>Feature sequence001 130 46 gene locus_tag LOCUS_t00010 130 46 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2292 223 gene locus_tag LOCUS_00010 2292 223 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_00010 2398 3576 gene locus_tag LOCUS_00020 2398 3576 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_00020 3587 4336 gene locus_tag LOCUS_00030 3587 4336 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_00030 5638 4382 gene locus_tag LOCUS_00040 5638 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962908.1 protein_id gnl|my_center|LOCUS_00040 8231 5667 gene locus_tag LOCUS_00050 gene gyrA 8231 5667 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962907.1 protein_id gnl|my_center|LOCUS_00050 8494 11043 gene locus_tag LOCUS_00060 8494 11043 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_00060 11261 11716 gene locus_tag LOCUS_00070 11261 11716 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295126.1 protein_id gnl|my_center|LOCUS_00070 11727 12290 gene locus_tag LOCUS_00080 11727 12290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 12268 13353 gene locus_tag LOCUS_00090 12268 13353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 13471 14205 gene locus_tag LOCUS_00100 13471 14205 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956832.1 protein_id gnl|my_center|LOCUS_00100 15549 14251 gene locus_tag LOCUS_00110 15549 14251 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_00110 16430 15609 gene locus_tag LOCUS_00120 16430 15609 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_00120 16599 17081 gene locus_tag LOCUS_00130 gene msrB 16599 17081 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963828.1 protein_id gnl|my_center|LOCUS_00130 17074 17472 gene locus_tag LOCUS_00140 gene msrB 17074 17472 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963829.1 protein_id gnl|my_center|LOCUS_00140 17465 18019 gene locus_tag LOCUS_00150 17465 18019 CDS product DUF1572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_00150 19021 18092 gene locus_tag LOCUS_00160 19021 18092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 20401 19118 gene locus_tag LOCUS_00170 20401 19118 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_00170 20517 21893 gene locus_tag LOCUS_00180 gene lpdA 20517 21893 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_00180 22648 22232 gene locus_tag LOCUS_00190 gene aroQ 22648 22232 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964118.1 protein_id gnl|my_center|LOCUS_00190 23318 22764 gene locus_tag LOCUS_00200 23318 22764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 24048 23497 gene locus_tag LOCUS_00210 24048 23497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 24730 24188 gene locus_tag LOCUS_00220 24730 24188 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_00220 26149 25238 gene locus_tag LOCUS_00230 26149 25238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 26167 26502 gene locus_tag LOCUS_00240 26167 26502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 26549 27463 gene locus_tag LOCUS_00250 gene xerD 26549 27463 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964120.1 protein_id gnl|my_center|LOCUS_00250 27570 28700 gene locus_tag LOCUS_00260 27570 28700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 30306 28732 gene locus_tag LOCUS_00270 gene rny 30306 28732 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963284.1 protein_id gnl|my_center|LOCUS_00270 30818 30525 gene locus_tag LOCUS_00280 30818 30525 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963283.1 protein_id gnl|my_center|LOCUS_00280 31123 30833 gene locus_tag LOCUS_00290 31123 30833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963282.1 protein_id gnl|my_center|LOCUS_00290 31345 33030 gene locus_tag LOCUS_00300 31345 33030 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_00300 33085 35505 gene locus_tag LOCUS_00310 33085 35505 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_00310 35566 36738 gene locus_tag LOCUS_00320 35566 36738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 36741 38642 gene locus_tag LOCUS_00330 36741 38642 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695564.1 protein_id gnl|my_center|LOCUS_00330 39788 38646 gene locus_tag LOCUS_00340 39788 38646 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_00340 39888 40808 gene locus_tag LOCUS_00350 39888 40808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 41371 40805 gene locus_tag LOCUS_00360 41371 40805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963034.1 protein_id gnl|my_center|LOCUS_00360 41562 41374 gene locus_tag LOCUS_00370 41562 41374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 41690 41974 gene locus_tag LOCUS_00380 41690 41974 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962900.1 protein_id gnl|my_center|LOCUS_00380 41985 42314 gene locus_tag LOCUS_00390 41985 42314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 43730 42486 gene locus_tag LOCUS_00400 gene rocD 43730 42486 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_00400 43988 45397 gene locus_tag LOCUS_00410 gene rlmD 43988 45397 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962893.1 protein_id gnl|my_center|LOCUS_00410 45433 45948 gene locus_tag LOCUS_00420 45433 45948 CDS product DUF6452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962892.1 protein_id gnl|my_center|LOCUS_00420 45956 46645 gene locus_tag LOCUS_00430 45956 46645 CDS product DUF6048 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962891.1 protein_id gnl|my_center|LOCUS_00430 46795 47139 gene locus_tag LOCUS_00440 46795 47139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 47133 48443 gene locus_tag LOCUS_00450 47133 48443 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_00450 48607 48978 gene locus_tag LOCUS_00460 48607 48978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 49061 49492 gene locus_tag LOCUS_00470 49061 49492 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022818.1 protein_id gnl|my_center|LOCUS_00470 49736 49557 gene locus_tag LOCUS_00480 49736 49557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 50002 52068 gene locus_tag LOCUS_00490 50002 52068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 53347 52208 gene locus_tag LOCUS_00500 53347 52208 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962888.1 protein_id gnl|my_center|LOCUS_00500 53543 54274 gene locus_tag LOCUS_00510 53543 54274 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962887.1 protein_id gnl|my_center|LOCUS_00510 54280 54951 gene locus_tag LOCUS_00520 54280 54951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 protein_id gnl|my_center|LOCUS_00520 54951 55379 gene locus_tag LOCUS_00530 54951 55379 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964040.1 protein_id gnl|my_center|LOCUS_00530 56008 55517 gene locus_tag LOCUS_00540 56008 55517 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296548.1 protein_id gnl|my_center|LOCUS_00540 56650 56027 gene locus_tag LOCUS_00550 56650 56027 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989831.1 protein_id gnl|my_center|LOCUS_00550 57292 56660 gene locus_tag LOCUS_00560 57292 56660 CDS product DUF4294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963216.1 protein_id gnl|my_center|LOCUS_00560 60912 57427 gene locus_tag LOCUS_00570 60912 57427 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037426.1 protein_id gnl|my_center|LOCUS_00570 62005 61121 gene locus_tag LOCUS_00580 62005 61121 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_00580 62107 63276 gene locus_tag LOCUS_00590 62107 63276 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_00590 63328 63876 gene locus_tag LOCUS_00600 63328 63876 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454674.1 protein_id gnl|my_center|LOCUS_00600 63893 64570 gene locus_tag LOCUS_00610 63893 64570 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584036.1 protein_id gnl|my_center|LOCUS_00610 64688 65170 gene locus_tag LOCUS_00620 64688 65170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 65167 66609 gene locus_tag LOCUS_00630 gene accC 65167 66609 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_00630 66613 68154 gene locus_tag LOCUS_00640 66613 68154 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421548.1 protein_id gnl|my_center|LOCUS_00640 70014 68434 gene locus_tag LOCUS_00650 70014 68434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 70746 70135 gene locus_tag LOCUS_00660 70746 70135 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962826.1 protein_id gnl|my_center|LOCUS_00660 71437 70859 gene locus_tag LOCUS_00670 71437 70859 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_00670 71823 71470 gene locus_tag LOCUS_00680 71823 71470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993823.1 protein_id gnl|my_center|LOCUS_00680 72505 71921 gene locus_tag LOCUS_00690 72505 71921 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_00690 73150 72632 gene locus_tag LOCUS_00700 73150 72632 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963000.1 protein_id gnl|my_center|LOCUS_00700 74928 73162 gene locus_tag LOCUS_00710 74928 73162 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990058.1 protein_id gnl|my_center|LOCUS_00710 75535 76857 gene locus_tag LOCUS_00720 75535 76857 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615609.1 protein_id gnl|my_center|LOCUS_00720 76844 77518 gene locus_tag LOCUS_00730 76844 77518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 77696 78214 gene locus_tag LOCUS_00740 77696 78214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 79074 79280 gene locus_tag LOCUS_00750 79074 79280 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902968.1 protein_id gnl|my_center|LOCUS_00750 79373 80248 gene locus_tag LOCUS_00760 79373 80248 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071881.1 protein_id gnl|my_center|LOCUS_00760 81025 80792 gene locus_tag LOCUS_00770 81025 80792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 81364 81122 gene locus_tag LOCUS_00780 81364 81122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 81976 81815 gene locus_tag LOCUS_00790 81976 81815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 81981 83435 gene locus_tag LOCUS_00800 81981 83435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 83574 84131 gene locus_tag LOCUS_00810 83574 84131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 84784 85398 gene locus_tag LOCUS_00820 84784 85398 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764144.1 protein_id gnl|my_center|LOCUS_00820 85484 87391 gene locus_tag LOCUS_00830 85484 87391 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963092.1 protein_id gnl|my_center|LOCUS_00830 87393 88058 gene locus_tag LOCUS_00840 87393 88058 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932717.1 protein_id gnl|my_center|LOCUS_00840 90121 88214 gene locus_tag LOCUS_00850 gene acs 90121 88214 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_00850 92027 90135 gene locus_tag LOCUS_00860 92027 90135 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477696.1 protein_id gnl|my_center|LOCUS_00860 92248 92024 gene locus_tag LOCUS_00870 92248 92024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 92662 92297 gene locus_tag LOCUS_00880 92662 92297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 95365 92678 gene locus_tag LOCUS_00890 95365 92678 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338040.1 protein_id gnl|my_center|LOCUS_00890 95552 95358 gene locus_tag LOCUS_00900 95552 95358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 97414 95642 gene locus_tag LOCUS_00910 97414 95642 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188216241.1 protein_id gnl|my_center|LOCUS_00910 97699 97439 gene locus_tag LOCUS_00920 97699 97439 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262767.1 protein_id gnl|my_center|LOCUS_00920 98880 97711 gene locus_tag LOCUS_00930 98880 97711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 99461 99042 gene locus_tag LOCUS_00940 99461 99042 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362005.1 protein_id gnl|my_center|LOCUS_00940 101015 99657 gene locus_tag LOCUS_00950 101015 99657 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_00950 101172 102233 gene locus_tag LOCUS_00960 101172 102233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 103186 102230 gene locus_tag LOCUS_00970 103186 102230 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963218.1 protein_id gnl|my_center|LOCUS_00970 104210 103257 gene locus_tag LOCUS_00980 104210 103257 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963220.1 protein_id gnl|my_center|LOCUS_00980 104354 105190 gene locus_tag LOCUS_00990 104354 105190 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_00990 105192 105494 gene locus_tag LOCUS_01000 105192 105494 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963226.1 protein_id gnl|my_center|LOCUS_01000 105608 106318 gene locus_tag LOCUS_01010 gene gldF 105608 106318 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_01010 106322 106813 gene locus_tag LOCUS_01020 106322 106813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 106800 108467 gene locus_tag LOCUS_01030 gene gldG 106800 108467 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_01030 108645 109763 gene locus_tag LOCUS_01040 gene dnaN 108645 109763 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963230.1 protein_id gnl|my_center|LOCUS_01040 110207 109869 gene locus_tag LOCUS_01050 110207 109869 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122309.1 protein_id gnl|my_center|LOCUS_01050 110317 110484 gene locus_tag LOCUS_01060 110317 110484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 110805 111746 gene locus_tag LOCUS_01070 110805 111746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 111757 112425 gene locus_tag LOCUS_01080 111757 112425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 112443 112856 gene locus_tag LOCUS_01090 112443 112856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 113783 112938 gene locus_tag LOCUS_01100 113783 112938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 113967 114731 gene locus_tag LOCUS_01110 113967 114731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 114743 115084 gene locus_tag LOCUS_01120 114743 115084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 115140 116186 gene locus_tag LOCUS_01130 115140 116186 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 protein_id gnl|my_center|LOCUS_01130 116197 117213 gene locus_tag LOCUS_01140 116197 117213 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 protein_id gnl|my_center|LOCUS_01140 117473 117279 gene locus_tag LOCUS_01150 117473 117279 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_01150 117617 117856 gene locus_tag LOCUS_01160 117617 117856 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962825.1 protein_id gnl|my_center|LOCUS_01160 119503 117884 gene locus_tag LOCUS_01170 119503 117884 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963187.1 protein_id gnl|my_center|LOCUS_01170 119840 121249 gene locus_tag LOCUS_01180 119840 121249 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963192.1 protein_id gnl|my_center|LOCUS_01180 121970 121317 gene locus_tag LOCUS_01190 gene fsa 121970 121317 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963193.1 protein_id gnl|my_center|LOCUS_01190 122506 122081 gene locus_tag LOCUS_01200 122506 122081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 123358 122555 gene locus_tag LOCUS_01210 123358 122555 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963194.1 protein_id gnl|my_center|LOCUS_01210 123614 124648 gene locus_tag LOCUS_01220 123614 124648 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963196.1 protein_id gnl|my_center|LOCUS_01220 125474 124653 gene locus_tag LOCUS_01230 125474 124653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 125452 125757 gene locus_tag LOCUS_01240 125452 125757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 126614 125838 gene locus_tag LOCUS_01250 126614 125838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 127416 126616 gene locus_tag LOCUS_01260 gene proC 127416 126616 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258104.1 protein_id gnl|my_center|LOCUS_01260 127671 127480 gene locus_tag LOCUS_01270 127671 127480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 129498 127855 gene locus_tag LOCUS_01280 gene glgP 129498 127855 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871155.1 protein_id gnl|my_center|LOCUS_01280 130298 129714 gene locus_tag LOCUS_01290 130298 129714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 130826 130308 gene locus_tag LOCUS_01300 130826 130308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 132855 130867 gene locus_tag LOCUS_01310 132855 130867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 137560 132866 gene locus_tag LOCUS_01320 137560 132866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 138115 139011 gene locus_tag LOCUS_01330 138115 139011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 138978 139352 gene locus_tag LOCUS_01340 138978 139352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 139574 142468 gene locus_tag LOCUS_01350 139574 142468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 142636 143922 gene locus_tag LOCUS_01360 142636 143922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 143949 145328 gene locus_tag LOCUS_01370 143949 145328 CDS product T9SS type A sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964550.1 protein_id gnl|my_center|LOCUS_01370 145426 147927 gene locus_tag LOCUS_01380 145426 147927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 147932 148633 gene locus_tag LOCUS_01390 147932 148633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 150232 148739 gene locus_tag LOCUS_01400 150232 148739 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_01400 152223 150250 gene locus_tag LOCUS_01410 152223 150250 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_01410 152684 152238 gene locus_tag LOCUS_01420 152684 152238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 153808 154143 gene locus_tag LOCUS_01430 153808 154143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 154660 157722 gene locus_tag LOCUS_01440 154660 157722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 157784 158416 gene locus_tag LOCUS_01450 157784 158416 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944228.1 protein_id gnl|my_center|LOCUS_01450 158549 159721 gene locus_tag LOCUS_01460 158549 159721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 159965 160600 gene locus_tag LOCUS_01470 159965 160600 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719850.1 protein_id gnl|my_center|LOCUS_01470 160719 161201 gene locus_tag LOCUS_01480 160719 161201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 161188 161991 gene locus_tag LOCUS_01490 161188 161991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 162009 162818 gene locus_tag LOCUS_01500 162009 162818 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258316.1 protein_id gnl|my_center|LOCUS_01500 162847 164016 gene locus_tag LOCUS_01510 162847 164016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 164049 164729 gene locus_tag LOCUS_01520 164049 164729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 164898 165116 gene locus_tag LOCUS_01530 164898 165116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 165147 166484 gene locus_tag LOCUS_01540 165147 166484 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147744042.1 protein_id gnl|my_center|LOCUS_01540 166558 167973 gene locus_tag LOCUS_01550 166558 167973 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729117.1 protein_id gnl|my_center|LOCUS_01550 169031 168390 gene locus_tag LOCUS_01560 169031 168390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 170767 170084 gene locus_tag LOCUS_01570 170767 170084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 171446 171616 gene locus_tag LOCUS_01580 171446 171616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 172722 172246 gene locus_tag LOCUS_01590 172722 172246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 173806 172724 gene locus_tag LOCUS_01600 173806 172724 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211252.1 protein_id gnl|my_center|LOCUS_01600 175303 173837 gene locus_tag LOCUS_01610 175303 173837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 176090 175398 gene locus_tag LOCUS_01620 176090 175398 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366897.1 protein_id gnl|my_center|LOCUS_01620 176729 176106 gene locus_tag LOCUS_01630 176729 176106 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966926.1 protein_id gnl|my_center|LOCUS_01630 177879 176734 gene locus_tag LOCUS_01640 177879 176734 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967289.1 protein_id gnl|my_center|LOCUS_01640 178742 177897 gene locus_tag LOCUS_01650 178742 177897 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263344.1 protein_id gnl|my_center|LOCUS_01650 178911 179807 gene locus_tag LOCUS_01660 178911 179807 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786279.1 protein_id gnl|my_center|LOCUS_01660 181025 179925 gene locus_tag LOCUS_01670 181025 179925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 181718 181038 gene locus_tag LOCUS_01680 181718 181038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 183837 181768 gene locus_tag LOCUS_01690 183837 181768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 184830 183901 gene locus_tag LOCUS_01700 184830 183901 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962250.1 protein_id gnl|my_center|LOCUS_01700 185376 185008 gene locus_tag LOCUS_01710 185376 185008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 188706 185389 gene locus_tag LOCUS_01720 188706 185389 CDS product TaqI-like C-terminal specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962421.1 protein_id gnl|my_center|LOCUS_01720 190710 188968 gene locus_tag LOCUS_01730 190710 188968 CDS product DUF3987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107908.1 protein_id gnl|my_center|LOCUS_01730 191615 190707 gene locus_tag LOCUS_01740 191615 190707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 191898 191602 gene locus_tag LOCUS_01750 191898 191602 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202678.1 protein_id gnl|my_center|LOCUS_01750 192197 191895 gene locus_tag LOCUS_01760 192197 191895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 193298 192354 gene locus_tag LOCUS_01770 193298 192354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 194392 193298 gene locus_tag LOCUS_01780 194392 193298 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361999.1 protein_id gnl|my_center|LOCUS_01780 194764 194399 gene locus_tag LOCUS_01790 194764 194399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 196360 194972 gene locus_tag LOCUS_01800 gene mnmE 196360 194972 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962791.1 protein_id gnl|my_center|LOCUS_01800 197204 196374 gene locus_tag LOCUS_01810 197204 196374 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962641.1 protein_id gnl|my_center|LOCUS_01810 197629 197291 gene locus_tag LOCUS_01820 197629 197291 CDS product DUF2853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963785.1 protein_id gnl|my_center|LOCUS_01820 199484 197724 gene locus_tag LOCUS_01830 gene menD 199484 197724 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963786.1 protein_id gnl|my_center|LOCUS_01830 200655 199534 gene locus_tag LOCUS_01840 200655 199534 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962818.1 protein_id gnl|my_center|LOCUS_01840 201083 200658 gene locus_tag LOCUS_01850 201083 200658 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962819.1 protein_id gnl|my_center|LOCUS_01850 201279 201851 gene locus_tag LOCUS_01860 201279 201851 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962847.1 protein_id gnl|my_center|LOCUS_01860 202537 201848 gene locus_tag LOCUS_01870 202537 201848 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203544.1 protein_id gnl|my_center|LOCUS_01870 204062 202626 gene locus_tag LOCUS_01880 204062 202626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 205227 204280 gene locus_tag LOCUS_01890 205227 204280 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983101.1 protein_id gnl|my_center|LOCUS_01890 207340 205433 gene locus_tag LOCUS_01900 gene dnaK 207340 205433 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963020.1 protein_id gnl|my_center|LOCUS_01900 207512 208933 gene locus_tag LOCUS_01910 207512 208933 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 protein_id gnl|my_center|LOCUS_01910 209396 208938 gene locus_tag LOCUS_01920 209396 208938 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840149.1 protein_id gnl|my_center|LOCUS_01920 209521 210339 gene locus_tag LOCUS_01930 gene panB 209521 210339 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963041.1 protein_id gnl|my_center|LOCUS_01930 210382 210648 gene locus_tag LOCUS_01940 210382 210648 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963264.1 protein_id gnl|my_center|LOCUS_01940 210705 211400 gene locus_tag LOCUS_01950 210705 211400 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963043.1 protein_id gnl|my_center|LOCUS_01950 211432 212802 gene locus_tag LOCUS_01960 211432 212802 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963044.1 protein_id gnl|my_center|LOCUS_01960 213545 212799 gene locus_tag LOCUS_01970 213545 212799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 214327 213581 gene locus_tag LOCUS_01980 214327 213581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 214799 214290 gene locus_tag LOCUS_01990 214799 214290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 215503 214868 gene locus_tag LOCUS_02000 215503 214868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 215954 215496 gene locus_tag LOCUS_02010 215954 215496 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963844.1 protein_id gnl|my_center|LOCUS_02010 216112 217314 gene locus_tag LOCUS_02020 216112 217314 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963843.1 protein_id gnl|my_center|LOCUS_02020 217440 218921 gene locus_tag LOCUS_02030 217440 218921 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_02030 >Feature sequence002 80 1369 gene locus_tag LOCUS_02040 80 1369 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_02040 1381 2052 gene locus_tag LOCUS_02050 gene tsaB 1381 2052 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_02050 2407 2054 gene locus_tag LOCUS_02060 2407 2054 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257550.1 protein_id gnl|my_center|LOCUS_02060 4440 2404 gene locus_tag LOCUS_02070 4440 2404 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_02070 4786 4586 gene locus_tag LOCUS_02080 4786 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 5841 4939 gene locus_tag LOCUS_02090 5841 4939 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964201.1 protein_id gnl|my_center|LOCUS_02090 6012 7013 gene locus_tag LOCUS_02100 6012 7013 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964200.1 protein_id gnl|my_center|LOCUS_02100 7018 7530 gene locus_tag LOCUS_02110 7018 7530 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_02110 7523 8614 gene locus_tag LOCUS_02120 7523 8614 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929131.1 protein_id gnl|my_center|LOCUS_02120 9406 8618 gene locus_tag LOCUS_02130 gene murI 9406 8618 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964198.1 protein_id gnl|my_center|LOCUS_02130 9971 9465 gene locus_tag LOCUS_02140 9971 9465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 11014 10001 gene locus_tag LOCUS_02150 11014 10001 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964196.1 protein_id gnl|my_center|LOCUS_02150 13766 11193 gene locus_tag LOCUS_02160 gene bamA 13766 11193 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100221.1 protein_id gnl|my_center|LOCUS_02160 14517 13777 gene locus_tag LOCUS_02170 14517 13777 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964194.1 protein_id gnl|my_center|LOCUS_02170 15207 14521 gene locus_tag LOCUS_02180 15207 14521 CDS product DUF6089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964193.1 protein_id gnl|my_center|LOCUS_02180 16192 15308 gene locus_tag LOCUS_02190 16192 15308 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_02190 16855 16196 gene locus_tag LOCUS_02200 16855 16196 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964191.1 protein_id gnl|my_center|LOCUS_02200 16945 17658 gene locus_tag LOCUS_02210 16945 17658 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964190.1 protein_id gnl|my_center|LOCUS_02210 17655 18428 gene locus_tag LOCUS_02220 17655 18428 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_02220 18555 18908 gene locus_tag LOCUS_02230 18555 18908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 19047 20375 gene locus_tag LOCUS_02240 19047 20375 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964185.1 protein_id gnl|my_center|LOCUS_02240 20531 21205 gene locus_tag LOCUS_02250 gene clpP 20531 21205 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964184.1 protein_id gnl|my_center|LOCUS_02250 21281 22459 gene locus_tag LOCUS_02260 gene clpX 21281 22459 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964183.1 protein_id gnl|my_center|LOCUS_02260 21640 21664 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24207 22693 gene locus_tag LOCUS_02270 24207 22693 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_02270 24250 25047 gene locus_tag LOCUS_02280 24250 25047 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962570.1 protein_id gnl|my_center|LOCUS_02280 27682 25040 gene locus_tag LOCUS_02290 27682 25040 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962569.1 protein_id gnl|my_center|LOCUS_02290 28481 27777 gene locus_tag LOCUS_02300 28481 27777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 28551 29684 gene locus_tag LOCUS_02310 gene folK 28551 29684 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962567.1 protein_id gnl|my_center|LOCUS_02310 30266 29787 gene locus_tag LOCUS_02320 30266 29787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 30932 30396 gene locus_tag LOCUS_02330 30932 30396 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_02330 31052 33655 gene locus_tag LOCUS_02340 gene mutS 31052 33655 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962564.1 protein_id gnl|my_center|LOCUS_02340 33752 33824 gene locus_tag LOCUS_t00020 33752 33824 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 33853 33937 gene locus_tag LOCUS_t00030 33853 33937 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 35002 34205 gene locus_tag LOCUS_02350 35002 34205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 36426 35272 gene locus_tag LOCUS_02360 36426 35272 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 protein_id gnl|my_center|LOCUS_02360 36670 37824 gene locus_tag LOCUS_02370 36670 37824 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_02370 37817 38839 gene locus_tag LOCUS_02380 gene galE 37817 38839 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962575.1 protein_id gnl|my_center|LOCUS_02380 39462 38974 gene locus_tag LOCUS_02390 gene lspA 39462 38974 CDS product lipoprotein signal peptidase LspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642185.1 protein_id gnl|my_center|LOCUS_02390 40353 39472 gene locus_tag LOCUS_02400 gene fabD 40353 39472 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962577.1 protein_id gnl|my_center|LOCUS_02400 42006 40450 gene locus_tag LOCUS_02410 42006 40450 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_02410 42948 42040 gene locus_tag LOCUS_02420 42948 42040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 43246 43542 gene locus_tag LOCUS_02430 43246 43542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 44419 43589 gene locus_tag LOCUS_02440 44419 43589 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962504.1 protein_id gnl|my_center|LOCUS_02440 45773 44544 gene locus_tag LOCUS_02450 45773 44544 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963821.1 protein_id gnl|my_center|LOCUS_02450 46439 45825 gene locus_tag LOCUS_02460 46439 45825 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_02460 47517 46558 gene locus_tag LOCUS_02470 47517 46558 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_02470 48295 47549 gene locus_tag LOCUS_02480 48295 47549 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_02480 48508 49485 gene locus_tag LOCUS_02490 48508 49485 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_02490 49549 50547 gene locus_tag LOCUS_02500 49549 50547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02500 50540 52012 gene locus_tag LOCUS_02510 50540 52012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02510 53672 52017 gene locus_tag LOCUS_02520 gene sulP 53672 52017 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 protein_id gnl|my_center|LOCUS_02520 53920 54447 gene locus_tag LOCUS_02530 53920 54447 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962510.1 protein_id gnl|my_center|LOCUS_02530 54578 56947 gene locus_tag LOCUS_02540 54578 56947 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_02540 57644 57030 gene locus_tag LOCUS_02550 57644 57030 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_02550 58425 57649 gene locus_tag LOCUS_02560 58425 57649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 58590 58775 gene locus_tag LOCUS_02570 58590 58775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 58772 59047 gene locus_tag LOCUS_02580 58772 59047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 59315 59022 gene locus_tag LOCUS_02590 59315 59022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 60671 59427 gene locus_tag LOCUS_02600 60671 59427 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118454.1 protein_id gnl|my_center|LOCUS_02600 60913 61782 gene locus_tag LOCUS_02610 60913 61782 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_02610 61779 62807 gene locus_tag LOCUS_02620 61779 62807 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699793.1 protein_id gnl|my_center|LOCUS_02620 64061 62808 gene locus_tag LOCUS_02630 gene metK 64061 62808 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962442.1 protein_id gnl|my_center|LOCUS_02630 64633 66318 gene locus_tag LOCUS_02640 gene ilvD 64633 66318 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962618.1 protein_id gnl|my_center|LOCUS_02640 66328 68061 gene locus_tag LOCUS_02650 gene ilvB 66328 68061 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962617.1 protein_id gnl|my_center|LOCUS_02650 68075 68608 gene locus_tag LOCUS_02660 gene ilvN 68075 68608 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_02660 68624 70099 gene locus_tag LOCUS_02670 gene ilvC 68624 70099 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024919.1 protein_id gnl|my_center|LOCUS_02670 70125 71390 gene locus_tag LOCUS_02680 gene ilvA 70125 71390 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962614.1 protein_id gnl|my_center|LOCUS_02680 71567 73159 gene locus_tag LOCUS_02690 71567 73159 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941484.1 protein_id gnl|my_center|LOCUS_02690 73664 74278 gene locus_tag LOCUS_02700 73664 74278 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108960.1 protein_id gnl|my_center|LOCUS_02700 74275 75459 gene locus_tag LOCUS_02710 74275 75459 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778881.1 protein_id gnl|my_center|LOCUS_02710 75464 76441 gene locus_tag LOCUS_02720 gene argC 75464 76441 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762696.1 protein_id gnl|my_center|LOCUS_02720 76463 77257 gene locus_tag LOCUS_02730 gene proC 76463 77257 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962247.1 protein_id gnl|my_center|LOCUS_02730 77260 78405 gene locus_tag LOCUS_02740 77260 78405 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762695.1 protein_id gnl|my_center|LOCUS_02740 78472 79668 gene locus_tag LOCUS_02750 78472 79668 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287452.1 protein_id gnl|my_center|LOCUS_02750 79671 80435 gene locus_tag LOCUS_02760 79671 80435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 80443 81384 gene locus_tag LOCUS_02770 80443 81384 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202024.1 protein_id gnl|my_center|LOCUS_02770 81429 82205 gene locus_tag LOCUS_02780 gene argB 81429 82205 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783875.1 protein_id gnl|my_center|LOCUS_02780 82207 83274 gene locus_tag LOCUS_02790 82207 83274 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767146.1 protein_id gnl|my_center|LOCUS_02790 83421 84695 gene locus_tag LOCUS_02800 gene argH 83421 84695 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784384.1 protein_id gnl|my_center|LOCUS_02800 84714 85682 gene locus_tag LOCUS_02810 84714 85682 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463386.1 protein_id gnl|my_center|LOCUS_02810 86880 85762 gene locus_tag LOCUS_02820 gene leuB 86880 85762 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789841.1 protein_id gnl|my_center|LOCUS_02820 88074 86899 gene locus_tag LOCUS_02830 88074 86899 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763196.1 protein_id gnl|my_center|LOCUS_02830 88223 89773 gene locus_tag LOCUS_02840 88223 89773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 90102 91376 gene locus_tag LOCUS_02850 90102 91376 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962432.1 protein_id gnl|my_center|LOCUS_02850 91393 94794 gene locus_tag LOCUS_02860 91393 94794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 94907 96079 gene locus_tag LOCUS_02870 94907 96079 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 protein_id gnl|my_center|LOCUS_02870 96093 96530 gene locus_tag LOCUS_02880 96093 96530 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_02880 96676 96939 gene locus_tag LOCUS_02890 96676 96939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 96927 97571 gene locus_tag LOCUS_02900 96927 97571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 97584 98495 gene locus_tag LOCUS_02910 gene cysD 97584 98495 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002735002.1 protein_id gnl|my_center|LOCUS_02910 98627 99874 gene locus_tag LOCUS_02920 98627 99874 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_02920 99923 102019 gene locus_tag LOCUS_02930 99923 102019 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_02930 102048 102824 gene locus_tag LOCUS_02940 gene cobA 102048 102824 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496681.1 protein_id gnl|my_center|LOCUS_02940 102833 103417 gene locus_tag LOCUS_02950 102833 103417 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880784.1 protein_id gnl|my_center|LOCUS_02950 103420 104469 gene locus_tag LOCUS_02960 103420 104469 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963782.1 protein_id gnl|my_center|LOCUS_02960 104575 105255 gene locus_tag LOCUS_02970 104575 105255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 105242 106132 gene locus_tag LOCUS_02980 gene cysM 105242 106132 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102419.1 protein_id gnl|my_center|LOCUS_02980 106378 107382 gene locus_tag LOCUS_02990 106378 107382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02990 107388 110063 gene locus_tag LOCUS_03000 107388 110063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03000 110114 110359 gene locus_tag LOCUS_03010 110114 110359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112513.1 protein_id gnl|my_center|LOCUS_03010 110356 111312 gene locus_tag LOCUS_03020 gene metF 110356 111312 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792069.1 protein_id gnl|my_center|LOCUS_03020 111349 112449 gene locus_tag LOCUS_03030 111349 112449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 112446 113192 gene locus_tag LOCUS_03040 112446 113192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 114089 113193 gene locus_tag LOCUS_03050 gene gldA 114089 113193 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_03050 114461 115288 gene locus_tag LOCUS_03060 114461 115288 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962426.1 protein_id gnl|my_center|LOCUS_03060 115285 116430 gene locus_tag LOCUS_03070 115285 116430 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962425.1 protein_id gnl|my_center|LOCUS_03070 116515 117366 gene locus_tag LOCUS_03080 116515 117366 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179240768.1 protein_id gnl|my_center|LOCUS_03080 117427 117490 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 117500 118336 gene locus_tag LOCUS_03090 117500 118336 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_03090 119038 118376 gene locus_tag LOCUS_03100 119038 118376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 119140 120090 gene locus_tag LOCUS_03110 gene rsgA 119140 120090 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962423.1 protein_id gnl|my_center|LOCUS_03110 120091 120543 gene locus_tag LOCUS_03120 gene dtd 120091 120543 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962422.1 protein_id gnl|my_center|LOCUS_03120 121048 122106 gene locus_tag LOCUS_03130 121048 122106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 122076 122099 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 122334 122858 gene locus_tag LOCUS_03140 122334 122858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 >Feature sequence003 245 1504 gene locus_tag LOCUS_03150 245 1504 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_03150 1764 2528 gene locus_tag LOCUS_03160 1764 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 3179 2571 gene locus_tag LOCUS_03170 gene udg 3179 2571 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147255.1 protein_id gnl|my_center|LOCUS_03170 4473 3130 gene locus_tag LOCUS_03180 4473 3130 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_03180 5032 4499 gene locus_tag LOCUS_03190 5032 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 6086 5025 gene locus_tag LOCUS_03200 6086 5025 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256572.1 protein_id gnl|my_center|LOCUS_03200 6191 6676 gene locus_tag LOCUS_03210 6191 6676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185130035.1 protein_id gnl|my_center|LOCUS_03210 7276 6671 gene locus_tag LOCUS_03220 7276 6671 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203441.1 protein_id gnl|my_center|LOCUS_03220 7390 8628 gene locus_tag LOCUS_03230 7390 8628 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766892.1 protein_id gnl|my_center|LOCUS_03230 9010 12318 gene locus_tag LOCUS_03240 9010 12318 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_03240 12335 13768 gene locus_tag LOCUS_03250 12335 13768 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767524.1 protein_id gnl|my_center|LOCUS_03250 14015 15412 gene locus_tag LOCUS_03260 14015 15412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 15588 17102 gene locus_tag LOCUS_03270 15588 17102 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964485.1 protein_id gnl|my_center|LOCUS_03270 17089 17592 gene locus_tag LOCUS_03280 17089 17592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 18209 18670 gene locus_tag LOCUS_03290 18209 18670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 18929 19666 gene locus_tag LOCUS_03300 18929 19666 CDS product RteC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107773.1 protein_id gnl|my_center|LOCUS_03300 20135 20413 gene locus_tag LOCUS_03310 20135 20413 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963652.1 protein_id gnl|my_center|LOCUS_03310 21396 22058 gene locus_tag LOCUS_03320 21396 22058 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963683.1 protein_id gnl|my_center|LOCUS_03320 22101 22724 gene locus_tag LOCUS_03330 22101 22724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963682.1 protein_id gnl|my_center|LOCUS_03330 23115 23714 gene locus_tag LOCUS_03340 23115 23714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 23725 25236 gene locus_tag LOCUS_03350 23725 25236 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_03350 25236 26555 gene locus_tag LOCUS_03360 25236 26555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 26559 27074 gene locus_tag LOCUS_03370 26559 27074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 27071 28408 gene locus_tag LOCUS_03380 27071 28408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 28422 28655 gene locus_tag LOCUS_03390 28422 28655 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107539.1 protein_id gnl|my_center|LOCUS_03390 28655 29002 gene locus_tag LOCUS_03400 28655 29002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 29013 29708 gene locus_tag LOCUS_03410 29013 29708 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485361.1 protein_id gnl|my_center|LOCUS_03410 29709 30206 gene locus_tag LOCUS_03420 29709 30206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485363.1 protein_id gnl|my_center|LOCUS_03420 30178 30471 gene locus_tag LOCUS_03430 30178 30471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 30579 33704 gene locus_tag LOCUS_03440 30579 33704 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938992.1 protein_id gnl|my_center|LOCUS_03440 33704 34405 gene locus_tag LOCUS_03450 33704 34405 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939808.1 protein_id gnl|my_center|LOCUS_03450 36234 35995 gene locus_tag LOCUS_03460 36234 35995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964410.1 protein_id gnl|my_center|LOCUS_03460 36634 36188 gene locus_tag LOCUS_03470 36634 36188 CDS product DUF5675 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963661.1 protein_id gnl|my_center|LOCUS_03470 37392 36637 gene locus_tag LOCUS_03480 37392 36637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963660.1 protein_id gnl|my_center|LOCUS_03480 37562 37756 gene locus_tag LOCUS_03490 37562 37756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143387514.1 protein_id gnl|my_center|LOCUS_03490 38190 38588 gene locus_tag LOCUS_03500 38190 38588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 40148 38808 gene locus_tag LOCUS_03510 40148 38808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 40828 40388 gene locus_tag LOCUS_03520 40828 40388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 41432 40905 gene locus_tag LOCUS_03530 41432 40905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 41969 41553 gene locus_tag LOCUS_03540 41969 41553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 43368 41989 gene locus_tag LOCUS_03550 43368 41989 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926478.1 protein_id gnl|my_center|LOCUS_03550 44211 43369 gene locus_tag LOCUS_03560 44211 43369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 44691 44266 gene locus_tag LOCUS_03570 44691 44266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 45557 44703 gene locus_tag LOCUS_03580 45557 44703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 46446 45616 gene locus_tag LOCUS_03590 46446 45616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 47304 46459 gene locus_tag LOCUS_03600 47304 46459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 48177 47323 gene locus_tag LOCUS_03610 48177 47323 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765729.1 protein_id gnl|my_center|LOCUS_03610 49970 48252 gene locus_tag LOCUS_03620 49970 48252 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143956636.1 protein_id gnl|my_center|LOCUS_03620 50088 50534 gene locus_tag LOCUS_03630 50088 50534 CDS product DUF2267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228678.1 protein_id gnl|my_center|LOCUS_03630 50542 51207 gene locus_tag LOCUS_03640 50542 51207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 51197 51847 gene locus_tag LOCUS_03650 51197 51847 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957597.1 protein_id gnl|my_center|LOCUS_03650 54298 53405 gene locus_tag LOCUS_03660 54298 53405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 55436 54381 gene locus_tag LOCUS_03670 55436 54381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 57402 55522 gene locus_tag LOCUS_03680 57402 55522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 57565 57975 gene locus_tag LOCUS_03690 57565 57975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 57978 58376 gene locus_tag LOCUS_03700 57978 58376 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_03700 58366 58665 gene locus_tag LOCUS_03710 gene trxA 58366 58665 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963919.1 protein_id gnl|my_center|LOCUS_03710 58747 59376 gene locus_tag LOCUS_03720 58747 59376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 59373 60461 gene locus_tag LOCUS_03730 59373 60461 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403786.1 protein_id gnl|my_center|LOCUS_03730 60643 61530 gene locus_tag LOCUS_03740 60643 61530 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789714.1 protein_id gnl|my_center|LOCUS_03740 61527 61826 gene locus_tag LOCUS_03750 61527 61826 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802742.1 protein_id gnl|my_center|LOCUS_03750 62198 61848 gene locus_tag