|my_center|LOCUS_07130 1807 2964 gene locus_tag LOCUS_07140 1807 2964 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_07140 2966 3748 gene locus_tag LOCUS_07150 2966 3748 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_07150 3748 4947 gene locus_tag LOCUS_07160 3748 4947 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545166.1 protein_id gnl|my_center|LOCUS_07160 4961 6595 gene locus_tag LOCUS_07170 gene pgi 4961 6595 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141691.1 protein_id gnl|my_center|LOCUS_07170 6952 7320 gene locus_tag LOCUS_07180 6952 7320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 8789 7443 gene locus_tag LOCUS_07190 8789 7443 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064444.1 protein_id gnl|my_center|LOCUS_07190 8974 9047 gene locus_tag LOCUS_t00080 8974 9047 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9141 9611 gene locus_tag LOCUS_07200 gene greA 9141 9611 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339475.1 protein_id gnl|my_center|LOCUS_07200 9678 10982 gene locus_tag LOCUS_07210 9678 10982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 11102 11166 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11427 12647 gene locus_tag LOCUS_07220 11427 12647 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938567.1 protein_id gnl|my_center|LOCUS_07220 12669 14051 gene locus_tag LOCUS_07230 12669 14051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 14492 14905 gene locus_tag LOCUS_07240 14492 14905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 15040 15984 gene locus_tag LOCUS_07250 15040 15984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 15981 16976 gene locus_tag LOCUS_07260 15981 16976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 17395 18183 gene locus_tag LOCUS_07270 17395 18183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 19390 18431 gene locus_tag LOCUS_07280 19390 18431 CDS product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941752.1 protein_id gnl|my_center|LOCUS_07280 19705 20712 gene locus_tag LOCUS_07290 19705 20712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 20841 21464 gene locus_tag LOCUS_07300 20841 21464 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762243.1 protein_id gnl|my_center|LOCUS_07300 21631 23130 gene locus_tag LOCUS_07310 21631 23130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 23373 24197 gene locus_tag LOCUS_07320 23373 24197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 24263 25666 gene locus_tag LOCUS_07330 gene atpD 24263 25666 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065404.1 protein_id gnl|my_center|LOCUS_07330 25656 26045 gene locus_tag LOCUS_07340 25656 26045 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022411.1 protein_id gnl|my_center|LOCUS_07340 26035 26367 gene locus_tag LOCUS_07350 26035 26367 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120167.1 protein_id gnl|my_center|LOCUS_07350 26381 26656 gene locus_tag LOCUS_07360 26381 26656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 26675 27409 gene locus_tag LOCUS_07370 26675 27409 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328512.1 protein_id gnl|my_center|LOCUS_07370 27472 27750 gene locus_tag LOCUS_07380 27472 27750 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328511.1 protein_id gnl|my_center|LOCUS_07380 27754 28533 gene locus_tag LOCUS_07390 27754 28533 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022406.1 protein_id gnl|my_center|LOCUS_07390 28549 30090 gene locus_tag LOCUS_07400 28549 30090 CDS product alternate F1F0 ATPase, F1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921807.1 protein_id gnl|my_center|LOCUS_07400 30093 30989 gene locus_tag LOCUS_07410 30093 30989 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340302.1 protein_id gnl|my_center|LOCUS_07410 31038 31859 gene locus_tag LOCUS_07420 31038 31859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 32004 32495 gene locus_tag LOCUS_07430 gene greA 32004 32495 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390637.1 protein_id gnl|my_center|LOCUS_07430 33456 32884 gene locus_tag LOCUS_07440 33456 32884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 34989 33526 gene locus_tag LOCUS_07450 34989 33526 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939629.1 protein_id gnl|my_center|LOCUS_07450 35496 35089 gene locus_tag LOCUS_07460 35496 35089 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940790.1 protein_id gnl|my_center|LOCUS_07460 36917 35511 gene locus_tag LOCUS_07470 gene atpD 36917 35511 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938076.1 protein_id gnl|my_center|LOCUS_07470 37855 36983 gene locus_tag LOCUS_07480 37855 36983 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938077.1 protein_id gnl|my_center|LOCUS_07480 39446 37932 gene locus_tag LOCUS_07490 gene atpA 39446 37932 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938078.1 protein_id gnl|my_center|LOCUS_07490 39995 39450 gene locus_tag LOCUS_07500 39995 39450 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425856.1 protein_id gnl|my_center|LOCUS_07500 40597 39992 gene locus_tag LOCUS_07510 40597 39992 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940785.1 protein_id gnl|my_center|LOCUS_07510 41022 40597 gene locus_tag LOCUS_07520 41022 40597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 41663 41307 gene locus_tag LOCUS_07530 41663 41307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 42056 41679 gene locus_tag LOCUS_07540 42056 41679 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938085.1 protein_id gnl|my_center|LOCUS_07540 43212 42103 gene locus_tag LOCUS_07550 gene rodA 43212 42103 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_07550 45076 43202 gene locus_tag LOCUS_07560 gene mrdA 45076 43202 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_07560 45554 45057 gene locus_tag LOCUS_07570 45554 45057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 46378 45551 gene locus_tag LOCUS_07580 gene mreC 46378 45551 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942723.1 protein_id gnl|my_center|LOCUS_07580 47690 46653 gene locus_tag LOCUS_07590 47690 46653 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_07590 47935 49533 gene locus_tag LOCUS_07600 47935 49533 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938364.1 protein_id gnl|my_center|LOCUS_07600 49765 52230 gene locus_tag LOCUS_07610 49765 52230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 52236 52607 gene locus_tag LOCUS_07620 52236 52607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 53521 52670 gene locus_tag LOCUS_07630 gene ccsB 53521 52670 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941276.1 protein_id gnl|my_center|LOCUS_07630 54909 53518 gene locus_tag LOCUS_07640 54909 53518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 55774 55049 gene locus_tag LOCUS_07650 55774 55049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 56010 55729 gene locus_tag LOCUS_07660 56010 55729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 56112 56116 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 56250 56330 gene locus_tag LOCUS_t00090 56250 56330 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 57516 56419 gene locus_tag LOCUS_07670 57516 56419 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_07670 57729 57520 gene locus_tag LOCUS_07680 57729 57520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 58036 57779 gene locus_tag LOCUS_07690 58036 57779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 58380 58688 gene locus_tag LOCUS_07700 58380 58688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07700 58685 59527 gene locus_tag LOCUS_07710 58685 59527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07710 59581 59952 gene locus_tag LOCUS_07720 59581 59952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 60322 60573 gene locus_tag LOCUS_07730 60322 60573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 60607 61536 gene locus_tag LOCUS_07740 60607 61536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 61562 61954 gene locus_tag LOCUS_07750 61562 61954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 62062 62271 gene locus_tag LOCUS_07760 62062 62271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 63082 62393 gene locus_tag LOCUS_07770 63082 62393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 64234 63395 gene locus_tag LOCUS_07780 64234 63395 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013747453.1 protein_id gnl|my_center|LOCUS_07780 65070 64234 gene locus_tag LOCUS_07790 65070 64234 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867167.1 protein_id gnl|my_center|LOCUS_07790 >Feature sequence11 92 487 gene locus_tag LOCUS_07800 92 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 678 1097 gene locus_tag LOCUS_07810 678 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 1493 1852 gene locus_tag LOCUS_07820 1493 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 1945 2559 gene locus_tag LOCUS_07830 1945 2559 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461805.1 protein_id gnl|my_center|LOCUS_07830 2658 3788 gene locus_tag LOCUS_07840 2658 3788 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962298.1 protein_id gnl|my_center|LOCUS_07840 3785 4396 gene locus_tag LOCUS_07850 gene bioD 3785 4396 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964418.1 protein_id gnl|my_center|LOCUS_07850 4410 5690 gene locus_tag LOCUS_07860 gene bioA 4410 5690 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964417.1 protein_id gnl|my_center|LOCUS_07860 5778 5975 gene locus_tag LOCUS_07870 5778 5975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 7431 6361 gene locus_tag LOCUS_07880 gene ychF 7431 6361 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_07880 7924 7610 gene locus_tag LOCUS_07890 7924 7610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 8037 9344 gene locus_tag LOCUS_07900 8037 9344 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626397.1 protein_id gnl|my_center|LOCUS_07900 9401 9859 gene locus_tag LOCUS_07910 9401 9859 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064308.1 protein_id gnl|my_center|LOCUS_07910 9899 10183 gene locus_tag LOCUS_07920 9899 10183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 10294 11949 gene locus_tag LOCUS_07930 10294 11949 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942184.1 protein_id gnl|my_center|LOCUS_07930 11946 12557 gene locus_tag LOCUS_07940 11946 12557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942183.1 protein_id gnl|my_center|LOCUS_07940 12625 13623 gene locus_tag LOCUS_07950 12625 13623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 14082 13696 gene locus_tag LOCUS_07960 14082 13696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 14381 14833 gene locus_tag LOCUS_07970 14381 14833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 14867 15652 gene locus_tag LOCUS_07980 14867 15652 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868514.1 protein_id gnl|my_center|LOCUS_07980 15691 15855 gene locus_tag LOCUS_07990 15691 15855 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459942.1 protein_id gnl|my_center|LOCUS_07990 16016 16333 gene locus_tag LOCUS_08000 16016 16333 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941982.1 protein_id gnl|my_center|LOCUS_08000 16504 17448 gene locus_tag LOCUS_08010 16504 17448 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 protein_id gnl|my_center|LOCUS_08010 17510 18709 gene locus_tag LOCUS_08020 17510 18709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 18860 20044 gene locus_tag LOCUS_08030 18860 20044 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_08030 20046 20468 gene locus_tag LOCUS_08040 20046 20468 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965765.1 protein_id gnl|my_center|LOCUS_08040 20635 21573 gene locus_tag LOCUS_08050 20635 21573 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657813.1 protein_id gnl|my_center|LOCUS_08050 21764 22420 gene locus_tag LOCUS_08060 21764 22420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 22430 23212 gene locus_tag LOCUS_08070 22430 23212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 23457 23675 gene locus_tag LOCUS_08080 23457 23675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 25143 23875 gene locus_tag LOCUS_08090 25143 23875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 25570 25770 gene locus_tag LOCUS_08100 25570 25770 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707209.1 protein_id gnl|my_center|LOCUS_08100 26207 25920 gene locus_tag LOCUS_08110 26207 25920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 26358 27719 gene locus_tag LOCUS_08120 26358 27719 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_08120 27958 28734 gene locus_tag LOCUS_08130 27958 28734 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958274.1 protein_id gnl|my_center|LOCUS_08130 31253 28923 gene locus_tag LOCUS_08140 31253 28923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 31965 31375 gene locus_tag LOCUS_08150 31965 31375 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844912.1 protein_id gnl|my_center|LOCUS_08150 32096 33061 gene locus_tag LOCUS_08160 32096 33061 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393185.1 protein_id gnl|my_center|LOCUS_08160 34021 33089 gene locus_tag LOCUS_08170 34021 33089 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_08170 34849 34058 gene locus_tag LOCUS_08180 34849 34058 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095636.1 protein_id gnl|my_center|LOCUS_08180 35396 35076 gene locus_tag LOCUS_08190 35396 35076 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_08190 35692 35426 gene locus_tag LOCUS_08200 35692 35426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08200 36159 35683 gene locus_tag LOCUS_08210 36159 35683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08210 36871 36350 gene locus_tag LOCUS_08220 36871 36350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 37468 36962 gene locus_tag LOCUS_08230 37468 36962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 38680 37553 gene locus_tag LOCUS_08240 38680 37553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 38953 39285 gene locus_tag LOCUS_08250 38953 39285 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939281.1 protein_id gnl|my_center|LOCUS_08250 39293 39730 gene locus_tag LOCUS_08260 39293 39730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 41707 39743 gene locus_tag LOCUS_08270 41707 39743 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053568.1 protein_id gnl|my_center|LOCUS_08270 42442 41738 gene locus_tag LOCUS_08280 42442 41738 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941514.1 protein_id gnl|my_center|LOCUS_08280 43239 42439 gene locus_tag LOCUS_08290 43239 42439 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202917.1 protein_id gnl|my_center|LOCUS_08290 44256 43552 gene locus_tag LOCUS_08300 44256 43552 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392265.1 protein_id gnl|my_center|LOCUS_08300 44748 46430 gene locus_tag LOCUS_08310 44748 46430 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_08310 45957 45856 gene locus_tag LOCUS_t00100 45957 45856 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 46445 46846 gene locus_tag LOCUS_08320 46445 46846 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146517.1 protein_id gnl|my_center|LOCUS_08320 48083 47325 gene locus_tag LOCUS_08330 48083 47325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 49234 48170 gene locus_tag LOCUS_08340 gene aroC 49234 48170 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_08340 49785 49237 gene locus_tag LOCUS_08350 49785 49237 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119378.1 protein_id gnl|my_center|LOCUS_08350 51132 49855 gene locus_tag LOCUS_08360 gene aroA 51132 49855 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031206.1 protein_id gnl|my_center|LOCUS_08360 52055 51192 gene locus_tag LOCUS_08370 52055 51192 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867574.1 protein_id gnl|my_center|LOCUS_08370 52904 52179 gene locus_tag LOCUS_08380 52904 52179 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867573.1 protein_id gnl|my_center|LOCUS_08380 53980 52901 gene locus_tag LOCUS_08390 gene pheA 53980 52901 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_08390 55068 53977 gene locus_tag LOCUS_08400 gene aroB 55068 53977 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545319.1 protein_id gnl|my_center|LOCUS_08400 56093 55065 gene locus_tag LOCUS_08410 gene aroF 56093 55065 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943764.1 protein_id gnl|my_center|LOCUS_08410 56608 57171 gene locus_tag LOCUS_08420 gene efp 56608 57171 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942396.1 protein_id gnl|my_center|LOCUS_08420 57179 58102 gene locus_tag LOCUS_08430 gene epmA 57179 58102 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942397.1 protein_id gnl|my_center|LOCUS_08430 58138 59559 gene locus_tag LOCUS_08440 58138 59559 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_08440 59720 61132 gene locus_tag LOCUS_08450 59720 61132 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545053.1 protein_id gnl|my_center|LOCUS_08450 61255 62637 gene locus_tag LOCUS_08460 61255 62637 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546417.1 protein_id gnl|my_center|LOCUS_08460 62779 63762 gene locus_tag LOCUS_08470 62779 63762 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583008.1 protein_id gnl|my_center|LOCUS_08470 64220 64017 gene locus_tag LOCUS_08480 64220 64017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence12 1187 594 gene locus_tag LOCUS_08490 1187 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 1631 1194 gene locus_tag LOCUS_08500 1631 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 2055 1633 gene locus_tag LOCUS_08510 2055 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 2844 2080 gene locus_tag LOCUS_08520 2844 2080 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_08520 3635 3180 gene locus_tag LOCUS_08530 3635 3180 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391711.1 protein_id gnl|my_center|LOCUS_08530 4427 3699 gene locus_tag LOCUS_08540 4427 3699 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023677.1 protein_id gnl|my_center|LOCUS_08540 4650 5741 gene locus_tag LOCUS_08550 gene ribD 4650 5741 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943609.1 protein_id gnl|my_center|LOCUS_08550 7479 5869 gene locus_tag LOCUS_08560 7479 5869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941782.1 protein_id gnl|my_center|LOCUS_08560 7556 8059 gene locus_tag LOCUS_08570 7556 8059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 9054 8062 gene locus_tag LOCUS_08580 9054 8062 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941710.1 protein_id gnl|my_center|LOCUS_08580 9255 9464 gene locus_tag LOCUS_08590 9255 9464 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545602.1 protein_id gnl|my_center|LOCUS_08590 10615 9491 gene locus_tag LOCUS_08600 10615 9491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 11887 10730 gene locus_tag LOCUS_08610 11887 10730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 12412 11948 gene locus_tag LOCUS_08620 12412 11948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 12670 13755 gene locus_tag LOCUS_08630 12670 13755 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545833.1 protein_id gnl|my_center|LOCUS_08630 13779 14525 gene locus_tag LOCUS_08640 13779 14525 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546413.1 protein_id gnl|my_center|LOCUS_08640 14530 15066 gene locus_tag LOCUS_08650 14530 15066 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869337.1 protein_id gnl|my_center|LOCUS_08650 15085 15513 gene locus_tag LOCUS_08660 15085 15513 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938903.1 protein_id gnl|my_center|LOCUS_08660 15608 15976 gene locus_tag LOCUS_08670 15608 15976 CDS product peptide chain release factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941214.1 protein_id gnl|my_center|LOCUS_08670 16419 16039 gene locus_tag LOCUS_08680 16419 16039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 16704 17168 gene locus_tag LOCUS_08690 16704 17168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 17228 18508 gene locus_tag LOCUS_08700 gene hemL 17228 18508 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941005.1 protein_id gnl|my_center|LOCUS_08700 18574 19893 gene locus_tag LOCUS_08710 18574 19893 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940434.1 protein_id gnl|my_center|LOCUS_08710 19955 20983 gene locus_tag LOCUS_08720 gene gmd 19955 20983 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546080.1 protein_id gnl|my_center|LOCUS_08720 20980 21924 gene locus_tag LOCUS_08730 20980 21924 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_08730 22044 22331 gene locus_tag LOCUS_08740 22044 22331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 22291 22692 gene locus_tag LOCUS_08750 22291 22692 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941003.1 protein_id gnl|my_center|LOCUS_08750 22698 23351 gene locus_tag LOCUS_08760 22698 23351 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_08760 25106 23553 gene locus_tag LOCUS_08770 25106 23553 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546159.1 protein_id gnl|my_center|LOCUS_08770 26521 25103 gene locus_tag LOCUS_08780 gene purF 26521 25103 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_08780 29793 26530 gene locus_tag LOCUS_08790 gene carB 29793 26530 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_08790 29919 29982 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31259 30165 gene locus_tag LOCUS_08800 gene carA 31259 30165 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_08800 32179 31400 gene locus_tag LOCUS_08810 gene hisF 32179 31400 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937595.1 protein_id gnl|my_center|LOCUS_08810 32807 32169 gene locus_tag LOCUS_08820 gene hisH 32807 32169 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937594.1 protein_id gnl|my_center|LOCUS_08820 33646 32906 gene locus_tag LOCUS_08830 33646 32906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083223.1 protein_id gnl|my_center|LOCUS_08830 34875 33775 gene locus_tag LOCUS_08840 34875 33775 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941892.1 protein_id gnl|my_center|LOCUS_08840 36215 34953 gene locus_tag LOCUS_08850 36215 34953 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941893.1 protein_id gnl|my_center|LOCUS_08850 36657 36220 gene locus_tag LOCUS_08860 36657 36220 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941894.1 protein_id gnl|my_center|LOCUS_08860 38293 36770 gene locus_tag LOCUS_08870 38293 36770 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939110.1 protein_id gnl|my_center|LOCUS_08870 39212 38736 gene locus_tag LOCUS_08880 39212 38736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 39594 39253 gene locus_tag LOCUS_08890 39594 39253 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083241.1 protein_id gnl|my_center|LOCUS_08890 40839 39607 gene locus_tag LOCUS_08900 40839 39607 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_08900 41877 41122 gene locus_tag LOCUS_08910 41877 41122 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054810.1 protein_id gnl|my_center|LOCUS_08910 43260 41932 gene locus_tag LOCUS_08920 gene glnA 43260 41932 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545065.1 protein_id gnl|my_center|LOCUS_08920 43578 44462 gene locus_tag LOCUS_08930 gene pdxS 43578 44462 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391558.1 protein_id gnl|my_center|LOCUS_08930 44499 45575 gene locus_tag LOCUS_08940 44499 45575 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246499.1 protein_id gnl|my_center|LOCUS_08940 45904 46572 gene locus_tag LOCUS_08950 45904 46572 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943820.1 protein_id gnl|my_center|LOCUS_08950 48548 46998 gene locus_tag LOCUS_08960 48548 46998 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228677.1 protein_id gnl|my_center|LOCUS_08960 50257 48830 gene locus_tag LOCUS_08970 gene gltA 50257 48830 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393026.1 protein_id gnl|my_center|LOCUS_08970 51083 50247 gene locus_tag LOCUS_08980 51083 50247 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932161.1 protein_id gnl|my_center|LOCUS_08980 52070 51216 gene locus_tag LOCUS_08990 52070 51216 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940762.1 protein_id gnl|my_center|LOCUS_08990 53203 52166 gene locus_tag LOCUS_09000 53203 52166 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932918.1 protein_id gnl|my_center|LOCUS_09000 54110 53247 gene locus_tag LOCUS_09010 54110 53247 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940765.1 protein_id gnl|my_center|LOCUS_09010 54541 54122 gene locus_tag LOCUS_09020 54541 54122 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_09020 56537 54576 gene locus_tag LOCUS_09030 gene hdrA 56537 54576 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_09030 57686 56547 gene locus_tag LOCUS_09040 57686 56547 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879269.1 protein_id gnl|my_center|LOCUS_09040 58530 57946 gene locus_tag LOCUS_09050 gene yihA 58530 57946 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943641.1 protein_id gnl|my_center|LOCUS_09050 60027 58648 gene locus_tag LOCUS_09060 60027 58648 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_09060 63214 60131 gene locus_tag LOCUS_09070 63214 60131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 63390 63211 gene locus_tag LOCUS_09080 63390 63211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 63833 64207 gene locus_tag LOCUS_09090 63833 64207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 >Feature sequence13 1238 78 gene locus_tag LOCUS_09100 1238 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 1581 2171 gene locus_tag LOCUS_09110 1581 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 2175 2906 gene locus_tag LOCUS_09120 2175 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 4912 3077 gene locus_tag LOCUS_09130 gene ade 4912 3077 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066541.1 protein_id gnl|my_center|LOCUS_09130 5405 4824 gene locus_tag LOCUS_09140 5405 4824 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_09140 7490 5424 gene locus_tag LOCUS_09150 7490 5424 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870094.1 protein_id gnl|my_center|LOCUS_09150 8154 7570 gene locus_tag LOCUS_09160 8154 7570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 9401 8181 gene locus_tag LOCUS_09170 9401 8181 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942444.1 protein_id gnl|my_center|LOCUS_09170 9894 9403 gene locus_tag LOCUS_09180 gene tsaE 9894 9403 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044854.1 protein_id gnl|my_center|LOCUS_09180 10304 9891 gene locus_tag LOCUS_09190 10304 9891 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942448.1 protein_id gnl|my_center|LOCUS_09190 11499 10306 gene locus_tag LOCUS_09200 gene folP 11499 10306 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391658.1 protein_id gnl|my_center|LOCUS_09200 13480 11663 gene locus_tag LOCUS_09210 gene ftsH 13480 11663 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_09210 14994 13564 gene locus_tag LOCUS_09220 gene tilS 14994 13564 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_09220 19337 14991 gene locus_tag LOCUS_09230 19337 14991 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081484.1 protein_id gnl|my_center|LOCUS_09230 20032 19388 gene locus_tag LOCUS_09240 