LOCUS_03760 62198 61848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 62429 63103 gene locus_tag LOCUS_03770 62429 63103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 63171 64136 gene locus_tag LOCUS_03780 63171 64136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 65119 64871 gene locus_tag LOCUS_03790 65119 64871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 65118 66020 gene locus_tag LOCUS_03800 65118 66020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 66210 66878 gene locus_tag LOCUS_03810 66210 66878 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833887.1 protein_id gnl|my_center|LOCUS_03810 67229 67023 gene locus_tag LOCUS_03820 67229 67023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 68400 67408 gene locus_tag LOCUS_03830 68400 67408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 69193 68411 gene locus_tag LOCUS_03840 69193 68411 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_03840 69828 69190 gene locus_tag LOCUS_03850 69828 69190 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880179.1 protein_id gnl|my_center|LOCUS_03850 70103 70705 gene locus_tag LOCUS_03860 70103 70705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 72623 70920 gene locus_tag LOCUS_03870 72623 70920 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_03870 72996 72628 gene locus_tag LOCUS_03880 72996 72628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 73151 73531 gene locus_tag LOCUS_03890 73151 73531 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964297.1 protein_id gnl|my_center|LOCUS_03890 73642 74421 gene locus_tag LOCUS_03900 73642 74421 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933543.1 protein_id gnl|my_center|LOCUS_03900 74480 74719 gene locus_tag LOCUS_03910 74480 74719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 74756 75475 gene locus_tag LOCUS_03920 74756 75475 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_03920 75540 76427 gene locus_tag LOCUS_03930 75540 76427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 77498 76467 gene locus_tag LOCUS_03940 gene ldhA 77498 76467 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762218.1 protein_id gnl|my_center|LOCUS_03940 78082 77501 gene locus_tag LOCUS_03950 78082 77501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 78259 78330 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 79330 78356 gene locus_tag LOCUS_03960 79330 78356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 81090 82046 gene locus_tag LOCUS_03970 81090 82046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 82163 83917 gene locus_tag LOCUS_03980 82163 83917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 84145 85014 gene locus_tag LOCUS_03990 84145 85014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 85104 85856 gene locus_tag LOCUS_04000 85104 85856 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088485.1 protein_id gnl|my_center|LOCUS_04000 85869 87338 gene locus_tag LOCUS_04010 85869 87338 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088589.1 protein_id gnl|my_center|LOCUS_04010 87404 87934 gene locus_tag LOCUS_04020 87404 87934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 87981 88415 gene locus_tag LOCUS_04030 87981 88415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 88473 89027 gene locus_tag LOCUS_04040 88473 89027 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076327.1 protein_id gnl|my_center|LOCUS_04040 89554 90036 gene locus_tag LOCUS_04050 89554 90036 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241839.1 protein_id gnl|my_center|LOCUS_04050 90520 90852 gene locus_tag LOCUS_04060 90520 90852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04060 91073 91246 gene locus_tag LOCUS_04070 91073 91246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 91833 91402 gene locus_tag LOCUS_04080 91833 91402 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930578.1 protein_id gnl|my_center|LOCUS_04080 91976 92479 gene locus_tag LOCUS_04090 91976 92479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 92485 93054 gene locus_tag LOCUS_04100 92485 93054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 93073 95037 gene locus_tag LOCUS_04110 gene nosZ 93073 95037 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838072.1 protein_id gnl|my_center|LOCUS_04110 95195 95827 gene locus_tag LOCUS_04120 95195 95827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808194.1 protein_id gnl|my_center|LOCUS_04120 95857 96291 gene locus_tag LOCUS_04130 95857 96291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 96369 97556 gene locus_tag LOCUS_04140 96369 97556 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550379.1 protein_id gnl|my_center|LOCUS_04140 97553 98263 gene locus_tag LOCUS_04150 97553 98263 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948483.1 protein_id gnl|my_center|LOCUS_04150 98256 99038 gene locus_tag LOCUS_04160 98256 99038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 99101 99823 gene locus_tag LOCUS_04170 gene ric 99101 99823 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073961.1 protein_id gnl|my_center|LOCUS_04170 102545 99915 gene locus_tag LOCUS_04180 102545 99915 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085500226.1 protein_id gnl|my_center|LOCUS_04180 103749 102760 gene locus_tag LOCUS_04190 103749 102760 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211618.1 protein_id gnl|my_center|LOCUS_04190 104005 105657 gene locus_tag LOCUS_04200 104005 105657 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_04200 106017 105865 gene locus_tag LOCUS_04210 106017 105865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 106507 108480 gene locus_tag LOCUS_04220 106507 108480 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962880.1 protein_id gnl|my_center|LOCUS_04220 110449 108638 gene locus_tag LOCUS_04230 110449 108638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 >Feature sequence004 1522 410 gene locus_tag LOCUS_04240 1522 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 3719 1668 gene locus_tag LOCUS_04250 3719 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 4324 3731 gene locus_tag LOCUS_04260 4324 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 4790 4575 gene locus_tag LOCUS_04270 4790 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 4986 4753 gene locus_tag LOCUS_04280 4986 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 6433 5096 gene locus_tag LOCUS_04290 6433 5096 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085466.1 protein_id gnl|my_center|LOCUS_04290 7062 6622 gene locus_tag LOCUS_04300 7062 6622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 7576 7088 gene locus_tag LOCUS_04310 7576 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 7985 7722 gene locus_tag LOCUS_04320 7985 7722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04320 8633 8064 gene locus_tag LOCUS_04330 8633 8064 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_04330 9120 8659 gene locus_tag LOCUS_04340 9120 8659 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173510078.1 protein_id gnl|my_center|LOCUS_04340 9529 9299 gene locus_tag LOCUS_04350 9529 9299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 10255 9746 gene locus_tag LOCUS_04360 gene nadD 10255 9746 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962322.1 protein_id gnl|my_center|LOCUS_04360 10907 10335 gene locus_tag LOCUS_04370 gene gmk 10907 10335 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962519.1 protein_id gnl|my_center|LOCUS_04370 11752 10907 gene locus_tag LOCUS_04380 11752 10907 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_04380 13004 12030 gene locus_tag LOCUS_04390 13004 12030 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_04390 14652 13111 gene locus_tag LOCUS_04400 14652 13111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 16651 14723 gene locus_tag LOCUS_04410 16651 14723 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_04410 19598 16680 gene locus_tag LOCUS_04420 19598 16680 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_04420 21108 19642 gene locus_tag LOCUS_04430 21108 19642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 22808 21120 gene locus_tag LOCUS_04440 22808 21120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 23641 22808 gene locus_tag LOCUS_04450 gene murQ 23641 22808 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962884.1 protein_id gnl|my_center|LOCUS_04450 25887 23638 gene locus_tag LOCUS_04460 25887 23638 CDS product DUF6259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108900.1 protein_id gnl|my_center|LOCUS_04460 27428 25953 gene locus_tag LOCUS_04470 27428 25953 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_04470 28680 27496 gene locus_tag LOCUS_04480 28680 27496 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_04480 30436 28949 gene locus_tag LOCUS_04490 30436 28949 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714626.1 protein_id gnl|my_center|LOCUS_04490 33637 30449 gene locus_tag LOCUS_04500 33637 30449 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121850300.1 protein_id gnl|my_center|LOCUS_04500 34881 33772 gene locus_tag LOCUS_04510 34881 33772 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762566.1 protein_id gnl|my_center|LOCUS_04510 35048 35797 gene locus_tag LOCUS_04520 35048 35797 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096592.1 protein_id gnl|my_center|LOCUS_04520 35824 37068 gene locus_tag LOCUS_04530 35824 37068 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100706.1 protein_id gnl|my_center|LOCUS_04530 37104 38351 gene locus_tag LOCUS_04540 37104 38351 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100706.1 protein_id gnl|my_center|LOCUS_04540 38441 38980 gene locus_tag LOCUS_04550 38441 38980 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885396.1 protein_id gnl|my_center|LOCUS_04550 40003 39065 gene locus_tag LOCUS_04560 40003 39065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 40136 41137 gene locus_tag LOCUS_04570 40136 41137 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962320.1 protein_id gnl|my_center|LOCUS_04570 41377 42375 gene locus_tag LOCUS_04580 41377 42375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 42796 42401 gene locus_tag LOCUS_04590 42796 42401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 42963 45506 gene locus_tag LOCUS_04600 42963 45506 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963253.1 protein_id gnl|my_center|LOCUS_04600 45496 46728 gene locus_tag LOCUS_04610 45496 46728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 47320 46730 gene locus_tag LOCUS_04620 47320 46730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 48763 47336 gene locus_tag LOCUS_04630 48763 47336 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783789.1 protein_id gnl|my_center|LOCUS_04630 51906 48769 gene locus_tag LOCUS_04640 51906 48769 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783792.1 protein_id gnl|my_center|LOCUS_04640 53052 51919 gene locus_tag LOCUS_04650 53052 51919 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932957.1 protein_id gnl|my_center|LOCUS_04650 53563 53066 gene locus_tag LOCUS_04660 53563 53066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 54710 53691 gene locus_tag LOCUS_04670 gene pheS 54710 53691 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962303.1 protein_id gnl|my_center|LOCUS_04670 55341 54985 gene locus_tag LOCUS_04680 55341 54985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_04680 55515 56048 gene locus_tag LOCUS_04690 55515 56048 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962305.1 protein_id gnl|my_center|LOCUS_04690 56681 56055 gene locus_tag LOCUS_04700 gene can 56681 56055 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964129.1 protein_id gnl|my_center|LOCUS_04700 57471 56722 gene locus_tag LOCUS_04710 57471 56722 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962306.1 protein_id gnl|my_center|LOCUS_04710 59245 57473 gene locus_tag LOCUS_04720 59245 57473 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099968.1 protein_id gnl|my_center|LOCUS_04720 60163 59315 gene locus_tag LOCUS_04730 60163 59315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 61288 60251 gene locus_tag LOCUS_04740 61288 60251 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_04740 62405 61401 gene locus_tag LOCUS_04750 62405 61401 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_04750 64135 62405 gene locus_tag LOCUS_04760 64135 62405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962312.1 protein_id gnl|my_center|LOCUS_04760 64952 64086 gene locus_tag LOCUS_04770 64952 64086 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_04770 66033 65029 gene locus_tag LOCUS_04780 66033 65029 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_04780 67350 66217 gene locus_tag LOCUS_04790 67350 66217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 67573 68325 gene locus_tag LOCUS_04800 67573 68325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 68355 69488 gene locus_tag LOCUS_04810 68355 69488 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038509176.1 protein_id gnl|my_center|LOCUS_04810 71197 69644 gene locus_tag LOCUS_04820 71197 69644 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_04820 71321 72361 gene locus_tag LOCUS_04830 71321 72361 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275150.1 protein_id gnl|my_center|LOCUS_04830 72354 72662 gene locus_tag LOCUS_04840 72354 72662 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168851.1 protein_id gnl|my_center|LOCUS_04840 73575 72667 gene locus_tag LOCUS_04850 73575 72667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 74073 73597 gene locus_tag LOCUS_04860 74073 73597 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784138.1 protein_id gnl|my_center|LOCUS_04860 74732 74070 gene locus_tag LOCUS_04870 74732 74070 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042743.1 protein_id gnl|my_center|LOCUS_04870 74775 75872 gene locus_tag LOCUS_04880 gene dinB 74775 75872 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974700.1 protein_id gnl|my_center|LOCUS_04880 77383 75941 gene locus_tag LOCUS_04890 gene pyk 77383 75941 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962380.1 protein_id gnl|my_center|LOCUS_04890 77868 77383 gene locus_tag LOCUS_04900 77868 77383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 78597 77995 gene locus_tag LOCUS_04910 gene rnc 78597 77995 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962378.1 protein_id gnl|my_center|LOCUS_04910 79987 78737 gene locus_tag LOCUS_04920 gene fabF 79987 78737 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962377.1 protein_id gnl|my_center|LOCUS_04920 80232 79999 gene locus_tag LOCUS_04930 80232 79999 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007137004.1 protein_id gnl|my_center|LOCUS_04930 80417 80989 gene locus_tag LOCUS_04940 gene purN 80417 80989 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796813.1 protein_id gnl|my_center|LOCUS_04940 >Feature sequence005 564 136 gene locus_tag LOCUS_04950 564 136 CDS product CHRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088650.1 protein_id gnl|my_center|LOCUS_04950 974 852 gene locus_tag LOCUS_04960 974 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 2671 1331 gene locus_tag LOCUS_04970 2671 1331 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_04970 2832 3221 gene locus_tag LOCUS_04980 2832 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 3505 6282 gene locus_tag LOCUS_04990 3505 6282 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109087.1 protein_id gnl|my_center|LOCUS_04990 6372 8609 gene locus_tag LOCUS_05000 6372 8609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 8977 8666 gene locus_tag LOCUS_05010 8977 8666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 9397 10587 gene locus_tag LOCUS_05020 9397 10587 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037719.1 protein_id gnl|my_center|LOCUS_05020 10656 12977 gene locus_tag LOCUS_05030 10656 12977 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766433.1 protein_id gnl|my_center|LOCUS_05030 13782 13036 gene locus_tag LOCUS_05040 13782 13036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 14293 13793 gene locus_tag LOCUS_05050 14293 13793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 16934 14463 gene locus_tag LOCUS_05060 16934 14463 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962626.1 protein_id gnl|my_center|LOCUS_05060 18110 17130 gene locus_tag LOCUS_05070 18110 17130 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_05070 18991 18425 gene locus_tag LOCUS_05080 18991 18425 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_05080 19103 19684 gene locus_tag LOCUS_05090 19103 19684 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962629.1 protein_id gnl|my_center|LOCUS_05090 19763 19966 gene locus_tag LOCUS_05100 19763 19966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 19966 20568 gene locus_tag LOCUS_05110 19966 20568 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962631.1 protein_id gnl|my_center|LOCUS_05110 21981 20728 gene locus_tag LOCUS_05120 21981 20728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 20751 20866 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22412 21981 gene locus_tag LOCUS_05130 22412 21981 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 protein_id gnl|my_center|LOCUS_05130 23238 22645 gene locus_tag LOCUS_05140 23238 22645 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_05140 24245 23286 gene locus_tag LOCUS_05150 24245 23286 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_05150 24441 24914 gene locus_tag LOCUS_05160 24441 24914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 24920 28387 gene locus_tag LOCUS_05170 24920 28387 CDS product T9SS type A sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962267.1 protein_id gnl|my_center|LOCUS_05170 29205 28492 gene locus_tag LOCUS_05180 29205 28492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 29426 29896 gene locus_tag LOCUS_05190 29426 29896 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377741.1 protein_id gnl|my_center|LOCUS_05190 30251 29901 gene locus_tag LOCUS_05200 30251 29901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_05200 30779 30270 gene locus_tag LOCUS_05210 30779 30270 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257161.1 protein_id gnl|my_center|LOCUS_05210 30962 31294 gene locus_tag LOCUS_05220 gene ssb 30962 31294 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361980.1 protein_id gnl|my_center|LOCUS_05220 32907 31351 gene locus_tag LOCUS_05230 gene nadB 32907 31351 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783573.1 protein_id gnl|my_center|LOCUS_05230 33836 32910 gene locus_tag LOCUS_05240 gene nadA 33836 32910 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056086.1 protein_id gnl|my_center|LOCUS_05240 33953 34399 gene locus_tag LOCUS_05250 33953 34399 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930578.1 protein_id gnl|my_center|LOCUS_05250 36213 34396 gene locus_tag LOCUS_05260 36213 34396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 38185 36317 gene locus_tag LOCUS_05270 gene nrdD 38185 36317 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083208.1 protein_id gnl|my_center|LOCUS_05270 38638 38189 gene locus_tag LOCUS_05280 38638 38189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 39025 41613 gene locus_tag LOCUS_05290 gene ppc 39025 41613 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058155.1 protein_id gnl|my_center|LOCUS_05290 42011 41673 gene locus_tag LOCUS_05300 42011 41673 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932186.1 protein_id gnl|my_center|LOCUS_05300 43187 42144 gene locus_tag LOCUS_05310 43187 42144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 43093 43389 gene locus_tag LOCUS_05320 43093 43389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 43740 43396 gene locus_tag LOCUS_05330 43740 43396 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932186.1 protein_id gnl|my_center|LOCUS_05330 45134 43893 gene locus_tag LOCUS_05340 45134 43893 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083240.1 protein_id gnl|my_center|LOCUS_05340 45495 45157 gene locus_tag LOCUS_05350 45495 45157 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932186.1 protein_id gnl|my_center|LOCUS_05350 46541 45519 gene locus_tag LOCUS_05360 46541 45519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 47016 51497 gene locus_tag LOCUS_05370 gene gltB 47016 51497 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964980.1 protein_id gnl|my_center|LOCUS_05370 51502 52968 gene locus_tag LOCUS_05380 51502 52968 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480842.1 protein_id gnl|my_center|LOCUS_05380 53175 53390 gene locus_tag LOCUS_05390 53175 53390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 53474 55066 gene locus_tag LOCUS_05400 53474 55066 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444186.1 protein_id gnl|my_center|LOCUS_05400 55073 55900 gene locus_tag LOCUS_05410 55073 55900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 55934 56569 gene locus_tag LOCUS_05420 55934 56569 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947903.1 protein_id gnl|my_center|LOCUS_05420 56579 56815 gene locus_tag LOCUS_05430 56579 56815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 56787 57122 gene locus_tag LOCUS_05440 56787 57122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 57310 59160 gene locus_tag LOCUS_05450 57310 59160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 60230 59226 gene locus_tag LOCUS_05460 gene fbp 60230 59226 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962470.1 protein_id gnl|my_center|LOCUS_05460 60350 60829 gene locus_tag LOCUS_05470 60350 60829 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100451.1 protein_id gnl|my_center|LOCUS_05470 60829 62079 gene locus_tag LOCUS_05480 60829 62079 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962473.1 protein_id gnl|my_center|LOCUS_05480 62178 64013 gene locus_tag LOCUS_05490 62178 64013 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962244.1 protein_id gnl|my_center|LOCUS_05490 64387 64019 gene locus_tag LOCUS_05500 64387 64019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 65216 64452 gene locus_tag LOCUS_05510 65216 64452 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461288.1 protein_id gnl|my_center|LOCUS_05510 65696 65325 gene locus_tag LOCUS_05520 65696 65325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 66183 65725 gene locus_tag LOCUS_05530 66183 65725 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027268.1 protein_id gnl|my_center|LOCUS_05530 67143 66208 gene locus_tag LOCUS_05540 67143 66208 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_05540 68684 67311 gene locus_tag LOCUS_05550 gene mgtE 68684 67311 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962248.1 protein_id gnl|my_center|LOCUS_05550 69498 68704 gene locus_tag LOCUS_05560 gene rsmA 69498 68704 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962249.1 protein_id gnl|my_center|LOCUS_05560 69881 69558 gene locus_tag LOCUS_05570 69881 69558 CDS product DUF4286 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_05570 70411 69896 gene locus_tag LOCUS_05580 70411 69896 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636204.1 protein_id gnl|my_center|LOCUS_05580 72191 70416 gene locus_tag LOCUS_05590 72191 70416 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962252.1 protein_id gnl|my_center|LOCUS_05590 73921 72650 gene locus_tag LOCUS_05600 gene serS 73921 72650 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_05600 74930 73998 gene locus_tag LOCUS_05610 74930 73998 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962409.1 protein_id gnl|my_center|LOCUS_05610 75012 77771 gene locus_tag LOCUS_05620 75012 77771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 78428 77802 gene locus_tag LOCUS_05630 gene pth 78428 77802 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100438.1 protein_id gnl|my_center|LOCUS_05630 79135 78506 gene locus_tag LOCUS_05640 79135 78506 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962325.1 protein_id gnl|my_center|LOCUS_05640 79633 79190 gene locus_tag LOCUS_05650 79633 79190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05650 80124 79696 gene locus_tag LOCUS_05660 80124 79696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05660 80297 80408 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence006 2426 1170 gene locus_tag LOCUS_05670 2426 1170 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_05670 4854 2461 gene locus_tag LOCUS_05680 4854 2461 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_05680 5313 4870 gene locus_tag LOCUS_05690 5313 4870 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_05690 5843 5451 gene locus_tag LOCUS_05700 5843 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 7758 5986 gene locus_tag LOCUS_05710 7758 5986 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_05710 7993 10722 gene locus_tag LOCUS_05720 gene ppdK 7993 10722 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202911.1 protein_id gnl|my_center|LOCUS_05720 14456 10797 gene locus_tag LOCUS_05730 gene purL 14456 10797 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962854.1 protein_id gnl|my_center|LOCUS_05730 15673 14597 gene locus_tag LOCUS_05740 15673 14597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 16895 15681 gene locus_tag LOCUS_05750 16895 15681 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_05750 17001 18047 gene locus_tag LOCUS_05760 17001 18047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962781.1 protein_id gnl|my_center|LOCUS_05760 18516 18076 gene locus_tag LOCUS_05770 18516 18076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 19024 18518 gene locus_tag LOCUS_05780 19024 18518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 19600 19058 gene locus_tag LOCUS_05790 19600 19058 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962784.1 protein_id gnl|my_center|LOCUS_05790 21747 19912 gene locus_tag LOCUS_05800 21747 19912 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_05800 23559 21829 gene locus_tag LOCUS_05810 23559 21829 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963276.1 protein_id gnl|my_center|LOCUS_05810 24587 23640 gene locus_tag LOCUS_05820 24587 23640 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963275.1 protein_id gnl|my_center|LOCUS_05820 25106 24591 gene locus_tag LOCUS_05830 25106 24591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 25266 25517 gene locus_tag LOCUS_05840 25266 25517 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963273.1 protein_id gnl|my_center|LOCUS_05840 25655 26830 gene locus_tag LOCUS_05850 25655 26830 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_05850 26870 27787 gene locus_tag LOCUS_05860 26870 27787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 28027 29379 gene locus_tag LOCUS_05870 gene mtaB 28027 29379 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_05870 29556 29984 gene locus_tag LOCUS_05880 29556 29984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 30354 30058 gene locus_tag LOCUS_05890 30354 30058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 30470 31132 gene locus_tag LOCUS_05900 30470 31132 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964116.1 protein_id gnl|my_center|LOCUS_05900 31180 32100 gene locus_tag LOCUS_05910 31180 32100 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_05910 32691 32116 gene locus_tag LOCUS_05920 32691 32116 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964088.1 protein_id gnl|my_center|LOCUS_05920 32996 33157 gene locus_tag LOCUS_05930 gene rpmH 32996 33157 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007136275.1 protein_id gnl|my_center|LOCUS_05930 33261 36113 gene locus_tag LOCUS_05940 gene carB 33261 36113 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964089.1 protein_id gnl|my_center|LOCUS_05940 36684 36145 gene locus_tag LOCUS_05950 36684 36145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 37109 36732 gene locus_tag LOCUS_05960 37109 36732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 37456 37133 gene locus_tag LOCUS_05970 37456 37133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 38318 37506 gene locus_tag LOCUS_05980 38318 37506 CDS product DUF5777 family beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_05980 38942 38370 gene locus_tag LOCUS_05990 38942 38370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 39338 38961 gene locus_tag LOCUS_06000 39338 38961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 40566 39493 gene locus_tag LOCUS_06010 40566 39493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 40745 41269 gene locus_tag LOCUS_06020 40745 41269 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766766.1 protein_id gnl|my_center|LOCUS_06020 41317 42225 gene locus_tag LOCUS_06030 41317 42225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 42209 44719 gene locus_tag LOCUS_06040 42209 44719 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_06040 45072 44716 gene locus_tag LOCUS_06050 45072 44716 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964092.1 protein_id gnl|my_center|LOCUS_06050 46444 45815 gene locus_tag LOCUS_06060 46444 45815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 47847 46528 gene locus_tag LOCUS_06070 47847 46528 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_06070 48794 47934 gene locus_tag LOCUS_06080 48794 47934 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964096.1 protein_id gnl|my_center|LOCUS_06080 49782 48751 gene locus_tag LOCUS_06090 49782 48751 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963582.1 protein_id gnl|my_center|LOCUS_06090 50937 49783 gene locus_tag LOCUS_06100 50937 49783 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963581.1 protein_id gnl|my_center|LOCUS_06100 51487 53421 gene locus_tag LOCUS_06110 gene btuB 51487 53421 CDS product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228170.1 protein_id gnl|my_center|LOCUS_06110 54955 53471 gene locus_tag LOCUS_06120 54955 53471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 56533 55025 gene locus_tag LOCUS_06130 56533 55025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 56681 57190 gene locus_tag LOCUS_06140 56681 57190 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963573.1 protein_id gnl|my_center|LOCUS_06140 57177 57656 gene locus_tag LOCUS_06150 57177 57656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 57664 58257 gene locus_tag LOCUS_06160 57664 58257 CDS product DUF4252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963571.1 protein_id gnl|my_center|LOCUS_06160 58275 58817 gene locus_tag LOCUS_06170 58275 58817 CDS product DUF4252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963570.1 protein_id gnl|my_center|LOCUS_06170 59062 58886 gene locus_tag LOCUS_06180 59062 58886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 60492 59065 gene locus_tag LOCUS_06190 gene purB 60492 59065 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963912.1 protein_id gnl|my_center|LOCUS_06190 60546 61526 gene locus_tag LOCUS_06200 60546 61526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 62109 61540 gene locus_tag LOCUS_06210 62109 61540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963491.1 protein_id gnl|my_center|LOCUS_06210 62150 62623 gene locus_tag LOCUS_06220 62150 62623 CDS product heme-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726283.1 protein_id gnl|my_center|LOCUS_06220 62747 63916 gene locus_tag LOCUS_06230 62747 63916 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962902.1 protein_id gnl|my_center|LOCUS_06230 63958 65523 gene locus_tag LOCUS_06240 63958 65523 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275523.1 protein_id gnl|my_center|LOCUS_06240 65970 65524 gene locus_tag LOCUS_06250 65970 65524 CDS product KTSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964067.1 protein_id gnl|my_center|LOCUS_06250 66101 67738 gene locus_tag LOCUS_06260 66101 67738 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962719.1 protein_id gnl|my_center|LOCUS_06260 67838 68446 gene locus_tag LOCUS_06270 67838 68446 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044977646.1 protein_id gnl|my_center|LOCUS_06270 69121 68441 gene locus_tag LOCUS_06280 69121 68441 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 protein_id gnl|my_center|LOCUS_06280 69308 69841 gene locus_tag LOCUS_06290 69308 69841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 70622 69849 gene locus_tag LOCUS_06300 70622 69849 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963924.1 protein_id gnl|my_center|LOCUS_06300 72638 70737 gene locus_tag LOCUS_06310 72638 70737 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963925.1 protein_id gnl|my_center|LOCUS_06310 74165 72933 gene locus_tag LOCUS_06320 74165 72933 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_06320 75073 74279 gene locus_tag LOCUS_06330 75073 74279 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_06330 75157 75948 gene locus_tag LOCUS_06340 75157 75948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 76882 75959 gene locus_tag LOCUS_06350 76882 75959 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964034.1 protein_id gnl|my_center|LOCUS_06350 77099 78559 gene locus_tag LOCUS_06360 77099 78559 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130286390.1 protein_id gnl|my_center|LOCUS_06360 79611 78706 gene locus_tag LOCUS_06370 79611 78706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 >Feature sequence007 1746 535 gene locus_tag LOCUS_06380 1746 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 1872 4298 gene locus_tag LOCUS_06390 gene pheT 1872 4298 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963186.1 protein_id gnl|my_center|LOCUS_06390 4449 4375 gene locus_tag LOCUS_t00040 4449 4375 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 5321 4602 gene locus_tag LOCUS_06400 gene bshB1 5321 4602 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_06400 5651 7327 gene locus_tag LOCUS_06410 gene pckA 5651 7327 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813680.1 protein_id gnl|my_center|LOCUS_06410 8056 7478 gene locus_tag LOCUS_06420 8056 7478 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_06420 11346 8158 gene locus_tag LOCUS_06430 gene ccsA 11346 8158 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 protein_id gnl|my_center|LOCUS_06430 11839 11450 gene locus_tag LOCUS_06440 11839 11450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 11899 12666 gene locus_tag LOCUS_06450 11899 12666 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963540.1 protein_id gnl|my_center|LOCUS_06450 12647 13177 gene locus_tag LOCUS_06460 12647 13177 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_06460 13181 14098 gene locus_tag LOCUS_06470 13181 14098 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_06470 14098 14694 gene locus_tag LOCUS_06480 14098 14694 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963543.1 protein_id gnl|my_center|LOCUS_06480 14731 15261 gene locus_tag LOCUS_06490 14731 15261 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071240.1 protein_id gnl|my_center|LOCUS_06490 15291 16358 gene locus_tag LOCUS_06500 gene corA 15291 16358 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021725.1 protein_id gnl|my_center|LOCUS_06500 16448 18976 gene locus_tag LOCUS_06510 16448 18976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 19092 20807 gene locus_tag LOCUS_06520 19092 20807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 20785 21771 gene locus_tag LOCUS_06530 20785 21771 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_06530 22813 21965 gene locus_tag LOCUS_06540 22813 21965 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_06540 25074 23017 gene locus_tag LOCUS_06550 25074 23017 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770054.1 protein_id gnl|my_center|LOCUS_06550 25196 26413 gene locus_tag LOCUS_06560 25196 26413 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986826.1 protein_id gnl|my_center|LOCUS_06560 27026 26427 gene locus_tag LOCUS_06570 27026 26427 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786586.1 protein_id gnl|my_center|LOCUS_06570 28649 27036 gene locus_tag LOCUS_06580 28649 27036 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931808.1 protein_id gnl|my_center|LOCUS_06580 29049 29564 gene locus_tag LOCUS_06590 29049 29564 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230784.1 protein_id gnl|my_center|LOCUS_06590 29569 29739 gene locus_tag LOCUS_06600 29569 29739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 30204 30671 gene locus_tag LOCUS_06610 30204 30671 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_06610 30668 31972 gene locus_tag LOCUS_06620 30668 31972 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_06620 31997 32281 gene locus_tag LOCUS_06630 31997 32281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 32353 32682 gene locus_tag LOCUS_06640 32353 32682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 32796 33740 gene locus_tag LOCUS_06650 32796 33740 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761007.1 protein_id gnl|my_center|LOCUS_06650 35055 33745 gene locus_tag LOCUS_06660 gene murA 35055 33745 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964114.1 protein_id gnl|my_center|LOCUS_06660 35714 35070 gene locus_tag LOCUS_06670 35714 35070 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_06670 36076 35783 gene locus_tag LOCUS_06680 36076 35783 CDS product DUF493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964112.1 protein_id gnl|my_center|LOCUS_06680 36166 36708 gene locus_tag LOCUS_06690 36166 36708 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964111.1 protein_id gnl|my_center|LOCUS_06690 36708 38612 gene locus_tag LOCUS_06700 36708 38612 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362014.1 protein_id gnl|my_center|LOCUS_06700 38609 39556 gene locus_tag LOCUS_06710 gene fmt 38609 39556 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964109.1 protein_id gnl|my_center|LOCUS_06710 39748 40020 gene locus_tag LOCUS_06720 39748 40020 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964108.1 protein_id gnl|my_center|LOCUS_06720 40144 40704 gene locus_tag LOCUS_06730 40144 40704 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964107.1 protein_id gnl|my_center|LOCUS_06730 41543 40701 gene locus_tag LOCUS_06740 41543 40701 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 protein_id gnl|my_center|LOCUS_06740 42013 41612 gene locus_tag LOCUS_06750 42013 41612 CDS product START-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_06750 42138 42212 gene locus_tag LOCUS_t00050 42138 42212 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 44170 42911 gene locus_tag LOCUS_06760 44170 42911 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201988.1 protein_id gnl|my_center|LOCUS_06760 45041 44208 gene locus_tag LOCUS_06770 45041 44208 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324929.1 protein_id gnl|my_center|LOCUS_06770 45902 45057 gene locus_tag LOCUS_06780 45902 45057 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442682.1 protein_id gnl|my_center|LOCUS_06780 47168 46059 gene locus_tag LOCUS_06790 47168 46059 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480283.1 protein_id gnl|my_center|LOCUS_06790 48569 47196 gene locus_tag LOCUS_06800 48569 47196 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_06800 49597 48845 gene locus_tag LOCUS_06810 49597 48845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 51255 49825 gene locus_tag LOCUS_06820 51255 49825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 54868 51344 gene locus_tag LOCUS_06830 54868 51344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 56281 54983 gene locus_tag LOCUS_06840 56281 54983 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_06840 56292 56558 gene locus_tag LOCUS_06850 56292 56558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 57249 56587 gene locus_tag LOCUS_06860 57249 56587 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805069.1 protein_id gnl|my_center|LOCUS_06860 59116 57302 gene locus_tag LOCUS_06870 59116 57302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 59714 59130 gene locus_tag LOCUS_06880 59714 59130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 60103 59726 gene locus_tag LOCUS_06890 60103 59726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 62799 60283 gene locus_tag LOCUS_06900 gene nirB 62799 60283 CDS product NADPH-nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049259.1 protein_id gnl|my_center|LOCUS_06900 63691 63900 gene locus_tag LOCUS_06910 63691 63900 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948081.1 protein_id gnl|my_center|LOCUS_06910 63903 64217 gene locus_tag LOCUS_06920 63903 64217 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948073.1 protein_id gnl|my_center|LOCUS_06920 64210 65139 gene locus_tag LOCUS_06930 64210 65139 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027224428.1 protein_id gnl|my_center|LOCUS_06930 65657 65493 gene locus_tag LOCUS_06940 65657 65493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 66766 65654 gene locus_tag LOCUS_06950 66766 65654 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974604.1 protein_id gnl|my_center|LOCUS_06950 67198 66887 gene locus_tag LOCUS_06960 67198 66887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 68077 67214 gene locus_tag LOCUS_06970 68077 67214 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962653.1 protein_id gnl|my_center|LOCUS_06970 68592 68074 gene locus_tag LOCUS_06980 68592 68074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 68821 68576 gene locus_tag LOCUS_06990 68821 68576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 69948 69748 gene locus_tag LOCUS_07000 69948 69748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 70194 70565 gene locus_tag LOCUS_07010 70194 70565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 72926 71700 gene locus_tag LOCUS_07020 72926 71700 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_07020 >Feature sequence008 89 991 gene locus_tag LOCUS_07030 89 991 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_07030 1046 2506 gene locus_tag LOCUS_07040 gene crtI 1046 2506 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_07040 2596 3348 gene locus_tag LOCUS_07050 2596 3348 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_07050 3358 3807 gene locus_tag LOCUS_07060 3358 3807 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_07060 4305 4523 gene locus_tag LOCUS_07070 4305 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 5061 4501 gene locus_tag LOCUS_07080 5061 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 5588 5163 gene locus_tag LOCUS_07090 5588 5163 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963864.1 protein_id gnl|my_center|LOCUS_07090 6232 5642 gene locus_tag LOCUS_07100 gene def 6232 5642 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963863.1 protein_id gnl|my_center|LOCUS_07100 6928 6347 gene locus_tag LOCUS_07110 6928 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 7406 6996 gene locus_tag LOCUS_07120 gene ruvX 7406 6996 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963861.1 protein_id gnl|my_center|LOCUS_07120 7833 7495 gene locus_tag LOCUS_07130 7833 7495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 8121 8936 gene locus_tag LOCUS_07140 8121 8936 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_07140 8977 10065 gene locus_tag LOCUS_07150 8977 10065 CDS product CDP-glycerol--glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074271.1 protein_id gnl|my_center|LOCUS_07150 10069 10827 gene locus_tag LOCUS_07160 10069 10827 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129903.1 protein_id gnl|my_center|LOCUS_07160 11593 10829 gene locus_tag LOCUS_07170 11593 10829 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963748.1 protein_id gnl|my_center|LOCUS_07170 11761 12606 gene locus_tag LOCUS_07180 11761 12606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 12624 13184 gene locus_tag LOCUS_07190 12624 13184 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963755.1 protein_id gnl|my_center|LOCUS_07190 13256 14680 gene locus_tag LOCUS_07200 13256 14680 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963756.1 protein_id gnl|my_center|LOCUS_07200 14677 15129 gene locus_tag LOCUS_07210 14677 15129 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965852.1 protein_id gnl|my_center|LOCUS_07210 15131 16147 gene locus_tag LOCUS_07220 15131 16147 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963757.1 protein_id gnl|my_center|LOCUS_07220 16184 16696 gene locus_tag LOCUS_07230 16184 16696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963768.1 protein_id gnl|my_center|LOCUS_07230 17764 16706 gene locus_tag LOCUS_07240 17764 16706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 17889 18785 gene locus_tag LOCUS_07250 17889 18785 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 protein_id gnl|my_center|LOCUS_07250 18791 19621 gene locus_tag LOCUS_07260 18791 19621 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963772.1 protein_id gnl|my_center|LOCUS_07260 19649 22354 gene locus_tag LOCUS_07270 19649 22354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 22515 27338 gene locus_tag LOCUS_07280 22515 27338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 27393 29711 gene locus_tag LOCUS_07290 27393 29711 CDS product choice-of-anchor L domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963773.1 protein_id gnl|my_center|LOCUS_07290 29739 31727 gene locus_tag LOCUS_07300 gene uvrB 29739 31727 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963054.1 protein_id gnl|my_center|LOCUS_07300 31831 34722 gene locus_tag LOCUS_07310 31831 34722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 34869 35024 gene locus_tag LOCUS_07320 34869 35024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 35027 35512 gene locus_tag LOCUS_07330 35027 35512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 35519 36295 gene locus_tag LOCUS_07340 35519 36295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 36314 37066 gene locus_tag LOCUS_07350 36314 37066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 37077 38339 gene locus_tag LOCUS_07360 37077 38339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 38340 39455 gene locus_tag LOCUS_07370 38340 39455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 40090 39689 gene locus_tag LOCUS_07380 40090 39689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963055.1 protein_id gnl|my_center|LOCUS_07380 40462 40722 gene locus_tag LOCUS_07390 40462 40722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 41970 40780 gene locus_tag LOCUS_07400 gene sucC 41970 40780 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963059.1 protein_id gnl|my_center|LOCUS_07400 42174 43409 gene locus_tag LOCUS_07410 gene lysA 42174 43409 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_07410 43615 45537 gene locus_tag LOCUS_07420 43615 45537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 45538 46278 gene locus_tag LOCUS_07430 45538 46278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 46485 47003 gene locus_tag LOCUS_07440 46485 47003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 47140 48078 gene locus_tag LOCUS_07450 47140 48078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 48106 48591 gene locus_tag LOCUS_07460 48106 48591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 48610 49485 gene locus_tag LOCUS_07470 48610 49485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 49500 50297 gene locus_tag LOCUS_07480 49500 50297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 50299 51474 gene locus_tag LOCUS_07490 50299 51474 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222927961.1 protein_id gnl|my_center|LOCUS_07490 51486 52532 gene locus_tag LOCUS_07500 51486 52532 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549454.1 protein_id gnl|my_center|LOCUS_07500 52569 52772 gene locus_tag LOCUS_07510 52569 52772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 52795 53832 gene locus_tag LOCUS_07520 52795 53832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 53928 55250 gene locus_tag LOCUS_07530 53928 55250 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002146066.1 protein_id gnl|my_center|LOCUS_07530 55269 56576 gene locus_tag LOCUS_07540 55269 56576 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265603.1 protein_id gnl|my_center|LOCUS_07540 56598 56846 gene locus_tag LOCUS_07550 56598 56846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 56861 58033 gene locus_tag LOCUS_07560 56861 58033 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112330.1 protein_id gnl|my_center|LOCUS_07560 58047 59354 gene locus_tag LOCUS_07570 58047 59354 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861814.1 protein_id gnl|my_center|LOCUS_07570 59347 59661 gene locus_tag LOCUS_07580 59347 59661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 59844 60695 gene locus_tag LOCUS_07590 59844 60695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 61281 60706 gene locus_tag LOCUS_07600 61281 60706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 62663 61281 gene locus_tag LOCUS_07610 62663 61281 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_07610 63635 62754 gene locus_tag LOCUS_07620 63635 62754 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962727.1 protein_id gnl|my_center|LOCUS_07620 63758 64489 gene locus_tag LOCUS_07630 63758 64489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 65928 64765 gene locus_tag LOCUS_07640 65928 64765 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_07640 66815 65940 gene locus_tag LOCUS_07650 66815 65940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 67893 66817 gene locus_tag LOCUS_07660 67893 66817 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07660 68075 67884 gene locus_tag LOCUS_07670 68075 67884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07670 67894 67905 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 69004 68078 gene locus_tag LOCUS_07680 69004 68078 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_07680 <70236 69258 gene locus_tag LOCUS_07690 <70236 69258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962830.1:molecular chaperone DnaJ >Feature sequence009 392 63 gene locus_tag LOCUS_07700 gene raiA 392 63 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_07700 1292 405 gene locus_tag LOCUS_07710 1292 405 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963321.1 protein_id gnl|my_center|LOCUS_07710 1613 1416 gene locus_tag LOCUS_07720 gene rpsU 1613 1416 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963322.1 protein_id gnl|my_center|LOCUS_07720 2861 1695 gene locus_tag LOCUS_07730 2861 1695 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963323.1 protein_id gnl|my_center|LOCUS_07730 3743 2883 gene locus_tag LOCUS_07740 3743 2883 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963324.1 protein_id gnl|my_center|LOCUS_07740 5442 3763 gene locus_tag LOCUS_07750 5442 3763 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_07750 6442 5552 gene locus_tag LOCUS_07760 6442 5552 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870874.1 protein_id gnl|my_center|LOCUS_07760 6796 6569 gene locus_tag LOCUS_07770 6796 6569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963325.1 protein_id gnl|my_center|LOCUS_07770 8168 6891 gene locus_tag LOCUS_07780 8168 6891 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_07780 8274 8801 gene locus_tag LOCUS_07790 gene hemG 8274 8801 CDS product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070441.1 protein_id gnl|my_center|LOCUS_07790 8806 9201 gene locus_tag LOCUS_07800 8806 9201 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788775.1 protein_id gnl|my_center|LOCUS_07800 9295 10038 gene locus_tag LOCUS_07810 9295 10038 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089713553.1 protein_id gnl|my_center|LOCUS_07810 10377 11174 gene locus_tag LOCUS_07820 10377 11174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 11404 11769 gene locus_tag LOCUS_07830 11404 11769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 12843 11863 gene locus_tag LOCUS_07840 12843 11863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 14334 13099 gene locus_tag LOCUS_07850 14334 13099 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 protein_id gnl|my_center|LOCUS_07850 14342 15562 gene locus_tag LOCUS_07860 14342 15562 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100706.1 protein_id gnl|my_center|LOCUS_07860 15583 16662 gene locus_tag LOCUS_07870 15583 16662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 17260 16652 gene locus_tag LOCUS_07880 17260 16652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 18323 17487 gene locus_tag LOCUS_07890 18323 17487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 18861 18370 gene locus_tag LOCUS_07900 18861 18370 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964287.1 protein_id gnl|my_center|LOCUS_07900 18933 19628 gene locus_tag LOCUS_07910 18933 19628 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964288.1 protein_id gnl|my_center|LOCUS_07910 21247 19625 gene locus_tag LOCUS_07920 21247 19625 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838626.1 protein_id gnl|my_center|LOCUS_07920 23049 21331 gene locus_tag LOCUS_07930 23049 21331 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962685.1 protein_id gnl|my_center|LOCUS_07930 26179 23159 gene locus_tag LOCUS_07940 26179 23159 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 protein_id gnl|my_center|LOCUS_07940 26391 27074 gene locus_tag LOCUS_07950 26391 27074 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_07950 27077 27970 gene locus_tag LOCUS_07960 27077 27970 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963966.1 protein_id gnl|my_center|LOCUS_07960 29036 27963 gene locus_tag LOCUS_07970 29036 27963 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107643.1 protein_id gnl|my_center|LOCUS_07970 30129 29041 gene locus_tag LOCUS_07980 30129 29041 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963969.1 protein_id gnl|my_center|LOCUS_07980 30245 31174 gene locus_tag LOCUS_07990 30245 31174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 31584 31177 gene locus_tag LOCUS_08000 31584 31177 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963968.1 protein_id gnl|my_center|LOCUS_08000 32866 31565 gene locus_tag LOCUS_08010 32866 31565 CDS product O-antigen translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963976.1 protein_id gnl|my_center|LOCUS_08010 33966 32854 gene locus_tag LOCUS_08020 33966 32854 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963975.1 protein_id gnl|my_center|LOCUS_08020 34937 33963 gene locus_tag LOCUS_08030 34937 33963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963974.1 protein_id gnl|my_center|LOCUS_08030 36291 34993 gene locus_tag LOCUS_08040 36291 34993 CDS product O-antigen translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963976.1 protein_id gnl|my_center|LOCUS_08040 36739 36458 gene locus_tag LOCUS_08050 36739 36458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 37458 36694 gene locus_tag LOCUS_08060 37458 36694 CDS product nicotinamide mononucleotide transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012552828.1 protein_id gnl|my_center|LOCUS_08060 39267 37468 gene locus_tag LOCUS_08070 gene typA 39267 37468 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962640.1 protein_id gnl|my_center|LOCUS_08070 39393 39752 gene locus_tag LOCUS_08080 39393 39752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 39784 40602 gene locus_tag LOCUS_08090 gene kdsA 39784 40602 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962665.1 protein_id gnl|my_center|LOCUS_08090 40615 41475 gene locus_tag LOCUS_08100 40615 41475 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962664.1 protein_id gnl|my_center|LOCUS_08100 43128 41755 gene locus_tag LOCUS_08110 43128 41755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 43658 43170 gene locus_tag LOCUS_08120 43658 43170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 44201 43833 gene locus_tag LOCUS_08130 44201 43833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 45436 44228 gene locus_tag LOCUS_08140 45436 44228 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_08140 45596 45661 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 46254 47636 gene locus_tag LOCUS_08150 46254 47636 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107821.1 protein_id gnl|my_center|LOCUS_08150 47939 47721 gene locus_tag LOCUS_08160 47939 47721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 48257 48577 gene locus_tag LOCUS_08170 48257 48577 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760318.1 protein_id gnl|my_center|LOCUS_08170 49371 48616 gene locus_tag LOCUS_08180 49371 48616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_08180 49869 49585 gene locus_tag LOCUS_08190 49869 49585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 51162 50767 gene locus_tag LOCUS_08200 51162 50767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 51483 51175 gene locus_tag LOCUS_08210 51483 51175 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962681.1 protein_id gnl|my_center|LOCUS_08210 52180 51566 gene locus_tag LOCUS_08220 52180 51566 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054459.1 protein_id gnl|my_center|LOCUS_08220 52732 52187 gene locus_tag LOCUS_08230 52732 52187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 52989 54392 gene locus_tag LOCUS_08240 52989 54392 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_08240 54395 54961 gene locus_tag LOCUS_08250 54395 54961 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_08250 54965 55957 gene locus_tag LOCUS_08260 gene trpD 54965 55957 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962675.1 protein_id gnl|my_center|LOCUS_08260 56043 56846 gene locus_tag LOCUS_08270 gene trpC 56043 56846 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962674.1 protein_id gnl|my_center|LOCUS_08270 56914 57678 gene locus_tag LOCUS_08280 56914 57678 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962673.1 protein_id gnl|my_center|LOCUS_08280 57746 58927 gene locus_tag LOCUS_08290 gene trpB 57746 58927 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962672.1 protein_id gnl|my_center|LOCUS_08290 59012 59776 gene locus_tag LOCUS_08300 gene trpA 59012 59776 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962671.1 protein_id gnl|my_center|LOCUS_08300 59858 61393 gene locus_tag LOCUS_08310 59858 61393 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_08310 61396 61620 gene locus_tag LOCUS_08320 61396 61620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 61610 62068 gene locus_tag LOCUS_08330 gene trmL 61610 62068 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538147.1 protein_id gnl|my_center|LOCUS_08330 62704 62069 gene locus_tag LOCUS_08340 62704 62069 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943590.1 protein_id gnl|my_center|LOCUS_08340 64544 62766 gene locus_tag LOCUS_08350 gene argS 64544 62766 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963616.1 protein_id gnl|my_center|LOCUS_08350 64864 64658 gene locus_tag LOCUS_08360 64864 64658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 65301 67319 gene locus_tag LOCUS_08370 65301 67319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 68265 67327 gene locus_tag LOCUS_08380 68265 67327 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_08380 >Feature sequence010 638 3487 gene locus_tag LOCUS_08390 638 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 4734 3556 gene locus_tag LOCUS_08400 4734 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 5691 4837 gene locus_tag LOCUS_08410 5691 4837 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963181.1 protein_id gnl|my_center|LOCUS_08410 6572 5709 gene locus_tag LOCUS_08420 6572 5709 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_08420 7503 6562 gene locus_tag LOCUS_08430 7503 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 7833 7507 gene locus_tag LOCUS_08440 7833 7507 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963176.1 protein_id gnl|my_center|LOCUS_08440 8807 7857 gene locus_tag LOCUS_08450 8807 7857 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_08450 8940 10943 gene locus_tag LOCUS_08460 8940 10943 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_08460 11082 11561 gene locus_tag LOCUS_08470 11082 11561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 11644 12051 gene locus_tag LOCUS_08480 11644 12051 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263864.1 protein_id gnl|my_center|LOCUS_08480 12239 12048 gene locus_tag LOCUS_08490 12239 12048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 12747 13379 gene locus_tag LOCUS_08500 12747 13379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 13487 15037 gene locus_tag LOCUS_08510 13487 15037 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963094.1 protein_id gnl|my_center|LOCUS_08510 15230 15682 gene locus_tag LOCUS_08520 15230 15682 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292665.1 protein_id gnl|my_center|LOCUS_08520 15731 16477 gene locus_tag LOCUS_08530 gene ppk2 15731 16477 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014894.1 protein_id gnl|my_center|LOCUS_08530 16498 17403 gene locus_tag LOCUS_08540 gene yedA 16498 17403 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112921.1 protein_id gnl|my_center|LOCUS_08540 17462 19009 gene locus_tag LOCUS_08550 17462 19009 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983276.1 protein_id gnl|my_center|LOCUS_08550 19082 19969 gene locus_tag LOCUS_08560 19082 19969 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909400.1 protein_id gnl|my_center|LOCUS_08560 19969 20997 gene locus_tag LOCUS_08570 19969 20997 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_08570 20997 21839 gene locus_tag LOCUS_08580 gene cntI 20997 21839 CDS product pseudopaline transport inner membrane protein CntI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104336.1 protein_id gnl|my_center|LOCUS_08580 23104 21983 gene locus_tag LOCUS_08590 23104 21983 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_08590 24210 23104 gene locus_tag LOCUS_08600 24210 23104 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202952.1 protein_id gnl|my_center|LOCUS_08600 24936 24214 gene locus_tag LOCUS_08610 24936 24214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 25842 24940 gene locus_tag LOCUS_08620 25842 24940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 26307 25849 gene locus_tag LOCUS_08630 26307 25849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 27238 26345 gene locus_tag LOCUS_08640 27238 26345 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107324.1 protein_id gnl|my_center|LOCUS_08640 28493 27243 gene locus_tag LOCUS_08650 28493 27243 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692557.1 protein_id gnl|my_center|LOCUS_08650 29100 28498 gene locus_tag LOCUS_08660 29100 28498 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107755.1 protein_id gnl|my_center|LOCUS_08660 29381 30001 gene locus_tag LOCUS_08670 29381 30001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 30064 30612 gene locus_tag LOCUS_08680 30064 30612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 31417 30977 gene locus_tag LOCUS_08690 31417 30977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 32072 33880 gene locus_tag LOCUS_08700 32072 33880 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839780.1 protein_id gnl|my_center|LOCUS_08700 33880 34773 gene locus_tag LOCUS_08710 33880 34773 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797481.1 protein_id gnl|my_center|LOCUS_08710 35033 35467 gene locus_tag LOCUS_08720 35033 35467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 36855 36475 gene locus_tag LOCUS_08730 36855 36475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 38977 36875 gene locus_tag LOCUS_08740 38977 36875 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_08740 39199 39816 gene locus_tag LOCUS_08750 39199 39816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 39832 40167 gene locus_tag LOCUS_08760 39832 40167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 40169 41416 gene locus_tag LOCUS_08770 40169 41416 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963097.1 protein_id gnl|my_center|LOCUS_08770 42525 41467 gene locus_tag LOCUS_08780 gene leuB 42525 41467 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767701.1 protein_id gnl|my_center|LOCUS_08780 44148 42628 gene locus_tag LOCUS_08790 44148 42628 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789843.1 protein_id gnl|my_center|LOCUS_08790 44749 44153 gene locus_tag LOCUS_08800 gene leuD 44749 44153 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763198.1 protein_id gnl|my_center|LOCUS_08800 46248 44854 gene locus_tag LOCUS_08810 gene leuC 46248 44854 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763197.1 protein_id gnl|my_center|LOCUS_08810 46866 46480 gene locus_tag LOCUS_08820 46866 46480 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963098.1 protein_id gnl|my_center|LOCUS_08820 47770 46880 gene locus_tag LOCUS_08830 47770 46880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 47910 48326 gene locus_tag LOCUS_08840 47910 48326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963100.1 protein_id gnl|my_center|LOCUS_08840 49000 48323 gene locus_tag LOCUS_08850 49000 48323 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902962.1 protein_id gnl|my_center|LOCUS_08850 49694 49011 gene locus_tag LOCUS_08860 gene truA 49694 49011 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118979.1 protein_id gnl|my_center|LOCUS_08860 49889 50305 gene locus_tag LOCUS_08870 49889 50305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 50910 50317 gene locus_tag LOCUS_08880 gene hisIE 50910 50317 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963101.1 protein_id gnl|my_center|LOCUS_08880 51662 50907 gene locus_tag LOCUS_08890 gene hisF 51662 50907 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963102.1 protein_id gnl|my_center|LOCUS_08890 52412 51678 gene locus_tag LOCUS_08900 gene hisA 52412 51678 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963103.1 protein_id gnl|my_center|LOCUS_08900 53064 52483 gene locus_tag LOCUS_08910 gene hisH 53064 52483 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963104.1 protein_id gnl|my_center|LOCUS_08910 54267 53134 gene locus_tag LOCUS_08920 gene hisB 54267 53134 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963105.1 protein_id gnl|my_center|LOCUS_08920 55311 54271 gene locus_tag LOCUS_08930 gene hisC 55311 54271 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963106.1 protein_id gnl|my_center|LOCUS_08930 56685 55402 gene locus_tag LOCUS_08940 gene hisD 56685 55402 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963107.1 protein_id gnl|my_center|LOCUS_08940 57552 56695 gene locus_tag LOCUS_08950 gene hisG 57552 56695 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963108.1 protein_id gnl|my_center|LOCUS_08950 58689 57874 gene locus_tag LOCUS_08960 58689 57874 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013490.1 protein_id gnl|my_center|LOCUS_08960 60735 58702 gene locus_tag LOCUS_08970 60735 58702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_08970 61485 60739 gene locus_tag LOCUS_08980 gene fabG 61485 60739 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_08980 62473 61595 gene locus_tag LOCUS_08990 gene sucD 62473 61595 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963119.1 protein_id gnl|my_center|LOCUS_08990 63473 62529 gene locus_tag LOCUS_09000 63473 62529 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence011 864 244 gene locus_tag LOCUS_09010 864 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 1235 861 gene locus_tag LOCUS_09020 1235 861 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592531.1 protein_id gnl|my_center|LOCUS_09020 1990 1376 gene locus_tag LOCUS_09030 1990 1376 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963710.1 protein_id gnl|my_center|LOCUS_09030 2574 2074 gene locus_tag LOCUS_09040 2574 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 3910 3368 gene locus_tag LOCUS_09050 3910 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 5227 3983 gene locus_tag LOCUS_09060 5227 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 5314 5523 gene locus_tag LOCUS_09070 5314 5523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 6778 6080 gene locus_tag LOCUS_09080 6778 6080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 7957 7394 gene locus_tag LOCUS_09090 7957 7394 CDS product DUF3347 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073122886.1 protein_id gnl|my_center|LOCUS_09090 8324 7980 gene locus_tag LOCUS_09100 8324 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 9083 8433 gene locus_tag LOCUS_09110 9083 8433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 9497 9111 gene locus_tag LOCUS_09120 9497 9111 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_09120 9689 9510 gene locus_tag LOCUS_09130 9689 9510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 12911 10605 gene locus_tag LOCUS_09140 12911 10605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 13059 13209 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13878 13444 gene locus_tag LOCUS_09150 13878 13444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 14287 14081 gene locus_tag LOCUS_09160 14287 14081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 14854 14312 gene locus_tag LOCUS_09170 14854 14312 CDS product DUF3347 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073122886.1 protein_id gnl|my_center|LOCUS_09170 16759 14882 gene locus_tag LOCUS_09180 16759 14882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 18015 16771 gene locus_tag LOCUS_09190 18015 16771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 21877 18026 gene locus_tag LOCUS_09200 21877 18026 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_09200 22363 21986 gene locus_tag LOCUS_09210 22363 21986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 22635 23096 gene locus_tag LOCUS_09220 22635 23096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09220 23130 24866 gene locus_tag LOCUS_09230 23130 24866 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787020.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09230 25114 25455 gene locus_tag LOCUS_09240 25114 25455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 25631 26212 gene locus_tag LOCUS_09250 25631 26212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 26384 26713 gene locus_tag LOCUS_09260 26384 26713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 26713 27900 gene locus_tag LOCUS_09270 26713 27900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 27866 28231 gene locus_tag LOCUS_09280 27866 28231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 28330 28806 gene locus_tag LOCUS_09290 28330 28806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 28830 29099 gene locus_tag LOCUS_09300 28830 29099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 29112 29327 gene locus_tag LOCUS_09310 29112 29327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 29350 29568 gene locus_tag LOCUS_09320 29350 29568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 29719 30435 gene locus_tag LOCUS_09330 29719 30435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 30584 30865 gene locus_tag LOCUS_09340 30584 30865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 31097 31678 gene locus_tag LOCUS_09350 31097 31678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 32421 32879 gene locus_tag LOCUS_09360 32421 32879 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940934.1 protein_id gnl|my_center|LOCUS_09360 32929 34314 gene locus_tag LOCUS_09370 32929 34314 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_09370 34322 35335 gene locus_tag LOCUS_09380 34322 35335 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023275.1 protein_id gnl|my_center|LOCUS_09380 35347 36408 gene locus_tag LOCUS_09390 35347 36408 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_09390 36651 37910 gene locus_tag LOCUS_09400 36651 37910 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_09400 37940 38770 gene locus_tag LOCUS_09410 37940 38770 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_09410 38774 39616 gene locus_tag LOCUS_09420 38774 39616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 39651 39905 gene locus_tag LOCUS_09430 39651 39905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 39921 41294 gene locus_tag LOCUS_09440 39921 41294 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444159.1 protein_id gnl|my_center|LOCUS_09440 41312 41851 gene locus_tag LOCUS_09450 41312 41851 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948363.1 protein_id gnl|my_center|LOCUS_09450 41861 42535 gene locus_tag LOCUS_09460 41861 42535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 42542 42835 gene locus_tag LOCUS_09470 42542 42835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 42853 45024 gene locus_tag LOCUS_09480 42853 45024 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093407568.1 protein_id gnl|my_center|LOCUS_09480 45332 49576 gene locus_tag LOCUS_09490 45332 49576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962563.1 protein_id gnl|my_center|LOCUS_09490 50855 49785 gene locus_tag LOCUS_09500 50855 49785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 53305 50921 gene locus_tag LOCUS_09510 53305 50921 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144873981.1 protein_id gnl|my_center|LOCUS_09510 54716 53478 gene locus_tag LOCUS_09520 54716 53478 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_09520 56014 55085 gene locus_tag LOCUS_09530 56014 55085 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_09530 56573 56031 gene locus_tag LOCUS_09540 gene clpP 56573 56031 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925383.1 protein_id gnl|my_center|LOCUS_09540 56968 56651 gene locus_tag LOCUS_09550 gene trxA 56968 56651 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962434.1 protein_id gnl|my_center|LOCUS_09550 58025 57159 gene locus_tag LOCUS_09560 58025 57159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 62487 58102 gene locus_tag LOCUS_09570 gene dnaE 62487 58102 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962512.1 protein_id gnl|my_center|LOCUS_09570 >Feature sequence012 211 855 gene locus_tag LOCUS_09580 211 855 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963839.1 protein_id gnl|my_center|LOCUS_09580 861 1175 gene locus_tag LOCUS_09590 861 1175 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963838.1 protein_id gnl|my_center|LOCUS_09590 1156 1413 gene locus_tag LOCUS_09600 1156 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963837.1 protein_id gnl|my_center|LOCUS_09600 3638 1488 gene locus_tag LOCUS_09610 gene katG 3638 1488 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400805.1 protein_id gnl|my_center|LOCUS_09610 3964 4332 gene locus_tag LOCUS_09620 3964 4332 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963705.1 protein_id gnl|my_center|LOCUS_09620 4485 6866 gene locus_tag LOCUS_09630 4485 6866 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_09630 6878 7513 gene locus_tag LOCUS_09640 6878 7513 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963703.1 protein_id gnl|my_center|LOCUS_09640 7590 9488 gene locus_tag LOCUS_09650 7590 9488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 9505 10665 gene locus_tag LOCUS_09660 gene ribB 9505 10665 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963701.1 protein_id gnl|my_center|LOCUS_09660 11861 10662 gene locus_tag LOCUS_09670 11861 10662 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072442.1 protein_id gnl|my_center|LOCUS_09670 12500 11868 gene locus_tag LOCUS_09680 12500 11868 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962679.1 protein_id gnl|my_center|LOCUS_09680 12975 14225 gene locus_tag LOCUS_09690 12975 14225 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_09690 14423 14686 gene locus_tag LOCUS_09700 14423 14686 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963652.1 protein_id gnl|my_center|LOCUS_09700 14686 16185 gene locus_tag LOCUS_09710 14686 16185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 16307 19375 gene locus_tag LOCUS_09720 16307 19375 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025455799.1 protein_id gnl|my_center|LOCUS_09720 19395 21029 gene locus_tag LOCUS_09730 19395 21029 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688773.1 protein_id gnl|my_center|LOCUS_09730 21013 22332 gene locus_tag LOCUS_09740 21013 22332 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922229.1 protein_id gnl|my_center|LOCUS_09740 22325 22954 gene locus_tag LOCUS_09750 22325 22954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 22944 24383 gene locus_tag LOCUS_09760 22944 24383 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022198.1 protein_id gnl|my_center|LOCUS_09760 24385 25290 gene locus_tag LOCUS_09770 24385 25290 CDS product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693981.1 protein_id gnl|my_center|LOCUS_09770 25639 25839 gene locus_tag LOCUS_09780 25639 25839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 25912 27234 gene locus_tag LOCUS_09790 25912 27234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 27930 27595 gene locus_tag LOCUS_09800 27930 27595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 28992 28243 gene locus_tag LOCUS_09810 28992 28243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964412.1 protein_id gnl|my_center|LOCUS_09810 29202 29390 gene locus_tag LOCUS_09820 29202 29390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161644875.1 protein_id gnl|my_center|LOCUS_09820 30250 29630 gene locus_tag LOCUS_09830 30250 29630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 30932 30498 gene locus_tag LOCUS_09840 30932 30498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 31543 31328 gene locus_tag LOCUS_09850 31543 31328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 31739 31978 gene locus_tag LOCUS_09860 31739 31978 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_09860 31950 32267 gene locus_tag LOCUS_09870 31950 32267 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_09870 32264 33220 gene locus_tag LOCUS_09880 32264 33220 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_09880 34405 33431 gene locus_tag LOCUS_09890 34405 33431 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962198.1 protein_id gnl|my_center|LOCUS_09890 48296 34443 gene locus_tag LOCUS_09900 48296 34443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 51099 48679 gene locus_tag LOCUS_09910 51099 48679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 52534 51101 gene locus_tag LOCUS_09920 52534 51101 CDS product gliding motility-associated C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962195.1 protein_id gnl|my_center|LOCUS_09920 53951 52638 gene locus_tag LOCUS_09930 53951 52638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962194.1 protein_id gnl|my_center|LOCUS_09930 54754 54350 gene locus_tag LOCUS_09940 54754 54350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962193.1 protein_id gnl|my_center|LOCUS_09940 55023 55409 gene locus_tag LOCUS_09950 55023 55409 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207371.1 protein_id gnl|my_center|LOCUS_09950 55553 57115 gene locus_tag LOCUS_09960 55553 57115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_09960 57282 57977 gene locus_tag LOCUS_09970 57282 57977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 >Feature sequence013 209 781 gene locus_tag LOCUS_09980 209 781 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962376.1 protein_id gnl|my_center|LOCUS_09980 774 1415 gene locus_tag LOCUS_09990 774 1415 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108811.1 protein_id gnl|my_center|LOCUS_09990 1472 2407 gene locus_tag LOCUS_10000 1472 2407 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_10000 2547 4445 gene locus_tag LOCUS_10010 2547 4445 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_10010 5521 4913 gene locus_tag LOCUS_10020 5521 4913 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962337.1 protein_id gnl|my_center|LOCUS_10020 5651 8791 gene locus_tag LOCUS_10030 5651 8791 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962336.1 protein_id gnl|my_center|LOCUS_10030 8813 10006 gene locus_tag LOCUS_10040 gene kbl 8813 10006 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962334.1 protein_id gnl|my_center|LOCUS_10040 10161 11489 gene locus_tag LOCUS_10050 10161 11489 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962333.1 protein_id gnl|my_center|LOCUS_10050 11559 14321 gene locus_tag LOCUS_10060 11559 14321 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962332.1 protein_id gnl|my_center|LOCUS_10060 14327 15163 gene locus_tag LOCUS_10070 14327 15163 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583927.1 protein_id gnl|my_center|LOCUS_10070 15521 16228 gene locus_tag LOCUS_10080 15521 16228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 16408 17271 gene locus_tag LOCUS_10090 16408 17271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 17318 17788 gene locus_tag LOCUS_10100 17318 17788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 17985 18572 gene locus_tag LOCUS_10110 17985 18572 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932189.1 protein_id gnl|my_center|LOCUS_10110 18583 19332 gene locus_tag LOCUS_10120 18583 19332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 19481 20812 gene locus_tag LOCUS_10130 19481 20812 CDS product DUF5690 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918537.1 protein_id gnl|my_center|LOCUS_10130 20815 21969 gene locus_tag LOCUS_10140 20815 21969 CDS product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921907.1 protein_id gnl|my_center|LOCUS_10140 21971 22651 gene locus_tag LOCUS_10150 21971 22651 CDS product phosphonatase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921908.1 protein_id gnl|my_center|LOCUS_10150 23239 22673 gene locus_tag LOCUS_10160 23239 22673 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772562.1 protein_id gnl|my_center|LOCUS_10160 23525 26581 gene locus_tag LOCUS_10170 23525 26581 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203176.1 protein_id gnl|my_center|LOCUS_10170 26593 28098 gene locus_tag LOCUS_10180 26593 28098 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789122.1 protein_id gnl|my_center|LOCUS_10180 28106 29746 gene locus_tag LOCUS_10190 28106 29746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 29759 31108 gene locus_tag LOCUS_10200 29759 31108 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481438.1 protein_id gnl|my_center|LOCUS_10200 31135 33939 gene locus_tag LOCUS_10210 31135 33939 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928482.1 protein_id gnl|my_center|LOCUS_10210 34454 34380 gene locus_tag LOCUS_t00060 34454 34380 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 35257 34460 gene locus_tag LOCUS_10220 35257 34460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 35407 35580 gene locus_tag LOCUS_10230 35407 35580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 35707 36159 gene locus_tag LOCUS_10240 35707 36159 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 protein_id gnl|my_center|LOCUS_10240 36152 36922 gene locus_tag LOCUS_10250 36152 36922 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_10250 38184 36919 gene locus_tag LOCUS_10260 gene nreB 38184 36919 CDS product nickel resistance MFS transporter NreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117292.1 protein_id gnl|my_center|LOCUS_10260 39887 38181 gene locus_tag LOCUS_10270 gene recJ 39887 38181 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_10270 40344 39922 gene locus_tag LOCUS_10280 40344 39922 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080643.1 protein_id gnl|my_center|LOCUS_10280 40520 41185 gene locus_tag LOCUS_10290 40520 41185 CDS product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356718.1 protein_id gnl|my_center|LOCUS_10290 41187 42650 gene locus_tag LOCUS_10300 41187 42650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 43936 42665 gene locus_tag LOCUS_10310 43936 42665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 44696 43947 gene locus_tag LOCUS_10320 44696 43947 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096592.1 protein_id gnl|my_center|LOCUS_10320 44822 48004 gene locus_tag LOCUS_10330 44822 48004 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813423.1 protein_id gnl|my_center|LOCUS_10330 48017 49507 gene locus_tag LOCUS_10340 48017 49507 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766448.1 protein_id gnl|my_center|LOCUS_10340 49743 52790 gene locus_tag LOCUS_10350 49743 52790 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121850300.1 protein_id gnl|my_center|LOCUS_10350 52802 54307 gene locus_tag LOCUS_10360 52802 54307 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766448.1 protein_id gnl|my_center|LOCUS_10360 55391 54369 gene locus_tag LOCUS_10370 55391 54369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 56408 55398 gene locus_tag LOCUS_10380 56408 55398 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922169.1 protein_id gnl|my_center|LOCUS_10380 56478 57068 gene locus_tag LOCUS_10390 56478 57068 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146459507.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence014 4633 2855 gene locus_tag LOCUS_10400 4633 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 4887 7748 gene locus_tag LOCUS_10410 4887 7748 CDS product triple tyrosine motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091372500.1 protein_id gnl|my_center|LOCUS_10410 7994 7806 gene locus_tag LOCUS_10420 7994 7806 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963915.1 protein_id gnl|my_center|LOCUS_10420 8312 8007 gene locus_tag LOCUS_10430 8312 8007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 11547 8317 gene locus_tag LOCUS_10440 11547 8317 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963916.1 protein_id gnl|my_center|LOCUS_10440 12816 11743 gene locus_tag LOCUS_10450 12816 11743 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963917.1 protein_id gnl|my_center|LOCUS_10450 14201 12888 gene locus_tag LOCUS_10460 14201 12888 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963918.1 protein_id gnl|my_center|LOCUS_10460 16098 14641 gene locus_tag LOCUS_10470 16098 14641 CDS product sulfide:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931811.1 protein_id gnl|my_center|LOCUS_10470 16375 16554 gene locus_tag LOCUS_10480 16375 16554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 17163 16489 gene locus_tag LOCUS_10490 17163 16489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 18497 17166 gene locus_tag LOCUS_10500 18497 17166 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942285.1 protein_id gnl|my_center|LOCUS_10500 19099 18587 gene locus_tag LOCUS_10510 19099 18587 CDS product DUF2202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020473.1 protein_id gnl|my_center|LOCUS_10510 19355 19669 gene locus_tag LOCUS_10520 19355 19669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 19753 21855 gene locus_tag LOCUS_10530 19753 21855 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943611.1 protein_id gnl|my_center|LOCUS_10530 22064 21912 gene locus_tag LOCUS_10540 22064 21912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 22264 22992 gene locus_tag LOCUS_10550 22264 22992 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761810.1 protein_id gnl|my_center|LOCUS_10550 23123 24007 gene locus_tag LOCUS_10560 gene era 23123 24007 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964066.1 protein_id gnl|my_center|LOCUS_10560 24739 24008 gene locus_tag LOCUS_10570 24739 24008 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002683251.1 protein_id gnl|my_center|LOCUS_10570 25294 24800 gene locus_tag LOCUS_10580 25294 24800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 25372 26676 gene locus_tag LOCUS_10590 gene der 25372 26676 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964065.1 protein_id gnl|my_center|LOCUS_10590 26726 27667 gene locus_tag LOCUS_10600 26726 27667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 28567 27803 gene locus_tag LOCUS_10610 28567 27803 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964050.1 protein_id gnl|my_center|LOCUS_10610 29043 28606 gene locus_tag LOCUS_10620 29043 28606 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_10620 29649 29050 gene locus_tag LOCUS_10630 29649 29050 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964048.1 protein_id gnl|my_center|LOCUS_10630 30043 29714 gene locus_tag LOCUS_10640 30043 29714 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_10640 31014 30043 gene locus_tag LOCUS_10650 31014 30043 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_10650 31232 33748 gene locus_tag LOCUS_10660 gene alaS 31232 33748 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964045.1 protein_id gnl|my_center|LOCUS_10660 33759 34265 gene locus_tag LOCUS_10670 33759 34265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 34342 35289 gene locus_tag LOCUS_10680 34342 35289 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964056.1 protein_id gnl|my_center|LOCUS_10680 36006 35701 gene locus_tag LOCUS_10690 36006 35701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 36161 36526 gene locus_tag LOCUS_10700 36161 36526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 36519 37454 gene locus_tag LOCUS_10710 36519 37454 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401697.1 protein_id gnl|my_center|LOCUS_10710 37513 38265 gene locus_tag LOCUS_10720 37513 38265 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_10720 40026 38266 gene locus_tag LOCUS_10730 40026 38266 CDS product aromatic amino acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964058.1 protein_id gnl|my_center|LOCUS_10730 40636 40136 gene locus_tag LOCUS_10740 40636 40136 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964059.1 protein_id gnl|my_center|LOCUS_10740 41369 42280 gene locus_tag LOCUS_10750 41369 42280 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_10750 42318 43361 gene locus_tag LOCUS_10760 42318 43361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 43389 44675 gene locus_tag LOCUS_10770 gene hemL 43389 44675 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963336.1 protein_id gnl|my_center|LOCUS_10770 45224 44766 gene locus_tag LOCUS_10780 45224 44766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 45536 46009 gene locus_tag LOCUS_10790 45536 46009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 47767 46079 gene locus_tag LOCUS_10800 gene lysS 47767 46079 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963334.1 protein_id gnl|my_center|LOCUS_10800 48324 47896 gene locus_tag LOCUS_10810 48324 47896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 49490 48432 gene locus_tag LOCUS_10820 49490 48432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 49797 50498 gene locus_tag LOCUS_10830 gene lipB 49797 50498 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963333.1 protein_id gnl|my_center|LOCUS_10830 51189 50488 gene locus_tag LOCUS_10840 51189 50488 CDS product aromatic aminobenezylarsenical efflux permease ArsG family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107126.1 protein_id gnl|my_center|LOCUS_10840 51626 51189 gene locus_tag LOCUS_10850 51626 51189 CDS product nitrophenyl compound nitroreductase subunit ArsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292399.1 protein_id gnl|my_center|LOCUS_10850 52620 51643 gene locus_tag LOCUS_10860 52620 51643 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943586.1 protein_id gnl|my_center|LOCUS_10860 52922 52629 gene locus_tag LOCUS_10870 52922 52629 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933389.1 protein_id gnl|my_center|LOCUS_10870 53251 52946 gene locus_tag LOCUS_10880 53251 52946 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933390.1 protein_id gnl|my_center|LOCUS_10880 54354 53317 gene locus_tag LOCUS_10890 gene arsB 54354 53317 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482643.1 protein_id gnl|my_center|LOCUS_10890 54972 54358 gene locus_tag LOCUS_10900 54972 54358 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615927.1 protein_id gnl|my_center|LOCUS_10900 55886 54993 gene locus_tag LOCUS_10910 55886 54993 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405176.1 protein_id gnl|my_center|LOCUS_10910 56370 55921 gene locus_tag LOCUS_10920 56370 55921 CDS product DUF6428 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_10920 56749 56420 gene locus_tag LOCUS_10930 56749 56420 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_10930 >Feature sequence015 127 615 gene locus_tag LOCUS_10940 127 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 856 623 gene locus_tag LOCUS_10950 856 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 1745 843 gene locus_tag LOCUS_10960 gene murQ 1745 843 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962884.1 protein_id gnl|my_center|LOCUS_10960 2535 1720 gene locus_tag LOCUS_10970 2535 1720 CDS product DUF4249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962851.1 protein_id gnl|my_center|LOCUS_10970 4914 2539 gene locus_tag LOCUS_10980 4914 2539 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_10980 7200 4978 gene locus_tag LOCUS_10990 7200 4978 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142855.1 protein_id gnl|my_center|LOCUS_10990 8450 8058 gene locus_tag LOCUS_11000 gene rplS 8450 8058 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963978.1 protein_id gnl|my_center|LOCUS_11000 9291 8614 gene locus_tag LOCUS_11010 gene trmD 9291 8614 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963979.1 protein_id gnl|my_center|LOCUS_11010 10100 9465 gene locus_tag LOCUS_11020 10100 9465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 11683 10235 gene locus_tag LOCUS_11030 11683 10235 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963349.1 protein_id gnl|my_center|LOCUS_11030 13227 11824 gene locus_tag LOCUS_11040 13227 11824 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 protein_id gnl|my_center|LOCUS_11040 13375 14148 gene locus_tag LOCUS_11050 gene dapF 13375 14148 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963347.1 protein_id gnl|my_center|LOCUS_11050 14145 14669 gene locus_tag LOCUS_11060 14145 14669 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 protein_id gnl|my_center|LOCUS_11060 14670 15713 gene locus_tag LOCUS_11070 gene mltG 14670 15713 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963345.1 protein_id gnl|my_center|LOCUS_11070 15716 16624 gene locus_tag LOCUS_11080 15716 16624 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_11080 16736 17401 gene locus_tag LOCUS_11090 16736 17401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 18126 17410 gene locus_tag LOCUS_11100 18126 17410 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_11100 18641 18189 gene locus_tag LOCUS_11110 18641 18189 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100664.1 protein_id gnl|my_center|LOCUS_11110 20081 18654 gene locus_tag LOCUS_11120 gene dnaA 20081 18654 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_11120 20275 20685 gene locus_tag LOCUS_11130 20275 20685 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_11130 21295 20687 gene locus_tag LOCUS_11140 21295 20687 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964127.1 protein_id gnl|my_center|LOCUS_11140 21913 21302 gene locus_tag LOCUS_11150 21913 21302 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964126.1 protein_id gnl|my_center|LOCUS_11150 22910 21906 gene locus_tag LOCUS_11160 gene ribD 22910 21906 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964125.1 protein_id gnl|my_center|LOCUS_11160 22933 23427 gene locus_tag LOCUS_11170 22933 23427 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964124.1 protein_id gnl|my_center|LOCUS_11170 23424 24293 gene locus_tag LOCUS_11180 gene prmC 23424 24293 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964123.1 protein_id gnl|my_center|LOCUS_11180 24290 24871 gene locus_tag LOCUS_11190 24290 24871 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222951.1 protein_id gnl|my_center|LOCUS_11190 24874 26862 gene locus_tag LOCUS_11200 gene ligA 24874 26862 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963952.1 protein_id gnl|my_center|LOCUS_11200 26955 27680 gene locus_tag LOCUS_11210 26955 27680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 28060 27677 gene locus_tag LOCUS_11220 28060 27677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 28228 28977 gene locus_tag LOCUS_11230 28228 28977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 29891 28974 gene locus_tag LOCUS_11240 29891 28974 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_11240 30595 29903 gene locus_tag LOCUS_11250 30595 29903 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963939.1 protein_id gnl|my_center|LOCUS_11250 30721 31248 gene locus_tag LOCUS_11260 30721 31248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 31241 32119 gene locus_tag LOCUS_11270 gene dapA 31241 32119 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963941.1 protein_id gnl|my_center|LOCUS_11270 32240 33046 gene locus_tag LOCUS_11280 gene bamD 32240 33046 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 protein_id gnl|my_center|LOCUS_11280 33046 33381 gene locus_tag LOCUS_11290 33046 33381 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963943.1 protein_id gnl|my_center|LOCUS_11290 33389 34600 gene locus_tag LOCUS_11300 gene coaBC 33389 34600 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 protein_id gnl|my_center|LOCUS_11300 34593 35480 gene locus_tag LOCUS_11310 34593 35480 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_11310 35545 37197 gene locus_tag LOCUS_11320 gene recN 35545 37197 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963946.1 protein_id gnl|my_center|LOCUS_11320 37255 38070 gene locus_tag LOCUS_11330 37255 38070 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759864.1 protein_id gnl|my_center|LOCUS_11330 