20032 19388 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086535.1 protein_id gnl|my_center|LOCUS_09240 20330 21229 gene locus_tag LOCUS_09250 20330 21229 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391687.1 protein_id gnl|my_center|LOCUS_09250 21226 22041 gene locus_tag LOCUS_09260 gene panB 21226 22041 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356105.1 protein_id gnl|my_center|LOCUS_09260 22264 22118 gene locus_tag LOCUS_09270 22264 22118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 22453 22310 gene locus_tag LOCUS_09280 22453 22310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 22937 22458 gene locus_tag LOCUS_09290 22937 22458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 23349 22975 gene locus_tag LOCUS_09300 23349 22975 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939487.1 protein_id gnl|my_center|LOCUS_09300 23534 24052 gene locus_tag LOCUS_09310 23534 24052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 24782 24012 gene locus_tag LOCUS_09320 24782 24012 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947927.1 protein_id gnl|my_center|LOCUS_09320 26069 24798 gene locus_tag LOCUS_09330 26069 24798 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063044.1 protein_id gnl|my_center|LOCUS_09330 26228 26713 gene locus_tag LOCUS_09340 26228 26713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 26760 27170 gene locus_tag LOCUS_09350 26760 27170 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583101.1 protein_id gnl|my_center|LOCUS_09350 27560 27201 gene locus_tag LOCUS_09360 27560 27201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 27713 29041 gene locus_tag LOCUS_09370 gene mtaB 27713 29041 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_09370 29034 29756 gene locus_tag LOCUS_09380 gene rnc 29034 29756 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670498.1 protein_id gnl|my_center|LOCUS_09380 29753 30877 gene locus_tag LOCUS_09390 29753 30877 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942867.1 protein_id gnl|my_center|LOCUS_09390 30870 31772 gene locus_tag LOCUS_09400 gene era 30870 31772 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360270.1 protein_id gnl|my_center|LOCUS_09400 31769 33088 gene locus_tag LOCUS_09410 gene der 31769 33088 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942865.1 protein_id gnl|my_center|LOCUS_09410 33534 33142 gene locus_tag LOCUS_09420 33534 33142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 33805 35541 gene locus_tag LOCUS_09430 33805 35541 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_09430 36163 35768 gene locus_tag LOCUS_09440 36163 35768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 36609 36229 gene locus_tag LOCUS_09450 36609 36229 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262622.1 protein_id gnl|my_center|LOCUS_09450 38455 37085 gene locus_tag LOCUS_09460 38455 37085 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_09460 40129 38495 gene locus_tag LOCUS_09470 40129 38495 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_09470 40531 42825 gene locus_tag LOCUS_09480 40531 42825 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_09480 42920 44209 gene locus_tag LOCUS_09490 gene hisS 42920 44209 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942303.1 protein_id gnl|my_center|LOCUS_09490 44202 45980 gene locus_tag LOCUS_09500 gene aspS 44202 45980 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_09500 46225 46734 gene locus_tag LOCUS_09510 46225 46734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 46827 48716 gene locus_tag LOCUS_09520 46827 48716 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937705.1 protein_id gnl|my_center|LOCUS_09520 50690 48726 gene locus_tag LOCUS_09530 50690 48726 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583112.1 protein_id gnl|my_center|LOCUS_09530 51361 50720 gene locus_tag LOCUS_09540 51361 50720 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021125.1 protein_id gnl|my_center|LOCUS_09540 51682 51825 gene locus_tag LOCUS_09550 51682 51825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 52125 53291 gene locus_tag LOCUS_09560 52125 53291 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940010.1 protein_id gnl|my_center|LOCUS_09560 53420 54295 gene locus_tag LOCUS_09570 53420 54295 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_09570 54300 54821 gene locus_tag LOCUS_09580 54300 54821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09580 54818 55420 gene locus_tag LOCUS_09590 54818 55420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09590 55407 56177 gene locus_tag LOCUS_09600 55407 56177 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_09600 56174 56893 gene locus_tag LOCUS_09610 56174 56893 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_09610 57386 56910 gene locus_tag LOCUS_09620 57386 56910 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007355700.1 protein_id gnl|my_center|LOCUS_09620 57702 57615 gene locus_tag LOCUS_t00110 57702 57615 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 57781 59097 gene locus_tag LOCUS_09630 57781 59097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 59100 60446 gene locus_tag LOCUS_09640 59100 60446 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545535.1 protein_id gnl|my_center|LOCUS_09640 60695 62344 gene locus_tag LOCUS_09650 60695 62344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 62447 62283 gene locus_tag LOCUS_09660 62447 62283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 62773 63936 gene locus_tag LOCUS_09670 62773 63936 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence14 469 125 gene locus_tag LOCUS_09680 469 125 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430911.1 protein_id gnl|my_center|LOCUS_09680 1240 500 gene locus_tag LOCUS_09690 gene hisA 1240 500 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199906.1 protein_id gnl|my_center|LOCUS_09690 2073 1357 gene locus_tag LOCUS_09700 2073 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 2700 2113 gene locus_tag LOCUS_09710 gene hisB 2700 2113 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_09710 3585 2713 gene locus_tag LOCUS_09720 gene hisG 3585 2713 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942177.1 protein_id gnl|my_center|LOCUS_09720 3956 3582 gene locus_tag LOCUS_09730 gene hisI 3956 3582 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937424.1 protein_id gnl|my_center|LOCUS_09730 4183 4476 gene locus_tag LOCUS_09740 4183 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 4708 5745 gene locus_tag LOCUS_09750 4708 5745 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942697.1 protein_id gnl|my_center|LOCUS_09750 5880 6365 gene locus_tag LOCUS_09760 5880 6365 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942698.1 protein_id gnl|my_center|LOCUS_09760 6362 7663 gene locus_tag LOCUS_09770 6362 7663 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 protein_id gnl|my_center|LOCUS_09770 7777 8223 gene locus_tag LOCUS_09780 7777 8223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 8712 8227 gene locus_tag LOCUS_09790 gene lspA 8712 8227 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_09790 11510 8709 gene locus_tag LOCUS_09800 gene ileS 11510 8709 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_09800 13308 11668 gene locus_tag LOCUS_09810 gene groL 13308 11668 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_09810 13614 13324 gene locus_tag LOCUS_09820 gene groES 13614 13324 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388344.1 protein_id gnl|my_center|LOCUS_09820 13864 14484 gene locus_tag LOCUS_09830 13864 14484 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_09830 14477 15481 gene locus_tag LOCUS_09840 14477 15481 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067595.1 protein_id gnl|my_center|LOCUS_09840 16246 15839 gene locus_tag LOCUS_09850 16246 15839 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_09850 16466 17410 gene locus_tag LOCUS_09860 16466 17410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 18154 17570 gene locus_tag LOCUS_09870 18154 17570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 18981 18364 gene locus_tag LOCUS_09880 18981 18364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 19637 19077 gene locus_tag LOCUS_09890 19637 19077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 20896 19844 gene locus_tag LOCUS_09900 20896 19844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 21942 20893 gene locus_tag LOCUS_09910 21942 20893 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016325.1 protein_id gnl|my_center|LOCUS_09910 24346 21896 gene locus_tag LOCUS_09920 24346 21896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 24764 24402 gene locus_tag LOCUS_09930 gene dksA 24764 24402 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940956.1 protein_id gnl|my_center|LOCUS_09930 26291 24804 gene locus_tag LOCUS_09940 26291 24804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 26464 27159 gene locus_tag LOCUS_09950 26464 27159 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986854.1 protein_id gnl|my_center|LOCUS_09950 28957 27194 gene locus_tag LOCUS_09960 gene phoR 28957 27194 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_09960 29652 28954 gene locus_tag LOCUS_09970 gene phoU 29652 28954 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_09970 30516 29740 gene locus_tag LOCUS_09980 gene pstB 30516 29740 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938383.1 protein_id gnl|my_center|LOCUS_09980 31372 30518 gene locus_tag LOCUS_09990 gene pstA 31372 30518 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939749.1 protein_id gnl|my_center|LOCUS_09990 32295 31408 gene locus_tag LOCUS_10000 gene pstC 32295 31408 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791822.1 protein_id gnl|my_center|LOCUS_10000 33261 32443 gene locus_tag LOCUS_10010 33261 32443 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868851.1 protein_id gnl|my_center|LOCUS_10010 34062 33361 gene locus_tag LOCUS_10020 gene ubiE 34062 33361 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403588.1 protein_id gnl|my_center|LOCUS_10020 34781 34086 gene locus_tag LOCUS_10030 34781 34086 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082164.1 protein_id gnl|my_center|LOCUS_10030 36159 34792 gene locus_tag LOCUS_10040 gene radA 36159 34792 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940957.1 protein_id gnl|my_center|LOCUS_10040 36314 37441 gene locus_tag LOCUS_10050 36314 37441 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090137.1 protein_id gnl|my_center|LOCUS_10050 37459 39042 gene locus_tag LOCUS_10060 gene serA 37459 39042 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_10060 39061 40359 gene locus_tag LOCUS_10070 39061 40359 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_10070 40422 40498 gene locus_tag LOCUS_t00120 40422 40498 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 40812 41003 gene locus_tag LOCUS_10080 40812 41003 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707209.1 protein_id gnl|my_center|LOCUS_10080 41119 41331 gene locus_tag LOCUS_10090 41119 41331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 41401 41661 gene locus_tag LOCUS_10100 41401 41661 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_10100 41806 41970 gene locus_tag LOCUS_10110 41806 41970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 42048 43394 gene locus_tag LOCUS_10120 42048 43394 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_10120 43486 43908 gene locus_tag LOCUS_10130 43486 43908 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809351.1 protein_id gnl|my_center|LOCUS_10130 43994 44134 gene locus_tag LOCUS_10140 43994 44134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 44151 44780 gene locus_tag LOCUS_10150 44151 44780 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10150 45552 46361 gene locus_tag LOCUS_10160 45552 46361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 46493 46927 gene locus_tag LOCUS_10170 46493 46927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 47683 46940 gene locus_tag LOCUS_10180 47683 46940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 47901 49571 gene locus_tag LOCUS_10190 47901 49571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 49669 50004 gene locus_tag LOCUS_10200 49669 50004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 50435 50154 gene locus_tag LOCUS_10210 50435 50154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 51003 50662 gene locus_tag LOCUS_10220 51003 50662 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083241.1 protein_id gnl|my_center|LOCUS_10220 52539 51049 gene locus_tag LOCUS_10230 gene amt 52539 51049 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056043.1 protein_id gnl|my_center|LOCUS_10230 53480 52623 gene locus_tag LOCUS_10240 53480 52623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546145.1 protein_id gnl|my_center|LOCUS_10240 54156 53794 gene locus_tag LOCUS_10250 54156 53794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 55167 54175 gene locus_tag LOCUS_10260 55167 54175 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227260.1 protein_id gnl|my_center|LOCUS_10260 55683 56267 gene locus_tag LOCUS_10270 55683 56267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 57361 56813 gene locus_tag LOCUS_10280 57361 56813 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_10280 >Feature sequence15 1721 72 gene locus_tag LOCUS_10290 gene dnaX 1721 72 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_10290 1980 2105 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2386 2293 gene locus_tag LOCUS_t00130 2386 2293 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2873 2397 gene locus_tag LOCUS_10300 gene tadA 2873 2397 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545402.1 protein_id gnl|my_center|LOCUS_10300 2992 3492 gene locus_tag LOCUS_10310 2992 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 3675 5063 gene locus_tag LOCUS_10320 3675 5063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 5751 5086 gene locus_tag LOCUS_10330 5751 5086 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100859.1 protein_id gnl|my_center|LOCUS_10330 6962 5973 gene locus_tag LOCUS_10340 6962 5973 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009988488.1 protein_id gnl|my_center|LOCUS_10340 7977 7003 gene locus_tag LOCUS_10350 gene sppA 7977 7003 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941487.1 protein_id gnl|my_center|LOCUS_10350 8207 8013 gene locus_tag LOCUS_10360 8207 8013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 8964 8347 gene locus_tag LOCUS_10370 8964 8347 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941409.1 protein_id gnl|my_center|LOCUS_10370 10338 9148 gene locus_tag LOCUS_10380 10338 9148 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941766.1 protein_id gnl|my_center|LOCUS_10380 11066 10509 gene locus_tag LOCUS_10390 gene cobO 11066 10509 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442279.1 protein_id gnl|my_center|LOCUS_10390 12123 11158 gene locus_tag LOCUS_10400 gene meaB 12123 11158 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867373.1 protein_id gnl|my_center|LOCUS_10400 12532 12131 gene locus_tag LOCUS_10410 12532 12131 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_10410 14250 12562 gene locus_tag LOCUS_10420 14250 12562 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878783.1 protein_id gnl|my_center|LOCUS_10420 15944 14493 gene locus_tag LOCUS_10430 gene abfD 15944 14493 CDS product 4-hydroxybutyryl-CoA dehydratase/vinylacetyl-CoA-Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_10430 17760 16480 gene locus_tag LOCUS_10440 17760 16480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 18541 19566 gene locus_tag LOCUS_10450 gene mtnA 18541 19566 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258877.1 protein_id gnl|my_center|LOCUS_10450 19563 20186 gene locus_tag LOCUS_10460 19563 20186 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_10460 20442 22109 gene locus_tag LOCUS_10470 20442 22109 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877773.1 protein_id gnl|my_center|LOCUS_10470 22391 22167 gene locus_tag LOCUS_10480 22391 22167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 22627 22926 gene locus_tag LOCUS_10490 22627 22926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 24251 22923 gene locus_tag LOCUS_10500 24251 22923 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871000.1 protein_id gnl|my_center|LOCUS_10500 24462 25238 gene locus_tag LOCUS_10510 24462 25238 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879137.1 protein_id gnl|my_center|LOCUS_10510 25281 25415 gene locus_tag LOCUS_10520 25281 25415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10520 25452 26636 gene locus_tag LOCUS_10530 25452 26636 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869104.1 protein_id gnl|my_center|LOCUS_10530 28892 26805 gene locus_tag LOCUS_10540 28892 26805 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_10540 29124 29372 gene locus_tag LOCUS_10550 29124 29372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 29447 30679 gene locus_tag LOCUS_10560 29447 30679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 30962 31537 gene locus_tag LOCUS_10570 30962 31537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 31594 31725 gene locus_tag LOCUS_10580 31594 31725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 31729 32928 gene locus_tag LOCUS_10590 31729 32928 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228947.1 protein_id gnl|my_center|LOCUS_10590 33002 33835 gene locus_tag LOCUS_10600 33002 33835 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545710.1 protein_id gnl|my_center|LOCUS_10600 34142 35167 gene locus_tag LOCUS_10610 gene btuC 34142 35167 CDS product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902994.1 protein_id gnl|my_center|LOCUS_10610 35171 35965 gene locus_tag LOCUS_10620 35171 35965 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023815.1 protein_id gnl|my_center|LOCUS_10620 36191 38197 gene locus_tag LOCUS_10630 36191 38197 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071109.1 protein_id gnl|my_center|LOCUS_10630 38222 38986 gene locus_tag LOCUS_10640 38222 38986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 39333 39052 gene locus_tag LOCUS_10650 39333 39052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10650 39819 39394 gene locus_tag LOCUS_10660 39819 39394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10660 41106 40024 gene locus_tag LOCUS_10670 41106 40024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 41867 41451 gene locus_tag LOCUS_10680 41867 41451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 43130 41955 gene locus_tag LOCUS_10690 43130 41955 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940070.1 protein_id gnl|my_center|LOCUS_10690 43319 43194 gene locus_tag LOCUS_10700 43319 43194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 44602 43316 gene locus_tag LOCUS_10710 44602 43316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940069.1 protein_id gnl|my_center|LOCUS_10710 44925 44662 gene locus_tag LOCUS_10720 44925 44662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 45281 44958 gene locus_tag LOCUS_10730 45281 44958 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940220.1 protein_id gnl|my_center|LOCUS_10730 46867 45512 gene locus_tag LOCUS_10740 gene orpR 46867 45512 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_10740 47096 49030 gene locus_tag LOCUS_10750 47096 49030 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940071.1 protein_id gnl|my_center|LOCUS_10750 50184 49159 gene locus_tag LOCUS_10760 50184 49159 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879345.1 protein_id gnl|my_center|LOCUS_10760 51197 50238 gene locus_tag LOCUS_10770 51197 50238 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021942.1 protein_id gnl|my_center|LOCUS_10770 51734 51249 gene locus_tag LOCUS_10780 gene tsaA 51734 51249 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249662.1 protein_id gnl|my_center|LOCUS_10780 52176 51727 gene locus_tag LOCUS_10790 gene nifU 52176 51727 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877697.1 protein_id gnl|my_center|LOCUS_10790 53032 52280 gene locus_tag LOCUS_10800 53032 52280 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496707.1 protein_id gnl|my_center|LOCUS_10800 53810 53022 gene locus_tag LOCUS_10810 53810 53022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 54637 53807 gene locus_tag LOCUS_10820 54637 53807 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942056.1 protein_id gnl|my_center|LOCUS_10820 55254 54703 gene locus_tag LOCUS_10830 55254 54703 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_10830 56152 55268 gene locus_tag LOCUS_10840 56152 55268 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545247.1 protein_id gnl|my_center|LOCUS_10840 56828 56109 gene locus_tag LOCUS_10850 56828 56109 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024124.1 protein_id gnl|my_center|LOCUS_10850 56830 56920 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 57395 56970 gene locus_tag LOCUS_10860 57395 56970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence16 131 179 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 374 2623 gene locus_tag LOCUS_10870 374 2623 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924872.1 protein_id gnl|my_center|LOCUS_10870 2727 4682 gene locus_tag LOCUS_10880 2727 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 4987 6063 gene locus_tag LOCUS_10890 gene ddlA 4987 6063 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121973253.1 protein_id gnl|my_center|LOCUS_10890 6200 6973 gene locus_tag LOCUS_10900 6200 6973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 7028 8065 gene locus_tag LOCUS_10910 7028 8065 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062349.1 protein_id gnl|my_center|LOCUS_10910 8066 8845 gene locus_tag LOCUS_10920 8066 8845 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880179.1 protein_id gnl|my_center|LOCUS_10920 8854 9600 gene locus_tag LOCUS_10930 8854 9600 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_10930 9619 11025 gene locus_tag LOCUS_10940 9619 11025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 11290 11814 gene locus_tag LOCUS_10950 11290 11814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 11847 12137 gene locus_tag LOCUS_10960 11847 12137 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545694.1 protein_id gnl|my_center|LOCUS_10960 12245 12628 gene locus_tag LOCUS_10970 12245 12628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 12635 13216 gene locus_tag LOCUS_10980 12635 13216 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943181.1 protein_id gnl|my_center|LOCUS_10980 13510 14205 gene locus_tag LOCUS_10990 13510 14205 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_10990 15280 14219 gene locus_tag LOCUS_11000 15280 14219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 16542 15589 gene locus_tag LOCUS_11010 16542 15589 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_11010 17628 16828 gene locus_tag LOCUS_11020 gene fdhD 17628 16828 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069995213.1 protein_id gnl|my_center|LOCUS_11020 19544 17625 gene locus_tag LOCUS_11030 gene selB 19544 17625 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_11030 19805 20233 gene locus_tag LOCUS_11040 gene ruvX 19805 20233 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428279.1 protein_id gnl|my_center|LOCUS_11040 20236 21255 gene locus_tag LOCUS_11050 gene mltG 20236 21255 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545006.1 protein_id gnl|my_center|LOCUS_11050 21352 21798 gene locus_tag LOCUS_11060 gene mraZ 21352 21798 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625480.1 protein_id gnl|my_center|LOCUS_11060 21828 22772 gene locus_tag LOCUS_11070 gene rsmH 21828 22772 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_11070 22773 23096 gene locus_tag LOCUS_11080 22773 23096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 23093 25090 gene locus_tag LOCUS_11090 23093 25090 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_11090 25235 26755 gene locus_tag LOCUS_11100 25235 26755 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943699.1 protein_id gnl|my_center|LOCUS_11100 26752 28212 gene locus_tag LOCUS_11110 26752 28212 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_11110 28235 29314 gene locus_tag LOCUS_11120 gene mraY 28235 29314 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_11120 29523 30869 gene locus_tag LOCUS_11130 gene murD 29523 30869 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_11130 30862 31980 gene locus_tag LOCUS_11140 gene spoVE 30862 31980 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753520.1 protein_id gnl|my_center|LOCUS_11140 32000 33079 gene locus_tag LOCUS_11150 gene murG 32000 33079 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_11150 33286 34710 gene locus_tag LOCUS_11160 gene murC 33286 34710 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_11160 34971 35894 gene locus_tag LOCUS_11170 gene murB 34971 35894 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287058.1 protein_id gnl|my_center|LOCUS_11170 35901 36746 gene locus_tag LOCUS_11180 35901 36746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 36797 38011 gene locus_tag LOCUS_11190 gene ftsA 36797 38011 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_11190 38027 39187 gene locus_tag LOCUS_11200 gene ftsZ 38027 39187 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_11200 40600 39368 gene locus_tag LOCUS_11210 40600 39368 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978370.1 protein_id gnl|my_center|LOCUS_11210 41006 42550 gene locus_tag LOCUS_11220 41006 42550 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_11220 42550 43878 gene locus_tag LOCUS_11230 gene leuC 42550 43878 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393737.1 protein_id gnl|my_center|LOCUS_11230 43875 44369 gene locus_tag LOCUS_11240 gene leuD 43875 44369 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544917.1 protein_id gnl|my_center|LOCUS_11240 44574 44371 gene locus_tag LOCUS_11250 44574 44371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 44758 44958 gene locus_tag LOCUS_11260 44758 44958 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707209.1 protein_id gnl|my_center|LOCUS_11260 45629 45228 gene locus_tag LOCUS_11270 45629 45228 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846721.1 protein_id gnl|my_center|LOCUS_11270 47334 45649 gene locus_tag LOCUS_11280 47334 45649 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_11280 48231 47716 gene locus_tag LOCUS_11290 48231 47716 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143891478.1 protein_id gnl|my_center|LOCUS_11290 48625 48550 gene locus_tag LOCUS_t00140 48625 48550 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 50888 48894 gene locus_tag LOCUS_11300 50888 48894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence17 1907 297 gene locus_tag LOCUS_11310 1907 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 2746 1970 gene locus_tag LOCUS_11320 2746 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 2964 3029 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4876 3173 gene locus_tag LOCUS_11330 4876 3173 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485037.1 protein_id gnl|my_center|LOCUS_11330 7102 4964 gene locus_tag LOCUS_11340 7102 4964 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404209.1 protein_id gnl|my_center|LOCUS_11340 8418 7117 gene locus_tag LOCUS_11350 8418 7117 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021108.1 