38146 39156 gene locus_tag LOCUS_11340 38146 39156 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963936.1 protein_id gnl|my_center|LOCUS_11340 39153 40118 gene locus_tag LOCUS_11350 39153 40118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 40135 40719 gene locus_tag LOCUS_11360 gene coaE 40135 40719 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963935.1 protein_id gnl|my_center|LOCUS_11360 40836 42371 gene locus_tag LOCUS_11370 40836 42371 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963934.1 protein_id gnl|my_center|LOCUS_11370 42374 43078 gene locus_tag LOCUS_11380 42374 43078 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_11380 43593 43291 gene locus_tag LOCUS_11390 43593 43291 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939018.1 protein_id gnl|my_center|LOCUS_11390 43887 43606 gene locus_tag LOCUS_11400 43887 43606 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_11400 44746 44087 gene locus_tag LOCUS_11410 44746 44087 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963235.1 protein_id gnl|my_center|LOCUS_11410 45081 44740 gene locus_tag LOCUS_11420 45081 44740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 46340 45084 gene locus_tag LOCUS_11430 46340 45084 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_11430 48259 46337 gene locus_tag LOCUS_11440 48259 46337 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_11440 48454 50346 gene locus_tag LOCUS_11450 48454 50346 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963061.1 protein_id gnl|my_center|LOCUS_11450 51218 50442 gene locus_tag LOCUS_11460 51218 50442 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503931.1 protein_id gnl|my_center|LOCUS_11460 51883 51218 gene locus_tag LOCUS_11470 51883 51218 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962793.1 protein_id gnl|my_center|LOCUS_11470 54369 51934 gene locus_tag LOCUS_11480 54369 51934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 54552 55094 gene locus_tag LOCUS_11490 gene msrA 54552 55094 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962794.1 protein_id gnl|my_center|LOCUS_11490 >Feature sequence016 <1 1133 gene locus_tag LOCUS_11500 <1 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361986.1:Calx-beta domain-containing protein 1145 2071 gene locus_tag LOCUS_11510 1145 2071 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_11510 2122 3999 gene locus_tag LOCUS_11520 2122 3999 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_11520 4053 5978 gene locus_tag LOCUS_11530 4053 5978 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_11530 6709 6131 gene locus_tag LOCUS_11540 6709 6131 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_11540 7988 6795 gene locus_tag LOCUS_11550 gene ackA 7988 6795 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_11550 10084 7991 gene locus_tag LOCUS_11560 gene pta 10084 7991 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_11560 10291 11532 gene locus_tag LOCUS_11570 gene hutI 10291 11532 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963888.1 protein_id gnl|my_center|LOCUS_11570 12478 11594 gene locus_tag LOCUS_11580 12478 11594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 12599 13618 gene locus_tag LOCUS_11590 12599 13618 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963810.1 protein_id gnl|my_center|LOCUS_11590 13608 14072 gene locus_tag LOCUS_11600 13608 14072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 14654 14061 gene locus_tag LOCUS_11610 gene nudK 14654 14061 CDS product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037689.1 protein_id gnl|my_center|LOCUS_11610 14850 15089 gene locus_tag LOCUS_11620 14850 15089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 17038 15347 gene locus_tag LOCUS_11630 gene ettA 17038 15347 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963874.1 protein_id gnl|my_center|LOCUS_11630 17220 17038 gene locus_tag LOCUS_11640 17220 17038 CDS product CAL67264 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963197.1 protein_id gnl|my_center|LOCUS_11640 18132 17410 gene locus_tag LOCUS_11650 18132 17410 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_11650 18594 18157 gene locus_tag LOCUS_11660 18594 18157 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_11660 18887 18603 gene locus_tag LOCUS_11670 18887 18603 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529296.1 protein_id gnl|my_center|LOCUS_11670 19513 18890 gene locus_tag LOCUS_11680 19513 18890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 20822 19542 gene locus_tag LOCUS_11690 gene aceA 20822 19542 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787342.1 protein_id gnl|my_center|LOCUS_11690 22492 20894 gene locus_tag LOCUS_11700 gene aceB 22492 20894 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107325.1 protein_id gnl|my_center|LOCUS_11700 22620 24095 gene locus_tag LOCUS_11710 22620 24095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 24143 25771 gene locus_tag LOCUS_11720 24143 25771 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_11720 26841 25768 gene locus_tag LOCUS_11730 26841 25768 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_11730 28023 26869 gene locus_tag LOCUS_11740 28023 26869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 29063 28026 gene locus_tag LOCUS_11750 29063 28026 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962662.1 protein_id gnl|my_center|LOCUS_11750 29794 29117 gene locus_tag LOCUS_11760 29794 29117 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080208.1 protein_id gnl|my_center|LOCUS_11760 30741 29839 gene locus_tag LOCUS_11770 gene menA 30741 29839 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962643.1 protein_id gnl|my_center|LOCUS_11770 31006 30743 gene locus_tag LOCUS_11780 31006 30743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 31055 31129 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31876 32052 gene locus_tag LOCUS_11790 31876 32052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 32746 32006 gene locus_tag LOCUS_11800 gene ung 32746 32006 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_11800 32732 34225 gene locus_tag LOCUS_11810 32732 34225 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949006.1 protein_id gnl|my_center|LOCUS_11810 35226 34222 gene locus_tag LOCUS_11820 gene holA 35226 34222 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_11820 35329 35778 gene locus_tag LOCUS_11830 35329 35778 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_11830 35775 36764 gene locus_tag LOCUS_11840 35775 36764 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_11840 36861 37700 gene locus_tag LOCUS_11850 36861 37700 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_11850 38399 37770 gene locus_tag LOCUS_11860 38399 37770 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_11860 38502 39458 gene locus_tag LOCUS_11870 38502 39458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 39455 40423 gene locus_tag LOCUS_11880 39455 40423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 42794 40428 gene locus_tag LOCUS_11890 42794 40428 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963024.1 protein_id gnl|my_center|LOCUS_11890 42912 43499 gene locus_tag LOCUS_11900 42912 43499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_11900 44418 43501 gene locus_tag LOCUS_11910 44418 43501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 45409 44507 gene locus_tag LOCUS_11920 45409 44507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 47398 45422 gene locus_tag LOCUS_11930 47398 45422 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963153.1 protein_id gnl|my_center|LOCUS_11930 49227 47539 gene locus_tag LOCUS_11940 49227 47539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 49439 51541 gene locus_tag LOCUS_11950 gene recG 49439 51541 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963155.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence017 634 89 gene locus_tag LOCUS_11960 gene rfbC 634 89 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_11960 949 782 gene locus_tag LOCUS_11970 949 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1968 1102 gene locus_tag LOCUS_11980 gene rfbA 1968 1102 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857508.1 protein_id gnl|my_center|LOCUS_11980 2353 2003 gene locus_tag LOCUS_11990 2353 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 3471 2428 gene locus_tag LOCUS_12000 gene rfbB 3471 2428 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963426.1 protein_id gnl|my_center|LOCUS_12000 4545 3472 gene locus_tag LOCUS_12010 4545 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 6248 4560 gene locus_tag LOCUS_12020 6248 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_12020 7778 6276 gene locus_tag LOCUS_12030 7778 6276 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_12030 8647 7778 gene locus_tag LOCUS_12040 8647 7778 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_12040 8765 8947 gene locus_tag LOCUS_12050 8765 8947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 9983 9006 gene locus_tag LOCUS_12060 9983 9006 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404416.1 protein_id gnl|my_center|LOCUS_12060 11561 10008 gene locus_tag LOCUS_12070 11561 10008 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962200.1 protein_id gnl|my_center|LOCUS_12070 12826 11639 gene locus_tag LOCUS_12080 12826 11639 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962199.1 protein_id gnl|my_center|LOCUS_12080 13107 14261 gene locus_tag LOCUS_12090 13107 14261 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962192.1 protein_id gnl|my_center|LOCUS_12090 14261 15184 gene locus_tag LOCUS_12100 14261 15184 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083159.1 protein_id gnl|my_center|LOCUS_12100 15772 15257 gene locus_tag LOCUS_12110 15772 15257 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962186.1 protein_id gnl|my_center|LOCUS_12110 16861 15995 gene locus_tag LOCUS_12120 16861 15995 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_12120 18796 16925 gene locus_tag LOCUS_12130 gene mnmG 18796 16925 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962184.1 protein_id gnl|my_center|LOCUS_12130 19321 18911 gene locus_tag LOCUS_12140 gene ybeY 19321 18911 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962183.1 protein_id gnl|my_center|LOCUS_12140 22670 19314 gene locus_tag LOCUS_12150 22670 19314 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_12150 22799 23842 gene locus_tag LOCUS_12160 22799 23842 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191500.1 protein_id gnl|my_center|LOCUS_12160 23893 25422 gene locus_tag LOCUS_12170 gene gltX 23893 25422 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964585.1 protein_id gnl|my_center|LOCUS_12170 26115 25429 gene locus_tag LOCUS_12180 26115 25429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 26191 27117 gene locus_tag LOCUS_12190 26191 27117 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_12190 28343 27264 gene locus_tag LOCUS_12200 28343 27264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964068.1 protein_id gnl|my_center|LOCUS_12200 28972 28490 gene locus_tag LOCUS_12210 28972 28490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 31106 29058 gene locus_tag LOCUS_12220 31106 29058 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964580.1 protein_id gnl|my_center|LOCUS_12220 31128 31574 gene locus_tag LOCUS_12230 gene folB 31128 31574 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964579.1 protein_id gnl|my_center|LOCUS_12230 31618 31689 gene locus_tag LOCUS_t00070 31618 31689 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 32400 31705 gene locus_tag LOCUS_12240 32400 31705 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964578.1 protein_id gnl|my_center|LOCUS_12240 32728 32519 gene locus_tag LOCUS_12250 32728 32519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 35553 33268 gene locus_tag LOCUS_12260 gene bglX 35553 33268 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658134.1 protein_id gnl|my_center|LOCUS_12260 36662 35550 gene locus_tag LOCUS_12270 36662 35550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 37605 36730 gene locus_tag LOCUS_12280 37605 36730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 39668 37617 gene locus_tag LOCUS_12290 39668 37617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 41160 39679 gene locus_tag LOCUS_12300 41160 39679 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108889.1 protein_id gnl|my_center|LOCUS_12300 44186 41169 gene locus_tag LOCUS_12310 44186 41169 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_12310 47225 44415 gene locus_tag LOCUS_12320 47225 44415 CDS product triple tyrosine motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091372500.1 protein_id gnl|my_center|LOCUS_12320 48032 47358 gene locus_tag LOCUS_12330 48032 47358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 50312 48123 gene locus_tag LOCUS_12340 gene rnr 50312 48123 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964576.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence018 238 1488 gene locus_tag LOCUS_12350 238 1488 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_12350 2207 1539 gene locus_tag LOCUS_12360 2207 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 3569 2466 gene locus_tag LOCUS_12370 3569 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 5387 3705 gene locus_tag LOCUS_12380 5387 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 6034 5540 gene locus_tag LOCUS_12390 6034 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 6342 6031 gene locus_tag LOCUS_12400 6342 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 8546 7422 gene locus_tag LOCUS_12410 8546 7422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 8991 8521 gene locus_tag LOCUS_12420 8991 8521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 9398 9610 gene locus_tag LOCUS_12430 9398 9610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 9661 9981 gene locus_tag LOCUS_12440 9661 9981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 10825 10262 gene locus_tag LOCUS_12450 10825 10262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 11762 12784 gene locus_tag LOCUS_12460 11762 12784 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005941495.1 protein_id gnl|my_center|LOCUS_12460 13092 16352 gene locus_tag LOCUS_12470 13092 16352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 16499 17497 gene locus_tag LOCUS_12480 16499 17497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 17472 18329 gene locus_tag LOCUS_12490 17472 18329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 18326 21316 gene locus_tag LOCUS_12500 18326 21316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 22690 21443 gene locus_tag LOCUS_12510 22690 21443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 22905 22783 gene locus_tag LOCUS_12520 22905 22783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 23041 23697 gene locus_tag LOCUS_12530 23041 23697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 23684 24091 gene locus_tag LOCUS_12540 23684 24091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 24078 24851 gene locus_tag LOCUS_12550 24078 24851 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331492.1 protein_id gnl|my_center|LOCUS_12550 26092 25364 gene locus_tag LOCUS_12560 26092 25364 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962837.1 protein_id gnl|my_center|LOCUS_12560 28009 26192 gene locus_tag LOCUS_12570 28009 26192 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962836.1 protein_id gnl|my_center|LOCUS_12570 28346 28002 gene locus_tag LOCUS_12580 28346 28002 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_12580 28850 28404 gene locus_tag LOCUS_12590 28850 28404 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074087.1 protein_id gnl|my_center|LOCUS_12590 28997 29458 gene locus_tag LOCUS_12600 28997 29458 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_12600 29528 30328 gene locus_tag LOCUS_12610 29528 30328 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147838.1 protein_id gnl|my_center|LOCUS_12610 30461 30658 gene locus_tag LOCUS_12620 30461 30658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 31626 30688 gene locus_tag LOCUS_12630 31626 30688 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_12630 31730 32209 gene locus_tag LOCUS_12640 31730 32209 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461991.1 protein_id gnl|my_center|LOCUS_12640 32352 32954 gene locus_tag LOCUS_12650 32352 32954 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_12650 33661 32951 gene locus_tag LOCUS_12660 33661 32951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 33665 34306 gene locus_tag LOCUS_12670 33665 34306 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_12670 34356 35153 gene locus_tag LOCUS_12680 34356 35153 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964038.1 protein_id gnl|my_center|LOCUS_12680 35172 35522 gene locus_tag LOCUS_12690 35172 35522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 35570 37861 gene locus_tag LOCUS_12700 35570 37861 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108131.1 protein_id gnl|my_center|LOCUS_12700 37870 38460 gene locus_tag LOCUS_12710 37870 38460 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964094.1 protein_id gnl|my_center|LOCUS_12710 39084 38449 gene locus_tag LOCUS_12720 39084 38449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964037.1 protein_id gnl|my_center|LOCUS_12720 39583 39089 gene locus_tag LOCUS_12730 39583 39089 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964036.1 protein_id gnl|my_center|LOCUS_12730 40096 42249 gene locus_tag LOCUS_12740 40096 42249 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963765.1 protein_id gnl|my_center|LOCUS_12740 42413 43141 gene locus_tag LOCUS_12750 42413 43141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 43342 43965 gene locus_tag LOCUS_12760 43342 43965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963764.1 protein_id gnl|my_center|LOCUS_12760 43990 45330 gene locus_tag LOCUS_12770 43990 45330 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963763.1 protein_id gnl|my_center|LOCUS_12770 45321 45653 gene locus_tag LOCUS_12780 45321 45653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 45672 46013 gene locus_tag LOCUS_12790 45672 46013 CDS product 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963760.1 protein_id gnl|my_center|LOCUS_12790 46010 46768 gene locus_tag LOCUS_12800 46010 46768 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_12800 49271 46746 gene locus_tag LOCUS_12810 49271 46746 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099839674.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence019 434 201 gene locus_tag LOCUS_12820 434 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 674 599 gene locus_tag LOCUS_t00080 674 599 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 685 1506 gene locus_tag LOCUS_12830 685 1506 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964522.1 protein_id gnl|my_center|LOCUS_12830 1503 2816 gene locus_tag LOCUS_12840 1503 2816 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_12840 2835 4217 gene locus_tag LOCUS_12850 2835 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 4275 4772 gene locus_tag LOCUS_12860 gene lptC 4275 4772 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964520.1 protein_id gnl|my_center|LOCUS_12860 4842 5036 gene locus_tag LOCUS_12870 4842 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 5037 6326 gene locus_tag LOCUS_12880 5037 6326 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_12880 6465 8588 gene locus_tag LOCUS_12890 6465 8588 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964518.1 protein_id gnl|my_center|LOCUS_12890 9556 8639 gene locus_tag LOCUS_12900 9556 8639 CDS product GYDIA family GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_12900 10875 9553 gene locus_tag LOCUS_12910 10875 9553 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964430.1 protein_id gnl|my_center|LOCUS_12910 11145 12683 gene locus_tag LOCUS_12920 11145 12683 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246610.1 protein_id gnl|my_center|LOCUS_12920 12737 14518 gene locus_tag LOCUS_12930 12737 14518 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118829520.1 protein_id gnl|my_center|LOCUS_12930 14626 15174 gene locus_tag LOCUS_12940 14626 15174 CDS product thioredoxin fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 protein_id gnl|my_center|LOCUS_12940 17215 15179 gene locus_tag LOCUS_12950 17215 15179 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964423.1 protein_id gnl|my_center|LOCUS_12950 17810 17238 gene locus_tag LOCUS_12960 17810 17238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 18933 17818 gene locus_tag LOCUS_12970 gene lpxB 18933 17818 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_12970 19230 18946 gene locus_tag LOCUS_12980 19230 18946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964420.1 protein_id gnl|my_center|LOCUS_12980 20032 19223 gene locus_tag LOCUS_12990 gene surE 20032 19223 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964421.1 protein_id gnl|my_center|LOCUS_12990 20212 22362 gene locus_tag LOCUS_13000 20212 22362 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_13000 23745 22537 gene locus_tag LOCUS_13010 23745 22537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 protein_id gnl|my_center|LOCUS_13010 24391 23780 gene locus_tag LOCUS_13020 gene yihA 24391 23780 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964166.1 protein_id gnl|my_center|LOCUS_13020 25172 24411 gene locus_tag LOCUS_13030 25172 24411 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_13030 25524 25940 gene locus_tag LOCUS_13040 gene mraZ 25524 25940 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964164.1 protein_id gnl|my_center|LOCUS_13040 25927 26823 gene locus_tag LOCUS_13050 gene rsmH 25927 26823 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172605046.1 protein_id gnl|my_center|LOCUS_13050 26929 27141 gene locus_tag LOCUS_13060 26929 27141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 27218 29164 gene locus_tag LOCUS_13070 27218 29164 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_13070 29161 30624 gene locus_tag LOCUS_13080 29161 30624 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964160.1 protein_id gnl|my_center|LOCUS_13080 30626 31867 gene locus_tag LOCUS_13090 gene mraY 30626 31867 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_13090 31868 33199 gene locus_tag LOCUS_13100 gene murD 31868 33199 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964158.1 protein_id gnl|my_center|LOCUS_13100 33229 34422 gene locus_tag LOCUS_13110 33229 34422 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_13110 34435 35541 gene locus_tag LOCUS_13120 gene murG 34435 35541 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964156.1 protein_id gnl|my_center|LOCUS_13120 35543 36895 gene locus_tag LOCUS_13130 gene murC 35543 36895 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964155.1 protein_id gnl|my_center|LOCUS_13130 36885 37604 gene locus_tag LOCUS_13140 36885 37604 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964154.1 protein_id gnl|my_center|LOCUS_13140 37608 38915 gene locus_tag LOCUS_13150 gene ftsA 37608 38915 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098846.1 protein_id gnl|my_center|LOCUS_13150 38991 40955 gene locus_tag LOCUS_13160 gene ftsZ 38991 40955 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964152.1 protein_id gnl|my_center|LOCUS_13160 41108 41557 gene locus_tag LOCUS_13170 41108 41557 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_13170 41577 41651 gene locus_tag LOCUS_t00090 41577 41651 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 41893 42744 gene locus_tag LOCUS_13180 41893 42744 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964150.1 protein_id gnl|my_center|LOCUS_13180 42971 42771 gene locus_tag LOCUS_13190 42971 42771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 43945 43283 gene locus_tag LOCUS_13200 gene rpe 43945 43283 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964149.1 protein_id gnl|my_center|LOCUS_13200 44405 44001 gene locus_tag LOCUS_13210 44405 44001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 45503 44640 gene locus_tag LOCUS_13220 45503 44640 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_13220 45966 45586 gene locus_tag LOCUS_13230 45966 45586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 46606 46028 gene locus_tag LOCUS_13240 46606 46028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 47028 46666 gene locus_tag LOCUS_13250 47028 46666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 47203 47976 gene locus_tag LOCUS_13260 47203 47976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 48012 48524 gene locus_tag LOCUS_13270 48012 48524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 <49420 48633 gene locus_tag LOCUS_13280 <49420 48633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964146.1:polyribonucleotide nucleotidyltransferase >Feature sequence020 1769 864 gene locus_tag LOCUS_13290 1769 864 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962202.1 protein_id gnl|my_center|LOCUS_13290 3405 1771 gene locus_tag LOCUS_13300 3405 1771 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964434.1 protein_id gnl|my_center|LOCUS_13300 3794 3417 gene locus_tag LOCUS_13310 gene rnpA 3794 3417 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964465.1 protein_id gnl|my_center|LOCUS_13310 5200 4217 gene locus_tag LOCUS_13320 5200 4217 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898981.1 protein_id gnl|my_center|LOCUS_13320 6170 5439 gene locus_tag LOCUS_13330 6170 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 6535 6350 gene locus_tag LOCUS_13340 6535 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 8295 6601 gene locus_tag LOCUS_13350 8295 6601 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_13350 10110 8503 gene locus_tag LOCUS_13360 10110 8503 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964485.1 protein_id gnl|my_center|LOCUS_13360 10983 10123 gene locus_tag LOCUS_13370 10983 10123 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_13370 11117 11500 gene locus_tag LOCUS_13380 11117 11500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962738.1 protein_id gnl|my_center|LOCUS_13380 11608 13920 gene locus_tag LOCUS_13390 11608 13920 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963893.1 protein_id gnl|my_center|LOCUS_13390 13923 15176 gene locus_tag LOCUS_13400 13923 15176 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390892.1 protein_id gnl|my_center|LOCUS_13400 17174 15255 gene locus_tag LOCUS_13410 17174 15255 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259450.1 protein_id gnl|my_center|LOCUS_13410 17376 19196 gene locus_tag LOCUS_13420 17376 19196 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072494.1 protein_id gnl|my_center|LOCUS_13420 21659 19257 gene locus_tag LOCUS_13430 21659 19257 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_13430 23704 21794 gene locus_tag LOCUS_13440 gene glgB 23704 21794 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_13440 25345 23711 gene locus_tag LOCUS_13450 25345 23711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 27285 25348 gene locus_tag LOCUS_13460 27285 25348 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933744.1 protein_id gnl|my_center|LOCUS_13460 28597 27332 gene locus_tag LOCUS_13470 28597 27332 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404664.1 protein_id gnl|my_center|LOCUS_13470 29897 28695 gene locus_tag LOCUS_13480 gene glgA 29897 28695 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258925.1 protein_id gnl|my_center|LOCUS_13480 32059 30263 gene locus_tag LOCUS_13490 gene lepA 32059 30263 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964332.1 protein_id gnl|my_center|LOCUS_13490 32187 33311 gene locus_tag LOCUS_13500 32187 33311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 33392 34387 gene locus_tag LOCUS_13510 gene dusB 33392 34387 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964342.1 protein_id gnl|my_center|LOCUS_13510 35609 34404 gene locus_tag LOCUS_13520 35609 34404 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962414.1 protein_id gnl|my_center|LOCUS_13520 36014 35610 gene locus_tag LOCUS_13530 gene rbfA 36014 35610 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962413.1 protein_id gnl|my_center|LOCUS_13530 36114 36515 gene locus_tag LOCUS_13540 gene mce 36114 36515 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_13540 36573 36647 gene locus_tag LOCUS_t00100 36573 36647 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 36953 37351 gene locus_tag LOCUS_13550 36953 37351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 37356 38891 gene locus_tag LOCUS_13560 37356 38891 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919511.1 protein_id gnl|my_center|LOCUS_13560 38975 40417 gene locus_tag LOCUS_13570 38975 40417 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_13570 41520 40930 gene locus_tag LOCUS_13580 41520 40930 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_13580 41586 42632 gene locus_tag LOCUS_13590 gene pdxA 41586 42632 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964471.1 protein_id gnl|my_center|LOCUS_13590 42707 43246 gene locus_tag LOCUS_13600 42707 43246 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_13600 43256 43459 gene locus_tag LOCUS_13610 gene rpmF 43256 43459 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964469.1 protein_id gnl|my_center|LOCUS_13610 43639 44640 gene locus_tag LOCUS_13620 43639 44640 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964468.1 protein_id gnl|my_center|LOCUS_13620 44659 45144 gene locus_tag LOCUS_13630 gene accB 44659 45144 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_13630 45231 46583 gene locus_tag LOCUS_13640 gene accC 45231 46583 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_13640 46754 47869 gene locus_tag LOCUS_13650 46754 47869 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence021 833 252 gene locus_tag LOCUS_13660 833 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 3231 859 gene locus_tag LOCUS_13670 3231 859 CDS product TraG family conjugative transposon ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112378231.1 protein_id gnl|my_center|LOCUS_13670 3375 3554 gene locus_tag LOCUS_13680 3375 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 3863 3555 gene locus_tag LOCUS_13690 3863 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 4674 4333 gene locus_tag LOCUS_13700 4674 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 5140 4655 gene locus_tag LOCUS_13710 5140 4655 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995946.1 protein_id gnl|my_center|LOCUS_13710 5746 5294 gene locus_tag LOCUS_13720 5746 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 6679 5753 gene locus_tag LOCUS_13730 6679 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 7947 6682 gene locus_tag LOCUS_13740 7947 6682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 8358 7954 gene locus_tag LOCUS_13750 8358 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 8664 8374 gene locus_tag LOCUS_13760 8664 8374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126828977.1 protein_id gnl|my_center|LOCUS_13760 9267 8782 gene locus_tag LOCUS_13770 9267 8782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 9542 9276 gene locus_tag LOCUS_13780 9542 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 9888 9580 gene locus_tag LOCUS_13790 9888 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 10274 10125 gene locus_tag LOCUS_13800 10274 10125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261681.1 protein_id gnl|my_center|LOCUS_13800 11107 10382 gene locus_tag LOCUS_13810 11107 10382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 11993 11328 gene locus_tag LOCUS_13820 gene narL 11993 11328 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705476.1 protein_id gnl|my_center|LOCUS_13820 13633 11996 gene locus_tag LOCUS_13830 13633 11996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 14256 14981 gene locus_tag LOCUS_13840 14256 14981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 16270 15020 gene locus_tag LOCUS_13850 16270 15020 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173917.1 protein_id gnl|my_center|LOCUS_13850 16559 16272 gene locus_tag LOCUS_13860 16559 16272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 17316 16654 gene locus_tag LOCUS_13870 17316 16654 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963650.1 protein_id gnl|my_center|LOCUS_13870 17558 17313 gene locus_tag LOCUS_13880 17558 17313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 17974 18222 gene locus_tag LOCUS_13890 17974 18222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 18993 22130 gene locus_tag LOCUS_13900 18993 22130 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076455918.1 protein_id gnl|my_center|LOCUS_13900 22143 23627 gene locus_tag LOCUS_13910 22143 23627 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_13910 23629 26034 gene locus_tag LOCUS_13920 23629 26034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 26053 27501 gene locus_tag LOCUS_13930 26053 27501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 27554 28306 gene locus_tag LOCUS_13940 27554 28306 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972695.1 protein_id gnl|my_center|LOCUS_13940 28317 30209 gene locus_tag LOCUS_13950 28317 30209 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203328.1 protein_id gnl|my_center|LOCUS_13950 30290 31162 gene locus_tag LOCUS_13960 30290 31162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 31175 32041 gene locus_tag LOCUS_13970 31175 32041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 32075 33229 gene locus_tag LOCUS_13980 32075 33229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 33311 36181 gene locus_tag LOCUS_13990 33311 36181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 36246 38039 gene locus_tag LOCUS_14000 36246 38039 CDS product polysaccharide lyase 6 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029032.1 protein_id gnl|my_center|LOCUS_14000 38048 38854 gene locus_tag LOCUS_14010 38048 38854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 39567 38899 gene locus_tag LOCUS_14020 39567 38899 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788379.1 protein_id gnl|my_center|LOCUS_14020 40798 39572 gene locus_tag LOCUS_14030 gene pfp 40798 39572 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870466.1 protein_id gnl|my_center|LOCUS_14030 41870 40830 gene locus_tag LOCUS_14040 41870 40830 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_14040 43179 41893 gene locus_tag LOCUS_14050 43179 41893 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784371.1 protein_id gnl|my_center|LOCUS_14050 44019 43312 gene locus_tag LOCUS_14060 44019 43312 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393787.1 protein_id gnl|my_center|LOCUS_14060 44560 44201 gene locus_tag LOCUS_14070 44560 44201 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108621.1 protein_id gnl|my_center|LOCUS_14070 46839 44560 gene locus_tag LOCUS_14080 46839 44560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence022 912 244 gene locus_tag LOCUS_14090 912 244 CDS product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884034.1 protein_id gnl|my_center|LOCUS_14090 1453 3453 gene locus_tag LOCUS_14100 1453 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 4010 3480 gene locus_tag LOCUS_14110 4010 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 4679 4071 gene locus_tag LOCUS_14120 4679 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 5098 4715 gene locus_tag LOCUS_14130 5098 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 5364 5281 gene locus_tag LOCUS_t00110 5364 5281 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5812 5405 gene locus_tag LOCUS_14140 5812 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 6367 6047 gene locus_tag LOCUS_14150 6367 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 6516 6441 gene locus_tag LOCUS_t00120 6516 6441 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7090 6962 gene locus_tag LOCUS_14160 7090 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 7758 7207 gene locus_tag LOCUS_14170 7758 7207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 7975 7748 gene locus_tag LOCUS_14180 7975 7748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 8546 8001 gene locus_tag LOCUS_14190 8546 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 8911 8555 gene locus_tag LOCUS_14200 8911 8555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 9401 8976 gene locus_tag LOCUS_14210 9401 8976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 9617 9985 gene locus_tag LOCUS_14220 9617 9985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 10307 10026 gene locus_tag LOCUS_14230 10307 10026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 10757 10452 gene locus_tag LOCUS_14240 10757 10452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 11416 10931 gene locus_tag LOCUS_14250 11416 10931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 12038 11523 gene locus_tag LOCUS_14260 12038 11523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 12757 12074 gene locus_tag LOCUS_14270 12757 12074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 13055 13762 gene locus_tag LOCUS_14280 13055 13762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 14420 13815 gene locus_tag LOCUS_14290 14420 13815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 14555 15196 gene locus_tag LOCUS_14300 14555 15196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 15310 15675 gene locus_tag LOCUS_14310 15310 15675 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244448.1 protein_id gnl|my_center|LOCUS_14310 16096 15680 gene locus_tag LOCUS_14320 16096 15680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 17018 16245 gene locus_tag LOCUS_14330 17018 16245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 17389 17156 gene locus_tag LOCUS_14340 17389 17156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 17877 17467 gene locus_tag LOCUS_14350 17877 17467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 18183 17896 gene locus_tag LOCUS_14360 18183 17896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 18581 18186 gene locus_tag LOCUS_14370 18581 18186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 18886 18701 gene locus_tag LOCUS_14380 18886 18701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 19504 19133 gene locus_tag LOCUS_14390 19504 19133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 19732 19520 gene locus_tag LOCUS_14400 19732 19520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 19841 19765 gene locus_tag LOCUS_t00130 19841 19765 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 20573 20109 gene locus_tag LOCUS_14410 20573 20109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 20689 20604 gene locus_tag LOCUS_t00140 20689 20604 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21209 20742 gene locus_tag LOCUS_14420 21209 20742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 21359 21231 gene locus_tag LOCUS_14430 21359 21231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 21666 21430 gene locus_tag LOCUS_14440 21666 21430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 21904 21722 gene locus_tag LOCUS_14450 21904 21722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 22182 21916 gene locus_tag LOCUS_14460 22182 21916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 22844 22284 gene locus_tag LOCUS_14470 22844 22284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 23510 22944 gene locus_tag LOCUS_14480 23510 22944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 24119 23574 gene locus_tag LOCUS_14490 24119 23574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 24650 24261 gene locus_tag LOCUS_14500 24650 24261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 24787 24665 gene locus_tag LOCUS_14510 24787 24665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 25368 24880 gene locus_tag LOCUS_14520 25368 24880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 25615 25436 gene locus_tag LOCUS_14530 25615 25436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 25737 26471 gene locus_tag LOCUS_14540 25737 26471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 26698 28827 gene locus_tag LOCUS_14550 26698 28827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 29102 28869 gene locus_tag LOCUS_14560 29102 28869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 29358 29167 gene locus_tag LOCUS_14570 29358 29167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 29589 29371 gene locus_tag LOCUS_14580 29589 29371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 30004 29600 gene locus_tag LOCUS_14590 30004 29600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 30692 30105 gene locus_tag LOCUS_14600 30692 30105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 31211 30843 gene locus_tag LOCUS_14610 31211 30843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 31563 31282 gene locus_tag LOCUS_14620 31563 31282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 32037 31630 gene locus_tag LOCUS_14630 32037 31630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 32859 32095 gene locus_tag LOCUS_14640 32859 32095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 33236 32925 gene locus_tag LOCUS_14650 33236 32925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 33342 33257 gene locus_tag LOCUS_t00150 33342 33257 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 33702 33394 gene locus_tag LOCUS_14660 33702 33394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 33993 33760 gene locus_tag LOCUS_14670 33993 33760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 34421 34059 gene locus_tag LOCUS_14680 34421 34059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 34765 36045 gene locus_tag LOCUS_14690 34765 36045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 35847 35868 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36310 36813 gene locus_tag LOCUS_14700 36310 36813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 36863 37474 gene locus_tag LOCUS_14710 36863 37474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 37784 37461 gene locus_tag LOCUS_14720 37784 37461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 37941 38639 gene locus_tag LOCUS_14730 37941 38639 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810854.1 protein_id gnl|my_center|LOCUS_14730 38685 40187 gene locus_tag LOCUS_14740 38685 40187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 40361 40437 gene locus_tag LOCUS_t00160 40361 40437 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 40506 40582 gene locus_tag LOCUS_t00170 40506 40582 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 40645 40947 gene locus_tag LOCUS_14750 40645 40947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 41005 41081 gene locus_tag LOCUS_t00180 41005 41081 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 41164 41248 gene locus_tag LOCUS_t00190 41164 41248 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 41305 41508 gene locus_tag LOCUS_14760 41305 41508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 41534 41610 gene locus_tag LOCUS_t00200 41534 41610 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 41821 42015 gene locus_tag LOCUS_14770 41821 42015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 42068 42808 gene locus_tag LOCUS_14780 42068 42808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 43006 43081 gene locus_tag LOCUS_t00210 43006 43081 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 43096 43171 gene locus_tag LOCUS_t00220 43096 43171 tRNA product tRNA-Pyl inference COORDINATES:profile:Aragorn:1.2.38 43239 44414 gene locus_tag LOCUS_14790 gene cysS 43239 44414 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546384.1 protein_id gnl|my_center|LOCUS_14790 46059 44494 gene locus_tag LOCUS_14800 46059 44494 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930721.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence023 1111 641 gene locus_tag LOCUS_14810 1111 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 2331 1111 gene locus_tag LOCUS_14820 2331 1111 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853131.1 protein_id gnl|my_center|LOCUS_14820 2465 3145 gene locus_tag LOCUS_14830 2465 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 3486 4478 gene locus_tag LOCUS_14840 3486 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 4515 5519 gene locus_tag LOCUS_14850 4515 5519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 5538 6590 gene locus_tag LOCUS_14860 5538 6590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 6688 7347 gene locus_tag LOCUS_14870 6688 7347 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963076.1 protein_id gnl|my_center|LOCUS_14870 7438 8616 gene locus_tag LOCUS_14880 7438 8616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 8627 8965 gene locus_tag LOCUS_14890 8627 8965 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546328.1 protein_id gnl|my_center|LOCUS_14890 8969 9709 gene locus_tag LOCUS_14900 8969 9709 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014858053.1 protein_id gnl|my_center|LOCUS_14900 9712 10296 gene locus_tag LOCUS_14910 9712 10296 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_14910 10280 10513 gene locus_tag LOCUS_14920 10280 10513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 10506 11591 gene locus_tag LOCUS_14930 gene moeB 10506 11591 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143401.1 protein_id gnl|my_center|LOCUS_14930 11672 12115 gene locus_tag LOCUS_14940 11672 12115 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232367.1 protein_id gnl|my_center|LOCUS_14940 12142 12351 gene locus_tag LOCUS_14950 12142 12351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 12383 13294 gene locus_tag LOCUS_14960 gene moaCB 12383 13294 CDS product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207007.1 protein_id gnl|my_center|LOCUS_14960 13295 14302 gene locus_tag LOCUS_14970 gene moaA 13295 14302 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722673.1 protein_id gnl|my_center|LOCUS_14970 16119 14305 gene locus_tag LOCUS_14980 gene extM 16119 14305 CDS product selenite/tellurite reduction operon c-type cytochrome ExtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943566.1 protein_id gnl|my_center|LOCUS_14980 16360 18603 gene locus_tag LOCUS_14990 16360 18603 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546592.1 protein_id gnl|my_center|LOCUS_14990 18600 19133 gene locus_tag LOCUS_15000 18600 19133 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545481.1 protein_id gnl|my_center|LOCUS_15000 19146 20105 gene locus_tag LOCUS_15010 gene nrfD 19146 20105 CDS product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074173.1 protein_id gnl|my_center|LOCUS_15010 20119 20649 gene locus_tag LOCUS_15020 20119 20649 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938826.1 protein_id gnl|my_center|LOCUS_15020 20669 21259 gene locus_tag LOCUS_15030 20669 21259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 21275 21937 gene locus_tag LOCUS_15040 21275 21937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 21965 22576 gene locus_tag LOCUS_15050 21965 22576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 22655 23314 gene locus_tag LOCUS_15060 22655 23314 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963076.1 protein_id gnl|my_center|LOCUS_15060 24711 23401 gene locus_tag LOCUS_15070 24711 23401 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119323.1 protein_id gnl|my_center|LOCUS_15070 25542 25087 gene locus_tag LOCUS_15080 25542 25087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 25958 25659 gene locus_tag LOCUS_15090 gene trxA 25958 25659 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963919.1 protein_id gnl|my_center|LOCUS_15090 26150 27391 gene locus_tag LOCUS_15100 26150 27391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 27391 28449 gene locus_tag LOCUS_15110 27391 28449 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143552.1 protein_id gnl|my_center|LOCUS_15110 28543 29382 gene locus_tag LOCUS_15120 28543 29382 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_15120 29534 30388 gene locus_tag LOCUS_15130 29534 30388 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_15130 30406 31206 gene locus_tag LOCUS_15140 30406 31206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 31236 32078 gene locus_tag LOCUS_15150 31236 32078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 32093 33466 gene locus_tag LOCUS_15160 32093 33466 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931030.1 protein_id gnl|my_center|LOCUS_15160 33573 34022 gene locus_tag LOCUS_15170 33573 34022 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083188.1 protein_id gnl|my_center|LOCUS_15170 34095 34538 gene locus_tag LOCUS_15180 34095 34538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 35713 34535 gene locus_tag LOCUS_15190 35713 34535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963733.1 protein_id gnl|my_center|LOCUS_15190 36809 35721 gene locus_tag LOCUS_15200 36809 35721 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_15200 37415 36915 gene locus_tag LOCUS_15210 37415 36915 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762785.1 protein_id gnl|my_center|LOCUS_15210 38168 37524 gene locus_tag LOCUS_15220 38168 37524 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116185855.1 protein_id gnl|my_center|LOCUS_15220 38874 38170 gene locus_tag LOCUS_15230 38874 38170 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963729.1 protein_id gnl|my_center|LOCUS_15230 39898 38876 gene locus_tag LOCUS_15240 gene tsaD 39898 38876 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503448.1 protein_id gnl|my_center|LOCUS_15240 40140 44453 gene locus_tag LOCUS_15250 40140 44453 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 protein_id gnl|my_center|LOCUS_15250 44612 45598 gene locus_tag LOCUS_15260 gene pfkA 44612 45598 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963726.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence024 2107 2826 gene locus_tag LOCUS_15270 2107 2826 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962496.1 protein_id gnl|my_center|LOCUS_15270 3557 2829 gene locus_tag LOCUS_15280 3557 2829 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 protein_id gnl|my_center|LOCUS_15280 4305 3559 gene locus_tag LOCUS_15290 gene ubiE 4305 3559 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024980308.1 protein_id gnl|my_center|LOCUS_15290 4490 6244 gene locus_tag LOCUS_15300 4490 6244 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109365.1 protein_id gnl|my_center|LOCUS_15300 6257 6949 gene locus_tag LOCUS_15310 6257 6949 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785882.1 protein_id gnl|my_center|LOCUS_15310 7198 7404 gene locus_tag LOCUS_15320 7198 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 7519 8637 gene locus_tag LOCUS_15330 7519 8637 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488875.1 protein_id gnl|my_center|LOCUS_15330 8761 9327 gene locus_tag LOCUS_15340 8761 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 9342 9788 gene locus_tag LOCUS_15350 9342 9788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 9788 11572 gene locus_tag LOCUS_15360 9788 11572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 11768 11920 gene locus_tag LOCUS_15370 11768 11920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 11994 12254 gene locus_tag LOCUS_15380 11994 12254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 12267 12668 gene locus_tag LOCUS_15390 12267 12668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 12655 12999 gene locus_tag LOCUS_15400 12655 12999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 13051 13713 gene locus_tag LOCUS_15410 13051 13713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 13748 14251 gene locus_tag LOCUS_15420 13748 14251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 15521 14337 gene locus_tag LOCUS_15430 15521 14337 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962581.1 protein_id gnl|my_center|LOCUS_15430 16646 15546 gene locus_tag LOCUS_15440 16646 15546 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_15440 16787 17416 gene locus_tag LOCUS_15450 gene rsmG 16787 17416 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962583.1 protein_id gnl|my_center|LOCUS_15450 17487 18041 gene locus_tag LOCUS_15460 17487 18041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 19132 18176 gene locus_tag LOCUS_15470 19132 18176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 19616 19287 gene locus_tag LOCUS_15480 19616 19287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 20374 19823 gene locus_tag LOCUS_15490 20374 19823 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327087.1 protein_id gnl|my_center|LOCUS_15490 20887 20387 gene locus_tag LOCUS_15500 20887 20387 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788988.1 protein_id gnl|my_center|LOCUS_15500 21722 20943 gene locus_tag LOCUS_15510 21722 20943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 23486 21861 gene locus_tag LOCUS_15520 gene pruA 23486 21861 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_15520 23647 24372 gene locus_tag LOCUS_15530 23647 24372 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962859.1 protein_id gnl|my_center|LOCUS_15530 24365 25354 gene locus_tag LOCUS_15540 24365 25354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 25746 25360 gene locus_tag LOCUS_15550 gene apaG 25746 25360 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962585.1 protein_id gnl|my_center|LOCUS_15550 27081 25831 gene locus_tag LOCUS_15560 27081 25831 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_15560 27238 28593 gene locus_tag LOCUS_15570 27238 28593 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765874.1 protein_id gnl|my_center|LOCUS_15570 28598 29797 gene locus_tag LOCUS_15580 28598 29797 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763477.1 protein_id gnl|my_center|LOCUS_15580 29800 30546 gene locus_tag LOCUS_15590 29800 30546 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 protein_id gnl|my_center|LOCUS_15590 30550 31197 gene locus_tag LOCUS_15600 30550 31197 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 protein_id gnl|my_center|LOCUS_15600 31274 31996 gene locus_tag LOCUS_15610 gene nqrE 31274 31996 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763480.1 protein_id gnl|my_center|LOCUS_15610 31996 33309 gene locus_tag LOCUS_15620 gene nqrF 31996 33309 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337386.1 protein_id gnl|my_center|LOCUS_15620 33387 33764 gene locus_tag LOCUS_15630 33387 33764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 34605 33844 gene locus_tag LOCUS_15640 34605 33844 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_15640 34871 35827 gene locus_tag LOCUS_15650 34871 35827 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_15650 36706 35942 gene locus_tag LOCUS_15660 36706 35942 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 protein_id gnl|my_center|LOCUS_15660 37024 36707 gene locus_tag LOCUS_15670 37024 36707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 37844 37035 gene locus_tag LOCUS_15680 gene map 37844 37035 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962588.1 protein_id gnl|my_center|LOCUS_15680 38009 39280 gene locus_tag LOCUS_15690 38009 39280 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962593.1 protein_id gnl|my_center|LOCUS_15690 41432 39363 gene locus_tag LOCUS_15700 41432 39363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964216.1 protein_id gnl|my_center|LOCUS_15700 42017 41439 gene locus_tag LOCUS_15710 42017 41439 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_15710 42762 42019 gene locus_tag LOCUS_15720 gene deoC 42762 42019 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964217.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence025 4 975 gene locus_tag LOCUS_15730 4 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 1763 1038 gene locus_tag LOCUS_15740 1763 1038 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888106.1 protein_id gnl|my_center|LOCUS_15740 2371 1850 gene locus_tag LOCUS_15750 2371 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 3446 2448 gene locus_tag LOCUS_15760 gene obgE 3446 2448 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963487.1 protein_id gnl|my_center|LOCUS_15760 4619 3507 gene locus_tag LOCUS_15770 4619 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 4755 5909 gene locus_tag LOCUS_15780 4755 5909 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963492.1 protein_id gnl|my_center|LOCUS_15780 6005 6487 gene locus_tag LOCUS_15790 gene purE 6005 6487 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963493.1 protein_id gnl|my_center|LOCUS_15790 6627 8663 gene locus_tag LOCUS_15800 6627 8663 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 protein_id gnl|my_center|LOCUS_15800 8749 9303 gene locus_tag LOCUS_15810 8749 9303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 9306 9572 gene locus_tag LOCUS_15820 9306 9572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 10398 9565 gene locus_tag LOCUS_15830 10398 9565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362021.1 protein_id gnl|my_center|LOCUS_15830 10519 13368 gene locus_tag LOCUS_15840 gene gcvP 10519 13368 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963500.1 protein_id gnl|my_center|LOCUS_15840 13470 14528 gene locus_tag LOCUS_15850 13470 14528 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_15850 14557 15078 gene locus_tag LOCUS_15860 14557 15078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 15103 15951 gene locus_tag LOCUS_15870 15103 15951 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963505.1 protein_id gnl|my_center|LOCUS_15870 16768 15944 gene locus_tag LOCUS_15880 16768 15944 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964510.1 protein_id gnl|my_center|LOCUS_15880 18419 16755 gene locus_tag LOCUS_15890 18419 16755 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_15890 18531 19268 gene locus_tag LOCUS_15900 18531 19268 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_15900 19268 20035 gene locus_tag LOCUS_15910 19268 20035 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_15910 20819 20094 gene locus_tag LOCUS_15920 20819 20094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 22599 20812 gene locus_tag LOCUS_15930 22599 20812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 24085 22622 gene locus_tag LOCUS_15940 24085 22622 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783735.1 protein_id gnl|my_center|LOCUS_15940 25282 24203 gene locus_tag LOCUS_15950 25282 24203 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963509.1 protein_id gnl|my_center|LOCUS_15950 25878 25285 gene locus_tag LOCUS_15960 25878 25285 CDS product SprT-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_15960 26571 25936 gene locus_tag LOCUS_15970 26571 25936 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085574.1 protein_id gnl|my_center|LOCUS_15970 27258 26575 gene locus_tag LOCUS_15980 27258 26575 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963511.1 protein_id gnl|my_center|LOCUS_15980 28129 27251 gene locus_tag LOCUS_15990 28129 27251 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 protein_id gnl|my_center|LOCUS_15990 28349 29455 gene locus_tag LOCUS_16000 28349 29455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 29589 29963 gene locus_tag LOCUS_16010 29589 29963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 29992 30264 gene locus_tag LOCUS_16020 29992 30264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 31962 30343 gene locus_tag LOCUS_16030 31962 30343 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963512.1 protein_id gnl|my_center|LOCUS_16030 32964 31966 gene locus_tag LOCUS_16040 gene pdhA 32964 31966 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963513.1 protein_id gnl|my_center|LOCUS_16040 33638 33156 gene locus_tag LOCUS_16050 gene cdd 33638 33156 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_16050 34977 33739 gene locus_tag LOCUS_16060 gene porV 34977 33739 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_16060 38890 35012 gene locus_tag LOCUS_16070 gene porU 38890 35012 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_16070 39151 40857 gene locus_tag LOCUS_16080 gene gldJ 39151 40857 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_16080 40925 42208 gene locus_tag LOCUS_16090 40925 42208 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963518.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence026 679 38 gene locus_tag LOCUS_16100 679 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 2713 947 gene locus_tag LOCUS_16110 2713 947 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962453.1 protein_id gnl|my_center|LOCUS_16110 2915 3364 gene locus_tag LOCUS_16120 2915 3364 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962451.1 protein_id gnl|my_center|LOCUS_16120 3597 3361 gene locus_tag LOCUS_16130 3597 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 5389 3599 gene locus_tag LOCUS_16140 5389 3599 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760864.1 protein_id gnl|my_center|LOCUS_16140 7189 5435 gene locus_tag LOCUS_16150 gene aspS 7189 5435 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962449.1 protein_id gnl|my_center|LOCUS_16150 7451 10354 gene locus_tag LOCUS_16160 7451 10354 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890684.1 protein_id gnl|my_center|LOCUS_16160 13920 10426 gene locus_tag LOCUS_16170 13920 10426 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_16170 15123 13945 gene locus_tag LOCUS_16180 15123 13945 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_16180 16487 15141 gene locus_tag LOCUS_16190 16487 15141 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_16190 17093 16491 gene locus_tag LOCUS_16200 17093 16491 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_16200 17218 18192 gene locus_tag LOCUS_16210 17218 18192 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_16210 18192 18539 gene locus_tag LOCUS_16220 18192 18539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964494.1 protein_id gnl|my_center|LOCUS_16220 19043 18543 gene locus_tag LOCUS_16230 19043 18543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 19250 21991 gene locus_tag LOCUS_16240 19250 21991 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_16240 22035 23216 gene locus_tag LOCUS_16250 gene odhB 22035 23216 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964497.1 protein_id gnl|my_center|LOCUS_16250 24174 23548 gene locus_tag LOCUS_16260 24174 23548 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969688.1 protein_id gnl|my_center|LOCUS_16260 24678 24235 gene locus_tag LOCUS_16270 24678 24235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 27181 24662 gene locus_tag LOCUS_16280 27181 24662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 29191 27236 gene locus_tag LOCUS_16290 29191 27236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 30513 29536 gene locus_tag LOCUS_16300 30513 29536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 31188 30601 gene locus_tag LOCUS_16310 31188 30601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 31707 31264 gene locus_tag LOCUS_16320 31707 31264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 31847 32428 gene locus_tag LOCUS_16330 31847 32428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 32434 33174 gene locus_tag LOCUS_16340 32434 33174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 33243 34010 gene locus_tag LOCUS_16350 33243 34010 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964379.1 protein_id gnl|my_center|LOCUS_16350 34013 35044 gene locus_tag LOCUS_16360 34013 35044 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_16360 35129 35217 gene locus_tag LOCUS_t00230 35129 35217 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 35329 36057 gene locus_tag LOCUS_16370 35329 36057 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_16370 36078 36515 gene locus_tag LOCUS_16380 36078 36515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 36521 37123 gene locus_tag LOCUS_16390 36521 37123 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_16390 37147 37623 gene locus_tag LOCUS_16400 37147 37623 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_16400 37710 38402 gene locus_tag LOCUS_16410 37710 38402 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962551.1 protein_id gnl|my_center|LOCUS_16410 39002 38397 gene locus_tag LOCUS_16420 39002 38397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 40459 39002 gene locus_tag LOCUS_16430 gene rpoN 40459 39002 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_16430 >Feature sequence027 893 534 gene locus_tag LOCUS_16440 893 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 1095 877 gene locus_tag LOCUS_16450 1095 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 1599 1108 gene locus_tag LOCUS_16460 1599 1108 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886701.1 protein_id gnl|my_center|LOCUS_16460 1882 1622 gene locus_tag LOCUS_16470 1882 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 1829 2785 gene locus_tag LOCUS_16480 1829 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 5637 2782 gene locus_tag LOCUS_16490 gene polA 5637 2782 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_16490 5812 7047 gene locus_tag LOCUS_16500 5812 7047 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_16500 7211 7507 gene locus_tag LOCUS_16510 7211 7507 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962464.1 protein_id gnl|my_center|LOCUS_16510 8144 7491 gene locus_tag LOCUS_16520 8144 7491 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_16520 11443 8147 gene locus_tag LOCUS_16530 11443 8147 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962469.1 protein_id gnl|my_center|LOCUS_16530 11689 11762 gene locus_tag LOCUS_t00240 11689 11762 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 12661 11834 gene locus_tag LOCUS_16540 12661 11834 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_16540 12806 13267 gene locus_tag LOCUS_16550 gene rimP 12806 13267 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962637.1 protein_id gnl|my_center|LOCUS_16550 13280 14512 gene locus_tag LOCUS_16560 gene nusA 13280 14512 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962638.1 protein_id gnl|my_center|LOCUS_16560 14541 17336 gene locus_tag LOCUS_16570 gene infB 14541 17336 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962639.1 protein_id gnl|my_center|LOCUS_16570 17807 17409 gene locus_tag LOCUS_16580 17807 17409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 18021 19304 gene locus_tag LOCUS_16590 18021 19304 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_16590 19334 23878 gene locus_tag LOCUS_16600 19334 23878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 22395 22419 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23882 24412 gene locus_tag LOCUS_16610 23882 24412 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_16610 24412 24978 gene locus_tag LOCUS_16620 24412 24978 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 protein_id gnl|my_center|LOCUS_16620 24991 26340 gene locus_tag LOCUS_16630 24991 26340 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962548.1 protein_id gnl|my_center|LOCUS_16630 26371 27438 gene locus_tag LOCUS_16640 26371 27438 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_16640 27467 29257 gene locus_tag LOCUS_16650 27467 29257 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_16650 29328 30350 gene locus_tag LOCUS_16660 gene ruvB 29328 30350 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964224.1 protein_id gnl|my_center|LOCUS_16660 30391 31326 gene locus_tag LOCUS_16670 gene queG 30391 31326 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_16670 31372 33672 gene locus_tag LOCUS_16680 31372 33672 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_16680 33725 34306 gene locus_tag LOCUS_16690 gene ruvA 33725 34306 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964221.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence028 1324 947 gene locus_tag LOCUS_16700 1324 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 1526 3922 gene locus_tag LOCUS_16710 1526 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 4446 4796 gene locus_tag LOCUS_16720 4446 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 5020 5349 gene locus_tag LOCUS_16730 5020 5349 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963652.1 protein_id gnl|my_center|LOCUS_16730 5565 5646 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5793 6455 gene locus_tag LOCUS_16740 5793 6455 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963683.1 protein_id gnl|my_center|LOCUS_16740 7546 6821 gene locus_tag LOCUS_16750 7546 6821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 8126 9445 gene locus_tag LOCUS_16760 8126 9445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 9337 9428 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9489 9710 gene locus_tag LOCUS_16770 9489 9710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 9713 10378 gene locus_tag LOCUS_16780 9713 10378 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083999.1 protein_id gnl|my_center|LOCUS_16780 10611 10760 gene locus_tag LOCUS_16790 10611 10760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261681.1 protein_id gnl|my_center|LOCUS_16790 11156 11602 gene locus_tag LOCUS_16800 11156 11602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 11599 12804 gene locus_tag LOCUS_16810 11599 12804 CDS product DUF4407 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 protein_id gnl|my_center|LOCUS_16810 13026 13787 gene locus_tag LOCUS_16820 13026 13787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 13768 15363 gene locus_tag LOCUS_16830 13768 15363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 15366 15890 gene locus_tag LOCUS_16840 15366 15890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 15891 16376 gene locus_tag LOCUS_16850 15891 16376 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995946.1 protein_id gnl|my_center|LOCUS_16850 17233 17520 gene locus_tag LOCUS_16860 17233 17520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 17545 17829 gene locus_tag LOCUS_16870 17545 17829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 17816 20224 gene locus_tag LOCUS_16880 17816 20224 CDS product TraG family conjugative transposon ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112378231.1 protein_id gnl|my_center|LOCUS_16880 20254 20874 gene locus_tag LOCUS_16890 20254 20874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 20877 21704 gene locus_tag LOCUS_16900 20877 21704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 21726 22337 gene locus_tag LOCUS_16910 21726 22337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 22369 23304 gene locus_tag LOCUS_16920 22369 23304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 23301 24095 gene locus_tag LOCUS_16930 23301 24095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 26010 24265 gene locus_tag LOCUS_16940 26010 24265 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107292.1 protein_id gnl|my_center|LOCUS_16940 28989 26029 gene locus_tag LOCUS_16950 28989 26029 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108938.1 protein_id gnl|my_center|LOCUS_16950 29328 31106 gene locus_tag LOCUS_16960 29328 31106 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117506598.1 protein_id gnl|my_center|LOCUS_16960 33482 31812 gene locus_tag LOCUS_16970 33482 31812 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545590.1 protein_id gnl|my_center|LOCUS_16970 34542 33454 gene locus_tag LOCUS_16980 34542 33454 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013491.1 protein_id gnl|my_center|LOCUS_16980 35301 34573 gene locus_tag LOCUS_16990 35301 34573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 35792 36064 gene locus_tag LOCUS_17000 35792 36064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 36729 36872 gene locus_tag LOCUS_17010 36729 36872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 >Feature sequence029 240 250 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 268 447 gene locus_tag LOCUS_17020 268 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 1287 517 gene locus_tag LOCUS_17030 1287 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 1559 2575 gene locus_tag LOCUS_17040 1559 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 2745 3671 gene locus_tag LOCUS_17050 2745 3671 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962692.1 protein_id gnl|my_center|LOCUS_17050 3742 4371 gene locus_tag LOCUS_17060 3742 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 4537 7518 gene locus_tag LOCUS_17070 gene secDF 4537 7518 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962693.1 protein_id gnl|my_center|LOCUS_17070 7691 8986 gene locus_tag LOCUS_17080 gene purD 7691 8986 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436062.1 protein_id gnl|my_center|LOCUS_17080 9002 9457 gene locus_tag LOCUS_17090 9002 9457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 9959 9468 gene locus_tag LOCUS_17100 9959 9468 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838769.1 protein_id gnl|my_center|LOCUS_17100 10890 9961 gene locus_tag LOCUS_17110 gene lgt 10890 9961 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962761.1 protein_id gnl|my_center|LOCUS_17110 12138 11008 gene locus_tag LOCUS_17120 12138 11008 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963995.1 protein_id gnl|my_center|LOCUS_17120 12690 12151 gene locus_tag LOCUS_17130 gene gldI 12690 12151 CDS product gliding motility-associated peptidyl-prolyl isomerase GldI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963996.1 protein_id gnl|my_center|LOCUS_17130 13699 12680 gene locus_tag LOCUS_17140 13699 12680 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_17140 13879 14298 gene locus_tag LOCUS_17150 13879 14298 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963530.1 protein_id gnl|my_center|LOCUS_17150 14623 14432 gene locus_tag LOCUS_17160 14623 14432 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_17160 15006 14710 gene locus_tag LOCUS_17170 15006 14710 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963535.1 protein_id gnl|my_center|LOCUS_17170 15446 15006 gene locus_tag LOCUS_17180 15446 15006 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963536.1 protein_id gnl|my_center|LOCUS_17180 16506 15427 gene locus_tag LOCUS_17190 gene recF 16506 15427 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964102.1 protein_id gnl|my_center|LOCUS_17190 16641 17414 gene locus_tag LOCUS_17200 16641 17414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964103.1 protein_id gnl|my_center|LOCUS_17200 17417 17902 gene locus_tag LOCUS_17210 gene ribH 17417 17902 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964104.1 protein_id gnl|my_center|LOCUS_17210 18032 18268 gene locus_tag LOCUS_17220 18032 18268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 18285 18572 gene locus_tag LOCUS_17230 18285 18572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 18573 20420 gene locus_tag LOCUS_17240 gene mutL 18573 20420 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963285.1 protein_id gnl|my_center|LOCUS_17240 20423 21172 gene locus_tag LOCUS_17250 20423 21172 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_17250 21172 22041 gene locus_tag LOCUS_17260 21172 22041 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_17260 22353 23072 gene locus_tag LOCUS_17270 22353 23072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 23387 23079 gene locus_tag LOCUS_17280 23387 23079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 24007 23387 gene locus_tag LOCUS_17290 24007 23387 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963263.1 protein_id gnl|my_center|LOCUS_17290 25616 24066 gene locus_tag LOCUS_17300 gene lepB 25616 24066 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963265.1 protein_id gnl|my_center|LOCUS_17300 26381 25677 gene locus_tag LOCUS_17310 gene dapB 26381 25677 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_17310 26932 26393 gene locus_tag LOCUS_17320 26932 26393 CDS product DUF5683 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963267.1 protein_id gnl|my_center|LOCUS_17320 27872 26961 gene locus_tag LOCUS_17330 27872 26961 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 protein_id gnl|my_center|LOCUS_17330 28640 27876 gene locus_tag LOCUS_17340 28640 27876 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_17340 28856 31147 gene locus_tag LOCUS_17350 28856 31147 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325625.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17350 31168 31623 gene locus_tag LOCUS_17360 31168 31623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17360 32970 31684 gene locus_tag LOCUS_17370 32970 31684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17370 33734 32967 gene locus_tag LOCUS_17380 33734 32967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17380 34370 33750 gene locus_tag LOCUS_17390 34370 33750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 35745 34372 gene locus_tag LOCUS_17400 35745 34372 CDS product methylmalonyl-CoA mutase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963259.1 protein_id gnl|my_center|LOCUS_17400 36067 35738 gene locus_tag LOCUS_17410 36067 35738 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963258.1 protein_id gnl|my_center|LOCUS_17410 36673 36068 gene locus_tag LOCUS_17420 gene udk 36673 36068 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963257.1 protein_id gnl|my_center|LOCUS_17420 >Feature sequence030 1387 518 gene locus_tag LOCUS_17430 gene rbsK 1387 518 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761960.1 protein_id gnl|my_center|LOCUS_17430 3320 1461 gene locus_tag LOCUS_17440 3320 1461 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_17440 5076 3436 gene locus_tag LOCUS_17450 5076 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 7741 5081 gene locus_tag LOCUS_17460 7741 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 8584 7772 gene locus_tag LOCUS_17470 8584 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 10404 8587 gene locus_tag LOCUS_17480 gene uidA 10404 8587 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003648792.1 protein_id gnl|my_center|LOCUS_17480 12673 10409 gene locus_tag LOCUS_17490 gene bglX 12673 10409 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_17490 13521 12682 gene locus_tag LOCUS_17500 13521 12682 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_17500 15082 13523 gene locus_tag LOCUS_17510 15082 13523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 16946 15408 gene locus_tag LOCUS_17520 16946 15408 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785902.1 protein_id gnl|my_center|LOCUS_17520 19004 16959 gene locus_tag LOCUS_17530 19004 16959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17530 20081 19074 gene locus_tag LOCUS_17540 20081 19074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17540 23230 20396 gene locus_tag LOCUS_17550 23230 20396 CDS product triple tyrosine motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091372500.1 protein_id gnl|my_center|LOCUS_17550 23607 24698 gene locus_tag LOCUS_17560 gene wecB 23607 24698 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555698.1 protein_id gnl|my_center|LOCUS_17560 25182 24859 gene locus_tag LOCUS_17570 25182 24859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 25465 25175 gene locus_tag LOCUS_17580 25465 25175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 26184 25348 gene locus_tag LOCUS_17590 26184 25348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 25484 25546 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26183 26383 gene locus_tag LOCUS_17600 26183 26383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 28488 26488 gene locus_tag LOCUS_17610 28488 26488 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964061.1 protein_id gnl|my_center|LOCUS_17610 29990 28500 gene locus_tag LOCUS_17620 gene hutH 29990 28500 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838340.1 protein_id gnl|my_center|LOCUS_17620 30072 30962 gene locus_tag LOCUS_17630 30072 30962 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142979.1 protein_id gnl|my_center|LOCUS_17630 31238 30945 gene locus_tag LOCUS_17640 31238 30945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 33855 31513 gene locus_tag LOCUS_17650 33855 31513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 35432 33948 gene locus_tag LOCUS_17660 35432 33948 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036277.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence031 1607 372 gene locus_tag LOCUS_17670 1607 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 2719 1853 gene locus_tag LOCUS_17680 2719 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17680 3080 2679 gene locus_tag LOCUS_17690 3080 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17690 3282 4565 gene locus_tag LOCUS_17700 gene fahA 3282 4565 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_17700 4675 5856 gene locus_tag LOCUS_17710 4675 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963930.1 protein_id gnl|my_center|LOCUS_17710 6709 5909 gene locus_tag LOCUS_17720 gene ppk2 6709 5909 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460167.1 protein_id gnl|my_center|LOCUS_17720 7155 6748 gene locus_tag LOCUS_17730 7155 6748 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090087.1 protein_id gnl|my_center|LOCUS_17730 7558 7169 gene locus_tag LOCUS_17740 gene ytxJ 7558 7169 CDS product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_17740 7715 10324 gene locus_tag LOCUS_17750 gene clpB 7715 10324 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963875.1 protein_id gnl|my_center|LOCUS_17750 10631 11293 gene locus_tag LOCUS_17760 gene deoC 10631 11293 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013448021.1 protein_id gnl|my_center|LOCUS_17760 11476 12141 gene locus_tag LOCUS_17770 gene deoC 11476 12141 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013448021.1 protein_id gnl|my_center|LOCUS_17770 12169 12867 gene locus_tag LOCUS_17780 gene deoD 12169 12867 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898215.1 protein_id gnl|my_center|LOCUS_17780 12874 13416 gene locus_tag LOCUS_17790 12874 13416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 13452 13979 gene locus_tag LOCUS_17800 13452 13979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 14831 13983 gene locus_tag LOCUS_17810 14831 13983 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382245.1 protein_id gnl|my_center|LOCUS_17810 15555 14824 gene locus_tag LOCUS_17820 gene pxpB 15555 14824 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889166.1 protein_id gnl|my_center|LOCUS_17820 16338 15559 gene locus_tag LOCUS_17830 gene pxpA 16338 15559 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207350.1 protein_id gnl|my_center|LOCUS_17830 17518 16409 gene locus_tag LOCUS_17840 17518 16409 CDS product DUF2891 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922099.1 protein_id gnl|my_center|LOCUS_17840 18253 17534 gene locus_tag LOCUS_17850 18253 17534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 19832 18297 gene locus_tag LOCUS_17860 19832 18297 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963722.1 protein_id gnl|my_center|LOCUS_17860 20468 19905 gene locus_tag LOCUS_17870 20468 19905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 21537 20527 gene locus_tag LOCUS_17880 21537 20527 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072950.1 protein_id gnl|my_center|LOCUS_17880 23765 21561 gene locus_tag LOCUS_17890 23765 21561 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_17890 24232 23777 gene locus_tag LOCUS_17900 24232 23777 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382916.1 protein_id gnl|my_center|LOCUS_17900 25301 24339 gene locus_tag LOCUS_17910 25301 24339 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_17910 26925 25303 gene locus_tag LOCUS_17920 gene ade 26925 25303 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963204.1 protein_id gnl|my_center|LOCUS_17920 28239 26926 gene locus_tag LOCUS_17930 gene tilS 28239 26926 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963738.1 protein_id gnl|my_center|LOCUS_17930 28324 29055 gene locus_tag LOCUS_17940 28324 29055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 30344 29052 gene locus_tag LOCUS_17950 30344 29052 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_17950 30397 31314 gene locus_tag LOCUS_17960 30397 31314 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966313.1 protein_id gnl|my_center|LOCUS_17960 31356 32699 gene locus_tag LOCUS_17970 31356 32699 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_17970 32957 33172 gene locus_tag LOCUS_17980 32957 33172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 33869 33429 gene locus_tag LOCUS_17990 33869 33429 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057349.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence032 1006 155 gene locus_tag LOCUS_18000 gene trxB 1006 155 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_18000 955 992 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1261 1659 gene locus_tag LOCUS_18010 1261 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 1695 2396 gene locus_tag LOCUS_18020 1695 2396 CDS product hydantoin utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125521.1 protein_id gnl|my_center|LOCUS_18020 3418 2393 gene locus_tag LOCUS_18030 gene hypE 3418 2393 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545205.1 protein_id gnl|my_center|LOCUS_18030 4516 3422 gene locus_tag LOCUS_18040 gene hypD 4516 3422 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893645.1 protein_id gnl|my_center|LOCUS_18040 6780 4513 gene locus_tag LOCUS_18050 gene hypF 6780 4513 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582504.1 protein_id gnl|my_center|LOCUS_18050 7338 6811 gene locus_tag LOCUS_18060 7338 6811 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173947.1 protein_id gnl|my_center|LOCUS_18060 8169 7417 gene locus_tag LOCUS_18070 gene cybH 8169 7417 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811165.1 protein_id gnl|my_center|LOCUS_18070 9921 8185 gene locus_tag LOCUS_18080 9921 8185 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502532.1 protein_id gnl|my_center|LOCUS_18080 11057 9933 gene locus_tag LOCUS_18090 11057 9933 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338265.1 protein_id gnl|my_center|LOCUS_18090 11229 11570 gene locus_tag LOCUS_18100 gene hypA 11229 11570 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933459.1 protein_id gnl|my_center|LOCUS_18100 11729 13555 gene locus_tag LOCUS_18110 11729 13555 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081675.1 protein_id gnl|my_center|LOCUS_18110 13548 14816 gene locus_tag LOCUS_18120 13548 14816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 14819 16267 gene locus_tag LOCUS_18130 14819 16267 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_18130 16251 16709 gene locus_tag LOCUS_18140 16251 16709 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582503.1 protein_id gnl|my_center|LOCUS_18140 16732 17574 gene locus_tag LOCUS_18150 gene hypB 16732 17574 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933458.1 protein_id gnl|my_center|LOCUS_18150 17581 17841 gene locus_tag LOCUS_18160 17581 17841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 18074 18742 gene locus_tag LOCUS_18170 18074 18742 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_18170 18739 20115 gene locus_tag LOCUS_18180 18739 20115 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545380.1 protein_id gnl|my_center|LOCUS_18180 20524 24846 gene locus_tag LOCUS_18190 20524 24846 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_18190 24849 26012 gene locus_tag LOCUS_18200 24849 26012 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_18200 26402 27817 gene locus_tag LOCUS_18210 26402 27817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 27830 29179 gene locus_tag LOCUS_18220 27830 29179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 29258 29698 gene locus_tag LOCUS_18230 29258 29698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 29661 30341 gene locus_tag LOCUS_18240 29661 30341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 30370 30612 gene locus_tag LOCUS_18250 30370 30612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 31151 30735 gene locus_tag LOCUS_18260 31151 30735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 31430 33142 gene locus_tag LOCUS_18270 31430 33142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 >Feature sequence033 <1 1881 gene locus_tag LOCUS_18280 <1 1881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203224.1:glycoside hydrolase family 13 protein 1887 3020 gene locus_tag LOCUS_18290 1887 3020 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249477.1 protein_id gnl|my_center|LOCUS_18290 3022 5406 gene locus_tag LOCUS_18300 3022 5406 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108625.1 protein_id gnl|my_center|LOCUS_18300 5417 6850 gene locus_tag LOCUS_18310 5417 6850 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503865.1 protein_id gnl|my_center|LOCUS_18310 6858 8729 gene locus_tag LOCUS_18320 6858 8729 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072207.1 protein_id gnl|my_center|LOCUS_18320 8757 10409 gene locus_tag LOCUS_18330 8757 10409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 10489 11355 gene locus_tag LOCUS_18340 gene tesB 10489 11355 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268943.1 protein_id gnl|my_center|LOCUS_18340 11361 12566 gene locus_tag LOCUS_18350 11361 12566 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_18350 12563 13105 gene locus_tag LOCUS_18360 12563 13105 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962897.1 protein_id gnl|my_center|LOCUS_18360 13102 14181 gene locus_tag LOCUS_18370 gene mvaD 13102 14181 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_18370 14210 15139 gene locus_tag LOCUS_18380 14210 15139 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_18380 15240 16100 gene locus_tag LOCUS_18390 15240 16100 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962485.1 protein_id gnl|my_center|LOCUS_18390 16187 17062 gene locus_tag LOCUS_18400 16187 17062 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962486.1 protein_id gnl|my_center|LOCUS_18400 17396 18796 gene locus_tag LOCUS_18410 17396 18796 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963818.1 protein_id gnl|my_center|LOCUS_18410 18786 19712 gene locus_tag LOCUS_18420 gene speB 18786 19712 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_18420 19702 20679 gene locus_tag LOCUS_18430 19702 20679 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963819.1 protein_id gnl|my_center|LOCUS_18430 20682 21011 gene locus_tag LOCUS_18440 20682 21011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 21026 21256 gene locus_tag LOCUS_18450 21026 21256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 21268 21684 gene locus_tag LOCUS_18460 21268 21684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 21872 22234 gene locus_tag LOCUS_18470 21872 22234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 23583 22255 gene locus_tag LOCUS_18480 23583 22255 CDS product DUF2029 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838851.1 protein_id gnl|my_center|LOCUS_18480 24728 23616 gene locus_tag LOCUS_18490 24728 23616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 24876 26048 gene locus_tag LOCUS_18500 24876 26048 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840191.1 protein_id gnl|my_center|LOCUS_18500 27535 26045 gene locus_tag LOCUS_18510 27535 26045 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_18510 28224 27532 gene locus_tag LOCUS_18520 28224 27532 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_18520 29858 28272 gene locus_tag LOCUS_18530 29858 28272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 31158 29860 gene locus_tag LOCUS_18540 31158 29860 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812847.1 protein_id gnl|my_center|LOCUS_18540 31304 32260 gene locus_tag LOCUS_18550 31304 32260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_18550 32547 32257 gene locus_tag LOCUS_18560 32547 32257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence034 <1 1040 gene locus_tag LOCUS_18570 <1 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963998.1:glutamine-hydrolyzing GMP synthase 1303 3237 gene locus_tag LOCUS_18580 1303 3237 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964000.1 protein_id gnl|my_center|LOCUS_18580 3283 3819 gene locus_tag LOCUS_18590 3283 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 3873 4055 gene locus_tag LOCUS_18600 3873 4055 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964002.1 protein_id gnl|my_center|LOCUS_18600 4272 5912 gene locus_tag LOCUS_18610 4272 5912 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964003.1 protein_id gnl|my_center|LOCUS_18610 5976 7874 gene locus_tag LOCUS_18620 gene yidC 5976 7874 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964004.1 protein_id gnl|my_center|LOCUS_18620 7945 8643 gene locus_tag LOCUS_18630 7945 8643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964005.1 protein_id gnl|my_center|LOCUS_18630 8720 9907 gene locus_tag LOCUS_18640 gene mnmA 8720 9907 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963885.1 protein_id gnl|my_center|LOCUS_18640 9934 11538 gene locus_tag LOCUS_18650 9934 11538 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963873.1 protein_id gnl|my_center|LOCUS_18650 11539 12480 gene locus_tag LOCUS_18660 11539 12480 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963872.1 protein_id gnl|my_center|LOCUS_18660 12777 14180 gene locus_tag LOCUS_18670 12777 14180 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_18670 14167 14394 gene locus_tag LOCUS_18680 14167 14394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962732.1 protein_id gnl|my_center|LOCUS_18680 14394 14957 gene locus_tag LOCUS_18690 14394 14957 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964181.1 protein_id gnl|my_center|LOCUS_18690 15835 14954 gene locus_tag LOCUS_18700 15835 14954 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761539.1 protein_id gnl|my_center|LOCUS_18700 17553 15841 gene locus_tag LOCUS_18710 17553 15841 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943579.1 protein_id gnl|my_center|LOCUS_18710 17642 17821 gene locus_tag LOCUS_18720 17642 17821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 19021 17942 gene locus_tag LOCUS_18730 gene meaB 19021 17942 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503589.1 protein_id gnl|my_center|LOCUS_18730 19615 19043 gene locus_tag LOCUS_18740 19615 19043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 19790 20341 gene locus_tag LOCUS_18750 19790 20341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 20325 20909 gene locus_tag LOCUS_18760 20325 20909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 20920 22410 gene locus_tag LOCUS_18770 20920 22410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 22681 23229 gene locus_tag LOCUS_18780 22681 23229 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962831.1 protein_id gnl|my_center|LOCUS_18780 23239 24366 gene locus_tag LOCUS_18790 gene dnaJ 23239 24366 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933150.1 protein_id gnl|my_center|LOCUS_18790 24379 24882 gene locus_tag LOCUS_18800 24379 24882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 24907 25464 gene locus_tag LOCUS_18810 24907 25464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 25474 26394 gene locus_tag LOCUS_18820 25474 26394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 26485 27030 gene locus_tag LOCUS_18830 gene rsmD 26485 27030 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968831.1 protein_id gnl|my_center|LOCUS_18830 27027 29087 gene locus_tag LOCUS_18840 27027 29087 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838619.1 protein_id gnl|my_center|LOCUS_18840 29223 31133 gene locus_tag LOCUS_18850 29223 31133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 >Feature sequence035 225 566 gene locus_tag LOCUS_18860 gene arsC 225 566 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963715.1 protein_id gnl|my_center|LOCUS_18860 661 3192 gene locus_tag LOCUS_18870 661 3192 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_18870 3472 3257 gene locus_tag LOCUS_18880 3472 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963717.1 protein_id gnl|my_center|LOCUS_18880 4172 3531 gene locus_tag LOCUS_18890 4172 3531 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186345.1 protein_id gnl|my_center|LOCUS_18890 4391 5788 gene locus_tag LOCUS_18900 gene fumC 4391 5788 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963718.1 protein_id gnl|my_center|LOCUS_18900 6376 5882 gene locus_tag LOCUS_18910 6376 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 7189 6542 gene locus_tag LOCUS_18920 gene pdxH 7189 6542 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963814.1 protein_id gnl|my_center|LOCUS_18920 7272 7685 gene locus_tag LOCUS_18930 7272 7685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 8586 7678 gene locus_tag LOCUS_18940 8586 7678 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963815.1 protein_id gnl|my_center|LOCUS_18940 8919 8587 gene locus_tag LOCUS_18950 8919 8587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963901.1 protein_id gnl|my_center|LOCUS_18950 9850 8921 gene locus_tag LOCUS_18960 9850 8921 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963902.1 protein_id gnl|my_center|LOCUS_18960 10396 9857 gene locus_tag LOCUS_18970 gene pyrR 10396 9857 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_18970 11802 10543 gene locus_tag LOCUS_18980 11802 10543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18980 12371 11841 gene locus_tag LOCUS_18990 12371 11841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18990 12663 13043 gene locus_tag LOCUS_19000 12663 13043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 13351 14277 gene locus_tag LOCUS_19010 13351 14277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 15033 14338 gene locus_tag LOCUS_19020 gene cmk 15033 14338 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963822.1 protein_id gnl|my_center|LOCUS_19020 16055 15036 gene locus_tag LOCUS_19030 gene porQ 16055 15036 CDS product type IX secretion system protein PorQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_19030 18601 16151 gene locus_tag LOCUS_19040 gene lon 18601 16151 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963824.1 protein_id gnl|my_center|LOCUS_19040 19449 18799 gene locus_tag LOCUS_19050 19449 18799 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963018.1 protein_id gnl|my_center|LOCUS_19050 19647 20396 gene locus_tag LOCUS_19060 19647 20396 CDS product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 protein_id gnl|my_center|LOCUS_19060 20994 20431 gene locus_tag LOCUS_19070 20994 20431 CDS product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049030.1 protein_id gnl|my_center|LOCUS_19070 22403 21012 gene locus_tag LOCUS_19080 gene glmM 22403 21012 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_19080 22533 23138 gene locus_tag LOCUS_19090 22533 23138 CDS product acyl carrier protein phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_19090 23135 24835 gene locus_tag LOCUS_19100 gene ggt 23135 24835 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_19100 24922 25638 gene locus_tag LOCUS_19110 24922 25638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 26170 25646 gene locus_tag LOCUS_19120 26170 25646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 26272 29049 gene locus_tag LOCUS_19130 gene uvrA 26272 29049 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963005.1 protein_id gnl|my_center|LOCUS_19130 29072 29761 gene locus_tag LOCUS_19140 29072 29761 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963001.