protein_id gnl|my_center|LOCUS_11350 9422 8742 gene locus_tag LOCUS_11360 9422 8742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 10388 9510 gene locus_tag LOCUS_11370 10388 9510 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462061.1 protein_id gnl|my_center|LOCUS_11370 10637 10912 gene locus_tag LOCUS_11380 10637 10912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 12209 10977 gene locus_tag LOCUS_11390 12209 10977 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227995.1 protein_id gnl|my_center|LOCUS_11390 12708 12241 gene locus_tag LOCUS_11400 12708 12241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 12876 13550 gene locus_tag LOCUS_11410 12876 13550 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462325.1 protein_id gnl|my_center|LOCUS_11410 13547 15208 gene locus_tag LOCUS_11420 13547 15208 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015051728.1 protein_id gnl|my_center|LOCUS_11420 15627 16553 gene locus_tag LOCUS_11430 15627 16553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 16555 17475 gene locus_tag LOCUS_11440 gene ptb 16555 17475 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966357.1 protein_id gnl|my_center|LOCUS_11440 17468 18538 gene locus_tag LOCUS_11450 gene buk 17468 18538 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420702.1 protein_id gnl|my_center|LOCUS_11450 18619 18864 gene locus_tag LOCUS_11460 18619 18864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 18861 19271 gene locus_tag LOCUS_11470 18861 19271 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119983.1 protein_id gnl|my_center|LOCUS_11470 19772 19275 gene locus_tag LOCUS_11480 19772 19275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 21061 19817 gene locus_tag LOCUS_11490 21061 19817 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256967.1 protein_id gnl|my_center|LOCUS_11490 22014 21193 gene locus_tag LOCUS_11500 22014 21193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 22972 22025 gene locus_tag LOCUS_11510 22972 22025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 26119 23006 gene locus_tag LOCUS_11520 26119 23006 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_11520 26769 26242 gene locus_tag LOCUS_11530 26769 26242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 27877 26750 gene locus_tag LOCUS_11540 27877 26750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 29807 28074 gene locus_tag LOCUS_11550 29807 28074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 30736 29786 gene locus_tag LOCUS_11560 30736 29786 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042382595.1 protein_id gnl|my_center|LOCUS_11560 31213 30746 gene locus_tag LOCUS_11570 31213 30746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 31565 31233 gene locus_tag LOCUS_11580 31565 31233 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939281.1 protein_id gnl|my_center|LOCUS_11580 33065 31929 gene locus_tag LOCUS_11590 33065 31929 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545564.1 protein_id gnl|my_center|LOCUS_11590 33874 33122 gene locus_tag LOCUS_11600 33874 33122 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458997.1 protein_id gnl|my_center|LOCUS_11600 34021 34884 gene locus_tag LOCUS_11610 34021 34884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 35101 36306 gene locus_tag LOCUS_11620 gene rpsA 35101 36306 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941857.1 protein_id gnl|my_center|LOCUS_11620 36434 36745 gene locus_tag LOCUS_11630 36434 36745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 37060 37428 gene locus_tag LOCUS_11640 37060 37428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 38431 37544 gene locus_tag LOCUS_11650 38431 37544 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941029.1 protein_id gnl|my_center|LOCUS_11650 38591 39088 gene locus_tag LOCUS_11660 38591 39088 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020686.1 protein_id gnl|my_center|LOCUS_11660 39493 39338 gene locus_tag LOCUS_11670 39493 39338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 41007 39832 gene locus_tag LOCUS_11680 41007 39832 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393313.1 protein_id gnl|my_center|LOCUS_11680 41992 41240 gene locus_tag LOCUS_11690 41992 41240 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223512.1 protein_id gnl|my_center|LOCUS_11690 42984 42220 gene locus_tag LOCUS_11700 42984 42220 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598675.1 protein_id gnl|my_center|LOCUS_11700 44711 43023 gene locus_tag LOCUS_11710 44711 43023 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878783.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence18 1681 170 gene locus_tag LOCUS_11720 gene pabB 1681 170 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941191.1 protein_id gnl|my_center|LOCUS_11720 1811 2041 gene locus_tag LOCUS_11730 1811 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 2574 2104 gene locus_tag LOCUS_11740 gene smpB 2574 2104 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942353.1 protein_id gnl|my_center|LOCUS_11740 3606 2776 gene locus_tag LOCUS_11750 3606 2776 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801071.1 protein_id gnl|my_center|LOCUS_11750 3900 5204 gene locus_tag LOCUS_11760 gene eno 3900 5204 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_11760 5268 6500 gene locus_tag LOCUS_11770 5268 6500 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673537.1 protein_id gnl|my_center|LOCUS_11770 6690 7814 gene locus_tag LOCUS_11780 6690 7814 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941744.1 protein_id gnl|my_center|LOCUS_11780 8002 9225 gene locus_tag LOCUS_11790 8002 9225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 11987 9333 gene locus_tag LOCUS_11800 11987 9333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 13808 12036 gene locus_tag LOCUS_11810 gene ptsP 13808 12036 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_11810 14077 13808 gene locus_tag LOCUS_11820 14077 13808 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933864.1 protein_id gnl|my_center|LOCUS_11820 14742 14074 gene locus_tag LOCUS_11830 14742 14074 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432375.1 protein_id gnl|my_center|LOCUS_11830 15108 15389 gene locus_tag LOCUS_11840 15108 15389 CDS product PxxKW family cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942657.1 protein_id gnl|my_center|LOCUS_11840 15832 15494 gene locus_tag LOCUS_11850 15832 15494 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408375.1 protein_id gnl|my_center|LOCUS_11850 16242 15964 gene locus_tag LOCUS_11860 16242 15964 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_11860 18684 16264 gene locus_tag LOCUS_11870 gene pheT 18684 16264 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_11870 19927 18911 gene locus_tag LOCUS_11880 gene pheS 19927 18911 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_11880 20283 19924 gene locus_tag LOCUS_11890 gene rplT 20283 19924 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393257.1 protein_id gnl|my_center|LOCUS_11890 20581 20384 gene locus_tag LOCUS_11900 gene rpmI 20581 20384 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429729.1 protein_id gnl|my_center|LOCUS_11900 21099 20608 gene locus_tag LOCUS_11910 gene infC 21099 20608 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942163.1 protein_id gnl|my_center|LOCUS_11910 23158 21242 gene locus_tag LOCUS_11920 gene thrS 23158 21242 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360261.1 protein_id gnl|my_center|LOCUS_11920 23334 23260 gene locus_tag LOCUS_t00150 23334 23260 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 23958 23401 gene locus_tag LOCUS_11930 23958 23401 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_11930 24834 23962 gene locus_tag LOCUS_11940 24834 23962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 25457 24819 gene locus_tag LOCUS_11950 25457 24819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 25741 25496 gene locus_tag LOCUS_11960 25741 25496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 26705 25821 gene locus_tag LOCUS_11970 gene rsmI 26705 25821 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941314.1 protein_id gnl|my_center|LOCUS_11970 27324 26941 gene locus_tag LOCUS_11980 27324 26941 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_11980 27963 27331 gene locus_tag LOCUS_11990 27963 27331 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369352.1 protein_id gnl|my_center|LOCUS_11990 28373 28026 gene locus_tag LOCUS_12000 gene rplS 28373 28026 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813207.1 protein_id gnl|my_center|LOCUS_12000 28986 28426 gene locus_tag LOCUS_12010 28986 28426 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941308.1 protein_id gnl|my_center|LOCUS_12010 29733 28999 gene locus_tag LOCUS_12020 gene trmD 29733 28999 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_12020 30242 29739 gene locus_tag LOCUS_12030 gene rimM 30242 29739 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858943.1 protein_id gnl|my_center|LOCUS_12030 30473 30243 gene locus_tag LOCUS_12040 30473 30243 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_12040 30841 30572 gene locus_tag LOCUS_12050 gene rpsP 30841 30572 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357434.1 protein_id gnl|my_center|LOCUS_12050 32238 30898 gene locus_tag LOCUS_12060 gene ffh 32238 30898 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941303.1 protein_id gnl|my_center|LOCUS_12060 32909 32280 gene locus_tag LOCUS_12070 32909 32280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 34586 32919 gene locus_tag LOCUS_12080 gene argS 34586 32919 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869400.1 protein_id gnl|my_center|LOCUS_12080 35383 34619 gene locus_tag LOCUS_12090 35383 34619 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_12090 35550 35804 gene locus_tag LOCUS_12100 35550 35804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 35819 37300 gene locus_tag LOCUS_12110 35819 37300 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706587.1 protein_id gnl|my_center|LOCUS_12110 39017 37305 gene locus_tag LOCUS_12120 39017 37305 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181877.1 protein_id gnl|my_center|LOCUS_12120 39786 39076 gene locus_tag LOCUS_12130 39786 39076 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_12130 40549 39770 gene locus_tag LOCUS_12140 40549 39770 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066879470.1 protein_id gnl|my_center|LOCUS_12140 41532 40546 gene locus_tag LOCUS_12150 41532 40546 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886927.1 protein_id gnl|my_center|LOCUS_12150 42389 41529 gene locus_tag LOCUS_12160 42389 41529 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886926.1 protein_id gnl|my_center|LOCUS_12160 43690 42482 gene locus_tag LOCUS_12170 43690 42482 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480285.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence19 3448 698 gene locus_tag LOCUS_12180 3448 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 4361 3591 gene locus_tag LOCUS_12190 4361 3591 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966947.1 protein_id gnl|my_center|LOCUS_12190 4698 4399 gene locus_tag LOCUS_12200 4698 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 6725 4728 gene locus_tag LOCUS_12210 6725 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 8771 6777 gene locus_tag LOCUS_12220 8771 6777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 9965 8841 gene locus_tag LOCUS_12230 9965 8841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 10860 10003 gene locus_tag LOCUS_12240 gene rfbD 10860 10003 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_12240 11597 10857 gene locus_tag LOCUS_12250 gene truA 11597 10857 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768766.1 protein_id gnl|my_center|LOCUS_12250 12807 11623 gene locus_tag LOCUS_12260 gene pgk 12807 11623 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942273.1 protein_id gnl|my_center|LOCUS_12260 13096 14649 gene locus_tag LOCUS_12270 13096 14649 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392670.1 protein_id gnl|my_center|LOCUS_12270 16504 15050 gene locus_tag LOCUS_12280 gene gltX 16504 15050 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399675.1 protein_id gnl|my_center|LOCUS_12280 16982 16491 gene locus_tag LOCUS_12290 gene ispF 16982 16491 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929316.1 protein_id gnl|my_center|LOCUS_12290 17885 17175 gene locus_tag LOCUS_12300 gene ispD 17885 17175 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_12300 18983 17955 gene locus_tag LOCUS_12310 18983 17955 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942743.1 protein_id gnl|my_center|LOCUS_12310 19621 19115 gene locus_tag LOCUS_12320 19621 19115 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_12320 20872 19724 gene locus_tag LOCUS_12330 20872 19724 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878808.1 protein_id gnl|my_center|LOCUS_12330 21684 21154 gene locus_tag LOCUS_12340 21684 21154 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391683.1 protein_id gnl|my_center|LOCUS_12340 23270 21684 gene locus_tag LOCUS_12350 23270 21684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 23384 23812 gene locus_tag LOCUS_12360 23384 23812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 23785 24438 gene locus_tag LOCUS_12370 23785 24438 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942171.1 protein_id gnl|my_center|LOCUS_12370 24485 25330 gene locus_tag LOCUS_12380 24485 25330 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192107.1 protein_id gnl|my_center|LOCUS_12380 25348 26013 gene locus_tag LOCUS_12390 25348 26013 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878079.1 protein_id gnl|my_center|LOCUS_12390 26051 26626 gene locus_tag LOCUS_12400 26051 26626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 26623 28047 gene locus_tag LOCUS_12410 26623 28047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 28319 28504 gene locus_tag LOCUS_12420 28319 28504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 28542 30074 gene locus_tag LOCUS_12430 gene glgA 28542 30074 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110443.1 protein_id gnl|my_center|LOCUS_12430 30157 30414 gene locus_tag LOCUS_12440 30157 30414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 30430 30612 gene locus_tag LOCUS_12450 30430 30612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 30630 31085 gene locus_tag LOCUS_12460 30630 31085 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496545.1 protein_id gnl|my_center|LOCUS_12460 31212 31733 gene locus_tag LOCUS_12470 31212 31733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 31799 32242 gene locus_tag LOCUS_12480 31799 32242 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258548.1 protein_id gnl|my_center|LOCUS_12480 32316 33245 gene locus_tag LOCUS_12490 32316 33245 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_12490 33258 33875 gene locus_tag LOCUS_12500 33258 33875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 34521 33886 gene locus_tag LOCUS_12510 34521 33886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 35780 34749 gene locus_tag LOCUS_12520 35780 34749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393763.1 protein_id gnl|my_center|LOCUS_12520 37974 35761 gene locus_tag LOCUS_12530 37974 35761 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207707612.1 protein_id gnl|my_center|LOCUS_12530 39516 37999 gene locus_tag LOCUS_12540 39516 37999 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268661.1 protein_id gnl|my_center|LOCUS_12540 41588 39513 gene locus_tag LOCUS_12550 41588 39513 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010349194.1 protein_id gnl|my_center|LOCUS_12550 43108 41801 gene locus_tag LOCUS_12560 gene dinB 43108 41801 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392743.1 protein_id gnl|my_center|LOCUS_12560 43703 43116 gene locus_tag LOCUS_12570 gene lexA 43703 43116 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140711.1 protein_id gnl|my_center|LOCUS_12570 44049 44312 gene locus_tag LOCUS_12580 44049 44312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence20 500 102 gene locus_tag LOCUS_12590 500 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 773 582 gene locus_tag LOCUS_12600 773 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 1067 3382 gene locus_tag LOCUS_12610 1067 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 5663 3423 gene locus_tag LOCUS_12620 5663 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 6095 5694 gene locus_tag LOCUS_12630 6095 5694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 7053 6130 gene locus_tag LOCUS_12640 7053 6130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 9168 7156 gene locus_tag LOCUS_12650 9168 7156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 10262 9252 gene locus_tag LOCUS_12660 10262 9252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 11089 10454 gene locus_tag LOCUS_12670 11089 10454 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387873.1 protein_id gnl|my_center|LOCUS_12670 12270 11200 gene locus_tag LOCUS_12680 12270 11200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 12829 12260 gene locus_tag LOCUS_12690 12829 12260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 13096 13665 gene locus_tag LOCUS_12700 13096 13665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 13662 14720 gene locus_tag LOCUS_12710 13662 14720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 15914 14709 gene locus_tag LOCUS_12720 15914 14709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 17135 15921 gene locus_tag LOCUS_12730 17135 15921 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545964.1 protein_id gnl|my_center|LOCUS_12730 18778 17132 gene locus_tag LOCUS_12740 18778 17132 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546442.1 protein_id gnl|my_center|LOCUS_12740 20405 18816 gene locus_tag LOCUS_12750 gene mshL 20405 18816 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545709.1 protein_id gnl|my_center|LOCUS_12750 20830 20387 gene locus_tag LOCUS_12760 20830 20387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 21372 20827 gene locus_tag LOCUS_12770 21372 20827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 22743 21388 gene locus_tag LOCUS_12780 22743 21388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 23474 22887 gene locus_tag LOCUS_12790 23474 22887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 24102 23884 gene locus_tag LOCUS_12800 24102 23884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 24428 24147 gene locus_tag LOCUS_12810 24428 24147 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379963.1 protein_id gnl|my_center|LOCUS_12810 24783 24433 gene locus_tag LOCUS_12820 24783 24433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 25339 25956 gene locus_tag LOCUS_12830 25339 25956 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022582.1 protein_id gnl|my_center|LOCUS_12830 25937 26386 gene locus_tag LOCUS_12840 25937 26386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229779.1 protein_id gnl|my_center|LOCUS_12840 26805 27869 gene locus_tag LOCUS_12850 26805 27869 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368910.1 protein_id gnl|my_center|LOCUS_12850 27926 28132 gene locus_tag LOCUS_12860 27926 28132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 28129 28278 gene locus_tag LOCUS_12870 28129 28278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 28533 29186 gene locus_tag LOCUS_12880 28533 29186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 29291 30946 gene locus_tag LOCUS_12890 29291 30946 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533256.1 protein_id gnl|my_center|LOCUS_12890 30981 38792 gene locus_tag LOCUS_12900 gene cdiA 30981 38792 CDS product contact-dependent inhibition toxin CdiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213819.1 protein_id gnl|my_center|LOCUS_12900 38767 39657 gene locus_tag LOCUS_12910 38767 39657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 39681 40517 gene locus_tag LOCUS_12920 39681 40517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 41159 40965 gene locus_tag LOCUS_12930 41159 40965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 41829 42566 gene locus_tag LOCUS_12940 41829 42566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence21 89 637 gene locus_tag LOCUS_12950 89 637 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941232.1 protein_id gnl|my_center|LOCUS_12950 873 1229 gene locus_tag LOCUS_12960 873 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 1226 1570 gene locus_tag LOCUS_12970 1226 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1876 1589 gene locus_tag LOCUS_12980 1876 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 2154 1873 gene locus_tag LOCUS_12990 2154 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 2248 2072 gene locus_tag LOCUS_13000 2248 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 3105 2245 gene locus_tag LOCUS_13010 3105 2245 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941438.1 protein_id gnl|my_center|LOCUS_13010 3665 3102 gene locus_tag LOCUS_13020 3665 3102 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877643.1 protein_id gnl|my_center|LOCUS_13020 4288 3683 gene locus_tag LOCUS_13030 4288 3683 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391021.1 protein_id gnl|my_center|LOCUS_13030 4461 4928 gene locus_tag LOCUS_13040 4461 4928 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_13040 7078 5000 gene locus_tag LOCUS_13050 7078 5000 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064349.1 protein_id gnl|my_center|LOCUS_13050 8089 7283 gene locus_tag LOCUS_13060 8089 7283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 8702 8241 gene locus_tag LOCUS_13070 8702 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 11401 9125 gene locus_tag LOCUS_13080 11401 9125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 12149 11409 gene locus_tag LOCUS_13090 12149 11409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 13765 12383 gene locus_tag LOCUS_13100 13765 12383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 14613 14359 gene locus_tag LOCUS_13110 14613 14359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 14906 15181 gene locus_tag LOCUS_13120 14906 15181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 15238 15468 gene locus_tag LOCUS_13130 15238 15468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 15779 15546 gene locus_tag LOCUS_13140 15779 15546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 15970 15752 gene locus_tag LOCUS_13150 15970 15752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 16993 16049 gene locus_tag LOCUS_13160 16993 16049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 17930 17067 gene locus_tag LOCUS_13170 17930 17067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 18931 17927 gene locus_tag LOCUS_13180 18931 17927 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545259.1 protein_id gnl|my_center|LOCUS_13180 19471 18959 gene locus_tag LOCUS_13190 19471 18959 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065175.1 protein_id gnl|my_center|LOCUS_13190 19749 19468 gene locus_tag LOCUS_13200 19749 19468 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877185.1 protein_id gnl|my_center|LOCUS_13200 21418 19799 gene locus_tag LOCUS_13210 gene muiA 21418 19799 CDS product mucoidy inhibitor MuiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114297.1 protein_id gnl|my_center|LOCUS_13210 22675 21560 gene locus_tag LOCUS_13220 22675 21560 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127133531.1 protein_id gnl|my_center|LOCUS_13220 23121 22672 gene locus_tag LOCUS_13230 23121 22672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 23053 23562 gene locus_tag LOCUS_13240 23053 23562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 24440 23535 gene locus_tag LOCUS_13250 24440 23535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 24956 24552 gene locus_tag LOCUS_13260 24956 24552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 25834 25103 gene locus_tag LOCUS_13270 25834 25103 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023861.1 protein_id gnl|my_center|LOCUS_13270 26703 25867 gene locus_tag LOCUS_13280 26703 25867 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_13280 26909 28336 gene locus_tag LOCUS_13290 26909 28336 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546372.1 protein_id gnl|my_center|LOCUS_13290 28903 28601 gene locus_tag LOCUS_13300 28903 28601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 30084 29779 gene locus_tag LOCUS_13310 30084 29779 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_13310 31469 30456 gene locus_tag LOCUS_13320 gene amrS 31469 30456 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942373.1 protein_id gnl|my_center|LOCUS_13320 31733 31542 gene locus_tag LOCUS_13330 31733 31542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 32155 31835 gene locus_tag LOCUS_13340 32155 31835 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061058.1 protein_id gnl|my_center|LOCUS_13340 32701 32156 gene locus_tag LOCUS_13350 32701 32156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 33084 34331 gene locus_tag LOCUS_13360 33084 34331 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888868.1 protein_id gnl|my_center|LOCUS_13360 34579 39879 gene locus_tag LOCUS_13370 gene uvrA 34579 39879 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039164.1 protein_id gnl|my_center|LOCUS_13370 40502 41314 gene locus_tag LOCUS_13380 40502 41314 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228241.1 protein_id gnl|my_center|LOCUS_13380 41504 42427 gene locus_tag LOCUS_13390 41504 42427 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963695.