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence036 <1 867 gene locus_tag LOCUS_19150 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963351.1:Nif3-like dinuclear metal center hexameric protein 871 1650 gene locus_tag LOCUS_19160 871 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963352.1 protein_id gnl|my_center|LOCUS_19160 1776 2432 gene locus_tag LOCUS_19170 gene msrA 1776 2432 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013187310.1 protein_id gnl|my_center|LOCUS_19170 2486 3154 gene locus_tag LOCUS_19180 2486 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 3716 3297 gene locus_tag LOCUS_19190 3716 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 3805 5103 gene locus_tag LOCUS_19200 gene kynU 3805 5103 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964305.1 protein_id gnl|my_center|LOCUS_19200 5096 6511 gene locus_tag LOCUS_19210 5096 6511 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964302.1 protein_id gnl|my_center|LOCUS_19210 6514 6921 gene locus_tag LOCUS_19220 6514 6921 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124713.1 protein_id gnl|my_center|LOCUS_19220 6924 7838 gene locus_tag LOCUS_19230 6924 7838 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026697.1 protein_id gnl|my_center|LOCUS_19230 7842 9293 gene locus_tag LOCUS_19240 gene hpaE 7842 9293 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723530.1 protein_id gnl|my_center|LOCUS_19240 9523 9885 gene locus_tag LOCUS_19250 9523 9885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 9882 10664 gene locus_tag LOCUS_19260 9882 10664 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971313.1 protein_id gnl|my_center|LOCUS_19260 10789 11322 gene locus_tag LOCUS_19270 10789 11322 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036739.1 protein_id gnl|my_center|LOCUS_19270 11329 12411 gene locus_tag LOCUS_19280 11329 12411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 12411 13052 gene locus_tag LOCUS_19290 12411 13052 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_19290 13342 13055 gene locus_tag LOCUS_19300 13342 13055 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964182.1 protein_id gnl|my_center|LOCUS_19300 15734 13422 gene locus_tag LOCUS_19310 15734 13422 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_19310 16347 15844 gene locus_tag LOCUS_19320 16347 15844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964227.1 protein_id gnl|my_center|LOCUS_19320 17218 16418 gene locus_tag LOCUS_19330 17218 16418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 17972 17205 gene locus_tag LOCUS_19340 17972 17205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 18117 18824 gene locus_tag LOCUS_19350 gene pepE 18117 18824 CDS product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964229.1 protein_id gnl|my_center|LOCUS_19350 18930 18857 gene locus_tag LOCUS_t00250 18930 18857 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 19455 19072 gene locus_tag LOCUS_19360 19455 19072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 19706 21223 gene locus_tag LOCUS_19370 gene gpmI 19706 21223 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964233.1 protein_id gnl|my_center|LOCUS_19370 21278 21688 gene locus_tag LOCUS_19380 21278 21688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788667.1 protein_id gnl|my_center|LOCUS_19380 22954 21689 gene locus_tag LOCUS_19390 22954 21689 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962593.1 protein_id gnl|my_center|LOCUS_19390 23153 22947 gene locus_tag LOCUS_19400 23153 22947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 23077 23895 gene locus_tag LOCUS_19410 gene map 23077 23895 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962588.1 protein_id gnl|my_center|LOCUS_19410 23899 24216 gene locus_tag LOCUS_19420 23899 24216 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_19420 24271 24990 gene locus_tag LOCUS_19430 24271 24990 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 protein_id gnl|my_center|LOCUS_19430 25970 24987 gene locus_tag LOCUS_19440 25970 24987 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_19440 26358 25981 gene locus_tag LOCUS_19450 26358 25981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 26683 27018 gene locus_tag LOCUS_19460 26683 27018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 28446 27130 gene locus_tag LOCUS_19470 gene nqrF 28446 27130 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337386.1 protein_id gnl|my_center|LOCUS_19470 29194 28439 gene locus_tag LOCUS_19480 gene nqrE 29194 28439 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787208.1 protein_id gnl|my_center|LOCUS_19480 29920 29273 gene locus_tag LOCUS_19490 29920 29273 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763479.1 protein_id gnl|my_center|LOCUS_19490 30595 29924 gene locus_tag LOCUS_19500 30595 29924 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence037 1101 739 gene locus_tag LOCUS_19510 1101 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 1435 1121 gene locus_tag LOCUS_19520 1435 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 1887 1453 gene locus_tag LOCUS_19530 1887 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2509 2129 gene locus_tag LOCUS_19540 2509 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 2717 4465 gene locus_tag LOCUS_19550 2717 4465 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124860.1 protein_id gnl|my_center|LOCUS_19550 4466 5794 gene locus_tag LOCUS_19560 4466 5794 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918507.1 protein_id gnl|my_center|LOCUS_19560 5804 7624 gene locus_tag LOCUS_19570 5804 7624 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209314.1 protein_id gnl|my_center|LOCUS_19570 7626 8246 gene locus_tag LOCUS_19580 7626 8246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 8303 11218 gene locus_tag LOCUS_19590 8303 11218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 11218 14229 gene locus_tag LOCUS_19600 11218 14229 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_19600 14272 14850 gene locus_tag LOCUS_19610 14272 14850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 14843 15670 gene locus_tag LOCUS_19620 14843 15670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 17015 15774 gene locus_tag LOCUS_19630 17015 15774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 17313 17008 gene locus_tag LOCUS_19640 17313 17008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 18181 17390 gene locus_tag LOCUS_19650 18181 17390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 19514 18189 gene locus_tag LOCUS_19660 19514 18189 CDS product phage integrase SAM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362019.1 protein_id gnl|my_center|LOCUS_19660 20573 19881 gene locus_tag LOCUS_19670 20573 19881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 20800 20585 gene locus_tag LOCUS_19680 20800 20585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 20870 22072 gene locus_tag LOCUS_19690 20870 22072 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_19690 25628 22092 gene locus_tag LOCUS_19700 25628 22092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 27281 26181 gene locus_tag LOCUS_19710 27281 26181 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_19710 28018 27365 gene locus_tag LOCUS_19720 gene fsa 28018 27365 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963193.1 protein_id gnl|my_center|LOCUS_19720 28612 28028 gene locus_tag LOCUS_19730 28612 28028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19730 <29183 28635 gene locus_tag LOCUS_19740 <29183 28635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766126.1:transketolase note possible pseudo, frameshifted >Feature sequence038 585 1538 gene locus_tag LOCUS_19750 585 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 1603 2958 gene locus_tag LOCUS_19760 1603 2958 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_19760 3941 3072 gene locus_tag LOCUS_19770 3941 3072 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425940.1 protein_id gnl|my_center|LOCUS_19770 4938 4051 gene locus_tag LOCUS_19780 4938 4051 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118048.1 protein_id gnl|my_center|LOCUS_19780 5921 4953 gene locus_tag LOCUS_19790 5921 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 8193 5983 gene locus_tag LOCUS_19800 8193 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 9197 8304 gene locus_tag LOCUS_19810 9197 8304 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766765.1 protein_id gnl|my_center|LOCUS_19810 9788 9273 gene locus_tag LOCUS_19820 9788 9273 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770321.1 protein_id gnl|my_center|LOCUS_19820 9947 11644 gene locus_tag LOCUS_19830 9947 11644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 11826 13154 gene locus_tag LOCUS_19840 gene ffh 11826 13154 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963594.1 protein_id gnl|my_center|LOCUS_19840 13194 14075 gene locus_tag LOCUS_19850 13194 14075 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963593.1 protein_id gnl|my_center|LOCUS_19850 14506 14084 gene locus_tag LOCUS_19860 14506 14084 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268094.1 protein_id gnl|my_center|LOCUS_19860 15279 14512 gene locus_tag LOCUS_19870 gene rluF 15279 14512 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963354.1 protein_id gnl|my_center|LOCUS_19870 16127 15300 gene locus_tag LOCUS_19880 16127 15300 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963353.1 protein_id gnl|my_center|LOCUS_19880 16489 16127 gene locus_tag LOCUS_19890 16489 16127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 17469 16495 gene locus_tag LOCUS_19900 17469 16495 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963796.1 protein_id gnl|my_center|LOCUS_19900 18043 17480 gene locus_tag LOCUS_19910 18043 17480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 19629 18082 gene locus_tag LOCUS_19920 19629 18082 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 protein_id gnl|my_center|LOCUS_19920 19734 20363 gene locus_tag LOCUS_19930 19734 20363 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964290.1 protein_id gnl|my_center|LOCUS_19930 21688 20417 gene locus_tag LOCUS_19940 21688 20417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 21852 23525 gene locus_tag LOCUS_19950 gene asnB 21852 23525 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_19950 23893 25515 gene locus_tag LOCUS_19960 gene gyrB 23893 25515 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962691.1 protein_id gnl|my_center|LOCUS_19960 25527 25985 gene locus_tag LOCUS_19970 25527 25985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 25969 25982 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26089 27429 gene locus_tag LOCUS_19980 26089 27429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 27440 27817 gene locus_tag LOCUS_19990 gene queF 27440 27817 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002834281.1 protein_id gnl|my_center|LOCUS_19990 27897 28130 gene locus_tag LOCUS_20000 27897 28130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 28988 28227 gene locus_tag LOCUS_20010 28988 28227 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943179.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence039 899 12 gene locus_tag LOCUS_20020 899 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 1870 902 gene locus_tag LOCUS_20030 gene arsM 1870 902 CDS product arsenosugar biosynthesis arsenite methyltransferase ArsM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143344.1 protein_id gnl|my_center|LOCUS_20030 2780 1968 gene locus_tag LOCUS_20040 2780 1968 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933475.1 protein_id gnl|my_center|LOCUS_20040 3450 2773 gene locus_tag LOCUS_20050 3450 2773 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_20050 3943 3452 gene locus_tag LOCUS_20060 3943 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 5002 3947 gene locus_tag LOCUS_20070 gene arsS 5002 3947 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272562.1 protein_id gnl|my_center|LOCUS_20070 5389 5054 gene locus_tag LOCUS_20080 5389 5054 CDS product arsenosugar biosynthesis-associated peroxidase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986517.1 protein_id gnl|my_center|LOCUS_20080 5532 8324 gene locus_tag LOCUS_20090 5532 8324 CDS product triple tyrosine motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091372500.1 protein_id gnl|my_center|LOCUS_20090 8546 11572 gene locus_tag LOCUS_20100 8546 11572 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_20100 11585 13132 gene locus_tag LOCUS_20110 11585 13132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 13152 15530 gene locus_tag LOCUS_20120 13152 15530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 15671 17032 gene locus_tag LOCUS_20130 15671 17032 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108887.1 protein_id gnl|my_center|LOCUS_20130 17044 18411 gene locus_tag LOCUS_20140 17044 18411 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796641.1 protein_id gnl|my_center|LOCUS_20140 18423 19232 gene locus_tag LOCUS_20150 18423 19232 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203675.1 protein_id gnl|my_center|LOCUS_20150 19235 21571 gene locus_tag LOCUS_20160 gene bglX 19235 21571 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_20160 21598 23352 gene locus_tag LOCUS_20170 21598 23352 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 protein_id gnl|my_center|LOCUS_20170 23512 24399 gene locus_tag LOCUS_20180 23512 24399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 24502 24669 gene locus_tag LOCUS_20190 24502 24669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 28458 24775 gene locus_tag LOCUS_20200 28458 24775 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163515044.1 protein_id gnl|my_center|LOCUS_20200 >Feature sequence040 1357 317 gene locus_tag LOCUS_20210 gene guaC 1357 317 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217330.1 protein_id gnl|my_center|LOCUS_20210 1593 3452 gene locus_tag LOCUS_20220 1593 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 3844 3464 gene locus_tag LOCUS_20230 3844 3464 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_20230 6718 3860 gene locus_tag LOCUS_20240 6718 3860 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 protein_id gnl|my_center|LOCUS_20240 6707 7831 gene locus_tag LOCUS_20250 6707 7831 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962911.1 protein_id gnl|my_center|LOCUS_20250 7860 8816 gene locus_tag LOCUS_20260 7860 8816 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962912.1 protein_id gnl|my_center|LOCUS_20260 8823 10124 gene locus_tag LOCUS_20270 8823 10124 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_20270 10239 11030 gene locus_tag LOCUS_20280 10239 11030 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_20280 11043 11672 gene locus_tag LOCUS_20290 11043 11672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 11674 12159 gene locus_tag LOCUS_20300 11674 12159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_20300 12237 12680 gene locus_tag LOCUS_20310 12237 12680 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964424.1 protein_id gnl|my_center|LOCUS_20310 12761 13660 gene locus_tag LOCUS_20320 12761 13660 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059223299.1 protein_id gnl|my_center|LOCUS_20320 13663 13872 gene locus_tag LOCUS_20330 13663 13872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 13899 15341 gene locus_tag LOCUS_20340 13899 15341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 15465 18383 gene locus_tag LOCUS_20350 15465 18383 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_20350 18436 19572 gene locus_tag LOCUS_20360 gene bshA 18436 19572 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 protein_id gnl|my_center|LOCUS_20360 20117 19629 gene locus_tag LOCUS_20370 20117 19629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 20401 21465 gene locus_tag LOCUS_20380 gene aroC 20401 21465 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962924.1 protein_id gnl|my_center|LOCUS_20380 21500 22849 gene locus_tag LOCUS_20390 21500 22849 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_20390 22864 23694 gene locus_tag LOCUS_20400 22864 23694 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477173.1 protein_id gnl|my_center|LOCUS_20400 24215 23802 gene locus_tag LOCUS_20410 24215 23802 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962927.1 protein_id gnl|my_center|LOCUS_20410 26385 24220 gene locus_tag LOCUS_20420 26385 24220 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963184.1 protein_id gnl|my_center|LOCUS_20420 26938 26462 gene locus_tag LOCUS_20430 26938 26462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340546.1 protein_id gnl|my_center|LOCUS_20430 <28218 26992 gene locus_tag LOCUS_20440 <28218 26992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962878.1:alpha-ketoacid dehydrogenase subunit alpha/beta >Feature sequence041 708 70 gene locus_tag LOCUS_20450 708 70 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964170.1 protein_id gnl|my_center|LOCUS_20450 1587 799 gene locus_tag LOCUS_20460 gene nadE 1587 799 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964169.1 protein_id gnl|my_center|LOCUS_20460 1680 2642 gene locus_tag LOCUS_20470 1680 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 2642 2977 gene locus_tag LOCUS_20480 gene gldC 2642 2977 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_20480 3626 2979 gene locus_tag LOCUS_20490 gene def 3626 2979 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116243.1 protein_id gnl|my_center|LOCUS_20490 4921 3644 gene locus_tag LOCUS_20500 gene rodA 4921 3644 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_20500 6854 4926 gene locus_tag LOCUS_20510 gene mrdA 6854 4926 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964508.1 protein_id gnl|my_center|LOCUS_20510 7357 6851 gene locus_tag LOCUS_20520 7357 6851 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964507.1 protein_id gnl|my_center|LOCUS_20520 8120 7350 gene locus_tag LOCUS_20530 gene mreC 8120 7350 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099559.1 protein_id gnl|my_center|LOCUS_20530 9218 8190 gene locus_tag LOCUS_20540 9218 8190 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_20540 10847 9315 gene locus_tag LOCUS_20550 gene purH 10847 9315 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964504.1 protein_id gnl|my_center|LOCUS_20550 11062 12312 gene locus_tag LOCUS_20560 11062 12312 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_20560 12782 12321 gene locus_tag LOCUS_20570 12782 12321 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964137.1 protein_id gnl|my_center|LOCUS_20570 12861 13412 gene locus_tag LOCUS_20580 gene xrtF 12861 13412 CDS product exosortase family protein XrtF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964136.1 protein_id gnl|my_center|LOCUS_20580 13405 13833 gene locus_tag LOCUS_20590 13405 13833 CDS product exosortase F system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964135.1 protein_id gnl|my_center|LOCUS_20590 13894 14310 gene locus_tag LOCUS_20600 13894 14310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 14414 16828 gene locus_tag LOCUS_20610 14414 16828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20610 16879 18222 gene locus_tag LOCUS_20620 16879 18222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20620 18225 19487 gene locus_tag LOCUS_20630 18225 19487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 19468 21207 gene locus_tag LOCUS_20640 19468 21207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 21238 21645 gene locus_tag LOCUS_20650 21238 21645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 21770 22342 gene locus_tag LOCUS_20660 21770 22342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 22445 24952 gene locus_tag LOCUS_20670 22445 24952 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946759.1 protein_id gnl|my_center|LOCUS_20670 25069 27291 gene locus_tag LOCUS_20680 25069 27291 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921395.1 protein_id gnl|my_center|LOCUS_20680 >Feature sequence042 168 749 gene locus_tag LOCUS_20690 168 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 1402 1551 gene locus_tag LOCUS_20700 1402 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 2755 1565 gene locus_tag LOCUS_20710 2755 1565 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_20710 2859 3743 gene locus_tag LOCUS_20720 2859 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 3926 3744 gene locus_tag LOCUS_20730 3926 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 4147 5355 gene locus_tag LOCUS_20740 4147 5355 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105100257.1 protein_id gnl|my_center|LOCUS_20740 6599 5409 gene locus_tag LOCUS_20750 6599 5409 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_20750 7683 6799 gene locus_tag LOCUS_20760 7683 6799 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789633.1 protein_id gnl|my_center|LOCUS_20760 9324 7831 gene locus_tag LOCUS_20770 9324 7831 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026811032.1 protein_id gnl|my_center|LOCUS_20770 10794 9379 gene locus_tag LOCUS_20780 10794 9379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 12510 10813 gene locus_tag LOCUS_20790 12510 10813 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_20790 15630 12529 gene locus_tag LOCUS_20800 15630 12529 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016266957.1 protein_id gnl|my_center|LOCUS_20800 17258 15642 gene locus_tag LOCUS_20810 17258 15642 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026811032.1 protein_id gnl|my_center|LOCUS_20810 18584 17268 gene locus_tag LOCUS_20820 18584 17268 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_20820 21680 18933 gene locus_tag LOCUS_20830 21680 18933 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203735.1 protein_id gnl|my_center|LOCUS_20830 22165 21854 gene locus_tag LOCUS_20840 22165 21854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 23039 22182 gene locus_tag LOCUS_20850 23039 22182 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962653.1 protein_id gnl|my_center|LOCUS_20850 23560 23036 gene locus_tag LOCUS_20860 23560 23036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 24398 23538 gene locus_tag LOCUS_20870 24398 23538 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361991.1 protein_id gnl|my_center|LOCUS_20870 25862 24666 gene locus_tag LOCUS_20880 25862 24666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 26158 25859 gene locus_tag LOCUS_20890 26158 25859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 >Feature sequence043 969 1535 gene locus_tag LOCUS_20900 969 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 2659 1874 gene locus_tag LOCUS_20910 2659 1874 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_20910 4152 2689 gene locus_tag LOCUS_20920 4152 2689 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962229.1 protein_id gnl|my_center|LOCUS_20920 4787 4239 gene locus_tag LOCUS_20930 4787 4239 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_20930 6165 4822 gene locus_tag LOCUS_20940 6165 4822 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948764.1 protein_id gnl|my_center|LOCUS_20940 7094 6177 gene locus_tag LOCUS_20950 gene hemH 7094 6177 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962227.1 protein_id gnl|my_center|LOCUS_20950 7005 7035 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7341 7189 gene locus_tag LOCUS_20960 7341 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 8301 7381 gene locus_tag LOCUS_20970 8301 7381 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962226.1 protein_id gnl|my_center|LOCUS_20970 8471 9730 gene locus_tag LOCUS_20980 gene hemA 8471 9730 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962225.1 protein_id gnl|my_center|LOCUS_20980 9723 11300 gene locus_tag LOCUS_20990 9723 11300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 11342 11698 gene locus_tag LOCUS_21000 11342 11698 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_21000 11745 12767 gene locus_tag LOCUS_21010 gene hemE 11745 12767 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962222.1 protein_id gnl|my_center|LOCUS_21010 12851 13384 gene locus_tag LOCUS_21020 12851 13384 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962220.1 protein_id gnl|my_center|LOCUS_21020 13400 14698 gene locus_tag LOCUS_21030 gene nhaA 13400 14698 CDS product sodium/proton antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049644.1 protein_id gnl|my_center|LOCUS_21030 14688 15590 gene locus_tag LOCUS_21040 gene hemF 14688 15590 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962218.1 protein_id gnl|my_center|LOCUS_21040 15656 16645 gene locus_tag LOCUS_21050 gene hemB 15656 16645 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962216.1 protein_id gnl|my_center|LOCUS_21050 16667 17947 gene locus_tag LOCUS_21060 16667 17947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 17949 18422 gene locus_tag LOCUS_21070 17949 18422 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962214.1 protein_id gnl|my_center|LOCUS_21070 18503 19654 gene locus_tag LOCUS_21080 18503 19654 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130543805.1 protein_id gnl|my_center|LOCUS_21080 19651 20364 gene locus_tag LOCUS_21090 19651 20364 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_21090 20787 22751 gene locus_tag LOCUS_21100 20787 22751 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 protein_id gnl|my_center|LOCUS_21100 25075 22748 gene locus_tag LOCUS_21110 25075 22748 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_21110 25575 25084 gene locus_tag LOCUS_21120 25575 25084 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962205.1 protein_id gnl|my_center|LOCUS_21120 26737 25565 gene locus_tag LOCUS_21130 gene ricT 26737 25565 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence044 1554 2648 gene locus_tag LOCUS_21140 gene ychF 1554 2648 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962805.1 protein_id gnl|my_center|LOCUS_21140 2717 3616 gene locus_tag LOCUS_21150 2717 3616 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347004.1 protein_id gnl|my_center|LOCUS_21150 3761 5617 gene locus_tag LOCUS_21160 3761 5617 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_21160 5617 6111 gene locus_tag LOCUS_21170 5617 6111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 6227 6355 gene locus_tag LOCUS_21180 6227 6355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 6355 9024 gene locus_tag LOCUS_21190 6355 9024 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_21190 9830 9036 gene locus_tag LOCUS_21200 9830 9036 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962881.1 protein_id gnl|my_center|LOCUS_21200 10794 9883 gene locus_tag LOCUS_21210 gene miaA 10794 9883 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964020.1 protein_id gnl|my_center|LOCUS_21210 11638 10787 gene locus_tag LOCUS_21220 11638 10787 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_21220 13625 11664 gene locus_tag LOCUS_21230 13625 11664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 14993 13629 gene locus_tag LOCUS_21240 14993 13629 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_21240 15758 15090 gene locus_tag LOCUS_21250 15758 15090 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_21250 17003 15762 gene locus_tag LOCUS_21260 17003 15762 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964016.1 protein_id gnl|my_center|LOCUS_21260 17443 17207 gene locus_tag LOCUS_21270 17443 17207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 18392 17502 gene locus_tag LOCUS_21280 18392 17502 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_21280 19365 18403 gene locus_tag LOCUS_21290 19365 18403 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_21290 19614 20255 gene locus_tag LOCUS_21300 19614 20255 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964013.1 protein_id gnl|my_center|LOCUS_21300 20703 20263 gene locus_tag LOCUS_21310 20703 20263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 21267 20707 gene locus_tag LOCUS_21320 21267 20707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 21758 21300 gene locus_tag LOCUS_21330 gene smpB 21758 21300 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963988.1 protein_id gnl|my_center|LOCUS_21330 21930 23330 gene locus_tag LOCUS_21340 gene lpdA 21930 23330 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963845.1 protein_id gnl|my_center|LOCUS_21340 24161 23382 gene locus_tag LOCUS_21350 24161 23382 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062784820.1 protein_id gnl|my_center|LOCUS_21350 24672 24184 gene locus_tag LOCUS_21360 24672 24184 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788377.1 protein_id gnl|my_center|LOCUS_21360 25441 24674 gene locus_tag LOCUS_21370 25441 24674 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765764.1 protein_id gnl|my_center|LOCUS_21370 >Feature sequence045 <1 1328 gene locus_tag LOCUS_21380 <1 1328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963528.1:radical SAM protein 2370 1393 gene locus_tag LOCUS_21390 2370 1393 CDS product DUF6340 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764527.1 protein_id gnl|my_center|LOCUS_21390 2528 3766 gene locus_tag LOCUS_21400 2528 3766 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963811.1 protein_id gnl|my_center|LOCUS_21400 4213 3797 gene locus_tag LOCUS_21410 4213 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 4784 4203 gene locus_tag LOCUS_21420 4784 4203 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 protein_id gnl|my_center|LOCUS_21420 4926 5270 gene locus_tag LOCUS_21430 4926 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 5991 5326 gene locus_tag LOCUS_21440 5991 5326 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948285.1 protein_id gnl|my_center|LOCUS_21440 6031 6624 gene locus_tag LOCUS_21450 6031 6624 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_21450 7007 7930 gene locus_tag LOCUS_21460 7007 7930 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682158.1 protein_id gnl|my_center|LOCUS_21460 8141 9451 gene locus_tag LOCUS_21470 8141 9451 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_21470 9528 10235 gene locus_tag LOCUS_21480 9528 10235 CDS product DUF4369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963060.1 protein_id gnl|my_center|LOCUS_21480 10678 10409 gene locus_tag LOCUS_21490 10678 10409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963895.1 protein_id gnl|my_center|LOCUS_21490 11210 10800 gene locus_tag LOCUS_21500 11210 10800 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963898.1 protein_id gnl|my_center|LOCUS_21500 11733 11194 gene locus_tag LOCUS_21510 gene idi 11733 11194 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_21510 13755 11821 gene locus_tag LOCUS_21520 13755 11821 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_21520 14705 13773 gene locus_tag LOCUS_21530 14705 13773 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_21530 20316 14734 gene locus_tag LOCUS_21540 20316 14734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 20711 22297 gene locus_tag LOCUS_21550 20711 22297 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963308.1 protein_id gnl|my_center|LOCUS_21550 22427 22663 gene locus_tag LOCUS_21560 22427 22663 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107822.1 protein_id gnl|my_center|LOCUS_21560 23049 22732 gene locus_tag LOCUS_21570 23049 22732 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_21570 <24589 23106 gene locus_tag LOCUS_21580 <24589 23106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963311.1:DNA-directed RNA polymerase subunit beta' >Feature sequence046 312 91 gene locus_tag LOCUS_21590 gene yidD 312 91 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962760.1 protein_id gnl|my_center|LOCUS_21590 1864 383 gene locus_tag LOCUS_21600 gene cysS 1864 383 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962759.1 protein_id gnl|my_center|LOCUS_21600 2286 1924 gene locus_tag LOCUS_21610 2286 1924 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963264.1 protein_id gnl|my_center|LOCUS_21610 3058 2381 gene locus_tag LOCUS_21620 gene folE 3058 2381 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962758.1 protein_id gnl|my_center|LOCUS_21620 4689 3223 gene locus_tag LOCUS_21630 4689 3223 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963523.1 protein_id gnl|my_center|LOCUS_21630 5841 4759 gene locus_tag LOCUS_21640 5841 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 5941 7419 gene locus_tag LOCUS_21650 gene proS 5941 7419 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963521.1 protein_id gnl|my_center|LOCUS_21650 7569 7644 gene locus_tag LOCUS_t00260 7569 7644 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7668 7922 gene locus_tag LOCUS_21660 gene rpsT 7668 7922 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963520.1 protein_id gnl|my_center|LOCUS_21660 8334 8056 gene locus_tag LOCUS_21670 8334 8056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 8414 8553 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9828 10238 gene locus_tag LOCUS_21680 9828 10238 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962875.1 protein_id gnl|my_center|LOCUS_21680 10793 10296 gene locus_tag LOCUS_21690 10793 10296 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962868.1 protein_id gnl|my_center|LOCUS_21690 10870 11613 gene locus_tag LOCUS_21700 gene truA 10870 11613 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963544.1 protein_id gnl|my_center|LOCUS_21700 11614 13380 gene locus_tag LOCUS_21710 11614 13380 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_21710 14175 13384 gene locus_tag LOCUS_21720 gene cdaA 14175 13384 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779023.1 protein_id gnl|my_center|LOCUS_21720 14900 14211 gene locus_tag LOCUS_21730 14900 14211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 15732 14908 gene locus_tag LOCUS_21740 gene folP 15732 14908 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963546.1 protein_id gnl|my_center|LOCUS_21740 15858 16397 gene locus_tag LOCUS_21750 15858 16397 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_21750 16437 17531 gene locus_tag LOCUS_21760 16437 17531 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188467563.1 protein_id gnl|my_center|LOCUS_21760 17685 18170 gene locus_tag LOCUS_21770 17685 18170 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963549.1 protein_id gnl|my_center|LOCUS_21770 18170 18919 gene locus_tag LOCUS_21780 gene tpiA 18170 18919 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963550.1 protein_id gnl|my_center|LOCUS_21780 19143 19979 gene locus_tag LOCUS_21790 gene prmA 19143 19979 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_21790 19995 20270 gene locus_tag LOCUS_21800 19995 20270 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_21800 20494 20291 gene locus_tag LOCUS_21810 20494 20291 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257467.1 protein_id gnl|my_center|LOCUS_21810 21927 20512 gene locus_tag LOCUS_21820 21927 20512 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_21820 22789 21986 gene locus_tag LOCUS_21830 22789 21986 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963923.1 protein_id gnl|my_center|LOCUS_21830 23204 22791 gene locus_tag LOCUS_21840 23204 22791 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_21840 23765 23208 gene locus_tag LOCUS_21850 23765 23208 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_21850 24443 23808 gene locus_tag LOCUS_21860 24443 23808 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028787344.1 protein_id gnl|my_center|LOCUS_21860 >Feature sequence047 546 980 gene locus_tag LOCUS_21870 546 980 CDS product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459284.1 protein_id gnl|my_center|LOCUS_21870 980 1693 gene locus_tag LOCUS_21880 gene rimK 980 1693 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459235.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21880 1671 1883 gene locus_tag LOCUS_21890 1671 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21890 1892 2866 gene locus_tag LOCUS_21900 1892 2866 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 protein_id gnl|my_center|LOCUS_21900 2877 3440 gene locus_tag LOCUS_21910 2877 3440 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962396.1 protein_id gnl|my_center|LOCUS_21910 4063 3437 gene locus_tag LOCUS_21920 4063 3437 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962395.1 protein_id gnl|my_center|LOCUS_21920 4556 4176 gene locus_tag LOCUS_21930 4556 4176 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962394.1 protein_id gnl|my_center|LOCUS_21930 7980 4561 gene locus_tag LOCUS_21940 gene ileS 7980 4561 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962393.1 protein_id gnl|my_center|LOCUS_21940 8532 8068 gene locus_tag LOCUS_21950 8532 8068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 10001 8643 gene locus_tag LOCUS_21960 gene radA 10001 8643 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962283.1 protein_id gnl|my_center|LOCUS_21960 11150 10002 gene locus_tag LOCUS_21970 11150 10002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 12205 11246 gene locus_tag LOCUS_21980 12205 11246 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962285.1 protein_id gnl|my_center|LOCUS_21980 12560 12210 gene locus_tag LOCUS_21990 12560 12210 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962286.1 protein_id gnl|my_center|LOCUS_21990 13422 12574 gene locus_tag LOCUS_22000 gene panC 13422 12574 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962287.1 protein_id gnl|my_center|LOCUS_22000 13618 14427 gene locus_tag LOCUS_22010 13618 14427 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_22010 14453 16180 gene locus_tag LOCUS_22020 14453 16180 CDS product DUF4270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962289.1 protein_id gnl|my_center|LOCUS_22020 16345 18192 gene locus_tag LOCUS_22030 gene glmS 16345 18192 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962290.1 protein_id gnl|my_center|LOCUS_22030 18431 21157 gene locus_tag LOCUS_22040 18431 21157 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_22040 21159 22814 gene locus_tag LOCUS_22050 21159 22814 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962292.1 protein_id gnl|my_center|LOCUS_22050 >Feature sequence048 251 1369 gene locus_tag LOCUS_22060 gene gmd 251 1369 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036868.1 protein_id gnl|my_center|LOCUS_22060 1499 1810 gene locus_tag LOCUS_22070 1499 1810 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089378.1 protein_id gnl|my_center|LOCUS_22070 2362 3438 gene locus_tag LOCUS_22080 2362 3438 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808880.1 protein_id gnl|my_center|LOCUS_22080 3520 4539 gene locus_tag LOCUS_22090 gene pseB 3520 4539 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867763.1 protein_id gnl|my_center|LOCUS_22090 4542 5690 gene locus_tag LOCUS_22100 gene pseC 4542 5690 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097863.1 protein_id gnl|my_center|LOCUS_22100 5683 6393 gene locus_tag LOCUS_22110 gene pseF 5683 6393 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 protein_id gnl|my_center|LOCUS_22110 6368 7525 gene locus_tag LOCUS_22120 gene pseA 6368 7525 CDS product pseudaminic acid biosynthesis protein PseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856493.1 protein_id gnl|my_center|LOCUS_22120 7525 8139 gene locus_tag LOCUS_22130 gene hisH 7525 8139 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856473.1 protein_id gnl|my_center|LOCUS_22130 8132 8911 gene locus_tag LOCUS_22140 gene hisF 8132 8911 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391341.1 protein_id gnl|my_center|LOCUS_22140 8916 10385 gene locus_tag LOCUS_22150 gene pseG 8916 10385 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870575.1 protein_id gnl|my_center|LOCUS_22150 10382 11410 gene locus_tag LOCUS_22160 gene pseI 10382 11410 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987011.1 protein_id gnl|my_center|LOCUS_22160 11471 12721 gene locus_tag LOCUS_22170 11471 12721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 12721 14148 gene locus_tag LOCUS_22180 12721 14148 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292875.1 protein_id gnl|my_center|LOCUS_22180 14150 15325 gene locus_tag LOCUS_22190 14150 15325 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966612.1 protein_id gnl|my_center|LOCUS_22190 15714 16505 gene locus_tag LOCUS_22200 15714 16505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 16483 17823 gene locus_tag LOCUS_22210 16483 17823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 17810 18850 gene locus_tag LOCUS_22220 17810 18850 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268293.1 protein_id gnl|my_center|LOCUS_22220 18847 19989 gene locus_tag LOCUS_22230 18847 19989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 >Feature sequence049 942 397 gene locus_tag LOCUS_22240 942 397 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963584.1 protein_id gnl|my_center|LOCUS_22240 2045 933 gene locus_tag LOCUS_22250 2045 933 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_22250 2255 2049 gene locus_tag LOCUS_22260 2255 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 2407 3093 gene locus_tag LOCUS_22270 gene aqpZ 2407 3093 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488716.1 protein_id gnl|my_center|LOCUS_22270 3955 3167 gene locus_tag LOCUS_22280 3955 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 4497 3964 gene locus_tag LOCUS_22290 4497 3964 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483035.1 protein_id gnl|my_center|LOCUS_22290 5578 4565 gene locus_tag LOCUS_22300 gene murB 5578 4565 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964097.1 protein_id gnl|my_center|LOCUS_22300 6768 5578 gene locus_tag LOCUS_22310 6768 5578 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963806.1 protein_id gnl|my_center|LOCUS_22310 6897 8237 gene locus_tag LOCUS_22320 6897 8237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 8722 8294 gene locus_tag LOCUS_22330 8722 8294 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963807.1 protein_id gnl|my_center|LOCUS_22330 8905 11535 gene locus_tag LOCUS_22340 8905 11535 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963808.1 protein_id gnl|my_center|LOCUS_22340 11626 12777 gene locus_tag LOCUS_22350 11626 12777 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_22350 13394 12807 gene locus_tag LOCUS_22360 13394 12807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 13699 13433 gene locus_tag LOCUS_22370 13699 13433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 14348 13692 gene locus_tag LOCUS_22380 14348 13692 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_22380 15159 14338 gene locus_tag LOCUS_22390 15159 14338 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962766.1 protein_id gnl|my_center|LOCUS_22390 15823 15215 gene locus_tag LOCUS_22400 15823 15215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962765.1 protein_id gnl|my_center|LOCUS_22400 17879 15939 gene locus_tag LOCUS_22410 gene ftsH 17879 15939 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962764.1 protein_id gnl|my_center|LOCUS_22410 18257 17886 gene locus_tag LOCUS_22420 gene rsfS 18257 17886 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962763.1 protein_id gnl|my_center|LOCUS_22420 18351 19082 gene locus_tag LOCUS_22430 18351 19082 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361998.1 protein_id gnl|my_center|LOCUS_22430 19474 19079 gene locus_tag LOCUS_22440 19474 19079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962824.1 protein_id gnl|my_center|LOCUS_22440 20164 19520 gene locus_tag LOCUS_22450 gene pyrE 20164 19520 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962823.1 protein_id gnl|my_center|LOCUS_22450 20295 20876 gene locus_tag LOCUS_22460 20295 20876 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097944.1 protein_id gnl|my_center|LOCUS_22460 >Feature sequence050 <1 1524 gene locus_tag LOCUS_22470 <1 1524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962273.1:fumarate reductase/succinate dehydrogenase flavoprotein subunit 1535 2113 gene locus_tag LOCUS_22480 1535 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 2388 3203 gene locus_tag LOCUS_22490 2388 3203 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920359.1 protein_id gnl|my_center|LOCUS_22490 6610 3200 gene locus_tag LOCUS_22500 6610 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_22500 6732 7496 gene locus_tag LOCUS_22510 6732 7496 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962243.1 protein_id gnl|my_center|LOCUS_22510 7528 8487 gene locus_tag LOCUS_22520 7528 8487 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_22520 8694 9731 gene locus_tag LOCUS_22530 8694 9731 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962241.1 protein_id gnl|my_center|LOCUS_22530 9777 10676 gene locus_tag LOCUS_22540 9777 10676 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117757.1 protein_id gnl|my_center|LOCUS_22540 12395 10848 gene locus_tag LOCUS_22550 12395 10848 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_22550 13098 12808 gene locus_tag LOCUS_22560 13098 12808 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_22560 13236 14276 gene locus_tag LOCUS_22570 gene mutY 13236 14276 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_22570 14366 14812 gene locus_tag LOCUS_22580 gene ssb 14366 14812 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963776.1 protein_id gnl|my_center|LOCUS_22580 14836 16143 gene locus_tag LOCUS_22590 14836 16143 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_22590 16140 16724 gene locus_tag LOCUS_22600 gene gldD 16140 16724 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_22600 17337 16774 gene locus_tag LOCUS_22610 17337 16774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 17564 18016 gene locus_tag LOCUS_22620 17564 18016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 18092 18643 gene locus_tag LOCUS_22630 18092 18643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 18669 18929 gene locus_tag LOCUS_22640 gene rpmA 18669 18929 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964306.1 protein_id gnl|my_center|LOCUS_22640 <20126 19107 gene locus_tag LOCUS_22650 <20126 19107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962366.1:adenosylhomocysteinase >Feature sequence051 2200 227 gene locus_tag LOCUS_22660 2200 227 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963329.1 protein_id gnl|my_center|LOCUS_22660 2607 3206 gene locus_tag LOCUS_22670 2607 3206 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963332.1 protein_id gnl|my_center|LOCUS_22670 3279 5714 gene locus_tag LOCUS_22680 3279 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 5772 6821 gene locus_tag LOCUS_22690 5772 6821 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_22690 7023 8723 gene locus_tag LOCUS_22700 7023 8723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 8906 9442 gene locus_tag LOCUS_22710 8906 9442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 9976 10701 gene locus_tag LOCUS_22720 9976 10701 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932971.1 protein_id gnl|my_center|LOCUS_22720 10866 12848 gene locus_tag LOCUS_22730 gene pulA 10866 12848 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107931.1 protein_id gnl|my_center|LOCUS_22730 13582 12983 gene locus_tag LOCUS_22740 13582 12983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 13661 13870 gene locus_tag LOCUS_22750 13661 13870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 14629 13871 gene locus_tag LOCUS_22760 gene yaaA 14629 13871 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962877.1 protein_id gnl|my_center|LOCUS_22760 15804 14761 gene locus_tag LOCUS_22770 15804 14761 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962812.1 protein_id gnl|my_center|LOCUS_22770 16364 15807 gene locus_tag LOCUS_22780 16364 15807 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962813.1 protein_id gnl|my_center|LOCUS_22780 16582 17556 gene locus_tag LOCUS_22790 16582 17556 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962814.1 protein_id gnl|my_center|LOCUS_22790 17575 18033 gene locus_tag LOCUS_22800 gene coaD 17575 18033 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962815.1 protein_id gnl|my_center|LOCUS_22800 19705 18083 gene locus_tag LOCUS_22810 19705 18083 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_22810 >Feature sequence052 <1 836 gene locus_tag LOCUS_22820 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926948.1:metallophosphoesterase family protein 1110 1541 gene locus_tag LOCUS_22830 1110 1541 CDS product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793421.1 protein_id gnl|my_center|LOCUS_22830 1544 2434 gene locus_tag LOCUS_22840 1544 2434 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761242.1 protein_id gnl|my_center|LOCUS_22840 2427 3755 gene locus_tag LOCUS_22850 gene rsxC 2427 3755 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788158.1 protein_id gnl|my_center|LOCUS_22850 3758 4768 gene locus_tag LOCUS_22860 3758 4768 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_22860 4771 5367 gene locus_tag LOCUS_22870 4771 5367 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202941.1 protein_id gnl|my_center|LOCUS_22870 5373 5981 gene locus_tag LOCUS_22880 5373 5981 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_22880 5981 6556 gene locus_tag LOCUS_22890 gene rsxA 5981 6556 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778198.1 protein_id gnl|my_center|LOCUS_22890 6894 6565 gene locus_tag LOCUS_22900 6894 6565 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_22900 7446 7114 gene locus_tag LOCUS_22910 7446 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 8880 7453 gene locus_tag LOCUS_22920 8880 7453 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992198.1 protein_id gnl|my_center|LOCUS_22920 9590 8898 gene locus_tag LOCUS_22930 9590 8898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22930 10323 9496 gene locus_tag LOCUS_22940 10323 9496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22940 12253 10334 gene locus_tag LOCUS_22950 gene nuoL 12253 10334 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785040.1 protein_id gnl|my_center|LOCUS_22950 12582 12265 gene locus_tag LOCUS_22960 gene nuoK 12582 12265 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775579.1 protein_id gnl|my_center|LOCUS_22960 13103 12579 gene locus_tag LOCUS_22970 13103 12579 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764300.1 protein_id gnl|my_center|LOCUS_22970 13584 13108 gene locus_tag LOCUS_22980 13584 13108 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109090.1 protein_id gnl|my_center|LOCUS_22980 14662 13589 gene locus_tag LOCUS_22990 gene nuoH 14662 13589 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785048.1 protein_id gnl|my_center|LOCUS_22990 15792 14665 gene locus_tag LOCUS_23000 15792 14665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23000 16254 15793 gene locus_tag LOCUS_23010 16254 15793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23010 16858 16265 gene locus_tag LOCUS_23020 16858 16265 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769486.1 protein_id gnl|my_center|LOCUS_23020 17199 16849 gene locus_tag LOCUS_23030 17199 16849 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775585.1 protein_id gnl|my_center|LOCUS_23030 18290 17277 gene locus_tag LOCUS_23040 18290 17277 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791975.1 protein_id gnl|my_center|LOCUS_23040 <19134 18293 gene locus_tag LOCUS_23050 <19134 18293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_107821429.1:2-oxoacid:acceptor oxidoreductase subunit alpha >Feature sequence053 515 1849 gene locus_tag LOCUS_23060 515 1849 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963880.1 protein_id gnl|my_center|LOCUS_23060 1905 2825 gene locus_tag LOCUS_23070 1905 2825 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458367.1 protein_id gnl|my_center|LOCUS_23070 2825 3844 gene locus_tag LOCUS_23080 2825 3844 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_23080 3837 4577 gene locus_tag LOCUS_23090 3837 4577 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963879.1 protein_id gnl|my_center|LOCUS_23090 4682 6718 gene locus_tag LOCUS_23100 4682 6718 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963876.1 protein_id gnl|my_center|LOCUS_23100 6807 7610 gene locus_tag LOCUS_23110 gene sppA 6807 7610 CDS product fructose-phosphate phosphohydrolase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263015.1 protein_id gnl|my_center|LOCUS_23110 8702 7611 gene locus_tag LOCUS_23120 8702 7611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 10009 8639 gene locus_tag LOCUS_23130 10009 8639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 8770 8873 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11051 10230 gene locus_tag LOCUS_23140 11051 10230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 11050 11319 gene locus_tag LOCUS_23150 11050 11319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 13263 11695 gene locus_tag LOCUS_23160 13263 11695 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114139.1 protein_id gnl|my_center|LOCUS_23160 14084 13308 gene locus_tag LOCUS_23170 gene mazG 14084 13308 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_23170 16461 14191 gene locus_tag LOCUS_23180 16461 14191 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_23180 16851 17063 gene locus_tag LOCUS_23190 16851 17063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 18074 17121 gene locus_tag LOCUS_23200 18074 17121 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_23200 <19059 18079 gene locus_tag LOCUS_23210 <19059 18079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963305.1:peptidylprolyl isomerase >Feature sequence054 2783 405 gene locus_tag LOCUS_23220 2783 405 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_23220 423 474 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2974 4173 gene locus_tag LOCUS_23230 2974 4173 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_23230 4195 4569 gene locus_tag LOCUS_23240 4195 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 4572 5165 gene locus_tag LOCUS_23250 4572 5165 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107355.1 protein_id gnl|my_center|LOCUS_23250 5269 6342 gene locus_tag LOCUS_23260 5269 6342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 7522 6347 gene locus_tag LOCUS_23270 7522 6347 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_23270 7698 8771 gene locus_tag LOCUS_23280 gene aroB 7698 8771 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963817.1 protein_id gnl|my_center|LOCUS_23280 8940 9254 gene locus_tag LOCUS_23290 8940 9254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963820.1 protein_id gnl|my_center|LOCUS_23290 9358 10104 gene locus_tag LOCUS_23300 9358 10104 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_23300 12483 10093 gene locus_tag LOCUS_23310 12483 10093 CDS product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963407.1 protein_id gnl|my_center|LOCUS_23310 13317 12496 gene locus_tag LOCUS_23320 13317 12496 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_23320 15278 13317 gene locus_tag LOCUS_23330 15278 13317 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963409.1 protein_id gnl|my_center|LOCUS_23330 16396 15275 gene locus_tag LOCUS_23340 16396 15275 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963410.1 protein_id gnl|my_center|LOCUS_23340 17137 18165 gene locus_tag LOCUS_23350 17137 18165 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931922.1 protein_id gnl|my_center|LOCUS_23350 18357 18764 gene locus_tag LOCUS_23360 18357 18764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23360 >Feature sequence055 2362 989 gene locus_tag LOCUS_23370 2362 989 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929838.1 protein_id gnl|my_center|LOCUS_23370 3970 2366 gene locus_tag LOCUS_23380 gene bshC 3970 2366 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963529.1 protein_id gnl|my_center|LOCUS_23380 4235 5539 gene locus_tag LOCUS_23390 4235 5539 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818018.1 protein_id gnl|my_center|LOCUS_23390 7035 5731 gene locus_tag LOCUS_23400 gene rimO 7035 5731 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963524.1 protein_id gnl|my_center|LOCUS_23400 7176 8246 gene locus_tag LOCUS_23410 7176 8246 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_23410 9282 8329 gene locus_tag LOCUS_23420 gene ftsY 9282 8329 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963551.1 protein_id gnl|my_center|LOCUS_23420 9625 9473 gene locus_tag LOCUS_23430 9625 9473 CDS product DUF4295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963552.1 protein_id gnl|my_center|LOCUS_23430 9854 9672 gene locus_tag LOCUS_23440 gene rpmG 9854 9672 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963553.1 protein_id gnl|my_center|LOCUS_23440 10116 9880 gene locus_tag LOCUS_23450 gene rpmB 10116 9880 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963554.1 protein_id gnl|my_center|LOCUS_23450 11449 10199 gene locus_tag LOCUS_23460 11449 10199 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963555.1 protein_id gnl|my_center|LOCUS_23460 11790 11449 gene locus_tag LOCUS_23470 11790 11449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 12401 11790 gene locus_tag LOCUS_23480 12401 11790 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_23480 13198 12425 gene locus_tag LOCUS_23490 13198 12425 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963559.1 protein_id gnl|my_center|LOCUS_23490 14002 13211 gene locus_tag LOCUS_23500 14002 13211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 15411 14092 gene locus_tag LOCUS_23510 15411 14092 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962751.1 protein_id gnl|my_center|LOCUS_23510 16601 15498 gene locus_tag LOCUS_23520 16601 15498 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962750.1 protein_id gnl|my_center|LOCUS_23520 17227 16610 gene locus_tag LOCUS_23530 gene recR 17227 16610 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963432.1 protein_id gnl|my_center|LOCUS_23530 >Feature sequence056 <1 642 gene locus_tag LOCUS_23540 <1 642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962992.1:glycine cleavage system aminomethyltransferase GcvT 644 1558 gene locus_tag LOCUS_23550 644 1558 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314081.1 protein_id gnl|my_center|LOCUS_23550 1572 2399 gene locus_tag LOCUS_23560 1572 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 2463 2756 gene locus_tag LOCUS_23570 2463 2756 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391328.1 protein_id gnl|my_center|LOCUS_23570 2846 3565 gene locus_tag LOCUS_23580 2846 3565 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962991.1 protein_id gnl|my_center|LOCUS_23580 3726 5300 gene locus_tag LOCUS_23590 3726 5300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 5612 7009 gene locus_tag LOCUS_23600 5612 7009 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839369.1 protein_id gnl|my_center|LOCUS_23600 7115 7900 gene locus_tag LOCUS_23610 7115 7900 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002268260.1 protein_id gnl|my_center|LOCUS_23610 8636 7908 gene locus_tag LOCUS_23620 8636 7908 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_23620 9274 8726 gene locus_tag LOCUS_23630 9274 8726 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962996.1 protein_id gnl|my_center|LOCUS_23630 10355 9276 gene locus_tag LOCUS_23640 10355 9276 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072443.1 protein_id gnl|my_center|LOCUS_23640 11021 10404 gene locus_tag LOCUS_23650 11021 10404 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787873.1 protein_id gnl|my_center|LOCUS_23650 11727 11023 gene locus_tag LOCUS_23660 11727 11023 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962235.1 protein_id gnl|my_center|LOCUS_23660 12431 11718 gene locus_tag LOCUS_23670 gene kdsB 12431 11718 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963128.1 protein_id gnl|my_center|LOCUS_23670 13061 12495 gene locus_tag LOCUS_23680 13061 12495 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_23680 14506 13082 gene locus_tag LOCUS_23690 14506 13082 CDS product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_23690 14635 15453 gene locus_tag LOCUS_23700 14635 15453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 15401 16258 gene locus_tag LOCUS_23710 15401 16258 CDS product DUF3822 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963132.1 protein_id gnl|my_center|LOCUS_23710 16258 16797 gene locus_tag LOCUS_23720 gene rsmD 16258 16797 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963133.1 protein_id gnl|my_center|LOCUS_23720 16955 17467 gene locus_tag LOCUS_23730 16955 17467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 17496 18242 gene locus_tag LOCUS_23740 17496 18242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 >Feature sequence057 <1 675 gene locus_tag LOCUS_23750 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202089.1:DUF5712 family protein 1100 861 gene locus_tag LOCUS_23760 1100 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 1224 2279 gene locus_tag LOCUS_23770 1224 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 2758 2384 gene locus_tag LOCUS_23780 2758 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 3134 3655 gene locus_tag LOCUS_23790 3134 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 3971 5509 gene locus_tag LOCUS_23800 3971 5509 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196385.1 protein_id gnl|my_center|LOCUS_23800 5523 6539 gene locus_tag LOCUS_23810 5523 6539 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941372.1 protein_id gnl|my_center|LOCUS_23810 6624 7487 gene locus_tag LOCUS_23820 6624 7487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 8698 7706 gene locus_tag LOCUS_23830 8698 7706 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098061990.1 protein_id gnl|my_center|LOCUS_23830 9394 8753 gene locus_tag LOCUS_23840 9394 8753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 9895 9410 gene locus_tag LOCUS_23850 9895 9410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 10485 10120 gene locus_tag LOCUS_23860 10485 10120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 11425 14388 gene locus_tag LOCUS_23870 11425 14388 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_23870 14407 15843 gene locus_tag LOCUS_23880 14407 15843 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_23880 15942 17264 gene locus_tag LOCUS_23890 15942 17264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 >Feature sequence058 787 813 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1401 1081 gene locus_tag LOCUS_23900 1401 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 3767 1560 gene locus_tag LOCUS_23910 3767 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 5310 3772 gene locus_tag LOCUS_23920 5310 3772 CDS product reverse transcriptase/maturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459234.1 protein_id gnl|my_center|LOCUS_23920 7017 6067 gene locus_tag LOCUS_23930 7017 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 10206 7030 gene locus_tag LOCUS_23940 10206 7030 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583655.1 protein_id gnl|my_center|LOCUS_23940 10711 10217 gene locus_tag LOCUS_23950 10711 10217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 13588 10730 gene locus_tag LOCUS_23960 13588 10730 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583653.1 protein_id gnl|my_center|LOCUS_23960 16469 13599 gene locus_tag LOCUS_23970 16469 13599 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286652.1 protein_id gnl|my_center|LOCUS_23970 <17516 16909 gene locus_tag LOCUS_23980 <17516 16909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964269.1:VapE family protein >Feature sequence059 992 3772 gene locus_tag LOCUS_23990 992 3772 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964328.1 protein_id gnl|my_center|LOCUS_23990 3783 5231 gene locus_tag LOCUS_24000 3783 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 6255 5281 gene locus_tag LOCUS_24010 6255 5281 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 protein_id gnl|my_center|LOCUS_24010 6331 7437 gene locus_tag LOCUS_24020 6331 7437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 6708 6780 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8414 7485 gene locus_tag LOCUS_24030 8414 7485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 8997 8491 gene locus_tag LOCUS_24040 8997 8491 CDS product DUF2480 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_24040 9343 9017 gene locus_tag LOCUS_24050 9343 9017 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_24050 9785 9345 gene locus_tag LOCUS_24060 9785 9345 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_24060 10323 9889 gene locus_tag LOCUS_24070 10323 9889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 11476 10403 gene locus_tag LOCUS_24080 11476 10403 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963731.1 protein_id gnl|my_center|LOCUS_24080 12857 11643 gene locus_tag LOCUS_24090 12857 11643 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964478.1 protein_id gnl|my_center|LOCUS_24090 14265 12952 gene locus_tag LOCUS_24100 gene sufD 14265 12952 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_24100 15102 14350 gene locus_tag LOCUS_24110 gene sufC 15102 14350 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_24110 16591 15143 gene locus_tag LOCUS_24120 gene sufB 16591 15143 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964482.1 protein_id gnl|my_center|LOCUS_24120 16950 16621 gene locus_tag LOCUS_24130 16950 16621 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_24130 >Feature sequence060 3357 31 gene locus_tag LOCUS_24140 3357 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 4554 3406 gene locus_tag LOCUS_24150 4554 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 5747 4974 gene locus_tag LOCUS_24160 5747 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 5875 5800 gene locus_tag LOCUS_t00270 5875 5800 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6036 5961 gene locus_tag LOCUS_t00280 6036 5961 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7316 6099 gene locus_tag LOCUS_24170 7316 6099 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_24170 8163 7318 gene locus_tag LOCUS_24180 8163 7318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964028.1 protein_id gnl|my_center|LOCUS_24180 8587 8192 gene locus_tag LOCUS_24190 8587 8192 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760840.1 protein_id gnl|my_center|LOCUS_24190 9290 8589 gene locus_tag LOCUS_24200 9290 8589 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_24200 10751 9345 gene locus_tag LOCUS_24210 gene nhaD 10751 9345 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966224.1 protein_id gnl|my_center|LOCUS_24210 11986 10760 gene locus_tag LOCUS_24220 11986 10760 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_24220 13205 12141 gene locus_tag LOCUS_24230 13205 12141 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_24230 13300 14442 gene locus_tag LOCUS_24240 13300 14442 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_24240 16889 14439 gene locus_tag LOCUS_24250 16889 14439 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202769.1 protein_id gnl|my_center|LOCUS_24250 >Feature sequence061 <1 3375 gene locus_tag LOCUS_24260 <1 3375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_100614127.1:cell surface protein SprA 3441 3821 gene locus_tag LOCUS_24270 gene gcvH 3441 3821 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964219.1 protein_id gnl|my_center|LOCUS_24270 3814 4185 gene locus_tag LOCUS_24280 3814 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 4249 4968 gene locus_tag LOCUS_24290 4249 4968 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_24290 5095 5664 gene locus_tag LOCUS_24300 5095 5664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 5680 5880 gene locus_tag LOCUS_24310 5680 5880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 5999 8098 gene locus_tag LOCUS_24320 5999 8098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964216.1 protein_id gnl|my_center|LOCUS_24320 8282 9109 gene locus_tag LOCUS_24330 gene cyoE 8282 9109 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964205.1 protein_id gnl|my_center|LOCUS_24330 9112 9693 gene locus_tag LOCUS_24340 9112 9693 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_24340 9831 10811 gene locus_tag LOCUS_24350 9831 10811 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 protein_id gnl|my_center|LOCUS_24350 10833 11213 gene locus_tag LOCUS_24360 10833 11213 CDS product cytochrome C oxidase subunit IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964208.1 protein_id gnl|my_center|LOCUS_24360 11309 12031 gene locus_tag LOCUS_24370 11309 12031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964209.1 protein_id gnl|my_center|LOCUS_24370 12018 12761 gene locus_tag LOCUS_24380 12018 12761 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964210.1 protein_id gnl|my_center|LOCUS_24380 12762 13307 gene locus_tag LOCUS_24390 12762 13307 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_24390 13300 13527 gene locus_tag LOCUS_24400 13300 13527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 13481 14362 gene locus_tag LOCUS_24410 13481 14362 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_24410 14355 15599 gene locus_tag LOCUS_24420 14355 15599 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_24420 15601 16860 gene locus_tag LOCUS_24430 15601 16860 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_24430 >Feature sequence062 722 1951 gene locus_tag LOCUS_24440 gene pepT 722 1951 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964023.1 protein_id gnl|my_center|LOCUS_24440 2050 2481 gene locus_tag LOCUS_24450 2050 2481 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_24450 2563 3291 gene locus_tag LOCUS_24460 2563 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 3304 4323 gene locus_tag LOCUS_24470 gene cysP 3304 4323 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232101.1 protein_id gnl|my_center|LOCUS_24470 4260 4487 gene locus_tag LOCUS_24480 4260 4487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 4484 5080 gene locus_tag LOCUS_24490 4484 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 5419 5129 gene locus_tag LOCUS_24500 gene yajC 5419 5129 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962700.1 protein_id gnl|my_center|LOCUS_24500 5904 5443 gene locus_tag LOCUS_24510 5904 5443 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 protein_id gnl|my_center|LOCUS_24510 6931 5987 gene locus_tag LOCUS_24520 gene nusB 6931 5987 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962698.1 protein_id gnl|my_center|LOCUS_24520 7262 8935 gene locus_tag LOCUS_24530 7262 8935 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_24530 9442 9537 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11263 10352 gene locus_tag LOCUS_24540 11263 10352 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_24540 11605 11270 gene locus_tag LOCUS_24550 11605 11270 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962694.1 protein_id gnl|my_center|LOCUS_24550 11654 12211 gene locus_tag LOCUS_24560 11654 12211 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947316.1 protein_id gnl|my_center|LOCUS_24560 12694 12212 gene locus_tag LOCUS_24570 12694 12212 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586895.1 protein_id gnl|my_center|LOCUS_24570 13249 12704 gene locus_tag LOCUS_24580 gene bstA 13249 12704 CDS product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999077.1 protein_id gnl|my_center|LOCUS_24580 13994 13290 gene locus_tag LOCUS_24590 13994 13290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 13954 14181 gene locus_tag LOCUS_24600 13954 14181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 15032 14100 gene locus_tag LOCUS_24610 15032 14100 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964012.1 protein_id gnl|my_center|LOCUS_24610 15136 15597 gene locus_tag LOCUS_24620 15136 15597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 >Feature sequence063 154 303 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 677 2224 gene locus_tag LOCUS_24630 677 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 5745 2389 gene locus_tag LOCUS_24640 5745 2389 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153439724.1 protein_id gnl|my_center|LOCUS_24640 6000 6305 gene locus_tag LOCUS_24650 6000 6305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 6302 7531 gene locus_tag LOCUS_24660 6302 7531 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_24660 7618 7833 gene locus_tag LOCUS_24670 7618 7833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24670 7846 8007 gene locus_tag LOCUS_24680 7846 8007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 8018 9142 gene locus_tag LOCUS_24690 8018 9142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 9260 9871 gene locus_tag LOCUS_24700 9260 9871 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203248.1 protein_id gnl|my_center|LOCUS_24700 9861 10877 gene locus_tag LOCUS_24710 9861 10877 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203247.1 protein_id gnl|my_center|LOCUS_24710 11052 14288 gene locus_tag LOCUS_24720 11052 14288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 14285 14959 gene locus_tag LOCUS_24730 14285 14959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 15159 15344 gene locus_tag LOCUS_24740 15159 15344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 >Feature sequence064 224 1477 gene locus_tag LOCUS_24750 224 1477 CDS product phage integrase SAM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362019.1 protein_id gnl|my_center|LOCUS_24750 1528 2814 gene locus_tag LOCUS_24760 1528 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 2911 3081 gene locus_tag LOCUS_24770 2911 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 3085 3360 gene locus_tag LOCUS_24780 3085 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 3363 5621 gene locus_tag LOCUS_24790 3363 5621 CDS product DUF3987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107254.1 protein_id gnl|my_center|LOCUS_24790 5678 7528 gene locus_tag LOCUS_24800 5678 7528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 7509 8159 gene locus_tag LOCUS_24810 7509 8159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 8170 10770 gene locus_tag LOCUS_24820 8170 10770 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034260979.1 protein_id gnl|my_center|LOCUS_24820 10773 10979 gene locus_tag LOCUS_24830 10773 10979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 10976 11440 gene locus_tag LOCUS_24840 10976 11440 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173534.1 protein_id gnl|my_center|LOCUS_24840 11694 12173 gene locus_tag LOCUS_24850 11694 12173 CDS product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036432311.1 protein_id gnl|my_center|LOCUS_24850 12177 12692 gene locus_tag LOCUS_24860 12177 12692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 14079 13873 gene locus_tag LOCUS_24870 14079 13873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 14590 14042 gene locus_tag LOCUS_24880 14590 14042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 14684 15175 gene locus_tag LOCUS_24890 14684 15175 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868177.1 protein_id gnl|my_center|LOCUS_24890 >Feature sequence065 <1 1002 gene locus_tag LOCUS_24900 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010956752.1:MMPL family transporter 1021 1755 gene locus_tag LOCUS_24910 1021 1755 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_24910 1765 2610 gene locus_tag LOCUS_24920 1765 2610 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262323.1 protein_id gnl|my_center|LOCUS_24920 2771 3439 gene locus_tag LOCUS_24930 2771 3439 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_24930 3436 4131 gene locus_tag LOCUS_24940 3436 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 4128 4817 gene locus_tag LOCUS_24950 4128 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 4814 6190 gene locus_tag LOCUS_24960 4814 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 6583 7194 gene locus_tag LOCUS_24970 6583 7194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 7684 8283 gene locus_tag LOCUS_24980 7684 8283 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791598.1 protein_id gnl|my_center|LOCUS_24980 8327 8953 gene locus_tag LOCUS_24990 8327 8953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 8925 10238 gene locus_tag LOCUS_25000 8925 10238 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_25000 10252 11307 gene locus_tag LOCUS_25010 10252 11307 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791602.1 protein_id gnl|my_center|LOCUS_25010 11358 14486 gene locus_tag LOCUS_25020 11358 14486 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804147.1 protein_id gnl|my_center|LOCUS_25020 14498 14791 gene locus_tag LOCUS_25030 14498 14791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762066.1 protein_id gnl|my_center|LOCUS_25030 >Feature sequence066 1904 432 gene locus_tag LOCUS_25040 1904 432 CDS product DUF5687 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079703094.1 protein_id gnl|my_center|LOCUS_25040 2373 1972 gene locus_tag LOCUS_25050 2373 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 2499 3557 gene locus_tag LOCUS_25060 2499 3557 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964555.1 protein_id gnl|my_center|LOCUS_25060 4606 3587 gene locus_tag LOCUS_25070 4606 3587 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043924886.1 protein_id gnl|my_center|LOCUS_25070 5250 4645 gene locus_tag LOCUS_25080 5250 4645 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_25080 5323 5982 gene locus_tag LOCUS_25090 gene upp 5323 5982 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_25090 6654 5971 gene locus_tag LOCUS_25100 6654 5971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 6755 6922 gene locus_tag LOCUS_25110 6755 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 7002 7229 gene locus_tag LOCUS_25120 7002 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 8495 7224 gene locus_tag LOCUS_25130 gene purD 8495 7224 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964560.1 protein_id gnl|my_center|LOCUS_25130 8640 9965 gene locus_tag LOCUS_25140 8640 9965 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964561.1 protein_id gnl|my_center|LOCUS_25140 9965 11128 gene locus_tag LOCUS_25150 9965 11128 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107354.1 protein_id gnl|my_center|LOCUS_25150 12480 11125 gene locus_tag LOCUS_25160 12480 11125 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 protein_id gnl|my_center|LOCUS_25160 13468 12482 gene locus_tag LOCUS_25170 13468 12482 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_25170 >Feature sequence067 1083 85 gene locus_tag LOCUS_25180 1083 85 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963908.1 protein_id gnl|my_center|LOCUS_25180 1240 1518 gene locus_tag LOCUS_25190 1240 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963907.1 protein_id gnl|my_center|LOCUS_25190 1549 3984 gene locus_tag LOCUS_25200 1549 3984 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963906.1 protein_id gnl|my_center|LOCUS_25200 3971 5254 gene locus_tag LOCUS_25210 3971 5254 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_25210 5254 6714 gene locus_tag LOCUS_25220 5254 6714 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868291.1 protein_id gnl|my_center|LOCUS_25220 7929 6787 gene locus_tag LOCUS_25230 7929 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 8808 8164 gene locus_tag LOCUS_25240 8808 8164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 8970 10037 gene locus_tag LOCUS_25250 8970 10037 CDS product DUF3667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928862.1 protein_id gnl|my_center|LOCUS_25250 12818 10038 gene locus_tag LOCUS_25260 gene uvrA 12818 10038 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963246.1 protein_id gnl|my_center|LOCUS_25260 13106 13720 gene locus_tag LOCUS_25270 13106 13720 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_25270 >Feature sequence068 <1 942 gene locus_tag LOCUS_25280 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964459.1:TonB-dependent receptor 1417 989 gene locus_tag LOCUS_25290 1417 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 1561 1764 gene locus_tag LOCUS_25300 1561 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 1782 1955 gene locus_tag LOCUS_25310 1782 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 1989 2378 gene locus_tag LOCUS_25320 1989 2378 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964456.1 protein_id gnl|my_center|LOCUS_25320 2583 2368 gene locus_tag LOCUS_25330 2583 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 3295 2585 gene locus_tag LOCUS_25340 3295 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 3634 4503 gene locus_tag LOCUS_25350 3634 4503 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_25350 4539 4916 gene locus_tag LOCUS_25360 4539 4916 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964440.1 protein_id gnl|my_center|LOCUS_25360 5007 5642 gene locus_tag LOCUS_25370 gene aat 5007 5642 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964441.1 protein_id gnl|my_center|LOCUS_25370 6202 5639 gene locus_tag LOCUS_25380 6202 5639 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 protein_id gnl|my_center|LOCUS_25380 6297 6917 gene locus_tag LOCUS_25390 6297 6917 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_25390 7560 6895 gene locus_tag LOCUS_25400 7560 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 8232 7681 gene locus_tag LOCUS_25410 8232 7681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 8970 8275 gene locus_tag LOCUS_25420 gene truB 8970 8275 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964446.1 protein_id gnl|my_center|LOCUS_25420 9782 8970 gene locus_tag LOCUS_25430 9782 8970 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964447.1 protein_id gnl|my_center|LOCUS_25430 10035 9775 gene locus_tag LOCUS_25440 10035 9775 CDS product DUF3098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 protein_id gnl|my_center|LOCUS_25440 11013 10135 gene locus_tag LOCUS_25450 11013 10135 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964449.1 protein_id gnl|my_center|LOCUS_25450 11080 12000 gene locus_tag LOCUS_25460 11080 12000 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259194.1 protein_id gnl|my_center|LOCUS_25460 12569 11997 gene locus_tag LOCUS_25470 12569 11997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 12597 12635 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence069 <1 979 gene locus_tag LOCUS_25480 <1 979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963854.1:effector binding domain-containing protein 1044 1409 gene locus_tag LOCUS_25490 gene crcB 1044 1409 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785744.1 protein_id gnl|my_center|LOCUS_25490 1886 2581 gene locus_tag LOCUS_25500 1886 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 2551 2742 gene locus_tag LOCUS_25510 2551 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 2857 3249 gene locus_tag LOCUS_25520 2857 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 3267 3734 gene locus_tag LOCUS_25530 3267 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 3919 6000 gene locus_tag LOCUS_25540 3919 6000 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303097.1 protein_id gnl|my_center|LOCUS_25540 6670 6065 gene locus_tag LOCUS_25550 6670 6065 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_25550 6941 8146 gene locus_tag LOCUS_25560 6941 8146 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963858.1 protein_id gnl|my_center|LOCUS_25560 8153 9124 gene locus_tag LOCUS_25570 8153 9124 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_25570 9569 9126 gene locus_tag LOCUS_25580 9569 9126 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869023.1 protein_id gnl|my_center|LOCUS_25580 9740 10081 gene locus_tag LOCUS_25590 9740 10081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 10280 10146 gene locus_tag LOCUS_25600 10280 10146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 11304 10708 gene locus_tag LOCUS_25610 11304 10708 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_25610 13877 11391 gene locus_tag LOCUS_25620 13877 11391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 >Feature sequence070 328 2262 gene locus_tag LOCUS_25630 gene thrS 328 2262 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963051.1 protein_id gnl|my_center|LOCUS_25630 2385 2840 gene locus_tag LOCUS_25640 gene infC 2385 2840 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695168.1 protein_id gnl|my_center|LOCUS_25640 2903 3100 gene locus_tag LOCUS_25650 gene rpmI 2903 3100 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963049.1 protein_id gnl|my_center|LOCUS_25650 3195 3539 gene locus_tag LOCUS_25660 gene rplT 3195 3539 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963048.1 protein_id gnl|my_center|LOCUS_25660 3680 4501 gene locus_tag LOCUS_25670 3680 4501 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861671.1 protein_id gnl|my_center|LOCUS_25670 4513 4992 gene locus_tag LOCUS_25680 4513 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 6259 5000 gene locus_tag LOCUS_25690 6259 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_25690 7863 6319 gene locus_tag LOCUS_25700 gene dnaB 7863 6319 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962775.1 protein_id gnl|my_center|LOCUS_25700 8986 8033 gene locus_tag LOCUS_25710 8986 8033 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962774.1 protein_id gnl|my_center|LOCUS_25710 9945 9049 gene locus_tag LOCUS_25720 9945 9049 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_25720 10954 9932 gene locus_tag LOCUS_25730 10954 9932 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962772.1 protein_id gnl|my_center|LOCUS_25730 12147 11011 gene locus_tag LOCUS_25740 gene tgt 12147 11011 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962771.1 protein_id gnl|my_center|LOCUS_25740 >Feature sequence071 1878 505 gene locus_tag LOCUS_25750 1878 505 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250835.1 protein_id gnl|my_center|LOCUS_25750 2638 3213 gene locus_tag LOCUS_25760 2638 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 5734 3302 gene locus_tag LOCUS_25770 gene galB 5734 3302 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202546.1 protein_id gnl|my_center|LOCUS_25770 6889 5747 gene locus_tag LOCUS_25780 6889 5747 CDS product arabinogalactan endo-1,4-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036451.1 protein_id gnl|my_center|LOCUS_25780 6975 7973 gene locus_tag LOCUS_25790 6975 7973 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766583.1 protein_id gnl|my_center|LOCUS_25790 8000 9154 gene locus_tag LOCUS_25800 gene galK 8000 9154 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107224.1 protein_id gnl|my_center|LOCUS_25800 9154 10182 gene locus_tag LOCUS_25810 gene galT 9154 10182 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693184.1 protein_id gnl|my_center|LOCUS_25810 >Feature sequence072 <1 674 gene locus_tag LOCUS_25820 <1 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963836.1:acyl-CoA dehydrogenase family protein 1778 759 gene locus_tag LOCUS_25830 1778 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 2036 3289 gene locus_tag LOCUS_25840 2036 3289 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_25840 2332 2365 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3300 4949 gene locus_tag LOCUS_25850 3300 4949 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093328686.1 protein_id gnl|my_center|LOCUS_25850 4946 5524 gene locus_tag LOCUS_25860 4946 5524 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_25860 6202 5525 gene locus_tag LOCUS_25870 6202 5525 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_25870 6342 8717 gene locus_tag LOCUS_25880 6342 8717 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_25880 8765 8775 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8889 11072 gene locus_tag LOCUS_25890 gene ccoN 8889 11072 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_25890 11092 11283 gene locus_tag LOCUS_25900 11092 11283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 11280 12221 gene locus_tag LOCUS_25910 11280 12221 CDS product cbb3-type cytochrome c oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963296.1 protein_id gnl|my_center|LOCUS_25910 >Feature sequence073 <1 726 gene locus_tag LOCUS_25920 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257880.1:circularly permuted type 2 ATP-grasp protein 745 1671 gene locus_tag LOCUS_25930 745 1671 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257879.1 protein_id gnl|my_center|LOCUS_25930 1680 2636 gene locus_tag LOCUS_25940 1680 2636 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919474.1 protein_id gnl|my_center|LOCUS_25940 2984 5053 gene locus_tag LOCUS_25950 2984 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 6168 5119 gene locus_tag LOCUS_25960 6168 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 7363 6386 gene locus_tag LOCUS_25970 7363 6386 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_25970 8474 7434 gene locus_tag LOCUS_25980 gene rlmN 8474 7434 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964179.1 protein_id gnl|my_center|LOCUS_25980 9611 8562 gene locus_tag LOCUS_25990 gene queA 9611 8562 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962415.1 protein_id gnl|my_center|LOCUS_25990 11006 9792 gene locus_tag LOCUS_26000 11006 9792 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962416.1 protein_id gnl|my_center|LOCUS_26000 11385 11059 gene locus_tag LOCUS_26010 11385 11059 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 protein_id gnl|my_center|LOCUS_26010 >Feature sequence074 <1 1448 gene locus_tag LOCUS_26020 <1 1448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964517.1:glycine--tRNA ligase 2025 1555 gene locus_tag LOCUS_26030 2025 1555 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964461.1 protein_id gnl|my_center|LOCUS_26030 3597 2233 gene locus_tag LOCUS_26040 3597 2233 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_26040 3677 4078 gene locus_tag LOCUS_26050 3677 4078 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 protein_id gnl|my_center|LOCUS_26050 4136 5752 gene locus_tag LOCUS_26060 gene pckA 4136 5752 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392169.1 protein_id gnl|my_center|LOCUS_26060 6559 5810 gene locus_tag LOCUS_26070 6559 5810 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_26070 7228 6584 gene locus_tag LOCUS_26080 7228 6584 CDS product DUF4271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962358.1 protein_id gnl|my_center|LOCUS_26080 7395 7784 gene locus_tag LOCUS_26090 7395 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26090 7700 8149 gene locus_tag LOCUS_26100 7700 8149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26100 8159 9505 gene locus_tag LOCUS_26110 8159 9505 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962341.1 protein_id gnl|my_center|LOCUS_26110 9505 10050 gene locus_tag LOCUS_26120 9505 10050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 11020 10010 gene locus_tag LOCUS_26130 11020 10010 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence075 2527 1133 gene locus_tag LOCUS_26140 2527 1133 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_26140 2835 2527 gene locus_tag LOCUS_26150 2835 2527 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816822.1 protein_id gnl|my_center|LOCUS_26150 3950 2838 gene locus_tag LOCUS_26160 3950 2838 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390032.1 protein_id gnl|my_center|LOCUS_26160 4145 4906 gene locus_tag LOCUS_26170 4145 4906 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_26170 4915 5415 gene locus_tag LOCUS_26180 4915 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963236.1 protein_id gnl|my_center|LOCUS_26180 5783 5412 gene locus_tag LOCUS_26190 5783 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962882.1 protein_id gnl|my_center|LOCUS_26190 6205 5819 gene locus_tag LOCUS_26200 6205 5819 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962997.1 protein_id gnl|my_center|LOCUS_26200 6507 7658 gene locus_tag LOCUS_26210 6507 7658 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 protein_id gnl|my_center|LOCUS_26210 7729 8208 gene locus_tag LOCUS_26220 7729 8208 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962999.1 protein_id gnl|my_center|LOCUS_26220 8389 9840 gene locus_tag LOCUS_26230 8389 9840 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_26230 10810 9845 gene locus_tag LOCUS_26240 10810 9845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 >Feature sequence076 230 907 gene locus_tag LOCUS_26250 230 907 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964515.1 protein_id gnl|my_center|LOCUS_26250 966 2570 gene locus_tag LOCUS_26260 966 2570 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_26260 3336 2557 gene locus_tag LOCUS_26270 3336 2557 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143916869.1 protein_id gnl|my_center|LOCUS_26270 4481 3339 gene locus_tag LOCUS_26280 4481 3339 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_26280 4561 6648 gene locus_tag LOCUS_26290 4561 6648 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962553.1 protein_id gnl|my_center|LOCUS_26290 8330 6651 gene locus_tag LOCUS_26300 8330 6651 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765433.1 protein_id gnl|my_center|LOCUS_26300 9189 8494 gene locus_tag LOCUS_26310 9189 8494 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_26310 9665 9357 gene locus_tag LOCUS_26320 9665 9357 CDS product DUF6370 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962578.1 protein_id gnl|my_center|LOCUS_26320 <12013 9786 gene locus_tag LOCUS_26330 <12013 9786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964452.1:leucine--tRNA ligase >Feature sequence077 1441 8 gene locus_tag LOCUS_26340 gene asnS 1441 8 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964340.1 protein_id gnl|my_center|LOCUS_26340 3816 1543 gene locus_tag LOCUS_26350 3816 1543 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_26350 5270 3999 gene locus_tag LOCUS_26360 5270 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 5887 5330 gene locus_tag LOCUS_26370 gene frr 5887 5330 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962605.1 protein_id gnl|my_center|LOCUS_26370 6639 5932 gene locus_tag LOCUS_26380 gene pyrH 6639 5932 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962604.1 protein_id gnl|my_center|LOCUS_26380 7577 6753 gene locus_tag LOCUS_26390 gene tsf 7577 6753 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962622.1 protein_id gnl|my_center|LOCUS_26390 8474 7671 gene locus_tag LOCUS_26400 gene rpsB 8474 7671 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962623.1 protein_id gnl|my_center|LOCUS_26400 9044 8658 gene locus_tag LOCUS_26410 gene rpsI 9044 8658 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962624.1 protein_id gnl|my_center|LOCUS_26410 9500 9045 gene locus_tag LOCUS_26420 gene rplM 9500 9045 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962625.1 protein_id gnl|my_center|LOCUS_26420 10034 9675 gene locus_tag LOCUS_26430 10034 9675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 10236 10018 gene locus_tag LOCUS_26440 10236 10018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 10740 10249 gene locus_tag LOCUS_26450 10740 10249 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886701.1 protein_id gnl|my_center|LOCUS_26450 11023 10763 gene locus_tag LOCUS_26460 11023 10763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 10970 11926 gene locus_tag LOCUS_26470 10970 11926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 >Feature sequence078 217 441 gene locus_tag LOCUS_26480 217 441 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962269.1 protein_id gnl|my_center|LOCUS_26480 