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence22 1480 185 gene locus_tag LOCUS_13400 1480 185 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724359.1 protein_id gnl|my_center|LOCUS_13400 1980 3329 gene locus_tag LOCUS_13410 1980 3329 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868207.1 protein_id gnl|my_center|LOCUS_13410 3352 4125 gene locus_tag LOCUS_13420 3352 4125 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061316.1 protein_id gnl|my_center|LOCUS_13420 4460 5743 gene locus_tag LOCUS_13430 gene thiC 4460 5743 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941266.1 protein_id gnl|my_center|LOCUS_13430 5745 6554 gene locus_tag LOCUS_13440 gene paaG 5745 6554 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206400.1 protein_id gnl|my_center|LOCUS_13440 6579 6800 gene locus_tag LOCUS_13450 6579 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 6802 7248 gene locus_tag LOCUS_13460 6802 7248 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393392.1 protein_id gnl|my_center|LOCUS_13460 7270 7578 gene locus_tag LOCUS_13470 7270 7578 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207800.1 protein_id gnl|my_center|LOCUS_13470 10395 7648 gene locus_tag LOCUS_13480 10395 7648 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942970.1 protein_id gnl|my_center|LOCUS_13480 10567 11364 gene locus_tag LOCUS_13490 10567 11364 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942917.1 protein_id gnl|my_center|LOCUS_13490 11380 11643 gene locus_tag LOCUS_13500 11380 11643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 12656 11679 gene locus_tag LOCUS_13510 12656 11679 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937980.1 protein_id gnl|my_center|LOCUS_13510 13139 14710 gene locus_tag LOCUS_13520 gene cimA 13139 14710 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583555.1 protein_id gnl|my_center|LOCUS_13520 14864 16123 gene locus_tag LOCUS_13530 gene leuC 14864 16123 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393737.1 protein_id gnl|my_center|LOCUS_13530 16210 16710 gene locus_tag LOCUS_13540 gene leuD 16210 16710 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544917.1 protein_id gnl|my_center|LOCUS_13540 16775 17905 gene locus_tag LOCUS_13550 16775 17905 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_13550 18183 18791 gene locus_tag LOCUS_13560 18183 18791 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_13560 18807 20612 gene locus_tag LOCUS_13570 18807 20612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 21605 20787 gene locus_tag LOCUS_13580 gene proC 21605 20787 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_13580 22228 22530 gene locus_tag LOCUS_13590 22228 22530 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545961.1 protein_id gnl|my_center|LOCUS_13590 22563 22865 gene locus_tag LOCUS_13600 22563 22865 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914001.1 protein_id gnl|my_center|LOCUS_13600 22929 24518 gene locus_tag LOCUS_13610 gene murJ 22929 24518 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_13610 26001 26158 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26326 26350 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26398 26474 gene locus_tag LOCUS_t00160 26398 26474 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 26740 26597 gene locus_tag LOCUS_13620 26740 26597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 27387 26779 gene locus_tag LOCUS_13630 27387 26779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 28432 27623 gene locus_tag LOCUS_13640 28432 27623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 28860 30125 gene locus_tag LOCUS_13650 28860 30125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 30162 32264 gene locus_tag LOCUS_13660 30162 32264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 33477 32425 gene locus_tag LOCUS_13670 33477 32425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 34289 33765 gene locus_tag LOCUS_13680 34289 33765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 34691 35704 gene locus_tag LOCUS_13690 gene msrB 34691 35704 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261262.1 protein_id gnl|my_center|LOCUS_13690 36021 37322 gene locus_tag LOCUS_13700 36021 37322 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861638.1 protein_id gnl|my_center|LOCUS_13700 37348 38313 gene locus_tag LOCUS_13710 37348 38313 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878701.1 protein_id gnl|my_center|LOCUS_13710 38335 39357 gene locus_tag LOCUS_13720 38335 39357 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815913.1 protein_id gnl|my_center|LOCUS_13720 39576 40499 gene locus_tag LOCUS_13730 39576 40499 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878705.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence23 546 1628 gene locus_tag LOCUS_13740 546 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1625 2056 gene locus_tag LOCUS_13750 1625 2056 CDS product protease inhibitor I42 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085581.1 protein_id gnl|my_center|LOCUS_13750 2163 4328 gene locus_tag LOCUS_13760 2163 4328 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921515.1 protein_id gnl|my_center|LOCUS_13760 5416 4241 gene locus_tag LOCUS_13770 gene ahbD 5416 4241 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_13770 6447 5524 gene locus_tag LOCUS_13780 6447 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 6841 7113 gene locus_tag LOCUS_13790 gene hupB 6841 7113 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081127.1 protein_id gnl|my_center|LOCUS_13790 7344 8336 gene locus_tag LOCUS_13800 gene trpS 7344 8336 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942477.1 protein_id gnl|my_center|LOCUS_13800 8424 9170 gene locus_tag LOCUS_13810 8424 9170 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_13810 9145 9666 gene locus_tag LOCUS_13820 gene scpB 9145 9666 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942475.1 protein_id gnl|my_center|LOCUS_13820 9683 10411 gene locus_tag LOCUS_13830 9683 10411 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_13830 10707 10982 gene locus_tag LOCUS_13840 10707 10982 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_13840 11100 11951 gene locus_tag LOCUS_13850 11100 11951 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_13850 12014 13000 gene locus_tag LOCUS_13860 12014 13000 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943615.1 protein_id gnl|my_center|LOCUS_13860 12991 13746 gene locus_tag LOCUS_13870 12991 13746 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943614.1 protein_id gnl|my_center|LOCUS_13870 13749 14573 gene locus_tag LOCUS_13880 13749 14573 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_13880 14605 15318 gene locus_tag LOCUS_13890 14605 15318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 15329 15853 gene locus_tag LOCUS_13900 15329 15853 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258358.1 protein_id gnl|my_center|LOCUS_13900 15945 16565 gene locus_tag LOCUS_13910 15945 16565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 16555 17895 gene locus_tag LOCUS_13920 16555 17895 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940356.1 protein_id gnl|my_center|LOCUS_13920 18078 19397 gene locus_tag LOCUS_13930 18078 19397 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545993.1 protein_id gnl|my_center|LOCUS_13930 19558 20661 gene locus_tag LOCUS_13940 19558 20661 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172437.1 protein_id gnl|my_center|LOCUS_13940 20648 23800 gene locus_tag LOCUS_13950 20648 23800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 23797 24087 gene locus_tag LOCUS_13960 23797 24087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 24424 24260 gene locus_tag LOCUS_13970 24424 24260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 25209 24442 gene locus_tag LOCUS_13980 gene folE2 25209 24442 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_13980 26029 25391 gene locus_tag LOCUS_13990 26029 25391 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546220.1 protein_id gnl|my_center|LOCUS_13990 27546 26026 gene locus_tag LOCUS_14000 27546 26026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 27777 28718 gene locus_tag LOCUS_14010 27777 28718 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546752.1 protein_id gnl|my_center|LOCUS_14010 29803 28751 gene locus_tag LOCUS_14020 29803 28751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939277.1 protein_id gnl|my_center|LOCUS_14020 30893 29853 gene locus_tag LOCUS_14030 30893 29853 CDS product phosphotransacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938731.1 protein_id gnl|my_center|LOCUS_14030 33130 30998 gene locus_tag LOCUS_14040 33130 30998 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545569.1 protein_id gnl|my_center|LOCUS_14040 35010 33136 gene locus_tag LOCUS_14050 35010 33136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 35783 35100 gene locus_tag LOCUS_14060 35783 35100 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792434.1 protein_id gnl|my_center|LOCUS_14060 36802 35936 gene locus_tag LOCUS_14070 36802 35936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 37797 36799 gene locus_tag LOCUS_14080 37797 36799 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625202.1 protein_id gnl|my_center|LOCUS_14080 37912 38619 gene locus_tag LOCUS_14090 37912 38619 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583967.1 protein_id gnl|my_center|LOCUS_14090 38749 39453 gene locus_tag LOCUS_14100 38749 39453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 >Feature sequence24 215 964 gene locus_tag LOCUS_14110 215 964 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_14110 1156 1635 gene locus_tag LOCUS_14120 gene ruvC 1156 1635 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393204.1 protein_id gnl|my_center|LOCUS_14120 1646 2254 gene locus_tag LOCUS_14130 gene ruvA 1646 2254 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_14130 2362 3378 gene locus_tag LOCUS_14140 gene ruvB 2362 3378 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_14140 3493 4008 gene locus_tag LOCUS_14150 3493 4008 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_14150 4370 5299 gene locus_tag LOCUS_14160 gene lpxC 4370 5299 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_14160 5487 6053 gene locus_tag LOCUS_14170 5487 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 6168 8366 gene locus_tag LOCUS_14180 6168 8366 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_14180 8536 9900 gene locus_tag LOCUS_14190 8536 9900 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941477.1 protein_id gnl|my_center|LOCUS_14190 10958 9984 gene locus_tag LOCUS_14200 10958 9984 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049979583.1 protein_id gnl|my_center|LOCUS_14200 11969 10983 gene locus_tag LOCUS_14210 11969 10983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 12449 12045 gene locus_tag LOCUS_14220 12449 12045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 15007 12530 gene locus_tag LOCUS_14230 15007 12530 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_14230 15896 15147 gene locus_tag LOCUS_14240 15896 15147 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545867.1 protein_id gnl|my_center|LOCUS_14240 16793 16002 gene locus_tag LOCUS_14250 16793 16002 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104295.1 protein_id gnl|my_center|LOCUS_14250 16972 19785 gene locus_tag LOCUS_14260 16972 19785 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392406.1 protein_id gnl|my_center|LOCUS_14260 20778 20059 gene locus_tag LOCUS_14270 20778 20059 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121009277.1 protein_id gnl|my_center|LOCUS_14270 21094 22449 gene locus_tag LOCUS_14280 21094 22449 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015878.1 protein_id gnl|my_center|LOCUS_14280 22703 24106 gene locus_tag LOCUS_14290 22703 24106 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141197.1 protein_id gnl|my_center|LOCUS_14290 24122 25126 gene locus_tag LOCUS_14300 gene cydB 24122 25126 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141196.1 protein_id gnl|my_center|LOCUS_14300 25130 25840 gene locus_tag LOCUS_14310 25130 25840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 27223 25814 gene locus_tag LOCUS_14320 gene purF 27223 25814 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878374.1 protein_id gnl|my_center|LOCUS_14320 30515 27312 gene locus_tag LOCUS_14330 gene carB 30515 27312 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_14330 30893 31129 gene locus_tag LOCUS_14340 30893 31129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 32706 31147 gene locus_tag LOCUS_14350 32706 31147 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_14350 33535 32693 gene locus_tag LOCUS_14360 33535 32693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 35082 33796 gene locus_tag LOCUS_14370 35082 33796 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461177.1 protein_id gnl|my_center|LOCUS_14370 35995 35066 gene locus_tag LOCUS_14380 35995 35066 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770435.1 protein_id gnl|my_center|LOCUS_14380 37331 36048 gene locus_tag LOCUS_14390 37331 36048 CDS product purine/pyrimidine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164691339.1 protein_id gnl|my_center|LOCUS_14390 37614 38372 gene locus_tag LOCUS_14400 37614 38372 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921271.1 protein_id gnl|my_center|LOCUS_14400 39741 38437 gene locus_tag LOCUS_14410 39741 38437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 >Feature sequence25 3082 1280 gene locus_tag LOCUS_14420 3082 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 3353 3697 gene locus_tag LOCUS_14430 3353 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 3780 4829 gene locus_tag LOCUS_14440 3780 4829 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879736.1 protein_id gnl|my_center|LOCUS_14440 4841 5080 gene locus_tag LOCUS_14450 4841 5080 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080561.1 protein_id gnl|my_center|LOCUS_14450 5134 5871 gene locus_tag LOCUS_14460 5134 5871 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027251.1 protein_id gnl|my_center|LOCUS_14460 6440 5853 gene locus_tag LOCUS_14470 gene sigZ 6440 5853 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120749.1 protein_id gnl|my_center|LOCUS_14470 7016 6474 gene locus_tag LOCUS_14480 7016 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 7414 7091 gene locus_tag LOCUS_14490 7414 7091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 8272 7556 gene locus_tag LOCUS_14500 8272 7556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 8726 8445 gene locus_tag LOCUS_14510 8726 8445 CDS product HgcAB-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877983.1 protein_id gnl|my_center|LOCUS_14510 9073 9423 gene locus_tag LOCUS_14520 9073 9423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 10806 9433 gene locus_tag LOCUS_14530 10806 9433 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_14530 12515 10803 gene locus_tag LOCUS_14540 12515 10803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 12752 13282 gene locus_tag LOCUS_14550 12752 13282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 13528 14226 gene locus_tag LOCUS_14560 13528 14226 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523242.1 protein_id gnl|my_center|LOCUS_14560 14226 15464 gene locus_tag LOCUS_14570 14226 15464 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119805.1 protein_id gnl|my_center|LOCUS_14570 15517 16251 gene locus_tag LOCUS_14580 15517 16251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 16257 17567 gene locus_tag LOCUS_14590 16257 17567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 17754 17954 gene locus_tag LOCUS_14600 17754 17954 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 protein_id gnl|my_center|LOCUS_14600 19234 18062 gene locus_tag LOCUS_14610 19234 18062 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894393.1 protein_id gnl|my_center|LOCUS_14610 21385 19388 gene locus_tag LOCUS_14620 gene fadJ 21385 19388 CDS product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072985.1 protein_id gnl|my_center|LOCUS_14620 22679 21459 gene locus_tag LOCUS_14630 22679 21459 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047982.1 protein_id gnl|my_center|LOCUS_14630 23095 23145 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23443 24003 gene locus_tag LOCUS_14640 23443 24003 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024403.1 protein_id gnl|my_center|LOCUS_14640 24241 26250 gene locus_tag LOCUS_14650 24241 26250 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966093.1 protein_id gnl|my_center|LOCUS_14650 26530 27615 gene locus_tag LOCUS_14660 26530 27615 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546390.1 protein_id gnl|my_center|LOCUS_14660 27628 28290 gene locus_tag LOCUS_14670 27628 28290 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729362.1 protein_id gnl|my_center|LOCUS_14670 28580 28810 gene locus_tag LOCUS_14680 28580 28810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 29332 30624 gene locus_tag LOCUS_14690 29332 30624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 30755 31171 gene locus_tag LOCUS_14700 30755 31171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 31590 33326 gene locus_tag LOCUS_14710 31590 33326 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_14710 33459 34031 gene locus_tag LOCUS_14720 33459 34031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 34275 34033 gene locus_tag LOCUS_14730 34275 34033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 34418 35293 gene locus_tag LOCUS_14740 34418 35293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 35436 35750 gene locus_tag LOCUS_14750 35436 35750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 36057 38363 gene locus_tag LOCUS_14760 36057 38363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 38625 39527 gene locus_tag LOCUS_14770 38625 39527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 >Feature sequence26 356 63 gene locus_tag LOCUS_14780 356 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 618 1277 gene locus_tag LOCUS_14790 618 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 1267 2649 gene locus_tag LOCUS_14800 1267 2649 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268044.1 protein_id gnl|my_center|LOCUS_14800 2624 4723 gene locus_tag LOCUS_14810 2624 4723 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082901051.1 protein_id gnl|my_center|LOCUS_14810 4723 6114 gene locus_tag LOCUS_14820 4723 6114 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966765.1 protein_id gnl|my_center|LOCUS_14820 6231 6860 gene locus_tag LOCUS_14830 6231 6860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 7081 9171 gene locus_tag LOCUS_14840 7081 9171 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_14840 9495 9214 gene locus_tag LOCUS_14850 9495 9214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 9907 9584 gene locus_tag LOCUS_14860 9907 9584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 10837 9929 gene locus_tag LOCUS_14870 10837 9929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 11377 12495 gene locus_tag LOCUS_14880 11377 12495 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_14880 13511 12942 gene locus_tag LOCUS_14890 13511 12942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 13937 14296 gene locus_tag LOCUS_14900 13937 14296 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097692.1 protein_id gnl|my_center|LOCUS_14900 14301 14639 gene locus_tag LOCUS_14910 14301 14639 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388650.1 protein_id gnl|my_center|LOCUS_14910 16294 14897 gene locus_tag LOCUS_14920 16294 14897 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016159.1 protein_id gnl|my_center|LOCUS_14920 17183 16719 gene locus_tag LOCUS_14930 17183 16719 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068725.1 protein_id gnl|my_center|LOCUS_14930 17956 17180 gene locus_tag LOCUS_14940 17956 17180 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941114.1 protein_id gnl|my_center|LOCUS_14940 18916 17957 gene locus_tag LOCUS_14950 gene prmA 18916 17957 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941115.1 protein_id gnl|my_center|LOCUS_14950 19144 19800 gene locus_tag LOCUS_14960 19144 19800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 19797 20615 gene locus_tag LOCUS_14970 gene ccsB 19797 20615 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_14970 20620 21891 gene locus_tag LOCUS_14980 gene hemA 20620 21891 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_14980 21955 22872 gene locus_tag LOCUS_14990 gene hemC 21955 22872 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_14990 22850 22999 gene locus_tag LOCUS_15000 22850 22999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 23007 24551 gene locus_tag LOCUS_15010 gene cobA 23007 24551 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943897.1 protein_id gnl|my_center|LOCUS_15010 24554 24742 gene locus_tag LOCUS_15020 24554 24742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 24739 25182 gene locus_tag LOCUS_15030 24739 25182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 25196 26374 gene locus_tag LOCUS_15040 gene ahbC 25196 26374 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022974.1 protein_id gnl|my_center|LOCUS_15040 26406 26795 gene locus_tag LOCUS_15050 26406 26795 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_15050 26861 27838 gene locus_tag LOCUS_15060 gene hemB 26861 27838 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940811.1 protein_id gnl|my_center|LOCUS_15060 28113 29219 gene locus_tag LOCUS_15070 gene ahbD 28113 29219 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938155.1 protein_id gnl|my_center|LOCUS_15070 29320 29766 gene locus_tag LOCUS_15080 29320 29766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 29909 29974 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30076 32757 gene locus_tag LOCUS_15090 gene polA 30076 32757 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_15090 33720 32764 gene locus_tag LOCUS_15100 33720 32764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 34062 33733 gene locus_tag LOCUS_15110 34062 33733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 34373 35173 gene locus_tag LOCUS_15120 34373 35173 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941678.1 protein_id gnl|my_center|LOCUS_15120 35507 36661 gene locus_tag LOCUS_15130 35507 36661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 36744 38198 gene locus_tag LOCUS_15140 36744 38198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence27 3 197 gene locus_tag LOCUS_15150 3 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 975 361 gene locus_tag LOCUS_15160 975 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 1355 975 gene locus_tag LOCUS_15170 1355 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 2083 1733 gene locus_tag LOCUS_15180 2083 1733 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546363.1 protein_id gnl|my_center|LOCUS_15180 2366 2076 gene locus_tag LOCUS_15190 2366 2076 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020159.1 protein_id gnl|my_center|LOCUS_15190 3106 2525 gene locus_tag LOCUS_15200 3106 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 3963 3106 gene locus_tag LOCUS_15210 3963 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 4381 4962 gene locus_tag LOCUS_15220 4381 4962 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943336.1 protein_id gnl|my_center|LOCUS_15220 4998 6203 gene locus_tag LOCUS_15230 4998 6203 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545408.1 protein_id gnl|my_center|LOCUS_15230 6216 9437 gene locus_tag LOCUS_15240 6216 9437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 6931 7080 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9439 10845 gene locus_tag LOCUS_15250 9439 10845 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855661.1 protein_id gnl|my_center|LOCUS_15250 11028 11795 gene locus_tag LOCUS_15260 11028 11795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 12114 11800 gene locus_tag LOCUS_15270 12114 11800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 12501 12283 gene locus_tag LOCUS_15280 12501 12283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 12639 13223 gene locus_tag LOCUS_15290 12639 13223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 13310 13540 gene locus_tag LOCUS_15300 13310 13540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 13578 16721 gene locus_tag LOCUS_15310 13578 16721 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545943.1 protein_id gnl|my_center|LOCUS_15310 16848 17948 gene locus_tag LOCUS_15320 16848 17948 CDS product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263137.1 protein_id gnl|my_center|LOCUS_15320 18528 18199 gene locus_tag LOCUS_15330 18528 18199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 18776 19903 gene locus_tag LOCUS_15340 18776 19903 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_15340 20664 19936 gene locus_tag LOCUS_15350 20664 19936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 21878 20661 gene locus_tag LOCUS_15360 21878 20661 CDS product DUF2157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022044.1 protein_id gnl|my_center|LOCUS_15360 22544 21966 gene locus_tag LOCUS_15370 22544 21966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 22769 23383 gene locus_tag LOCUS_15380 22769 23383 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880618.1 protein_id gnl|my_center|LOCUS_15380 24656 23445 gene locus_tag LOCUS_15390 24656 23445 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024286.1 protein_id gnl|my_center|LOCUS_15390 25399 24644 gene locus_tag LOCUS_15400 25399 24644 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938321.1 protein_id gnl|my_center|LOCUS_15400 28300 26048 gene locus_tag LOCUS_15410 gene feoB 28300 26048 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868183.1 protein_id gnl|my_center|LOCUS_15410 28988 28326 gene locus_tag LOCUS_15420 28988 28326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 28926 29198 gene locus_tag LOCUS_15430 28926 29198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 30480 29320 gene locus_tag LOCUS_15440 30480 29320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 31383 30691 gene locus_tag LOCUS_15450 31383 30691 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_15450 32239 31406 gene locus_tag LOCUS_15460 32239 31406 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002078886.1 protein_id gnl|my_center|LOCUS_15460 32643 33365 gene locus_tag LOCUS_15470 32643 33365 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227903.1 protein_id gnl|my_center|LOCUS_15470 33416 33616 gene locus_tag LOCUS_15480 33416 33616 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_15480 33629 33844 gene locus_tag LOCUS_15490 33629 33844 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022122.1 protein_id gnl|my_center|LOCUS_15490 34734 33928 gene locus_tag LOCUS_15500 34734 33928 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087972.1 protein_id gnl|my_center|LOCUS_15500 36541 34982 gene locus_tag LOCUS_15510 36541 34982 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932252.1 protein_id gnl|my_center|LOCUS_15510 36685 37521 gene locus_tag LOCUS_15520 36685 37521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 >Feature sequence28 3057 2092 gene locus_tag LOCUS_15530 gene selD 3057 2092 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_15530 3409 3191 gene locus_tag LOCUS_15540 3409 3191 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392950.1 protein_id gnl|my_center|LOCUS_15540 4304 3396 gene locus_tag LOCUS_15550 4304 3396 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392951.1 protein_id gnl|my_center|LOCUS_15550 4842 4306 gene locus_tag LOCUS_15560 4842 4306 CDS product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545577.1 protein_id gnl|my_center|LOCUS_15560 5938 4859 gene locus_tag LOCUS_15570 gene yedE 5938 4859 CDS product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545330.1 protein_id gnl|my_center|LOCUS_15570 5937 6146 gene locus_tag LOCUS_15580 5937 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 6128 7081 gene locus_tag LOCUS_15590 6128 7081 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813638.1 protein_id gnl|my_center|LOCUS_15590 7088 8479 gene locus_tag LOCUS_15600 gene thrC 7088 8479 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_15600 9475 8645 gene locus_tag LOCUS_15610 9475 8645 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382474.1 protein_id gnl|my_center|LOCUS_15610 11148 9493 gene locus_tag LOCUS_15620 11148 9493 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_15620 11821 11186 gene locus_tag LOCUS_15630 11821 11186 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390489.1 protein_id gnl|my_center|LOCUS_15630 12306 13091 gene locus_tag LOCUS_15640 gene xth 12306 13091 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878084.1 protein_id gnl|my_center|LOCUS_15640 13160 13861 gene locus_tag LOCUS_15650 13160 13861 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942636.1 protein_id gnl|my_center|LOCUS_15650 13881 15668 gene locus_tag LOCUS_15660 13881 15668 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480577.1 protein_id gnl|my_center|LOCUS_15660 16218 15886 gene locus_tag LOCUS_15670 16218 15886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 16515 16898 gene locus_tag LOCUS_15680 16515 16898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 17876 16914 gene locus_tag LOCUS_15690 17876 16914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 17939 18067 gene locus_tag LOCUS_15700 17939 18067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 18054 18542 gene locus_tag LOCUS_15710 gene nuoE 18054 18542 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582933.1 protein_id gnl|my_center|LOCUS_15710 18523 20376 gene locus_tag LOCUS_15720 18523 20376 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986412.1 protein_id gnl|my_center|LOCUS_15720 20388 21077 gene locus_tag LOCUS_15730 20388 21077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 22763 21174 gene locus_tag LOCUS_15740 22763 21174 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080443.1 protein_id gnl|my_center|LOCUS_15740 23811 22843 gene locus_tag LOCUS_15750 23811 22843 CDS product NrpR regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546211.1 protein_id gnl|my_center|LOCUS_15750 24050 25015 gene locus_tag LOCUS_15760 gene guaA 24050 25015 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877764.1 protein_id gnl|my_center|LOCUS_15760 25768 25019 gene locus_tag LOCUS_15770 25768 25019 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967135.1 protein_id gnl|my_center|LOCUS_15770 26755 26105 gene locus_tag LOCUS_15780 26755 26105 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070923.1 protein_id gnl|my_center|LOCUS_15780 27118 27756 gene locus_tag LOCUS_15790 27118 27756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 27855 28622 gene locus_tag LOCUS_15800 27855 28622 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102518.1 protein_id gnl|my_center|LOCUS_15800 28894 30111 gene locus_tag LOCUS_15810 28894 30111 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047982.1 protein_id gnl|my_center|LOCUS_15810 30126 31274 gene locus_tag LOCUS_15820 30126 31274 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245114.1 protein_id gnl|my_center|LOCUS_15820 31366 33033 gene locus_tag LOCUS_15830 31366 33033 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879349.1 protein_id gnl|my_center|LOCUS_15830 33073 34257 gene locus_tag LOCUS_15840 33073 34257 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461380.1 protein_id gnl|my_center|LOCUS_15840 34445 35326 gene locus_tag LOCUS_15850 34445 35326 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_15850 35328 37055 gene locus_tag LOCUS_15860 gene recN 35328 37055 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_15860 37055 37513 gene locus_tag LOCUS_15870 37055 37513 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546022.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence29 778 990 gene locus_tag LOCUS_15880 778 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 1191 1033 gene locus_tag LOCUS_15890 1191 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 1344 2531 gene locus_tag LOCUS_15900 1344 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 4199 2952 gene locus_tag LOCUS_15910 4199 2952 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_15910 4473 5378 gene locus_tag LOCUS_15920 gene nadA 4473 5378 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940699.1 protein_id gnl|my_center|LOCUS_15920 5859 5590 gene locus_tag LOCUS_15930 5859 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 5773 9123 gene locus_tag LOCUS_15940 gene mfd 5773 9123 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_15940 9330 10316 gene locus_tag LOCUS_15950 9330 10316 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940694.1 protein_id gnl|my_center|LOCUS_15950 10363 11319 gene locus_tag LOCUS_15960 10363 11319 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892066.1 protein_id gnl|my_center|LOCUS_15960 11323 14133 gene locus_tag LOCUS_15970 gene uvrA 11323 14133 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943938.1 protein_id gnl|my_center|LOCUS_15970 14539 14273 gene locus_tag LOCUS_15980 14539 14273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 15460 14789 gene locus_tag LOCUS_15990 gene nadD 15460 14789 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841927.1 protein_id gnl|my_center|LOCUS_15990 16713 15457 gene locus_tag LOCUS_16000 16713 15457 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943829.1 protein_id gnl|my_center|LOCUS_16000 16902 17978 gene locus_tag LOCUS_16010 16902 17978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_16010 17981 18943 gene locus_tag LOCUS_16020 17981 18943 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_16020 18953 19180 gene locus_tag LOCUS_16030 18953 19180 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941743.1 protein_id gnl|my_center|LOCUS_16030 19426 20613 gene locus_tag LOCUS_16040 19426 20613 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118830450.1 protein_id gnl|my_center|LOCUS_16040 21441 20815 gene locus_tag LOCUS_16050 21441 20815 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530159.1 protein_id gnl|my_center|LOCUS_16050 22332 21865 gene locus_tag LOCUS_16060 22332 21865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 22687 23265 gene locus_tag LOCUS_16070 22687 23265 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397458.1 protein_id gnl|my_center|LOCUS_16070 23507 24859 gene locus_tag LOCUS_16080 23507 24859 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767086.1 protein_id gnl|my_center|LOCUS_16080 24863 26152 gene locus_tag LOCUS_16090 24863 26152 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_16090 26149 26874 gene locus_tag LOCUS_16100 26149 26874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 27158 28165 gene locus_tag LOCUS_16110 27158 28165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 28822 30354 gene locus_tag LOCUS_16120 28822 30354 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201994.1 protein_id gnl|my_center|LOCUS_16120 30351 31409 gene locus_tag LOCUS_16130 30351 31409 CDS product DUF4922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784241.1 protein_id gnl|my_center|LOCUS_16130 31406 33469 gene locus_tag LOCUS_16140 gene ligA 31406 33469 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_16140 33613 33912 gene locus_tag LOCUS_16150 33613 33912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 33870 34547 gene locus_tag LOCUS_16160 33870 34547 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890562.1 protein_id gnl|my_center|LOCUS_16160 34871 35791 gene locus_tag LOCUS_16170 34871 35791 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257492.1 protein_id gnl|my_center|LOCUS_16170 36277 36621 gene locus_tag LOCUS_16180 36277 36621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence30 698 264 gene locus_tag LOCUS_16190 698 264 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390712.1 protein_id gnl|my_center|LOCUS_16190 1945 758 gene locus_tag LOCUS_16200 1945 758 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_16200 2859 1942 gene locus_tag LOCUS_16210 2859 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 3387 2887 gene locus_tag LOCUS_16220 3387 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 5001 3427 gene locus_tag LOCUS_16230 5001 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 5304 5044 gene locus_tag LOCUS_16240 5304 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 5633 5352 gene locus_tag LOCUS_16250 5633 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 5905 6366 gene locus_tag LOCUS_16260 5905 6366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 7791 6442 gene locus_tag LOCUS_16270 7791 6442 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878474.1 protein_id gnl|my_center|LOCUS_16270 9123 7798 gene locus_tag LOCUS_16280 9123 7798 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878473.1 protein_id gnl|my_center|LOCUS_16280 10121 9435 gene locus_tag LOCUS_16290 10121 9435 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876891.1 protein_id gnl|my_center|LOCUS_16290 11064 10144 gene locus_tag LOCUS_16300 11064 10144 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_16300 11602 11081 gene locus_tag LOCUS_16310 11602 11081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 12396 11890 gene locus_tag LOCUS_16320 gene rimI 12396 11890 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434429.1 protein_id gnl|my_center|LOCUS_16320 13111 12425 gene locus_tag LOCUS_16330 gene agaW 13111 12425 CDS product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387359.1 protein_id gnl|my_center|LOCUS_16330 13631 13101 gene locus_tag LOCUS_16340 13631 13101 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425168.1 protein_id gnl|my_center|LOCUS_16340 14123 13713 gene locus_tag LOCUS_16350 14123 13713 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391194.1 protein_id gnl|my_center|LOCUS_16350 14296 14781 gene locus_tag LOCUS_16360 14296 14781 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_16360 14778 17468 gene locus_tag LOCUS_16370 14778 17468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 17465 20860 gene locus_tag LOCUS_16380 17465 20860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 20949 21233 gene locus_tag LOCUS_16390 20949 21233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 22060 21275 gene locus_tag LOCUS_16400 22060 21275 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067768.1 protein_id gnl|my_center|LOCUS_16400 22932 22066 gene locus_tag LOCUS_16410 gene sppA 22932 22066 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941890.1 protein_id gnl|my_center|LOCUS_16410 24732 22960 gene locus_tag LOCUS_16420 24732 22960 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_16420 25522 24839 gene locus_tag LOCUS_16430 gene cmk 25522 24839 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_16430 25771 27201 gene locus_tag LOCUS_16440 25771 27201 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767670.1 protein_id gnl|my_center|LOCUS_16440 27278 28627 gene locus_tag LOCUS_16450 27278 28627 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545411.1 protein_id gnl|my_center|LOCUS_16450 28976 30214 gene locus_tag LOCUS_16460 28976 30214 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680921.1 protein_id gnl|my_center|LOCUS_16460 30330 31346 gene locus_tag LOCUS_16470 30330 31346 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792172.1 protein_id gnl|my_center|LOCUS_16470 31343 33709 gene locus_tag LOCUS_16480 31343 33709 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942922.1 protein_id gnl|my_center|LOCUS_16480 33726 34124 gene locus_tag LOCUS_16490 gene ybeY 33726 34124 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942921.1 protein_id gnl|my_center|LOCUS_16490 35917 34205 gene locus_tag LOCUS_16500 35917 34205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 >Feature sequence31 <1 995 gene locus_tag LOCUS_16510 <1 995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_069456631.1:IS110 family transposase 2491 1496 gene locus_tag LOCUS_16520 2491 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 4888 2669 gene locus_tag LOCUS_16530 4888 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 5546 4998 gene locus_tag LOCUS_16540 5546 4998 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_16540 6463 5582 gene locus_tag LOCUS_16550 gene speB 6463 5582 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_16550 7317 6595 gene locus_tag LOCUS_16560 7317 6595 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943095.1 protein_id gnl|my_center|LOCUS_16560 8072 7407 gene locus_tag LOCUS_16570 8072 7407 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545579.1 protein_id gnl|my_center|LOCUS_16570 8214 9389 gene locus_tag LOCUS_16580 gene lptF 8214 9389 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_16580 9386 10465 gene locus_tag LOCUS_16590 gene lptG 9386 10465 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942568.1 protein_id gnl|my_center|LOCUS_16590 11820 10564 gene locus_tag LOCUS_16600 gene ahcY 11820 10564 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_16600 13078 11900 gene locus_tag LOCUS_16610 gene metK 13078 11900 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355656.1 protein_id gnl|my_center|LOCUS_16610 13791 13177 gene locus_tag LOCUS_16620 13791 13177 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947206.1 protein_id gnl|my_center|LOCUS_16620 14329 13949 gene locus_tag LOCUS_16630 14329 13949 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191357.1 protein_id gnl|my_center|LOCUS_16630 15274 14417 gene locus_tag LOCUS_16640 gene panC 15274 14417 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942350.1 protein_id gnl|my_center|LOCUS_16640 16298 15432 gene locus_tag LOCUS_16650 gene rsmA 16298 15432 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226751.1 protein_id gnl|my_center|LOCUS_16650 16728 16240 gene locus_tag LOCUS_16660 16728 16240 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583738.1 protein_id gnl|my_center|LOCUS_16660 17822 16794 gene locus_tag LOCUS_16670 gene tsaD 17822 16794 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942510.1 protein_id gnl|my_center|LOCUS_16670 18082 19704 gene locus_tag LOCUS_16680 gene nadB 18082 19704 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_16680 20361 19735 gene locus_tag LOCUS_16690 20361 19735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 21717 20407 gene locus_tag LOCUS_16700 gene purB 21717 20407 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942277.1 protein_id gnl|my_center|LOCUS_16700 21904 22338 gene locus_tag LOCUS_16710 21904 22338 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918284.1 protein_id gnl|my_center|LOCUS_16710 22343 23479 gene locus_tag LOCUS_16720 22343 23479 CDS product Acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245999.1 protein_id gnl|my_center|LOCUS_16720 23483 24433 gene locus_tag LOCUS_16730 23483 24433 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088879.1 protein_id gnl|my_center|LOCUS_16730 24438 25769 gene locus_tag LOCUS_16740 24438 25769 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088880.1 protein_id gnl|my_center|LOCUS_16740 25971 25819 gene locus_tag LOCUS_16750 25971 25819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 26324 27094 gene locus_tag LOCUS_16760 26324 27094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 27191 27583 gene locus_tag LOCUS_16770 27191 27583 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259566.1 protein_id gnl|my_center|LOCUS_16770 27634 29328 gene locus_tag LOCUS_16780 27634 29328 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence32 1245 436 gene locus_tag LOCUS_16790 1245 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 3181 1994 gene locus_tag LOCUS_16800 3181 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 3912 5132 gene locus_tag LOCUS_16810 3912 5132 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143177.1 protein_id gnl|my_center|LOCUS_16810 5356 5643 gene locus_tag LOCUS_16820 5356 5643 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_16820 5640 5879 gene locus_tag LOCUS_16830 5640 5879 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_16830 6107 7102 gene locus_tag LOCUS_16840 6107 7102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 8372 7125 gene locus_tag LOCUS_16850 8372 7125 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613399.1 protein_id gnl|my_center|LOCUS_16850 8595 8365 gene locus_tag LOCUS_16860 8595 8365 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016100.1 protein_id gnl|my_center|LOCUS_16860 10121 8886 gene locus_tag LOCUS_16870 10121 8886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 11562 10216 gene locus_tag LOCUS_16880 11562 10216 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762937.1 protein_id gnl|my_center|LOCUS_16880 13077 11581 gene locus_tag LOCUS_16890 13077 11581 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941686.1 protein_id gnl|my_center|LOCUS_16890 13488 14306 gene locus_tag LOCUS_16900 gene mpgP 13488 14306 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228324.1 protein_id gnl|my_center|LOCUS_16900 14341 15597 gene locus_tag LOCUS_16910 14341 15597 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868664.1 protein_id gnl|my_center|LOCUS_16910 15594 16856 gene locus_tag LOCUS_16920 15594 16856 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868852.1 protein_id gnl|my_center|LOCUS_16920 16849 18057 gene locus_tag LOCUS_16930 16849 18057 CDS product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 protein_id gnl|my_center|LOCUS_16930 18156 19211 gene locus_tag LOCUS_16940 18156 19211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 19242 21512 gene locus_tag LOCUS_16950 19242 21512 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879109.1 protein_id gnl|my_center|LOCUS_16950 21505 22164 gene locus_tag LOCUS_16960 21505 22164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 22249 25071 gene locus_tag LOCUS_16970 22249 25071 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958545.1 protein_id gnl|my_center|LOCUS_16970 25288 26037 gene locus_tag LOCUS_16980 25288 26037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 26048 27118 gene locus_tag LOCUS_16990 26048 27118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 27315 28844 gene locus_tag LOCUS_17000 27315 28844 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence33 2 187 gene locus_tag LOCUS_17010 2 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 866 1723 gene locus_tag LOCUS_17020 866 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17020 1645 2580 gene locus_tag LOCUS_17030 1645 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17030 2761 3879 gene locus_tag LOCUS_17040 gene fldC 2761 3879 CDS product phenyllactyl-CoA dehydratase subunit FldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048236.1 protein_id gnl|my_center|LOCUS_17040 4446 5702 gene locus_tag LOCUS_17050 4446 5702 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 protein_id gnl|my_center|LOCUS_17050 5815 6585 gene locus_tag LOCUS_17060 5815 6585 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_17060 6588 8039 gene locus_tag LOCUS_17070 6588 8039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 8050 8718 gene locus_tag LOCUS_17080 8050 8718 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030700.1 protein_id gnl|my_center|LOCUS_17080 8812 9171 gene locus_tag LOCUS_17090 8812 9171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 9260 10174 gene locus_tag LOCUS_17100 9260 10174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 12353 10191 gene locus_tag LOCUS_17110 12353 10191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 13861 12350 gene locus_tag LOCUS_17120 13861 12350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 15434 14199 gene locus_tag LOCUS_17130 gene amrS 15434 14199 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_17130 15955 15431 gene locus_tag LOCUS_17140 gene paaY 15955 15431 CDS product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123464.1 protein_id gnl|my_center|LOCUS_17140 16133 16411 gene locus_tag LOCUS_17150 16133 16411 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942006.1 protein_id gnl|my_center|LOCUS_17150 16414 16713 gene locus_tag LOCUS_17160 16414 16713 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942007.1 protein_id gnl|my_center|LOCUS_17160 17000 16779 gene locus_tag LOCUS_17170 17000 16779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 17240 17007 gene locus_tag LOCUS_17180 17240 17007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 17432 19363 gene locus_tag LOCUS_17190 17432 19363 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_17190 19715 19969 gene locus_tag LOCUS_17200 19715 19969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 20218 22398 gene locus_tag LOCUS_17210 20218 22398 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869551.1 protein_id gnl|my_center|LOCUS_17210 22855 22667 gene locus_tag LOCUS_17220 22855 22667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 23067 25784 gene locus_tag LOCUS_17230 23067 25784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 26109 27809 gene locus_tag LOCUS_17240 26109 27809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 28535 28251 gene locus_tag LOCUS_17250 28535 28251 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110276.1 protein_id gnl|my_center|LOCUS_17250 28859 28539 gene locus_tag LOCUS_17260 28859 28539 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296467.1 protein_id gnl|my_center|LOCUS_17260 >Feature sequence34 412 1569 gene locus_tag LOCUS_17270 412 1569 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_17270 1724 2515 gene locus_tag LOCUS_17280 1724 2515 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_17280 3560 2517 gene locus_tag LOCUS_17290 gene nifS 3560 2517 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583089.1 protein_id gnl|my_center|LOCUS_17290 5043 3901 gene locus_tag LOCUS_17300 5043 3901 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072004.1 protein_id gnl|my_center|LOCUS_17300 6486 5152 gene locus_tag LOCUS_17310 6486 5152 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459193.1 protein_id gnl|my_center|LOCUS_17310 7214 6753 gene locus_tag LOCUS_17320 7214 6753 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270458.1 protein_id gnl|my_center|LOCUS_17320 8403 7237 gene locus_tag LOCUS_17330 8403 7237 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877713.1 protein_id gnl|my_center|LOCUS_17330 9558 8416 gene locus_tag LOCUS_17340 9558 8416 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064172.1 protein_id gnl|my_center|LOCUS_17340 10079 9627 gene locus_tag LOCUS_17350 10079 9627 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318983.1 protein_id gnl|my_center|LOCUS_17350 11312 10152 gene locus_tag LOCUS_17360 11312 10152 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040775.1 protein_id gnl|my_center|LOCUS_17360 11568 14708 gene locus_tag LOCUS_17370 11568 14708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 14811 16076 gene locus_tag LOCUS_17380 14811 16076 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944609.1 protein_id gnl|my_center|LOCUS_17380 16125 17612 gene locus_tag LOCUS_17390 gene abfD 16125 17612 CDS product 4-hydroxybutyryl-CoA dehydratase/vinylacetyl-CoA-Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_17390 17617 18540 gene locus_tag LOCUS_17400 17617 18540 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878705.1 protein_id gnl|my_center|LOCUS_17400 19971 18829 gene locus_tag LOCUS_17410 19971 18829 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878526.1 protein_id gnl|my_center|LOCUS_17410 22219 20081 gene locus_tag LOCUS_17420 gene fadJ 22219 20081 CDS product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072985.1 protein_id gnl|my_center|LOCUS_17420 23387 22242 gene locus_tag LOCUS_17430 23387 22242 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374065.1 protein_id gnl|my_center|LOCUS_17430 24873 23449 gene locus_tag LOCUS_17440 24873 23449 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_17440 26620 24962 gene locus_tag LOCUS_17450 26620 24962 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878190.1 protein_id gnl|my_center|LOCUS_17450 27646 26789 gene locus_tag LOCUS_17460 27646 26789 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_17460 >Feature sequence35 346 645 gene locus_tag LOCUS_17470 346 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 642 839 gene locus_tag LOCUS_17480 642 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 1496 1861 gene locus_tag LOCUS_17490 1496 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 2700 1918 gene locus_tag LOCUS_17500 2700 1918 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 protein_id gnl|my_center|LOCUS_17500 3914 2910 gene locus_tag LOCUS_17510 3914 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 5580 3877 gene locus_tag LOCUS_17520 5580 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 6341 5643 gene locus_tag LOCUS_17530 gene cobB 6341 5643 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_17530 8379 6313 gene locus_tag LOCUS_17540 8379 6313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 9866 8439 gene locus_tag LOCUS_17550 9866 8439 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_17550 10226 11032 gene locus_tag LOCUS_17560 gene murI 10226 11032 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223465.1 protein_id gnl|my_center|LOCUS_17560 12006 11185 gene locus_tag LOCUS_17570 12006 11185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 13854 12190 gene locus_tag LOCUS_17580 gene ilvD 13854 12190 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_17580 15120 14068 gene locus_tag LOCUS_17590 gene ilvC 15120 14068 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962615.1 protein_id gnl|my_center|LOCUS_17590 15664 15173 gene locus_tag LOCUS_17600 gene ilvN 15664 15173 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545180.1 protein_id gnl|my_center|LOCUS_17600 17441 15741 gene locus_tag LOCUS_17610 gene ilvB 17441 15741 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938671.1 protein_id gnl|my_center|LOCUS_17610 20225 17811 gene locus_tag LOCUS_17620 20225 17811 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546286.1 protein_id gnl|my_center|LOCUS_17620 20968 20222 gene locus_tag LOCUS_17630 20968 20222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 21368 21045 gene locus_tag LOCUS_17640 21368 21045 CDS product TatA/E family twin arginine-targeting protein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940700.1 protein_id gnl|my_center|LOCUS_17640 21602 22660 gene locus_tag LOCUS_17650 21602 22660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 22766 23053 gene locus_tag LOCUS_17660 gene gatC 22766 23053 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_17660 23076 24533 gene locus_tag LOCUS_17670 gene gatA 23076 24533 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546781.1 protein_id gnl|my_center|LOCUS_17670 24533 25963 gene locus_tag LOCUS_17680 gene gatB 24533 25963 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_17680 25960 27009 gene locus_tag LOCUS_17690 gene mtnA 25960 27009 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_17690 27014 27328 gene locus_tag LOCUS_17700 27014 27328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence36 514 86 gene locus_tag LOCUS_17710 514 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 779 2305 gene locus_tag LOCUS_17720 779 2305 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357216.1 protein_id gnl|my_center|LOCUS_17720 2312 3430 gene locus_tag LOCUS_17730 2312 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 3427 4581 gene locus_tag LOCUS_17740 3427 4581 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546440.1 protein_id gnl|my_center|LOCUS_17740 4761 5480 gene locus_tag LOCUS_17750 4761 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 5826 6221 gene locus_tag LOCUS_17760 5826 6221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 7494 6265 gene locus_tag LOCUS_17770 7494 6265 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649370.1 protein_id gnl|my_center|LOCUS_17770 8450 7704 gene locus_tag LOCUS_17780 8450 7704 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928634.1 protein_id gnl|my_center|LOCUS_17780 8719 9783 gene locus_tag LOCUS_17790 8719 9783 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878191.1 protein_id gnl|my_center|LOCUS_17790 10689 11099 gene locus_tag LOCUS_17800 10689 11099 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532372.1 protein_id gnl|my_center|LOCUS_17800 11147 11920 gene locus_tag LOCUS_17810 11147 11920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 11942 12292 gene locus_tag LOCUS_17820 gene hypA 11942 12292 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393668.1 protein_id gnl|my_center|LOCUS_17820 12292 12966 gene locus_tag LOCUS_17830 gene hypB 12292 12966 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356857.1 protein_id gnl|my_center|LOCUS_17830 13044 14126 gene locus_tag LOCUS_17840 13044 14126 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878191.1 protein_id gnl|my_center|LOCUS_17840 14219 15499 gene locus_tag LOCUS_17850 14219 15499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 16308 15667 gene locus_tag LOCUS_17860 16308 15667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 17243 16305 gene locus_tag LOCUS_17870 17243 16305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 17512 17240 gene locus_tag LOCUS_17880 17512 17240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 17707 17513 gene locus_tag LOCUS_17890 17707 17513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 18445 17777 gene locus_tag LOCUS_17900 18445 17777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256488.1 protein_id gnl|my_center|LOCUS_17900 18795 18448 gene locus_tag LOCUS_17910 18795 18448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 19021 19731 gene locus_tag LOCUS_17920 19021 19731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 19754 21442 gene locus_tag LOCUS_17930 19754 21442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 21655 22113 gene locus_tag LOCUS_17940 21655 22113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 22216 22446 gene locus_tag LOCUS_17950 22216 22446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 22443 22853 gene locus_tag LOCUS_17960 22443 22853 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228775.1 protein_id gnl|my_center|LOCUS_17960 22914 23408 gene locus_tag LOCUS_17970 22914 23408 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258683.1 protein_id gnl|my_center|LOCUS_17970 23786 25069 gene locus_tag LOCUS_17980 23786 25069 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545697.1 protein_id gnl|my_center|LOCUS_17980 25066 26250 gene locus_tag LOCUS_17990 25066 26250 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_17990 26253 26945 gene locus_tag LOCUS_18000 26253 26945 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546598.1 protein_id gnl|my_center|LOCUS_18000 27033 27066 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence37 548 186 gene locus_tag LOCUS_18010 548 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 974 564 gene locus_tag LOCUS_18020 974 564 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943377.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18020 2407 1142 gene locus_tag LOCUS_18030 2407 1142 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940986.1 protein_id gnl|my_center|LOCUS_18030 3956 2463 gene locus_tag LOCUS_18040 3956 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 4135 6306 gene locus_tag LOCUS_18050 4135 6306 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_18050 6383 6955 gene locus_tag LOCUS_18060 6383 6955 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877643.1 protein_id gnl|my_center|LOCUS_18060 7088 8152 gene locus_tag LOCUS_18070 gene corA 7088 8152 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942048.1 protein_id gnl|my_center|LOCUS_18070 8143 9252 gene locus_tag LOCUS_18080 8143 9252 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876130.1 protein_id gnl|my_center|LOCUS_18080 9249 11516 gene locus_tag LOCUS_18090 9249 11516 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876131.1 protein_id gnl|my_center|LOCUS_18090 11588 12901 gene locus_tag LOCUS_18100 11588 12901 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852462.1 protein_id gnl|my_center|LOCUS_18100 13496 12921 gene locus_tag LOCUS_18110 13496 12921 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020385.1 protein_id gnl|my_center|LOCUS_18110 14156 13644 gene locus_tag LOCUS_18120 14156 13644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 14790 14383 gene locus_tag LOCUS_18130 14790 14383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 15607 14885 gene locus_tag LOCUS_18140 15607 14885 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941846.1 protein_id gnl|my_center|LOCUS_18140 16938 15799 gene locus_tag LOCUS_18150 16938 15799 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811492.1 protein_id gnl|my_center|LOCUS_18150 17161 18372 gene locus_tag LOCUS_18160 gene rlmD 17161 18372 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_18160 18682 19962 gene locus_tag LOCUS_18170 18682 19962 CDS product IS701-like element ISBj6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038951335.1 protein_id gnl|my_center|LOCUS_18170 20238 21860 gene locus_tag LOCUS_18180 20238 21860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 22174 25026 gene locus_tag LOCUS_18190 22174 25026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 25088 26350 gene locus_tag LOCUS_18200 25088 26350 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545078.1 protein_id gnl|my_center|LOCUS_18200 26357 27004 gene locus_tag LOCUS_18210 26357 27004 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184839.1 protein_id gnl|my_center|LOCUS_18210 27515 27249 gene locus_tag LOCUS_18220 27515 27249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 27738 27499 gene locus_tag LOCUS_18230 27738 27499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence38 172 1266 gene locus_tag LOCUS_18240 gene ychF 172 1266 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_18240 1353 1826 gene locus_tag LOCUS_18250 1353 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 2071 3063 gene locus_tag LOCUS_18260 gene gctA 2071 3063 CDS product glutaconate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902658.1 protein_id gnl|my_center|LOCUS_18260 3082 3852 gene locus_tag LOCUS_18270 3082 3852 CDS product glutaconate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272325.1 protein_id gnl|my_center|LOCUS_18270 4217 4017 gene locus_tag LOCUS_18280 4217 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 6285 4225 gene locus_tag LOCUS_18290 6285 4225 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257258.1 protein_id gnl|my_center|LOCUS_18290 6990 6373 gene locus_tag LOCUS_18300 6990 6373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 7154 8680 gene locus_tag LOCUS_18310 7154 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 8691 10235 gene locus_tag LOCUS_18320 8691 10235 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 protein_id gnl|my_center|LOCUS_18320 11235 10258 gene locus_tag LOCUS_18330 11235 10258 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583848.1 protein_id gnl|my_center|LOCUS_18330 12517 11327 gene locus_tag LOCUS_18340 12517 11327 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072004.1 protein_id gnl|my_center|LOCUS_18340 13046 13732 gene locus_tag LOCUS_18350 13046 13732 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462061.1 protein_id gnl|my_center|LOCUS_18350 13878 14096 gene locus_tag LOCUS_18360 13878 14096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 14098 14679 gene locus_tag LOCUS_18370 14098 14679 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939708.1 protein_id gnl|my_center|LOCUS_18370 14750 15490 gene locus_tag LOCUS_18380 14750 15490 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941775.1 protein_id gnl|my_center|LOCUS_18380 15630 16265 gene locus_tag LOCUS_18390 15630 16265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 16289 18322 gene locus_tag LOCUS_18400 gene fusA 16289 18322 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_18400 18328 19512 gene locus_tag LOCUS_18410 18328 19512 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675897.1 protein_id gnl|my_center|LOCUS_18410 19570 20079 gene locus_tag LOCUS_18420 19570 20079 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531302.1 protein_id gnl|my_center|LOCUS_18420 20124 22310 gene locus_tag LOCUS_18430 20124 22310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 22725 22958 gene locus_tag LOCUS_18440 22725 22958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 23593 23207 gene locus_tag LOCUS_18450 23593 23207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 24011 23637 gene locus_tag LOCUS_18460 24011 23637 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546034.1 protein_id gnl|my_center|LOCUS_18460 24984 24121 gene locus_tag LOCUS_18470 24984 24121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 >Feature sequence39 584 817 gene locus_tag LOCUS_18480 584 817 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_18480 872 3520 gene locus_tag LOCUS_18490 872 3520 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087775.1 protein_id gnl|my_center|LOCUS_18490 3517 4845 gene locus_tag LOCUS_18500 3517 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 4842 5507 gene locus_tag LOCUS_18510 4842 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 5504 6754 gene locus_tag LOCUS_18520 5504 6754 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946819.1 protein_id gnl|my_center|LOCUS_18520 6751 10206 gene locus_tag LOCUS_18530 6751 10206 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087773.1 protein_id gnl|my_center|LOCUS_18530 7886 7903 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10203 10916 gene locus_tag LOCUS_18540 10203 10916 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087772.1 protein_id gnl|my_center|LOCUS_18540 10959 11768 gene locus_tag LOCUS_18550 10959 11768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 11772 12773 gene locus_tag LOCUS_18560 11772 12773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 12773 14047 gene locus_tag LOCUS_18570 12773 14047 CDS product DUF2791 family P-loop domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875950.1 protein_id gnl|my_center|LOCUS_18570 14068 14625 gene locus_tag LOCUS_18580 14068 14625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 15768 16847 gene locus_tag LOCUS_18590 15768 16847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 17083 17009 gene locus_tag LOCUS_t00170 17083 17009 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 17162 17089 gene locus_tag LOCUS_t00180 17162 17089 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 18801 17392 gene locus_tag LOCUS_18600 gene gltX 18801 17392 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941876.1 protein_id gnl|my_center|LOCUS_18600 19237 19770 gene locus_tag LOCUS_18610 19237 19770 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_18610 19801 19986 gene locus_tag LOCUS_18620 gene rpmF 19801 19986 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942244.1 protein_id gnl|my_center|LOCUS_18620 20016 20966 gene locus_tag LOCUS_18630 gene fabD 20016 20966 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_18630 21116 21859 gene locus_tag LOCUS_18640 gene fabG 21116 21859 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_18640 21902 22147 gene locus_tag LOCUS_18650 gene acpP 21902 22147 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_18650 22175 23413 gene locus_tag LOCUS_18660 gene fabF 22175 23413 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_18660 23524 23982 gene locus_tag LOCUS_18670 gene rpiB 23524 23982 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942251.1 protein_id gnl|my_center|LOCUS_18670 >Feature sequence40 52 1305 gene locus_tag LOCUS_18680 52 1305 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_18680 1612 2079 gene locus_tag LOCUS_18690 1612 2079 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_18690 2076 2555 gene locus_tag LOCUS_18700 gene nrdR 2076 2555 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_18700 2571 3233 gene locus_tag LOCUS_18710 2571 3233 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942332.1 protein_id gnl|my_center|LOCUS_18710 3365 3449 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3589 4791 gene locus_tag LOCUS_18720 3589 4791 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_18720 4905 5369 gene locus_tag LOCUS_18730 gene ribE 4905 5369 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545200.1 protein_id gnl|my_center|LOCUS_18730 5492 5890 gene locus_tag LOCUS_18740 gene nusB 5492 5890 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460271.1 protein_id gnl|my_center|LOCUS_18740 5862 6419 gene locus_tag LOCUS_18750 5862 6419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 6463 9063 gene locus_tag LOCUS_18760 gene leuS 6463 9063 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942849.1 protein_id gnl|my_center|LOCUS_18760 9263 9790 gene locus_tag LOCUS_18770 9263 9790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 10676 10413 gene locus_tag LOCUS_18780 gene rpsT 10676 10413 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545489.1 protein_id gnl|my_center|LOCUS_18780 13323 10762 gene locus_tag LOCUS_18790 13323 10762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 14955 13486 gene locus_tag LOCUS_18800 14955 13486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 16262 15087 gene locus_tag LOCUS_18810 16262 15087 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_18810 16873 17820 gene locus_tag LOCUS_18820 gene thiL 16873 17820 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_18820 18491 17778 gene locus_tag LOCUS_18830 18491 17778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 18889 20553 gene locus_tag LOCUS_18840 18889 20553 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389689.1 protein_id gnl|my_center|LOCUS_18840 20680 21924 gene locus_tag LOCUS_18850 20680 21924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 21894 22859 gene locus_tag LOCUS_18860 21894 22859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 23068 22838 gene locus_tag LOCUS_18870 23068 22838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 >Feature sequence41 636 274 gene locus_tag LOCUS_18880 gene dksA 636 274 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940956.1 protein_id gnl|my_center|LOCUS_18880 1239 757 gene locus_tag LOCUS_18890 1239 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 2115 1393 gene locus_tag LOCUS_18900 2115 1393 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_18900 2497 2117 gene locus_tag LOCUS_18910 gene rsfS 2497 2117 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998173.1 protein_id gnl|my_center|LOCUS_18910 2730 3575 gene locus_tag LOCUS_18920 2730 3575 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546451.1 protein_id gnl|my_center|LOCUS_18920 3775 5103 gene locus_tag LOCUS_18930 3775 5103 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_18930 5116 6090 gene locus_tag LOCUS_18940 5116 6090 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_18940 6145 6972 gene locus_tag LOCUS_18950 6145 6972 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_18950 7021 7197 gene locus_tag LOCUS_18960 7021 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 7200 7976 gene locus_tag LOCUS_18970 7200 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 8120 9091 gene locus_tag LOCUS_18980 8120 9091 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940727.1 protein_id gnl|my_center|LOCUS_18980 10014 11642 gene locus_tag LOCUS_18990 gene cas3 10014 11642 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932807.1 protein_id gnl|my_center|LOCUS_18990 11666 12379 gene locus_tag LOCUS_19000 gene cas5c 11666 12379 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932806.1 protein_id gnl|my_center|LOCUS_19000 12376 14139 gene locus_tag LOCUS_19010 gene cas8c 12376 14139 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926986.1 protein_id gnl|my_center|LOCUS_19010 14170 15285 gene locus_tag LOCUS_19020 gene cas7c 14170 15285 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932804.1 protein_id gnl|my_center|LOCUS_19020 15402 16220 gene locus_tag LOCUS_19030 15402 16220 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_19030 16433 17074 gene locus_tag LOCUS_19040 gene cas4 16433 17074 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932803.1 protein_id gnl|my_center|LOCUS_19040 17166 17708 gene locus_tag LOCUS_19050 17166 17708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 17960 18991 gene locus_tag LOCUS_19060 gene cas1c 17960 18991 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_19060 19003 19293 gene locus_tag LOCUS_19070 gene cas2 19003 19293 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 protein_id gnl|my_center|LOCUS_19070 19477 21970 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcgccccatgcgggcgcgtggattgaaac 21961 21999 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22141 22175 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22162 22795 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcgccccatgcgggcgcgtggattgaaac 22852 22959 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22960 23112 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgggcgcgtggattgaaac >Feature sequence42 1381 179 gene locus_tag LOCUS_19080 1381 179 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072442.1 protein_id gnl|my_center|LOCUS_19080 2554 1397 gene locus_tag LOCUS_19090 2554 1397 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870021.1 protein_id gnl|my_center|LOCUS_19090 3373 2636 gene locus_tag LOCUS_19100 3373 2636 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940003.1 protein_id gnl|my_center|LOCUS_19100 3417 4097 gene locus_tag LOCUS_19110 gene rsmG 3417 4097 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131091.1 protein_id gnl|my_center|LOCUS_19110 4216 4986 gene locus_tag LOCUS_19120 4216 4986 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_19120 4987 5835 gene locus_tag LOCUS_19130 4987 5835 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940783.1 protein_id gnl|my_center|LOCUS_19130 6073 7434 gene locus_tag LOCUS_19140 gene dnaA 6073 7434 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940678.1 protein_id gnl|my_center|LOCUS_19140 7584 8705 gene locus_tag LOCUS_19150 gene dnaN 7584 8705 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_19150 8790 11192 gene locus_tag LOCUS_19160 gene gyrB 8790 11192 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940681.1 protein_id gnl|my_center|LOCUS_19160 11206 11751 gene locus_tag LOCUS_19170 11206 11751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 12685 11777 gene locus_tag LOCUS_19180 12685 11777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 13201 12707 gene locus_tag LOCUS_19190 13201 12707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 13513 14802 gene locus_tag LOCUS_19200 13513 14802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 15547 14909 gene locus_tag LOCUS_19210 15547 14909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 16026 15613 gene locus_tag LOCUS_19220 16026 15613 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064953.1 protein_id gnl|my_center|LOCUS_19220 16265 18763 gene locus_tag LOCUS_19230 gene gyrA 16265 18763 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 protein_id gnl|my_center|LOCUS_19230 19136 19552 gene locus_tag LOCUS_19240 19136 19552 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583624.1 protein_id gnl|my_center|LOCUS_19240 19545 20987 gene locus_tag LOCUS_19250 19545 20987 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546530.1 protein_id gnl|my_center|LOCUS_19250 21027 21251 gene locus_tag LOCUS_19260 21027 21251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 21270 21467 gene locus_tag LOCUS_19270 21270 21467 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939599.1 protein_id gnl|my_center|LOCUS_19270 22037 21480 gene locus_tag LOCUS_19280 22037 21480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 22837 22043 gene locus_tag LOCUS_19290 22837 22043 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095645285.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence43 3025 884 gene locus_tag LOCUS_19300 gene recG 3025 884 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_19300 3103 4263 gene locus_tag LOCUS_19310 gene purM 3103 4263 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 protein_id gnl|my_center|LOCUS_19310 4266 4931 gene locus_tag LOCUS_19320 gene purN 4266 4931 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942403.1 protein_id gnl|my_center|LOCUS_19320 5278 5021 gene locus_tag LOCUS_19330 5278 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 5633 6415 gene locus_tag LOCUS_19340 5633 6415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 6412 7734 gene locus_tag LOCUS_19350 6412 7734 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448293.1 protein_id gnl|my_center|LOCUS_19350 7815 8012 gene locus_tag LOCUS_19360 gene rpmB 7815 8012 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_19360 8440 8015 gene locus_tag LOCUS_19370 8440 8015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 8725 8456 gene locus_tag LOCUS_19380 8725 8456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 8839 10590 gene locus_tag LOCUS_19390 gene recJ 8839 10590 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_19390 10661 11107 gene locus_tag LOCUS_19400 10661 11107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 11187 11819 gene locus_tag LOCUS_19410 11187 11819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 12629 11838 gene locus_tag LOCUS_19420 12629 11838 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_19420 13718 12645 gene locus_tag LOCUS_19430 13718 12645 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463596.1 protein_id gnl|my_center|LOCUS_19430 14601 13723 gene locus_tag LOCUS_19440 14601 13723 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227944.1 protein_id gnl|my_center|LOCUS_19440 16586 14655 gene locus_tag LOCUS_19450 16586 14655 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227943.1 protein_id gnl|my_center|LOCUS_19450 17415 16591 gene locus_tag LOCUS_19460 17415 16591 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227942.1 protein_id gnl|my_center|LOCUS_19460 18630 17422 gene locus_tag LOCUS_19470 18630 17422 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926442.1 protein_id gnl|my_center|LOCUS_19470 19054 20409 gene locus_tag LOCUS_19480 19054 20409 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544969.1 protein_id gnl|my_center|LOCUS_19480 20504 20349 gene locus_tag LOCUS_19490 20504 20349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 20746 20675 gene locus_tag LOCUS_t00190 20746 20675 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 21844 20729 gene locus_tag LOCUS_19500 21844 20729 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence44 147 1445 gene locus_tag LOCUS_19510 147 1445 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272192.1 protein_id gnl|my_center|LOCUS_19510 2613 2101 gene locus_tag LOCUS_19520 2613 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 2781 3533 gene locus_tag LOCUS_19530 2781 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 3773 4885 gene locus_tag LOCUS_19540 3773 4885 CDS product DUF1207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873776.1 protein_id gnl|my_center|LOCUS_19540 6073 4898 gene locus_tag LOCUS_19550 6073 4898 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_19550 8167 6287 gene locus_tag LOCUS_19560 8167 6287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 8458 8679 gene locus_tag LOCUS_19570 8458 8679 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022341.1 protein_id gnl|my_center|LOCUS_19570 8711 8893 gene locus_tag LOCUS_19580 8711 8893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 9007 9462 gene locus_tag LOCUS_19590 9007 9462 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526466.1 protein_id gnl|my_center|LOCUS_19590 10604 9600 gene locus_tag LOCUS_19600 10604 9600 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404488.1 protein_id gnl|my_center|LOCUS_19600 10773 11000 gene locus_tag LOCUS_19610 10773 11000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 11559 11113 gene locus_tag LOCUS_19620 11559 11113 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932389.1 protein_id gnl|my_center|LOCUS_19620 11703 12623 gene locus_tag LOCUS_19630 11703 12623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 14165 12624 gene locus_tag LOCUS_19640 14165 12624 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943972.1 protein_id gnl|my_center|LOCUS_19640 14449 15207 gene locus_tag LOCUS_19650 gene tolQ 14449 15207 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_19650 15236 15634 gene locus_tag LOCUS_19660 gene tolR 15236 15634 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_19660 15637 16350 gene locus_tag LOCUS_19670 15637 16350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 16437 17798 gene locus_tag LOCUS_19680 gene tolB 16437 17798 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_19680 17874 18506 gene locus_tag LOCUS_19690 17874 18506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 18627 19361 gene locus_tag LOCUS_19700 gene ybgF 18627 19361 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545231.1 protein_id gnl|my_center|LOCUS_19700 20236 19598 gene locus_tag LOCUS_19710 20236 19598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 22263 20578 gene locus_tag LOCUS_19720 22263 20578 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942079.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence45 402 935 gene locus_tag LOCUS_19730 402 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 995 1969 gene locus_tag LOCUS_19740 995 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 2035 2361 gene locus_tag LOCUS_19750 2035 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 2358 2726 gene locus_tag LOCUS_19760 2358 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 2852 3445 gene locus_tag LOCUS_19770 2852 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 3472 4167 gene locus_tag LOCUS_19780 3472 4167 CDS product DUF799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103486.1 protein_id gnl|my_center|LOCUS_19780 4164 5666 gene locus_tag LOCUS_19790 4164 5666 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459194.1 protein_id gnl|my_center|LOCUS_19790 6021 7604 gene locus_tag LOCUS_19800 6021 7604 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_19800 7647 9128 gene locus_tag LOCUS_19810 gene abfD 7647 9128 CDS product 4-hydroxybutyryl-CoA dehydratase/vinylacetyl-CoA-Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_19810 9152 10291 gene locus_tag LOCUS_19820 gene acdA 9152 10291 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_19820 10313 11098 gene locus_tag LOCUS_19830 10313 11098 CDS product electron transfer flavoprotein FixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692187.1 protein_id gnl|my_center|LOCUS_19830 11100 12056 gene locus_tag LOCUS_19840 11100 12056 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048184.1 protein_id gnl|my_center|LOCUS_19840 12068 13363 gene locus_tag LOCUS_19850 12068 13363 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287748.1 protein_id gnl|my_center|LOCUS_19850 13354 13647 gene locus_tag LOCUS_19860 13354 13647 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461381.1 protein_id gnl|my_center|LOCUS_19860 14751 13705 gene locus_tag LOCUS_19870 14751 13705 CDS product DUF3137 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761173.1 protein_id gnl|my_center|LOCUS_19870 15199 17688 gene locus_tag LOCUS_19880 15199 17688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 17829 18677 gene locus_tag LOCUS_19890 17829 18677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 18674 19678 gene locus_tag LOCUS_19900 18674 19678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 20303 19710 gene locus_tag LOCUS_19910 20303 19710 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence46 1028 351 gene locus_tag LOCUS_19920 1028 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2133 1021 gene locus_tag LOCUS_19930 2133 1021 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909134.1 protein_id gnl|my_center|LOCUS_19930 3185 2286 gene locus_tag LOCUS_19940 3185 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 3533 3285 gene locus_tag LOCUS_19950 3533 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 4668 4889 gene locus_tag LOCUS_19960 4668 4889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 5098 4913 gene locus_tag LOCUS_19970 5098 4913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 5070 5309 gene locus_tag LOCUS_19980 5070 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 5311 6057 gene locus_tag LOCUS_19990 5311 6057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 6167 6592 gene locus_tag LOCUS_20000 6167 6592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 7105 6692 gene locus_tag LOCUS_20010 7105 6692 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_20010 7355 7098 gene locus_tag LOCUS_20020 7355 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 7921 7553 gene locus_tag LOCUS_20030 7921 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 9774 8074 gene locus_tag LOCUS_20040 9774 8074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 10508 9771 gene locus_tag LOCUS_20050 10508 9771 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_20050 12001 10505 gene locus_tag LOCUS_20060 12001 10505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 12777 12001 gene locus_tag LOCUS_20070 12777 12001 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022348.1 protein_id gnl|my_center|LOCUS_20070 13264 12863 gene locus_tag LOCUS_20080 13264 12863 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545896.1 protein_id gnl|my_center|LOCUS_20080 15077 13380 gene locus_tag LOCUS_20090 15077 13380 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546350.1 protein_id gnl|my_center|LOCUS_20090 16293 15091 gene locus_tag LOCUS_20100 16293 15091 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938060.1 protein_id gnl|my_center|LOCUS_20100 17183 16593 gene locus_tag LOCUS_20110 17183 16593 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080707.1 protein_id gnl|my_center|LOCUS_20110 17862 17272 gene locus_tag LOCUS_20120 17862 17272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 18348 18623 gene locus_tag LOCUS_20130 18348 18623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 >Feature sequence47 339 187 gene locus_tag LOCUS_20140 339 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 221 230 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 860 633 gene locus_tag LOCUS_20150 860 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 1992 1120 gene locus_tag LOCUS_20160 gene sucD 1992 1120 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750467.1 protein_id gnl|my_center|LOCUS_20160 3199 2051 gene locus_tag LOCUS_20170 gene sucC 3199 2051 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228010.1 protein_id gnl|my_center|LOCUS_20170 3415 4110 gene locus_tag LOCUS_20180 3415 4110 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441056.1 protein_id gnl|my_center|LOCUS_20180 4157 5593 gene locus_tag LOCUS_20190 4157 5593 CDS product 4-hydroxyphenylacetate 3-hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064616.1 protein_id gnl|my_center|LOCUS_20190 7025 5913 gene locus_tag LOCUS_20200 7025 5913 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197192.1 protein_id gnl|my_center|LOCUS_20200 7269 7182 gene locus_tag LOCUS_t00200 7269 7182 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7401 8354 gene locus_tag LOCUS_20210 7401 8354 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392568.1 protein_id gnl|my_center|LOCUS_20210 9683 8490 gene locus_tag LOCUS_20220 9683 8490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 10846 9695 gene locus_tag LOCUS_20230 10846 9695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 10979 11659 gene locus_tag LOCUS_20240 gene nfi 10979 11659 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172477.1 protein_id gnl|my_center|LOCUS_20240 12483 11656 gene locus_tag LOCUS_20250 12483 11656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 13160 12537 gene locus_tag LOCUS_20260 gene pyrE 13160 12537 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546400.1 protein_id gnl|my_center|LOCUS_20260 15814 13394 gene locus_tag LOCUS_20270 15814 13394 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938876.1 protein_id gnl|my_center|LOCUS_20270 16446 15847 gene locus_tag LOCUS_20280 16446 15847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 16663 17136 gene locus_tag LOCUS_20290 16663 17136 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392661.1 protein_id gnl|my_center|LOCUS_20290 17207 17596 gene locus_tag LOCUS_20300 17207 17596 CDS product DUF5320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392926.1 protein_id gnl|my_center|LOCUS_20300 17675 18076 gene locus_tag LOCUS_20310 17675 18076 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392924.1 protein_id gnl|my_center|LOCUS_20310 18129 18494 gene locus_tag LOCUS_20320 18129 18494 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545235.1 protein_id gnl|my_center|LOCUS_20320 >Feature sequence48 229 295 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 349 480 gene locus_tag LOCUS_20330 349 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 1106 1498 gene locus_tag LOCUS_20340 1106 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 2355 1522 gene locus_tag LOCUS_20350 2355 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 2604 2371 gene locus_tag LOCUS_20360 2604 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 3288 2728 gene locus_tag LOCUS_20370 3288 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 4188 3298 gene locus_tag LOCUS_20380 4188 3298 CDS product DUF4384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546601.1 protein_id gnl|my_center|LOCUS_20380 4595 4416 gene locus_tag LOCUS_20390 4595 4416 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064556.1 protein_id gnl|my_center|LOCUS_20390 5113 4634 gene locus_tag LOCUS_20400 5113 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 5733 5113 gene locus_tag LOCUS_20410 5733 5113 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356161.1 protein_id gnl|my_center|LOCUS_20410 5890 6354 gene locus_tag LOCUS_20420 5890 6354 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043223.1 protein_id gnl|my_center|LOCUS_20420 6370 7266 gene locus_tag LOCUS_20430 gene mtgA 6370 7266 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933680.1 protein_id gnl|my_center|LOCUS_20430 7411 9006 gene locus_tag LOCUS_20440 7411 9006 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456248.1 protein_id gnl|my_center|LOCUS_20440 9273 10397 gene locus_tag LOCUS_20450 9273 10397 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943943.1 protein_id gnl|my_center|LOCUS_20450 10394 12082 gene locus_tag LOCUS_20460 10394 12082 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940888.1 protein_id gnl|my_center|LOCUS_20460 12262 13113 gene locus_tag LOCUS_20470 12262 13113 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_20470 13123 14316 gene locus_tag LOCUS_20480 13123 14316 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267108.1 protein_id gnl|my_center|LOCUS_20480 14322 14735 gene locus_tag LOCUS_20490 14322 14735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 14847 16763 gene locus_tag LOCUS_20500 14847 16763 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_20500 16763 18409 gene locus_tag LOCUS_20510 16763 18409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 >Feature sequence49 210 1016 gene locus_tag LOCUS_20520 210 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 1847 1539 gene locus_tag LOCUS_20530 1847 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 1872 2081 gene locus_tag LOCUS_20540 1872 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 2780 2304 gene locus_tag LOCUS_20550 2780 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 3509 6658 gene locus_tag LOCUS_20560 3509 6658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 6845 7564 gene locus_tag LOCUS_20570 6845 7564 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184045.1 protein_id gnl|my_center|LOCUS_20570 8369 7731 gene locus_tag LOCUS_20580 8369 7731 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065173.1 protein_id gnl|my_center|LOCUS_20580 9167 8421 gene locus_tag LOCUS_20590 9167 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 9842 9213 gene locus_tag LOCUS_20600 gene cobC 9842 9213 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_20600 10274 11494 gene locus_tag LOCUS_20610 10274 11494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 11886 12854 gene locus_tag LOCUS_20620 11886 12854 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768681.1 protein_id gnl|my_center|LOCUS_20620 12866 13702 gene locus_tag LOCUS_20630 gene gctB 12866 13702 CDS product glutaconate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902656.1 protein_id gnl|my_center|LOCUS_20630 13921 14073 gene locus_tag LOCUS_20640 13921 14073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 14107 14928 gene locus_tag LOCUS_20650 14107 14928 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_20650 14947 16143 gene locus_tag LOCUS_20660 14947 16143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 16542 17537 gene locus_tag LOCUS_20670 16542 17537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 17437 17952 gene locus_tag LOCUS_20680 17437 17952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20680 17876 17907 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence50 198 1052 gene locus_tag LOCUS_20690 198 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 1132 3099 gene locus_tag LOCUS_20700 1132 3099 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867965.1 protein_id gnl|my_center|LOCUS_20700 3103 3513 gene locus_tag LOCUS_20710 3103 3513 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146517.1 protein_id gnl|my_center|LOCUS_20710 3784 5424 gene locus_tag LOCUS_20720 3784 5424 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867965.1 protein_id gnl|my_center|LOCUS_20720 5508 6719 gene locus_tag LOCUS_20730 5508 6719 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941766.1 protein_id gnl|my_center|LOCUS_20730 6762 7208 gene locus_tag LOCUS_20740 6762 7208 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274661.1 protein_id gnl|my_center|LOCUS_20740 7219 7647 gene locus_tag LOCUS_20750 7219 7647 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034360.1 protein_id gnl|my_center|LOCUS_20750 7689 8519 gene locus_tag LOCUS_20760 gene fabG 7689 8519 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392464.1 protein_id gnl|my_center|LOCUS_20760 8594 10045 gene locus_tag LOCUS_20770 8594 10045 CDS product hydroxymethylglutaryl-CoA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 protein_id gnl|my_center|LOCUS_20770 10075 11277 gene locus_tag LOCUS_20780 10075 11277 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 protein_id gnl|my_center|LOCUS_20780 11437 13068 gene locus_tag LOCUS_20790 11437 13068 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228885.1 protein_id gnl|my_center|LOCUS_20790 13176 14321 gene locus_tag LOCUS_20800 13176 14321 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878637.1 protein_id gnl|my_center|LOCUS_20800 14468 16150 gene locus_tag LOCUS_20810 14468 16150 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_20810 16247 16603 gene locus_tag LOCUS_20820 16247 16603 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146517.1 protein_id gnl|my_center|LOCUS_20820 >Feature sequence51 20 1369 gene locus_tag LOCUS_20830 gene lpdA 20 1369 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970376.1 protein_id gnl|my_center|LOCUS_20830 1375 2223 gene locus_tag LOCUS_20840 1375 2223 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_20840 3295 2240 gene locus_tag LOCUS_20850 3295 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 4590 3376 gene locus_tag LOCUS_20860 4590 3376 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024286.1 protein_id gnl|my_center|LOCUS_20860 5306 4578 gene locus_tag LOCUS_20870 5306 4578 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938321.1 protein_id gnl|my_center|LOCUS_20870 6097 5435 gene locus_tag LOCUS_20880 6097 5435 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360272.1 protein_id gnl|my_center|LOCUS_20880 7649 6159 gene locus_tag LOCUS_20890 7649 6159 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_20890 8993 7800 gene locus_tag LOCUS_20900 8993 7800 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881355.1 protein_id gnl|my_center|LOCUS_20900 10449 9271 gene locus_tag LOCUS_20910 10449 9271 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_20910 10674 11594 gene locus_tag LOCUS_20920 gene yijE 10674 11594 CDS product cystine transporter YijE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271257.1 protein_id gnl|my_center|LOCUS_20920 11677 13698 gene locus_tag LOCUS_20930 11677 13698 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878706.1 protein_id gnl|my_center|LOCUS_20930 14030 14260 gene locus_tag LOCUS_20940 14030 14260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 14257 14664 gene locus_tag LOCUS_20950 14257 14664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 14683 14982 gene locus_tag LOCUS_20960 14683 14982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 14979 15356 gene locus_tag LOCUS_20970 14979 15356 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 protein_id gnl|my_center|LOCUS_20970 15940 15662 gene locus_tag LOCUS_20980 15940 15662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 16171 15944 gene locus_tag LOCUS_20990 16171 15944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 16639 16226 gene locus_tag LOCUS_21000 16639 16226 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525071.1 protein_id gnl|my_center|LOCUS_21000 17058 16684 gene locus_tag LOCUS_21010 17058 16684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 >Feature sequence52 1077 922 gene locus_tag LOCUS_21020 1077 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21020 1435 2019 gene locus_tag LOCUS_21030 1435 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 2483 2253 gene locus_tag LOCUS_21040 2483 2253 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024016.1 protein_id gnl|my_center|LOCUS_21040 2689 2480 gene locus_tag LOCUS_21050 2689 2480 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024015.1 protein_id gnl|my_center|LOCUS_21050 4186 3044 gene locus_tag LOCUS_21060 4186 3044 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940843.1 protein_id gnl|my_center|LOCUS_21060 4803 6233 gene locus_tag LOCUS_21070 gene acdAII 4803 6233 CDS product acetate--CoA ligase I subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868410.1 protein_id gnl|my_center|LOCUS_21070 6478 7164 gene locus_tag LOCUS_21080 6478 7164 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867423.1 protein_id gnl|my_center|LOCUS_21080 7238 8164 gene locus_tag LOCUS_21090 7238 8164 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_21090 8428 9363 gene locus_tag LOCUS_21100 8428 9363 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812829.1 protein_id gnl|my_center|LOCUS_21100 9356 10408 gene locus_tag LOCUS_21110 9356 10408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 11637 10426 gene locus_tag LOCUS_21120 11637 10426 CDS product YcaO-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876618.1 protein_id gnl|my_center|LOCUS_21120 12658 11666 gene locus_tag LOCUS_21130 gene mnmA 12658 11666 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393152.1 protein_id gnl|my_center|LOCUS_21130 13001 13999 gene locus_tag LOCUS_21140 gene bioB 13001 13999 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_21140 14113 14418 gene locus_tag LOCUS_21150 14113 14418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 14415 15164 gene locus_tag LOCUS_21160 14415 15164 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890732.1 protein_id gnl|my_center|LOCUS_21160 16818 15568 gene locus_tag LOCUS_21170 16818 15568 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_21170 >Feature sequence53 1845 187 gene locus_tag LOCUS_21180 1845 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 2030 3151 gene locus_tag LOCUS_21190 gene dprA 2030 3151 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_21190 3156 5408 gene locus_tag LOCUS_21200 gene topA 3156 5408 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_21200 5519 6883 gene locus_tag LOCUS_21210 gene trmFO 5519 6883 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943183.1 protein_id gnl|my_center|LOCUS_21210 7607 6840 gene locus_tag LOCUS_21220 7607 6840 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_21220 8395 7604 gene locus_tag LOCUS_21230 8395 7604 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545308.1 protein_id gnl|my_center|LOCUS_21230 9268 8435 gene locus_tag LOCUS_21240 gene nadC 9268 8435 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_21240 12004 9362 gene locus_tag LOCUS_21250 12004 9362 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 protein_id gnl|my_center|LOCUS_21250 13352 12174 gene locus_tag LOCUS_21260 13352 12174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 14400 13480 gene locus_tag LOCUS_21270 gene miaA 14400 13480 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_21270 16154 14397 gene locus_tag LOCUS_21280 gene mutL 16154 14397 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090225.1 protein_id gnl|my_center|LOCUS_21280 >Feature sequence54 324 1562 gene locus_tag LOCUS_21290 324 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 1801 1574 gene locus_tag LOCUS_21300 1801 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21300 2019 1798 gene locus_tag LOCUS_21310 2019 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21310 2207 2245 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2734 2351 gene locus_tag LOCUS_21320 2734 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 2877 3083 gene locus_tag LOCUS_21330 2877 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 4804 6300 gene locus_tag LOCUS_21340 gene trpE 4804 6300 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_21340 6382 6966 gene locus_tag LOCUS_21350 gene pabA 6382 6966 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602287.1 protein_id gnl|my_center|LOCUS_21350 7385 8395 gene locus_tag LOCUS_21360 gene trpD 7385 8395 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943017.1 protein_id gnl|my_center|LOCUS_21360 8643 9416 gene locus_tag LOCUS_21370 gene trpC 8643 9416 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392852.1 protein_id gnl|my_center|LOCUS_21370 9413 10060 gene locus_tag LOCUS_21380 9413 10060 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_21380 10553 11749 gene locus_tag LOCUS_21390 gene trpB 10553 11749 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943010.1 protein_id gnl|my_center|LOCUS_21390 11752 12549 gene locus_tag LOCUS_21400 gene trpA 11752 12549 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_21400 12961 12746 gene locus_tag LOCUS_21410 12961 12746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 14443 13109 gene locus_tag LOCUS_21420 14443 13109 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459193.1 protein_id gnl|my_center|LOCUS_21420 15712 14534 gene locus_tag LOCUS_21430 15712 14534 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860958.1 protein_id gnl|my_center|LOCUS_21430 16559 15762 gene locus_tag LOCUS_21440 16559 15762 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231526.1 protein_id gnl|my_center|LOCUS_21440 >Feature sequence55 650 108 gene locus_tag LOCUS_21450 650 108 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544933.1 protein_id gnl|my_center|LOCUS_21450 1651 647 gene locus_tag LOCUS_21460 1651 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 2625 1654 gene locus_tag LOCUS_21470 gene galE 2625 1654 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929113.1 protein_id gnl|my_center|LOCUS_21470 3614 2622 gene locus_tag LOCUS_21480 3614 2622 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403373.1 protein_id gnl|my_center|LOCUS_21480 3808 5337 gene locus_tag LOCUS_21490 gene lysS 3808 5337 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_21490 5505 6782 gene locus_tag LOCUS_21500 5505 6782 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_21500 6954 7532 gene locus_tag LOCUS_21510 6954 7532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21510 7402 7447 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7596 10244 gene locus_tag LOCUS_21520 gene bamA 7596 10244 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_21520 10588 11160 gene locus_tag LOCUS_21530 10588 11160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 11173 12213 gene locus_tag LOCUS_21540 gene lpxD 11173 12213 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_21540 12294 13067 gene locus_tag LOCUS_21550 gene lpxA 12294 13067 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942904.1 protein_id gnl|my_center|LOCUS_21550 13250 14242 gene locus_tag LOCUS_21560 13250 14242 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771932.1 protein_id gnl|my_center|LOCUS_21560 14208 15302 gene locus_tag LOCUS_21570 14208 15302 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546476.1 protein_id gnl|my_center|LOCUS_21570 15292 16494 gene locus_tag LOCUS_21580 gene lpxB 15292 16494 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence56 325 906 gene locus_tag LOCUS_21590 325 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 1058 1372 gene locus_tag LOCUS_21600 1058 1372 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389255.1 protein_id gnl|my_center|LOCUS_21600 2736 1870 gene locus_tag LOCUS_21610 2736 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 4060 2819 gene locus_tag LOCUS_21620 4060 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 6433 4166 gene locus_tag LOCUS_21630 6433 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 7754 6945 gene locus_tag LOCUS_21640 7754 6945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 10148 9564 gene locus_tag LOCUS_21650 10148 9564 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061181.1 protein_id gnl|my_center|LOCUS_21650 10396 11181 gene locus_tag LOCUS_21660 10396 11181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 12961 11657 gene locus_tag LOCUS_21670 12961 11657 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089309.1 protein_id gnl|my_center|LOCUS_21670 13131 12958 gene locus_tag LOCUS_21680 13131 12958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 13207 13623 gene locus_tag LOCUS_21690 13207 13623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 14391 13822 gene locus_tag LOCUS_21700 14391 13822 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937640.1 protein_id gnl|my_center|LOCUS_21700 15514 15059 gene locus_tag LOCUS_21710 15514 15059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 15665 15468 gene locus_tag LOCUS_21720 15665 15468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 >Feature sequence57 12 629 gene locus_tag LOCUS_21730 12 629 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_21730 846 3044 gene locus_tag LOCUS_21740 gene priA 846 3044 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940804.1 protein_id gnl|my_center|LOCUS_21740 3087 4031 gene locus_tag LOCUS_21750 gene fmt 3087 4031 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_21750 4039 5391 gene locus_tag LOCUS_21760 gene rsmB 4039 5391 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_21760 5658 6287 gene locus_tag LOCUS_21770 5658 6287 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_21770 6310 7194 gene locus_tag LOCUS_21780 6310 7194 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_21780 7273 8340 gene locus_tag LOCUS_21790 gene dnaJ 7273 8340 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_21790 8563 9549 gene locus_tag LOCUS_21800 8563 9549 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879345.1 protein_id gnl|my_center|LOCUS_21800 9792 11117 gene locus_tag LOCUS_21810 9792 11117 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738818.1 protein_id gnl|my_center|LOCUS_21810 11146 11574 gene locus_tag LOCUS_21820 11146 11574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 11850 11653 gene locus_tag LOCUS_21830 11850 11653 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 protein_id gnl|my_center|LOCUS_21830 12586 12431 gene locus_tag LOCUS_21840 12586 12431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 14585 13389 gene locus_tag LOCUS_21850 14585 13389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 14946 14797 gene locus_tag LOCUS_21860 14946 14797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 <15504 14992 gene locus_tag LOCUS_21870 <15504 14992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266284.1:BON domain-containing protein >Feature sequence58 1005 430 gene locus_tag LOCUS_21880 1005 430 CDS product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391492.1 protein_id gnl|my_center|LOCUS_21880 1961 1188 gene locus_tag LOCUS_21890 1961 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21890 3710 2190 gene locus_tag LOCUS_21900 gene lnt 3710 2190 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_21900 4554 3703 gene locus_tag LOCUS_21910 4554 3703 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942919.1 protein_id gnl|my_center|LOCUS_21910 5454 4582 gene locus_tag LOCUS_21920 5454 4582 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459741.1 protein_id gnl|my_center|LOCUS_21920 5673 5464 gene locus_tag LOCUS_21930 5673 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 5851 5906 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8521 6083 gene locus_tag LOCUS_21940 gene lon 8521 6083 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942434.1 protein_id gnl|my_center|LOCUS_21940 9795 8533 gene locus_tag LOCUS_21950 gene clpX 9795 8533 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_21950 10406 9807 gene locus_tag LOCUS_21960 gene clpP 10406 9807 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942436.1 protein_id gnl|my_center|LOCUS_21960 11740 10418 gene locus_tag LOCUS_21970 gene tig 11740 10418 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942437.1 protein_id gnl|my_center|LOCUS_21970 11872 11788 gene locus_tag LOCUS_t00210 11872 11788 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12273 14480 gene locus_tag LOCUS_21980 12273 14480 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249788.1 protein_id gnl|my_center|LOCUS_21980 15122 14535 gene locus_tag LOCUS_21990 15122 14535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21990 >Feature sequence59 259 62 gene locus_tag LOCUS_22000 259 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 369 2018 gene locus_tag LOCUS_22010 369 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 2015 3370 gene locus_tag LOCUS_22020 2015 3370 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_22020 3797 4957 gene locus_tag LOCUS_22030 3797 4957 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477243.1 protein_id gnl|my_center|LOCUS_22030 5153 5614 gene locus_tag LOCUS_22040 5153 5614 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879802.1 protein_id gnl|my_center|LOCUS_22040 5796 6932 gene locus_tag LOCUS_22050 5796 6932 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064172.1 protein_id gnl|my_center|LOCUS_22050 6943 8115 gene locus_tag LOCUS_22060 6943 8115 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877713.1 protein_id gnl|my_center|LOCUS_22060 8131 8598 gene locus_tag LOCUS_22070 8131 8598 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270458.1 protein_id gnl|my_center|LOCUS_22070 8612 9076 gene locus_tag LOCUS_22080 8612 9076 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979867.1 protein_id gnl|my_center|LOCUS_22080 9144 10508 gene locus_tag LOCUS_22090 9144 10508 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454645.1 protein_id gnl|my_center|LOCUS_22090 10588 11730 gene locus_tag LOCUS_22100 10588 11730 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044389757.1 protein_id gnl|my_center|LOCUS_22100 12037 13617 gene locus_tag LOCUS_22110 12037 13617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 13614 14261 gene locus_tag LOCUS_22120 13614 14261 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940928.1 protein_id gnl|my_center|LOCUS_22120 14505 14969 gene locus_tag LOCUS_22130 14505 14969 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318983.1 protein_id gnl|my_center|LOCUS_22130 >Feature sequence60 2209 155 gene locus_tag LOCUS_22140 gene tkt 2209 155 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_22140 3570 2401 gene locus_tag LOCUS_22150 gene glk 3570 2401 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259043.1 protein_id gnl|my_center|LOCUS_22150 4498 3542 gene locus_tag LOCUS_22160 gene menA 4498 3542 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081897.1 protein_id gnl|my_center|LOCUS_22160 5136 4525 gene locus_tag LOCUS_22170 5136 4525 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060758.1 protein_id gnl|my_center|LOCUS_22170 5976 5269 gene locus_tag LOCUS_22180 5976 5269 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_22180 7413 6217 gene locus_tag LOCUS_22190 7413 6217 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963926.1 protein_id gnl|my_center|LOCUS_22190 9184 7841 gene locus_tag LOCUS_22200 9184 7841 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939825.1 protein_id gnl|my_center|LOCUS_22200 9972 9361 gene locus_tag LOCUS_22210 9972 9361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 11168 10002 gene locus_tag LOCUS_22220 11168 10002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 protein_id gnl|my_center|LOCUS_22220 11659 12843 gene locus_tag LOCUS_22230 11659 12843 CDS product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948785.1 protein_id gnl|my_center|LOCUS_22230 13015 13776 gene locus_tag LOCUS_22240 13015 13776 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943860.1 protein_id gnl|my_center|LOCUS_22240 >Feature sequence61 1655 378 gene locus_tag LOCUS_22250 1655 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 4639 1652 gene locus_tag LOCUS_22260 4639 1652 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021984.1 protein_id gnl|my_center|LOCUS_22260 8349 5122 gene locus_tag LOCUS_22270 8349 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 10712 8424 gene locus_tag LOCUS_22280 10712 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 11746 10724 gene locus_tag LOCUS_22290 11746 10724 CDS product NrtA/SsuA/CpmA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967169.1 protein_id gnl|my_center|LOCUS_22290 12951 11974 gene locus_tag LOCUS_22300 12951 11974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 13402 13037 gene locus_tag LOCUS_22310 13402 13037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 14056 13550 gene locus_tag LOCUS_22320 14056 13550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 >Feature sequence62 1358 336 gene locus_tag LOCUS_22330 1358 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 2737 1373 gene locus_tag LOCUS_22340 2737 1373 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876537.1 protein_id gnl|my_center|LOCUS_22340 3890 2793 gene locus_tag LOCUS_22350 3890 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 4546 3935 gene locus_tag LOCUS_22360 4546 3935 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226951.1 protein_id gnl|my_center|LOCUS_22360 5112 4543 gene locus_tag LOCUS_22370 5112 4543 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_22370 5485 5138 gene locus_tag LOCUS_22380 5485 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 6275 5568 gene locus_tag LOCUS_22390 6275 5568 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250526.1 protein_id gnl|my_center|LOCUS_22390 6944 7165 gene locus_tag LOCUS_22400 6944 7165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 7231 7503 gene locus_tag LOCUS_22410 7231 7503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 7503 7898 gene locus_tag LOCUS_22420 7503 7898 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679941.1 protein_id gnl|my_center|LOCUS_22420 8304 8642 gene locus_tag LOCUS_22430 8304 8642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 8635 9744 gene locus_tag LOCUS_22440 8635 9744 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_22440 10515 10850 gene locus_tag LOCUS_22450 10515 10850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22450 10930 11217 gene locus_tag LOCUS_22460 10930 11217 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929718.1 protein_id gnl|my_center|LOCUS_22460 11201 11497 gene locus_tag LOCUS_22470 11201 11497 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015205689.1 protein_id gnl|my_center|LOCUS_22470 12357 11788 gene locus_tag LOCUS_22480 12357 11788 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020386.1 protein_id gnl|my_center|LOCUS_22480 13060 13890 gene locus_tag LOCUS_22490 13060 13890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 >Feature sequence63 181 3399 gene locus_tag LOCUS_22500 181 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 3402 5990 gene locus_tag LOCUS_22510 3402 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 7390 5999 gene locus_tag LOCUS_22520 7390 5999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 7832 8341 gene locus_tag LOCUS_22530 7832 8341 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 protein_id gnl|my_center|LOCUS_22530 8512 8766 gene locus_tag LOCUS_22540 8512 8766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 8959 9930 gene locus_tag LOCUS_22550 8959 9930 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462165.1 protein_id gnl|my_center|LOCUS_22550 9982 11016 gene locus_tag LOCUS_22560 9982 11016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878828.1 protein_id gnl|my_center|LOCUS_22560 11173 11724 gene locus_tag LOCUS_22570 11173 11724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 12078 12995 gene locus_tag LOCUS_22580 12078 12995 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048127.1 protein_id gnl|my_center|LOCUS_22580 13122 13247 gene locus_tag LOCUS_22590 13122 13247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 13271 13660 gene locus_tag LOCUS_22600 13271 13660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 >Feature sequence64 385 8 gene locus_tag LOCUS_22610 385 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22610 626 435 gene locus_tag LOCUS_22620 626 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 1407 778 gene locus_tag LOCUS_22630 1407 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 2753 1776 gene locus_tag LOCUS_22640 gene meaB 2753 1776 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942224.1 protein_id gnl|my_center|LOCUS_22640 3178 2762 gene locus_tag LOCUS_22650 3178 2762 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846721.1 protein_id gnl|my_center|LOCUS_22650 3622 3191 gene locus_tag LOCUS_22660 3622 3191 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_22660 5322 3634 gene locus_tag LOCUS_22670 5322 3634 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_22670 6229 5768 gene locus_tag LOCUS_22680 6229 5768 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270458.1 protein_id gnl|my_center|LOCUS_22680 7350 6250 gene locus_tag LOCUS_22690 7350 6250 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877713.1 protein_id gnl|my_center|LOCUS_22690 8606 7464 gene locus_tag LOCUS_22700 8606 7464 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064172.1 protein_id gnl|my_center|LOCUS_22700 10270 8879 gene locus_tag LOCUS_22710 10270 8879 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_22710 11943 10267 gene locus_tag LOCUS_22720 11943 10267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 12134 12643 gene locus_tag LOCUS_22730 12134 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 12981 12655 gene locus_tag LOCUS_22740 12981 12655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 >Feature sequence65 <1 779 gene locus_tag LOCUS_22750 <1 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022752.1:IS1182-like element ISMac20 family transposase 1946 2119 gene locus_tag LOCUS_22760 1946 2119 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878572.1 protein_id gnl|my_center|LOCUS_22760 3061 2363 gene locus_tag LOCUS_22770 gene radC 3061 2363 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114357.1 protein_id gnl|my_center|LOCUS_22770 4391 3066 gene locus_tag LOCUS_22780 4391 3066 CDS product radical SAM/SPASM family putative metalloenzyme maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176675.1 protein_id gnl|my_center|LOCUS_22780 5206 4388 gene locus_tag LOCUS_22790 5206 4388 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986474.1 protein_id gnl|my_center|LOCUS_22790 5432 5208 gene locus_tag LOCUS_22800 5432 5208 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358284.1 protein_id gnl|my_center|LOCUS_22800 7197 5461 gene locus_tag LOCUS_22810 7197 5461 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_22810 7488 8339 gene locus_tag LOCUS_22820 7488 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 8510 9934 gene locus_tag LOCUS_22830 8510 9934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 10076 11389 gene locus_tag LOCUS_22840 10076 11389 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_22840 11386 12282 gene locus_tag LOCUS_22850 11386 12282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 >Feature sequence66 1496 3928 gene locus_tag LOCUS_22860 gene ppsA 1496 3928 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941469.1 protein_id gnl|my_center|LOCUS_22860 5770 4100 gene locus_tag LOCUS_22870 5770 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 5868 5885 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6628 6209 gene locus_tag LOCUS_22880 6628 6209 CDS product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868935.1 protein_id gnl|my_center|LOCUS_22880 7343 6621 gene locus_tag LOCUS_22890 7343 6621 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_22890 7578 7503 gene locus_tag LOCUS_t00220 7578 7503 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9423 7669 gene locus_tag LOCUS_22900 gene rpoD 9423 7669 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_22900 11212 9425 gene locus_tag LOCUS_22910 11212 9425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 <11978 11447 gene locus_tag LOCUS_22920 <11978 11447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943713.1:GatB/YqeY domain-containing protein >Feature sequence67 1584 223 gene locus_tag LOCUS_22930 1584 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 2090 1614 gene locus_tag LOCUS_22940 2090 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 2822 2145 gene locus_tag LOCUS_22950 2822 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 3277 2819 gene locus_tag LOCUS_22960 3277 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 3813 3274 gene locus_tag LOCUS_22970 3813 3274 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938692.1 protein_id gnl|my_center|LOCUS_22970 4158 6452 gene locus_tag LOCUS_22980 4158 6452 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943246.1 protein_id gnl|my_center|LOCUS_22980 8338 7973 gene locus_tag LOCUS_22990 8338 7973 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817423.1 protein_id gnl|my_center|LOCUS_22990 8558 8322 gene locus_tag LOCUS_23000 8558 8322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 <9967 8628 gene locus_tag LOCUS_23010 <9967 8628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015826.1:tetratricopeptide repeat protein >Feature sequence68 1709 801 gene locus_tag LOCUS_23020 1709 801 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_23020 1935 1699 gene locus_tag LOCUS_23030 1935 1699 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942410.1 protein_id gnl|my_center|LOCUS_23030 3268 1940 gene locus_tag LOCUS_23040 gene xseA 3268 1940 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_23040 3409 4443 gene locus_tag LOCUS_23050 3409 4443 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957761.1 protein_id gnl|my_center|LOCUS_23050 4594 4519 gene locus_tag LOCUS_t00230 4594 4519 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4679 5761 gene locus_tag LOCUS_23060 4679 5761 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_23060 5894 7060 gene locus_tag LOCUS_23070 5894 7060 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545245.1 protein_id gnl|my_center|LOCUS_23070 7087 7602 gene locus_tag LOCUS_23080 7087 7602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 8548 7610 gene locus_tag LOCUS_23090 8548 7610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 8922 9314 gene locus_tag LOCUS_23100 gene mutT 8922 9314 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459573.1 protein_id gnl|my_center|LOCUS_23100 >Feature sequence69 1350 181 gene locus_tag LOCUS_23110 1350 181 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_23110 2620 1430 gene locus_tag LOCUS_23120 2620 1430 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053195.1 protein_id gnl|my_center|LOCUS_23120 4154 2880 gene locus_tag LOCUS_23130 4154 2880 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053195.1 protein_id gnl|my_center|LOCUS_23130 4777 4403 gene locus_tag LOCUS_23140 4777 4403 CDS product MarR family EPS-associated transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340715.1 protein_id gnl|my_center|LOCUS_23140 5236 4859 gene locus_tag LOCUS_23150 5236 4859 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809264.1 protein_id gnl|my_center|LOCUS_23150 5522 5226 gene locus_tag LOCUS_23160 5522 5226 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809266.1 protein_id gnl|my_center|LOCUS_23160 6141 5647 gene locus_tag LOCUS_23170 6141 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 6344 6117 gene locus_tag LOCUS_23180 6344 6117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 6629 6459 gene locus_tag LOCUS_23190 6629 6459 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545155.1 protein_id gnl|my_center|LOCUS_23190 7349 6729 gene locus_tag LOCUS_23200 7349 6729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 8594 7554 gene locus_tag LOCUS_23210 gene waaC 8594 7554 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_23210 9292 8729 gene locus_tag LOCUS_23220 gene gmhB 9292 8729 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_23220 >Feature sequence70 799 104 gene locus_tag LOCUS_23230 799 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 911 1039 gene locus_tag LOCUS_23240 911 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 2099 1203 gene locus_tag LOCUS_23250 gene pqsE 2099 1203 CDS product 2-aminobenzoylacetyl-CoA thioesterase PqsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086247.1 protein_id gnl|my_center|LOCUS_23250 2373 4196 gene locus_tag LOCUS_23260 gene typA 2373 4196 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939506.1 protein_id gnl|my_center|LOCUS_23260 4637 4422 gene locus_tag LOCUS_23270 4637 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 5947 4799 gene locus_tag LOCUS_23280 5947 4799 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259270.1 protein_id gnl|my_center|LOCUS_23280 6156 5950 gene locus_tag LOCUS_23290 6156 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 7492 6377 gene locus_tag LOCUS_23300 7492 6377 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391455.1 protein_id gnl|my_center|LOCUS_23300 8054 7776 gene locus_tag LOCUS_23310 8054 7776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 9190 7982 gene locus_tag LOCUS_23320 9190 7982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 >Feature sequence71 955 686 gene locus_tag LOCUS_23330 955 686 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546355.1 protein_id gnl|my_center|LOCUS_23330 2516 1530 gene locus_tag LOCUS_23340 2516 1530 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393452.1 protein_id gnl|my_center|LOCUS_23340 2971 2543 gene locus_tag LOCUS_23350 2971 2543 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188904829.1 protein_id gnl|my_center|LOCUS_23350 3059 3331 gene locus_tag LOCUS_23360 3059 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 3875 3354 gene locus_tag LOCUS_23370 3875 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 4733 4059 gene locus_tag LOCUS_23380 4733 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249947.1 protein_id gnl|my_center|LOCUS_23380 5688 4726 gene locus_tag LOCUS_23390 5688 4726 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249945.1 protein_id gnl|my_center|LOCUS_23390 5966 5685 gene locus_tag LOCUS_23400 5966 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 7844 6048 gene locus_tag LOCUS_23410 7844 6048 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868362.1 protein_id gnl|my_center|LOCUS_23410 8487 7921 gene locus_tag LOCUS_23420 8487 7921 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_23420 >Feature sequence72 463 924 gene locus_tag LOCUS_23430 463 924 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_23430 935 2095 gene locus_tag LOCUS_23440 935 2095 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040775.1 protein_id gnl|my_center|LOCUS_23440 2159 3340 gene locus_tag LOCUS_23450 2159 3340 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081868529.1 protein_id gnl|my_center|LOCUS_23450 3375 4541 gene locus_tag LOCUS_23460 3375 4541 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878467.1 protein_id gnl|my_center|LOCUS_23460 4571 5032 gene locus_tag LOCUS_23470 4571 5032 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878466.1 protein_id gnl|my_center|LOCUS_23470 5183 6754 gene locus_tag LOCUS_23480 5183 6754 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090588.1 protein_id gnl|my_center|LOCUS_23480 7236 8159 gene locus_tag LOCUS_23490 7236 8159 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878705.1 protein_id gnl|my_center|LOCUS_23490 >Feature sequence73 88 684 gene locus_tag LOCUS_23500 88 684 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940756.1 protein_id gnl|my_center|LOCUS_23500 827 1393 gene locus_tag LOCUS_23510 gene porC 827 1393 CDS product pyruvate synthase subunit PorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869766.1 protein_id gnl|my_center|LOCUS_23510 1524 3281 gene locus_tag LOCUS_23520 1524 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 3278 4456 gene locus_tag LOCUS_23530 gene porA 3278 4456 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877345.1 protein_id gnl|my_center|LOCUS_23530 4437 5318 gene locus_tag LOCUS_23540 4437 5318 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868480.1 protein_id gnl|my_center|LOCUS_23540 5837 5331 gene locus_tag LOCUS_23550 5837 5331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 6048 5866 gene locus_tag LOCUS_23560 6048 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 6065 6871 gene locus_tag LOCUS_23570 6065 6871 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402843.1 protein_id gnl|my_center|LOCUS_23570 7090 7458 gene locus_tag LOCUS_23580 7090 7458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 7403 7579 gene locus_tag LOCUS_23590 7403 7579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 7576 7749 gene locus_tag LOCUS_23600 7576 7749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 >Feature sequence74 392 1207 gene locus_tag LOCUS_23610 392 1207 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496786.1 protein_id gnl|my_center|LOCUS_23610 1260 2189 gene locus_tag LOCUS_23620 1260 2189 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_23620 3353 2304 gene locus_tag LOCUS_23630 3353 2304 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830878.1 protein_id gnl|my_center|LOCUS_23630 3559 4302 gene locus_tag LOCUS_23640 3559 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23640 4286 4783 gene locus_tag LOCUS_23650 4286 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23650 5167 7512 gene locus_tag LOCUS_23660 5167 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 >Feature sequence75 162 276 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 595 293 gene locus_tag LOCUS_23670 595 293 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404971.1 protein_id gnl|my_center|LOCUS_23670 1742 672 gene locus_tag LOCUS_23680 gene waaF 1742 672 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_23680 2203 1820 gene locus_tag LOCUS_23690 2203 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 3106 2228 gene locus_tag LOCUS_23700 3106 2228 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531221.1 protein_id gnl|my_center|LOCUS_23700 4356 3103 gene locus_tag LOCUS_23710 4356 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 6348 4612 gene locus_tag LOCUS_23720 gene msbA 6348 4612 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_23720 >Feature sequence76 295 125 gene locus_tag LOCUS_23730 295 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 923 762 gene locus_tag LOCUS_23740 923 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 1092 1466 gene locus_tag LOCUS_23750 1092 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 1826 2863 gene locus_tag LOCUS_23760 1826 2863 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225238.1 protein_id gnl|my_center|LOCUS_23760 2940 3077 gene locus_tag LOCUS_23770 2940 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 3105 3410 gene locus_tag LOCUS_23780 3105 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 3577 4137 gene locus_tag LOCUS_23790 3577 4137 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583840.1 protein_id gnl|my_center|LOCUS_23790 5178 4153 gene locus_tag LOCUS_23800 5178 4153 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931000.1 protein_id gnl|my_center|LOCUS_23800 5357 5689 gene locus_tag LOCUS_23810 5357 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 >Feature sequence77 230 721 gene locus_tag LOCUS_23820 230 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 721 930 gene locus_tag LOCUS_23830 721 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 1228 2415 gene locus_tag LOCUS_23840 1228 2415 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_23840 2873 2670 gene locus_tag LOCUS_23850 2873 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 2787 3563 gene locus_tag LOCUS_23860 2787 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 4016 4453 gene locus_tag LOCUS_23870 4016 4453 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065140.1 protein_id gnl|my_center|LOCUS_23870 4428 4847 gene locus_tag LOCUS_23880 4428 4847 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867144.1 protein_id gnl|my_center|LOCUS_23880 >Feature sequence78 1484 288 gene locus_tag LOCUS_23890 1484 288 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545078.1 protein_id gnl|my_center|LOCUS_23890 2854 1526 gene locus_tag LOCUS_23900 gene gcvPA 2854 1526 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_23900 3278 2988 gene locus_tag LOCUS_23910 3278 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 3296 3338 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3474 3493 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4642 3545 gene locus_tag LOCUS_23920 gene gcvT 4642 3545 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986167.1 protein_id gnl|my_center|LOCUS_23920 >Feature sequence79 2818 2102 gene locus_tag LOCUS_23930 2818 2102 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940076.1 protein_id gnl|my_center|LOCUS_23930 >Feature sequence80 139 65 gene locus_tag LOCUS_t00240 139 65 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 409 458 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 534 459 gene locus_tag LOCUS_t00250 534 459 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2092 677 gene locus_tag LOCUS_23940 gene amrB 2092 677 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444593.1 protein_id gnl|my_center|LOCUS_23940 2413 3429 gene locus_tag LOCUS_23950 gene gap 2413 3429 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_23950 3433 4185 gene locus_tag LOCUS_23960 gene tpiA 3433 4185 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942272.1 protein_id gnl|my_center|LOCUS_23960 4198 4545 gene locus_tag LOCUS_23970 4198 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 >Feature sequence81 2370 628 gene locus_tag LOCUS_23980 2370 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 2742 3710 gene locus_tag LOCUS_23990 2742 3710 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360255.1 protein_id gnl|my_center|LOCUS_23990 3723 4439 gene locus_tag LOCUS_24000 3723 4439 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_24000 >Feature sequence82 <1 863 gene locus_tag LOCUS_24010 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088086.1:NUDIX hydrolase 912 1700 gene locus_tag LOCUS_24020 912 1700 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889459.1 protein_id gnl|my_center|LOCUS_24020 2869 2294 gene locus_tag LOCUS_24030 2869 2294 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682263.1 protein_id gnl|my_center|LOCUS_24030 3922 3191 gene locus_tag LOCUS_24040 3922 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 >Feature sequence83 550 2778 gene locus_tag LOCUS_24050 550 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 2775 3104 gene locus_tag LOCUS_24060 2775 3104 CDS product DUF1937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083172.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence84 <1 779 gene locus_tag LOCUS_24070 <1 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083755940.1:IS1182-like element ISMac20 family transposase 1089 2606 gene locus_tag LOCUS_24080 1089 2606 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086603.1 protein_id gnl|my_center|LOCUS_24080 3269 2715 gene locus_tag LOCUS_24090 3269 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 >Feature sequence85 370 1314 gene locus_tag LOCUS_24100 370 1314 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031151.1 protein_id gnl|my_center|LOCUS_24100 1869 1450 gene locus_tag LOCUS_24110 1869 1450 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_24110 2129 1866 gene locus_tag LOCUS_24120 2129 1866 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249839.1 protein_id gnl|my_center|LOCUS_24120 2419 2237 gene locus_tag LOCUS_24130 2419 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 >Feature sequence86 1742 576 gene locus_tag LOCUS_24140 1742 576 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811506.1 protein_id gnl|my_center|LOCUS_24140 2158 1742 gene locus_tag LOCUS_24150 2158 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 3468 2323 gene locus_tag LOCUS_24160 3468 2323 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245114.1 protein_id gnl|my_center|LOCUS_24160 >Feature sequence87 <1 1094 gene locus_tag LOCUS_24170 <1 1094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942398.1:KamA family radical SAM protein 1244 1690 gene locus_tag LOCUS_24180 1244 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 1687 2496 gene locus_tag LOCUS_24190 1687 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 >Feature sequence88 298 1740 gene locus_tag LOCUS_24200 gene gcvPB 298 1740 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460674.1 protein_id gnl|my_center|LOCUS_24200 1747 2607 gene locus_tag LOCUS_24210 gene lipA 1747 2607 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258693.1 protein_id gnl|my_center|LOCUS_24210