445 2544 gene locus_tag LOCUS_26490 gene feoB 445 2544 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962270.1 protein_id gnl|my_center|LOCUS_26490 2585 2722 gene locus_tag LOCUS_26500 2585 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 3480 2719 gene locus_tag LOCUS_26510 3480 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 4923 3505 gene locus_tag LOCUS_26520 4923 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26520 5697 4933 gene locus_tag LOCUS_26530 5697 4933 CDS product FeoB small GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392919.1 protein_id gnl|my_center|LOCUS_26530 6722 5700 gene locus_tag LOCUS_26540 6722 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 7377 6724 gene locus_tag LOCUS_26550 7377 6724 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_26550 7508 7867 gene locus_tag LOCUS_26560 7508 7867 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361979.1 protein_id gnl|my_center|LOCUS_26560 9191 7878 gene locus_tag LOCUS_26570 9191 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 <11678 9222 gene locus_tag LOCUS_26580 <11678 9222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962369.1:transcription-repair coupling factor >Feature sequence079 1670 411 gene locus_tag LOCUS_26590 1670 411 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_26590 2904 1864 gene locus_tag LOCUS_26600 2904 1864 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098105.1 protein_id gnl|my_center|LOCUS_26600 5047 2987 gene locus_tag LOCUS_26610 5047 2987 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_26610 5130 5453 gene locus_tag LOCUS_26620 5130 5453 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963031.1 protein_id gnl|my_center|LOCUS_26620 6474 5446 gene locus_tag LOCUS_26630 6474 5446 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_26630 6588 7241 gene locus_tag LOCUS_26640 6588 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968783.1 protein_id gnl|my_center|LOCUS_26640 8219 7230 gene locus_tag LOCUS_26650 8219 7230 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582952.1 protein_id gnl|my_center|LOCUS_26650 8277 8397 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9591 8494 gene locus_tag LOCUS_26660 9591 8494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 10875 9748 gene locus_tag LOCUS_26670 10875 9748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 >Feature sequence080 896 1984 gene locus_tag LOCUS_26680 896 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 2691 1939 gene locus_tag LOCUS_26690 2691 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 2769 3692 gene locus_tag LOCUS_26700 2769 3692 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_26700 4571 3726 gene locus_tag LOCUS_26710 4571 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 5361 4573 gene locus_tag LOCUS_26720 5361 4573 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_26720 6114 5452 gene locus_tag LOCUS_26730 6114 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 6882 6130 gene locus_tag LOCUS_26740 6882 6130 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801362.1 protein_id gnl|my_center|LOCUS_26740 7933 6875 gene locus_tag LOCUS_26750 7933 6875 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202154.1 protein_id gnl|my_center|LOCUS_26750 8190 7933 gene locus_tag LOCUS_26760 8190 7933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 9183 8194 gene locus_tag LOCUS_26770 9183 8194 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202790.1 protein_id gnl|my_center|LOCUS_26770 <11489 9313 gene locus_tag LOCUS_26780 <11489 9313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:immunoglobulin domain-containing protein >Feature sequence081 920 1090 gene locus_tag LOCUS_26790 920 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 1968 2065 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2066 2305 gene locus_tag LOCUS_26800 2066 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 2502 2774 gene locus_tag LOCUS_26810 2502 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 2861 3052 gene locus_tag LOCUS_26820 2861 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 3144 3563 gene locus_tag LOCUS_26830 3144 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 3649 4050 gene locus_tag LOCUS_26840 3649 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 4058 4324 gene locus_tag LOCUS_26850 4058 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 4591 4316 gene locus_tag LOCUS_26860 4591 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 4718 5713 gene locus_tag LOCUS_26870 4718 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 5824 5976 gene locus_tag LOCUS_26880 5824 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 6000 6185 gene locus_tag LOCUS_26890 6000 6185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 6260 6535 gene locus_tag LOCUS_26900 6260 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 6678 6986 gene locus_tag LOCUS_26910 6678 6986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 7080 7352 gene locus_tag LOCUS_26920 7080 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 7515 7850 gene locus_tag LOCUS_26930 7515 7850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 7954 8445 gene locus_tag LOCUS_26940 7954 8445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 8516 8731 gene locus_tag LOCUS_26950 8516 8731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 8802 9032 gene locus_tag LOCUS_26960 8802 9032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 9116 9553 gene locus_tag LOCUS_26970 9116 9553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 9717 10160 gene locus_tag LOCUS_26980 9717 10160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 10279 10506 gene locus_tag LOCUS_26990 10279 10506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 10635 10886 gene locus_tag LOCUS_27000 10635 10886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 >Feature sequence082 1299 22 gene locus_tag LOCUS_27010 1299 22 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_27010 1422 2150 gene locus_tag LOCUS_27020 1422 2150 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963478.1 protein_id gnl|my_center|LOCUS_27020 2881 2147 gene locus_tag LOCUS_27030 gene rlmB 2881 2147 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963477.1 protein_id gnl|my_center|LOCUS_27030 3444 2947 gene locus_tag LOCUS_27040 3444 2947 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759578.1 protein_id gnl|my_center|LOCUS_27040 4215 3460 gene locus_tag LOCUS_27050 4215 3460 CDS product DUF5012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108196.1 protein_id gnl|my_center|LOCUS_27050 5694 4231 gene locus_tag LOCUS_27060 5694 4231 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100991023.1 protein_id gnl|my_center|LOCUS_27060 8941 5711 gene locus_tag LOCUS_27070 8941 5711 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759576.1 protein_id gnl|my_center|LOCUS_27070 9382 9062 gene locus_tag LOCUS_27080 9382 9062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 10538 9339 gene locus_tag LOCUS_27090 10538 9339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 >Feature sequence083 337 549 gene locus_tag LOCUS_27100 337 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 616 1155 gene locus_tag LOCUS_27110 616 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27110 1554 2816 gene locus_tag LOCUS_27120 gene rhlE 1554 2816 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704814.1 protein_id gnl|my_center|LOCUS_27120 2822 3046 gene locus_tag LOCUS_27130 2822 3046 CDS product DUF6500 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530530.1 protein_id gnl|my_center|LOCUS_27130 3027 3260 gene locus_tag LOCUS_27140 3027 3260 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_27140 4349 3297 gene locus_tag LOCUS_27150 4349 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 5052 4501 gene locus_tag LOCUS_27160 5052 4501 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807705.1 protein_id gnl|my_center|LOCUS_27160 5160 5858 gene locus_tag LOCUS_27170 gene radC 5160 5858 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_27170 5859 7172 gene locus_tag LOCUS_27180 5859 7172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 7238 7927 gene locus_tag LOCUS_27190 7238 7927 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 protein_id gnl|my_center|LOCUS_27190 7967 8530 gene locus_tag LOCUS_27200 7967 8530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 8629 9939 gene locus_tag LOCUS_27210 8629 9939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 9929 10822 gene locus_tag LOCUS_27220 9929 10822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 >Feature sequence084 <1 828 gene locus_tag LOCUS_27230 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257508.1:glycosyltransferase family 2 protein 837 2705 gene locus_tag LOCUS_27240 gene asnB 837 2705 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808454.1 protein_id gnl|my_center|LOCUS_27240 2772 3596 gene locus_tag LOCUS_27250 2772 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 3603 4790 gene locus_tag LOCUS_27260 3603 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 4938 4780 gene locus_tag LOCUS_27270 4938 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 5928 5704 gene locus_tag LOCUS_27280 5928 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 6000 7385 gene locus_tag LOCUS_27290 6000 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 7385 8311 gene locus_tag LOCUS_27300 7385 8311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 8308 9102 gene locus_tag LOCUS_27310 8308 9102 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963056.1 protein_id gnl|my_center|LOCUS_27310 >Feature sequence085 1625 369 gene locus_tag LOCUS_27320 1625 369 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085672.1 protein_id gnl|my_center|LOCUS_27320 1555 1728 gene locus_tag LOCUS_27330 1555 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 1864 5037 gene locus_tag LOCUS_27340 1864 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 5669 5082 gene locus_tag LOCUS_27350 5669 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 7513 5711 gene locus_tag LOCUS_27360 7513 5711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 7841 8008 gene locus_tag LOCUS_27370 7841 8008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 >Feature sequence086 <1 1383 gene locus_tag LOCUS_27380 <1 1383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964545.1:F0F1 ATP synthase subunit alpha 1450 2310 gene locus_tag LOCUS_27390 gene atpG 1450 2310 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964544.1 protein_id gnl|my_center|LOCUS_27390 2508 2933 gene locus_tag LOCUS_27400 2508 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 2993 4417 gene locus_tag LOCUS_27410 2993 4417 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_27410 4419 4853 gene locus_tag LOCUS_27420 gene dut 4419 4853 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964537.1 protein_id gnl|my_center|LOCUS_27420 4962 5981 gene locus_tag LOCUS_27430 4962 5981 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_27430 6061 7383 gene locus_tag LOCUS_27440 6061 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964529.1 protein_id gnl|my_center|LOCUS_27440 7394 8170 gene locus_tag LOCUS_27450 7394 8170 CDS product DUF4292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964528.1 protein_id gnl|my_center|LOCUS_27450 8170 9396 gene locus_tag LOCUS_27460 8170 9396 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_27460 9909 9397 gene locus_tag LOCUS_27470 9909 9397 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_27470 >Feature sequence087 979 305 gene locus_tag LOCUS_27480 gene rsmI 979 305 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963206.1 protein_id gnl|my_center|LOCUS_27480 1689 979 gene locus_tag LOCUS_27490 1689 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963207.1 protein_id gnl|my_center|LOCUS_27490 1823 2470 gene locus_tag LOCUS_27500 1823 2470 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963208.1 protein_id gnl|my_center|LOCUS_27500 2463 3569 gene locus_tag LOCUS_27510 2463 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 3639 4043 gene locus_tag LOCUS_27520 gene mscL 3639 4043 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027547170.1 protein_id gnl|my_center|LOCUS_27520 4179 5168 gene locus_tag LOCUS_27530 4179 5168 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962688.1 protein_id gnl|my_center|LOCUS_27530 5257 6024 gene locus_tag LOCUS_27540 5257 6024 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203389.1 protein_id gnl|my_center|LOCUS_27540 6256 8328 gene locus_tag LOCUS_27550 6256 8328 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479228.1 protein_id gnl|my_center|LOCUS_27550 8502 9419 gene locus_tag LOCUS_27560 8502 9419 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963622.1 protein_id gnl|my_center|LOCUS_27560 9896 9435 gene locus_tag LOCUS_27570 9896 9435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962689.1 protein_id gnl|my_center|LOCUS_27570 >Feature sequence088 1511 654 gene locus_tag LOCUS_27580 1511 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 1906 1511 gene locus_tag LOCUS_27590 1906 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 2423 2079 gene locus_tag LOCUS_27600 2423 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 3610 3419 gene locus_tag LOCUS_27610 3610 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 3933 3691 gene locus_tag LOCUS_27620 3933 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 4598 3993 gene locus_tag LOCUS_27630 4598 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 5388 4879 gene locus_tag LOCUS_27640 5388 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 6456 5707 gene locus_tag LOCUS_27650 6456 5707 CDS product fibrobacter succinogenes major paralogous domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_27650 6932 6720 gene locus_tag LOCUS_27660 6932 6720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 7529 6945 gene locus_tag LOCUS_27670 7529 6945 CDS product DUF6338 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135907833.1 protein_id gnl|my_center|LOCUS_27670 8416 7691 gene locus_tag LOCUS_27680 8416 7691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 9545 9105 gene locus_tag LOCUS_27690 9545 9105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 >Feature sequence089 592 520 gene locus_tag LOCUS_t00290 592 520 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2720 609 gene locus_tag LOCUS_27700 2720 609 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767003.1 protein_id gnl|my_center|LOCUS_27700 3188 2832 gene locus_tag LOCUS_27710 3188 2832 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962523.1 protein_id gnl|my_center|LOCUS_27710 3268 3726 gene locus_tag LOCUS_27720 3268 3726 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 protein_id gnl|my_center|LOCUS_27720 4152 3709 gene locus_tag LOCUS_27730 4152 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 4151 4444 gene locus_tag LOCUS_27740 4151 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 4516 5655 gene locus_tag LOCUS_27750 4516 5655 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_27750 6496 5666 gene locus_tag LOCUS_27760 6496 5666 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962446.1 protein_id gnl|my_center|LOCUS_27760 6697 8040 gene locus_tag LOCUS_27770 gene gdhA 6697 8040 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_27770 >Feature sequence090 <1 1634 gene locus_tag LOCUS_27780 <1 1634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003022291.1:asparagine synthase (glutamine-hydrolyzing) 1610 2746 gene locus_tag LOCUS_27790 1610 2746 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022292.1 protein_id gnl|my_center|LOCUS_27790 2749 3921 gene locus_tag LOCUS_27800 gene wcaL 2749 3921 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862660.1 protein_id gnl|my_center|LOCUS_27800 3960 5015 gene locus_tag LOCUS_27810 3960 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 5078 6415 gene locus_tag LOCUS_27820 5078 6415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 6405 7511 gene locus_tag LOCUS_27830 6405 7511 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_27830 7529 8650 gene locus_tag LOCUS_27840 7529 8650 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963379.1 protein_id gnl|my_center|LOCUS_27840 >Feature sequence091 1011 1865 gene locus_tag LOCUS_27850 gene purU 1011 1865 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762395.1 protein_id gnl|my_center|LOCUS_27850 1919 2626 gene locus_tag LOCUS_27860 1919 2626 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_27860 2741 2932 gene locus_tag LOCUS_27870 2741 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 3015 3164 gene locus_tag LOCUS_27880 3015 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 3972 3157 gene locus_tag LOCUS_27890 gene pyrF 3972 3157 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_27890 5084 4008 gene locus_tag LOCUS_27900 gene prfA 5084 4008 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964025.1 protein_id gnl|my_center|LOCUS_27900 7820 5265 gene locus_tag LOCUS_27910 7820 5265 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769973.1 protein_id gnl|my_center|LOCUS_27910 8894 8001 gene locus_tag LOCUS_27920 8894 8001 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_27920 >Feature sequence092 816 157 gene locus_tag LOCUS_27930 816 157 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_27930 2730 985 gene locus_tag LOCUS_27940 2730 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 2940 4172 gene locus_tag LOCUS_27950 2940 4172 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_27950 5467 4385 gene locus_tag LOCUS_27960 5467 4385 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764912.1 protein_id gnl|my_center|LOCUS_27960 4423 4430 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5567 6223 gene locus_tag LOCUS_27970 5567 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 7516 6224 gene locus_tag LOCUS_27980 gene brnQ 7516 6224 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948515.1 protein_id gnl|my_center|LOCUS_27980 7549 8322 gene locus_tag LOCUS_27990 7549 8322 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099991.1 protein_id gnl|my_center|LOCUS_27990 8388 8654 gene locus_tag LOCUS_28000 8388 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 8746 8976 gene locus_tag LOCUS_28010 8746 8976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 >Feature sequence093 1098 646 gene locus_tag LOCUS_28020 1098 646 CDS product DUF2231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975779.1 protein_id gnl|my_center|LOCUS_28020 1181 1807 gene locus_tag LOCUS_28030 1181 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962295.1 protein_id gnl|my_center|LOCUS_28030 2233 1820 gene locus_tag LOCUS_28040 2233 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 4019 2295 gene locus_tag LOCUS_28050 4019 2295 CDS product M61 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920396.1 protein_id gnl|my_center|LOCUS_28050 5668 4172 gene locus_tag LOCUS_28060 5668 4172 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208163.1 protein_id gnl|my_center|LOCUS_28060 5748 7586 gene locus_tag LOCUS_28070 5748 7586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 7719 8657 gene locus_tag LOCUS_28080 7719 8657 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774253.1 protein_id gnl|my_center|LOCUS_28080 >Feature sequence094 2 1162 gene locus_tag LOCUS_28090 gene hppD 2 1162 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_28090 1309 2091 gene locus_tag LOCUS_28100 1309 2091 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_28100 2098 3015 gene locus_tag LOCUS_28110 2098 3015 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_28110 2973 4286 gene locus_tag LOCUS_28120 2973 4286 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_28120 4286 5923 gene locus_tag LOCUS_28130 gene pgi 4286 5923 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962324.1 protein_id gnl|my_center|LOCUS_28130 5830 5903 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5938 8571 gene locus_tag LOCUS_28140 5938 8571 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962323.1 protein_id gnl|my_center|LOCUS_28140 >Feature sequence095 523 2583 gene locus_tag LOCUS_28150 gene metG 523 2583 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962236.1 protein_id gnl|my_center|LOCUS_28150 2720 3190 gene locus_tag LOCUS_28160 2720 3190 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963626.1 protein_id gnl|my_center|LOCUS_28160 3196 3900 gene locus_tag LOCUS_28170 3196 3900 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963625.1 protein_id gnl|my_center|LOCUS_28170 3982 6108 gene locus_tag LOCUS_28180 3982 6108 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964572.1 protein_id gnl|my_center|LOCUS_28180 6659 6159 gene locus_tag LOCUS_28190 6659 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 7656 7225 gene locus_tag LOCUS_28200 7656 7225 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962635.1 protein_id gnl|my_center|LOCUS_28200 >Feature sequence096 2442 3986 gene locus_tag LOCUS_28210 2442 3986 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109230.1 protein_id gnl|my_center|LOCUS_28210 5087 4038 gene locus_tag LOCUS_28220 5087 4038 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962448.1 protein_id gnl|my_center|LOCUS_28220 5749 8265 gene locus_tag LOCUS_28230 5749 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 >Feature sequence097 558 588 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 864 917 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1586 1602 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1613 1978 gene locus_tag LOCUS_28240 1613 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 1982 3112 gene locus_tag LOCUS_28250 1982 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 3131 4234 gene locus_tag LOCUS_28260 3131 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 4252 4524 gene locus_tag LOCUS_28270 4252 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 4521 4817 gene locus_tag LOCUS_28280 4521 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 4810 6348 gene locus_tag LOCUS_28290 4810 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 6389 6562 gene locus_tag LOCUS_28300 6389 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 6585 7304 gene locus_tag LOCUS_28310 6585 7304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 7373 7519 gene locus_tag LOCUS_28320 7373 7519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 7497 7742 gene locus_tag LOCUS_28330 7497 7742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 7782 8246 gene locus_tag LOCUS_28340 7782 8246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 >Feature sequence098 119 385 gene locus_tag LOCUS_28350 119 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 376 636 gene locus_tag LOCUS_28360 376 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 618 833 gene locus_tag LOCUS_28370 618 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 1009 1473 gene locus_tag LOCUS_28380 1009 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 1486 2376 gene locus_tag LOCUS_28390 1486 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 2396 3178 gene locus_tag LOCUS_28400 2396 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 3188 3712 gene locus_tag LOCUS_28410 3188 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 3723 4091 gene locus_tag LOCUS_28420 3723 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 4099 5847 gene locus_tag LOCUS_28430 4099 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 5847 6047 gene locus_tag LOCUS_28440 5847 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 6051 6239 gene locus_tag LOCUS_28450 6051 6239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 6236 6532 gene locus_tag LOCUS_28460 6236 6532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 6547 6750 gene locus_tag LOCUS_28470 6547 6750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 6740 6961 gene locus_tag LOCUS_28480 6740 6961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 7029 7241 gene locus_tag LOCUS_28490 7029 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 7274 7543 gene locus_tag LOCUS_28500 7274 7543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 7559 7633 gene locus_tag LOCUS_t00300 7559 7633 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7665 7964 gene locus_tag LOCUS_28510 7665 7964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 >Feature sequence099 930 16 gene locus_tag LOCUS_28520 930 16 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963439.1 protein_id gnl|my_center|LOCUS_28520 2281 995 gene locus_tag LOCUS_28530 2281 995 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963440.1 protein_id gnl|my_center|LOCUS_28530 3783 2455 gene locus_tag LOCUS_28540 3783 2455 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_28540 5267 3975 gene locus_tag LOCUS_28550 gene eno 5267 3975 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963441.1 protein_id gnl|my_center|LOCUS_28550 6522 5416 gene locus_tag LOCUS_28560 gene carA 6522 5416 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963443.1 protein_id gnl|my_center|LOCUS_28560 7422 6679 gene locus_tag LOCUS_28570 7422 6679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 7989 7495 gene locus_tag LOCUS_28580 gene rplQ 7989 7495 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963444.1 protein_id gnl|my_center|LOCUS_28580 >Feature sequence100 64 603 gene locus_tag LOCUS_28590 64 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 853 626 gene locus_tag LOCUS_28600 853 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 1027 958 gene locus_tag LOCUS_t00310 1027 958 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1140 1066 gene locus_tag LOCUS_t00320 1140 1066 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1224 1149 gene locus_tag LOCUS_t00330 1224 1149 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1306 1232 gene locus_tag LOCUS_t00340 1306 1232 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1393 1319 gene locus_tag LOCUS_t00350 1393 1319 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1545 1470 gene locus_tag LOCUS_t00360 1545 1470 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2313 2038 gene locus_tag LOCUS_28610 2313 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 2972 2349 gene locus_tag LOCUS_28620 2972 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 3242 2982 gene locus_tag LOCUS_28630 3242 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 3629 3252 gene locus_tag LOCUS_28640 3629 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 3750 4487 gene locus_tag LOCUS_28650 3750 4487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 4589 4516 gene locus_tag LOCUS_t00370 4589 4516 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4672 4596 gene locus_tag LOCUS_t00380 4672 4596 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4755 4679 gene locus_tag LOCUS_t00390 4755 4679 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 4838 4765 gene locus_tag LOCUS_t00400 4838 4765 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5037 4961 gene locus_tag LOCUS_t00410 5037 4961 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5124 5049 gene locus_tag LOCUS_t00420 5124 5049 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5206 5131 gene locus_tag LOCUS_t00430 5206 5131 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 5287 5214 gene locus_tag LOCUS_t00440 5287 5214 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 5370 5296 gene locus_tag LOCUS_t00450 5370 5296 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5451 5377 gene locus_tag LOCUS_t00460 5451 5377 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 5534 5460 gene locus_tag LOCUS_t00470 5534 5460 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5625 5549 gene locus_tag LOCUS_t00480 5625 5549 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5709 5634 gene locus_tag LOCUS_t00490 5709 5634 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 5796 5720 gene locus_tag LOCUS_t00500 5796 5720 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 6270 6659 gene locus_tag LOCUS_28660 6270 6659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 <7999 6590 gene locus_tag LOCUS_28670 <7999 6590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897221.1:RNA-guided endonuclease TnpB family protein >Feature sequence101 <1 598 gene locus_tag LOCUS_28680 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525382.1:cupin-like domain-containing protein 1082 609 gene locus_tag LOCUS_28690 1082 609 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_28690 1149 5747 gene locus_tag LOCUS_28700 1149 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 <7954 5757 gene locus_tag LOCUS_28710 <7954 5757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140284.1:TonB-dependent receptor >Feature sequence102 134 178 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 995 213 gene locus_tag LOCUS_28720 995 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 2340 1438 gene locus_tag LOCUS_28730 gene ygiD 2340 1438 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184346.1 protein_id gnl|my_center|LOCUS_28730 2788 2357 gene locus_tag LOCUS_28740 2788 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 3326 2841 gene locus_tag LOCUS_28750 3326 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 4742 3645 gene locus_tag LOCUS_28760 4742 3645 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097679.1 protein_id gnl|my_center|LOCUS_28760 5640 4861 gene locus_tag LOCUS_28770 5640 4861 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921905.1 protein_id gnl|my_center|LOCUS_28770 6702 5671 gene locus_tag LOCUS_28780 6702 5671 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142690.1 protein_id gnl|my_center|LOCUS_28780 6850 7194 gene locus_tag LOCUS_28790 6850 7194 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476381.1 protein_id gnl|my_center|LOCUS_28790 >Feature sequence103 701 150 gene locus_tag LOCUS_28800 701 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569938.1 protein_id gnl|my_center|LOCUS_28800 1549 1764 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcggatttgtaatccgtgac 2378 1806 gene locus_tag LOCUS_28810 2378 1806 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_28810 3163 2567 gene locus_tag LOCUS_28820 3163 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 3620 3255 gene locus_tag LOCUS_28830 3620 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 4418 3636 gene locus_tag LOCUS_28840 4418 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 4780 4448 gene locus_tag LOCUS_28850 4780 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 5273 4830 gene locus_tag LOCUS_28860 5273 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 5792 5349 gene locus_tag LOCUS_28870 5792 5349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 6996 5911 gene locus_tag LOCUS_28880 6996 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 7527 7165 gene locus_tag LOCUS_28890 7527 7165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 >Feature sequence104 877 80 gene locus_tag LOCUS_28900 877 80 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102692.1 protein_id gnl|my_center|LOCUS_28900 980 1597 gene locus_tag LOCUS_28910 980 1597 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066656.1 protein_id gnl|my_center|LOCUS_28910 1953 1756 gene locus_tag LOCUS_28920 1953 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 1967 3025 gene locus_tag LOCUS_28930 1967 3025 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_28930 3101 4165 gene locus_tag LOCUS_28940 gene serC 3101 4165 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962801.1 protein_id gnl|my_center|LOCUS_28940 4280 5230 gene locus_tag LOCUS_28950 4280 5230 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 protein_id gnl|my_center|LOCUS_28950 5339 5977 gene locus_tag LOCUS_28960 5339 5977 CDS product DUF937 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962799.1 protein_id gnl|my_center|LOCUS_28960 6101 6538 gene locus_tag LOCUS_28970 6101 6538 CDS product DUF6146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962798.1 protein_id gnl|my_center|LOCUS_28970 6570 7070 gene locus_tag LOCUS_28980 6570 7070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 7070 7402 gene locus_tag LOCUS_28990 7070 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 7532 7290 gene locus_tag LOCUS_29000 7532 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 >Feature sequence105 1833 835 gene locus_tag LOCUS_29010 1833 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 3521 1830 gene locus_tag LOCUS_29020 3521 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 4143 3541 gene locus_tag LOCUS_29030 4143 3541 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963415.1 protein_id gnl|my_center|LOCUS_29030 4847 4164 gene locus_tag LOCUS_29040 4847 4164 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462476.1 protein_id gnl|my_center|LOCUS_29040 5796 4831 gene locus_tag LOCUS_29050 5796 4831 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462477.1 protein_id gnl|my_center|LOCUS_29050 7217 6048 gene locus_tag LOCUS_29060 7217 6048 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014978.1 protein_id gnl|my_center|LOCUS_29060 >Feature sequence106 713 285 gene locus_tag LOCUS_29070 gene tsaE 713 285 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 protein_id gnl|my_center|LOCUS_29070 2362 809 gene locus_tag LOCUS_29080 2362 809 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_29080 2479 3699 gene locus_tag LOCUS_29090 2479 3699 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_29090 3752 4780 gene locus_tag LOCUS_29100 gene lpxD 3752 4780 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963125.1 protein_id gnl|my_center|LOCUS_29100 4767 6173 gene locus_tag LOCUS_29110 4767 6173 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963124.1 protein_id gnl|my_center|LOCUS_29110 6177 6962 gene locus_tag LOCUS_29120 gene lpxA 6177 6962 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_29120 >Feature sequence107 741 1049 gene locus_tag LOCUS_29130 741 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 1587 2723 gene locus_tag LOCUS_29140 1587 2723 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080474.1 protein_id gnl|my_center|LOCUS_29140 2857 3966 gene locus_tag LOCUS_29150 2857 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 4006 4479 gene locus_tag LOCUS_29160 4006 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 4533 5525 gene locus_tag LOCUS_29170 4533 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 5583 6053 gene locus_tag LOCUS_29180 5583 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 6516 6923 gene locus_tag LOCUS_29190 6516 6923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 6939 7235 gene locus_tag LOCUS_29200 6939 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 >Feature sequence108 4000 899 gene locus_tag LOCUS_29210 4000 899 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141537.1 protein_id gnl|my_center|LOCUS_29210 4644 4015 gene locus_tag LOCUS_29220 4644 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29220 5254 4676 gene locus_tag LOCUS_29230 5254 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29230 6798 5251 gene locus_tag LOCUS_29240 6798 5251 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199604.1 protein_id gnl|my_center|LOCUS_29240 >Feature sequence109 1104 2141 gene locus_tag LOCUS_29250 gene lpxK 1104 2141 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963591.1 protein_id gnl|my_center|LOCUS_29250 4359 2131 gene locus_tag LOCUS_29260 4359 2131 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963589.1 protein_id gnl|my_center|LOCUS_29260 5403 4387 gene locus_tag LOCUS_29270 gene gap 5403 4387 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963588.1 protein_id gnl|my_center|LOCUS_29270 6284 5406 gene locus_tag LOCUS_29280 gene lipA 6284 5406 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963587.1 protein_id gnl|my_center|LOCUS_29280 <7176 6334 gene locus_tag LOCUS_29290 <7176 6334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263870.1:divalent metal cation transporter >Feature sequence110 459 265 gene locus_tag LOCUS_29300 459 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 359 1597 gene locus_tag LOCUS_29310 359 1597 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_29310 2065 1598 gene locus_tag LOCUS_29320 2065 1598 CDS product DUF6495 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963953.1 protein_id gnl|my_center|LOCUS_29320 5248 2123 gene locus_tag LOCUS_29330 5248 2123 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_29330 5812 5366 gene locus_tag LOCUS_29340 gene rplI 5812 5366 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963954.1 protein_id gnl|my_center|LOCUS_29340 6116 5826 gene locus_tag LOCUS_29350 gene rpsR 6116 5826 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963955.1 protein_id gnl|my_center|LOCUS_29350 6457 6119 gene locus_tag LOCUS_29360 gene rpsF 6457 6119 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963956.1 protein_id gnl|my_center|LOCUS_29360 >Feature sequence111 131 3604 gene locus_tag LOCUS_29370 131 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 >Feature sequence112 1338 661 gene locus_tag LOCUS_29380 1338 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 2080 1331 gene locus_tag LOCUS_29390 2080 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 2680 2165 gene locus_tag LOCUS_29400 2680 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 3440 2820 gene locus_tag LOCUS_29410 3440 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 4140 3442 gene locus_tag LOCUS_29420 4140 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 4867 4142 gene locus_tag LOCUS_29430 4867 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 5744 4986 gene locus_tag LOCUS_29440 5744 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 6510 5773 gene locus_tag LOCUS_29450 6510 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 >Feature sequence113 687 367 gene locus_tag LOCUS_29460 687 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 1180 722 gene locus_tag LOCUS_29470 1180 722 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995946.1 protein_id gnl|my_center|LOCUS_29470 1746 1177 gene locus_tag LOCUS_29480 1746 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 3478 2333 gene locus_tag LOCUS_29490 3478 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 4031 4744 gene locus_tag LOCUS_29500 4031 4744 CDS product SprT-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005842205.1 protein_id gnl|my_center|LOCUS_29500 5160 4750 gene locus_tag LOCUS_29510 5160 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 5392 5153 gene locus_tag LOCUS_29520 5392 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 5733 5398 gene locus_tag LOCUS_29530 5733 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 6028 5759 gene locus_tag LOCUS_29540 6028 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 6322 6065 gene locus_tag LOCUS_29550 6322 6065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 6636 6325 gene locus_tag LOCUS_29560 6636 6325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 >Feature sequence114 75 1055 gene locus_tag LOCUS_29570 75 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 1787 3046 gene locus_tag LOCUS_29580 1787 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 3006 3203 gene locus_tag LOCUS_29590 3006 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 3205 3498 gene locus_tag LOCUS_29600 3205 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 3672 3857 gene locus_tag LOCUS_29610 3672 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 4088 5344 gene locus_tag LOCUS_29620 4088 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 5621 5439 gene locus_tag LOCUS_29630 5621 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 >Feature sequence115 443 685 gene locus_tag LOCUS_29640 443 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29640 685 1302 gene locus_tag LOCUS_29650 685 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29650 1316 1696 gene locus_tag LOCUS_29660 1316 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29660 1698 2522 gene locus_tag LOCUS_29670 1698 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29670 2566 2946 gene locus_tag LOCUS_29680 2566 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29680 3921 2962 gene locus_tag LOCUS_29690 3921 2962 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_29690 4251 3964 gene locus_tag LOCUS_29700 4251 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 4390 4232 gene locus_tag LOCUS_29710 4390 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 4655 4769 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4788 5228 gene locus_tag LOCUS_29720 4788 5228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 6329 5229 gene locus_tag LOCUS_29730 6329 5229 CDS product DUF4407 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 protein_id gnl|my_center|LOCUS_29730 >Feature sequence116 323 964 gene locus_tag LOCUS_29740 gene gldL 323 964 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_29740 1019 2578 gene locus_tag LOCUS_29750 gene gldM 1019 2578 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_29750 2708 3598 gene locus_tag LOCUS_29760 gene gldN 2708 3598 CDS product gliding motility protein GldN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_29760 3698 4738 gene locus_tag LOCUS_29770 3698 4738 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_29770 5122 4739 gene locus_tag LOCUS_29780 5122 4739 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 protein_id gnl|my_center|LOCUS_29780 >Feature sequence117 55 840 gene locus_tag LOCUS_29790 55 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 1636 1190 gene locus_tag LOCUS_29800 1636 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 2545 1640 gene locus_tag LOCUS_29810 2545 1640 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_29810 3357 2677 gene locus_tag LOCUS_29820 gene mnmD 3357 2677 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963850.1 protein_id gnl|my_center|LOCUS_29820 3842 3375 gene locus_tag LOCUS_29830 3842 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 3971 5038 gene locus_tag LOCUS_29840 3971 5038 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963851.1 protein_id gnl|my_center|LOCUS_29840 5579 5193 gene locus_tag LOCUS_29850 5579 5193 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_29850 <6616 6059 gene locus_tag LOCUS_29860 <6616 6059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769535.1:dihydrofolate reductase >Feature sequence118 1611 751 gene locus_tag LOCUS_29870 gene nadC 1611 751 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963961.1 protein_id gnl|my_center|LOCUS_29870 1737 2108 gene locus_tag LOCUS_29880 gene rlmH 1737 2108 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963965.1 protein_id gnl|my_center|LOCUS_29880 1787 1799 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4485 2266 gene locus_tag LOCUS_29890 4485 2266 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_29890 4623 5195 gene locus_tag LOCUS_29900 4623 5195 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963926.1 protein_id gnl|my_center|LOCUS_29900 >Feature sequence119 3001 407 gene locus_tag LOCUS_29910 3001 407 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034260979.1 protein_id gnl|my_center|LOCUS_29910 4798 3005 gene locus_tag LOCUS_29920 4798 3005 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201781412.1 protein_id gnl|my_center|LOCUS_29920 5897 4821 gene locus_tag LOCUS_29930 5897 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 >Feature sequence120 491 1165 gene locus_tag LOCUS_29940 gene trmB 491 1165 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962539.1 protein_id gnl|my_center|LOCUS_29940 1243 1797 gene locus_tag LOCUS_29950 1243 1797 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962540.1 protein_id gnl|my_center|LOCUS_29950 1801 2130 gene locus_tag LOCUS_29960 1801 2130 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_29960 2441 3577 gene locus_tag LOCUS_29970 2441 3577 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963780.1 protein_id gnl|my_center|LOCUS_29970 3581 3820 gene locus_tag LOCUS_29980 3581 3820 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963781.1 protein_id gnl|my_center|LOCUS_29980 4271 3897 gene locus_tag LOCUS_29990 4271 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 <6373 4391 gene locus_tag LOCUS_30000 <6373 4391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870177.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence121 430 2994 gene locus_tag LOCUS_30010 430 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 protein_id gnl|my_center|LOCUS_30010 3006 3425 gene locus_tag LOCUS_30020 3006 3425 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964553.1 protein_id gnl|my_center|LOCUS_30020 3385 3615 gene locus_tag LOCUS_30030 3385 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 3615 4001 gene locus_tag LOCUS_30040 3615 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 4118 5221 gene locus_tag LOCUS_30050 gene atpB 4118 5221 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964549.1 protein_id gnl|my_center|LOCUS_30050 5256 5450 gene locus_tag LOCUS_30060 gene atpE 5256 5450 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964548.1 protein_id gnl|my_center|LOCUS_30060 5531 6031 gene locus_tag LOCUS_30070 5531 6031 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964547.1 protein_id gnl|my_center|LOCUS_30070 >Feature sequence122 151 414 gene locus_tag LOCUS_30080 151 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 417 728 gene locus_tag LOCUS_30090 417 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 725 1048 gene locus_tag LOCUS_30100 725 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 1096 1908 gene locus_tag LOCUS_30110 1096 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 1905 2267 gene locus_tag LOCUS_30120 1905 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 2255 3064 gene locus_tag LOCUS_30130 2255 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 3061 3525 gene locus_tag LOCUS_30140 3061 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 3500 3802 gene locus_tag LOCUS_30150 3500 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 3799 4146 gene locus_tag LOCUS_30160 3799 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 4151 4429 gene locus_tag LOCUS_30170 4151 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 4439 4741 gene locus_tag LOCUS_30180 4439 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659529.1 protein_id gnl|my_center|LOCUS_30180 4744 5067 gene locus_tag LOCUS_30190 4744 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 >Feature sequence123 560 1045 gene locus_tag LOCUS_30200 gene sixA 560 1045 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_30200 1144 3207 gene locus_tag LOCUS_30210 gene ppk1 1144 3207 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963117.1 protein_id gnl|my_center|LOCUS_30210 3209 4114 gene locus_tag LOCUS_30220 3209 4114 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_30220 4213 4740 gene locus_tag LOCUS_30230 4213 4740 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_30230 5318 4737 gene locus_tag LOCUS_30240 5318 4737 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_30240 5892 5320 gene locus_tag LOCUS_30250 5892 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 >Feature sequence124 516 124 gene locus_tag LOCUS_30260 516 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 2480 522 gene locus_tag LOCUS_30270 2480 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 4339 2483 gene locus_tag LOCUS_30280 4339 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443144.1 protein_id gnl|my_center|LOCUS_30280 5657 4332 gene locus_tag LOCUS_30290 5657 4332 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199244775.1 protein_id gnl|my_center|LOCUS_30290 5862 6065 gene locus_tag LOCUS_30300 5862 6065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 >Feature sequence125 956 516 gene locus_tag LOCUS_30310 956 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 1725 1516 gene locus_tag LOCUS_30320 1725 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 2007 1801 gene locus_tag LOCUS_30330 2007 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 2343 2098 gene locus_tag LOCUS_30340 2343 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 2603 2343 gene locus_tag LOCUS_30350 2603 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 2995 2600 gene locus_tag LOCUS_30360 2995 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 3258 3022 gene locus_tag LOCUS_30370 3258 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 3687 3295 gene locus_tag LOCUS_30380 3687 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 3933 3715 gene locus_tag LOCUS_30390 3933 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 4231 3977 gene locus_tag LOCUS_30400 4231 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 4498 4262 gene locus_tag LOCUS_30410 4498 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 4628 4849 gene locus_tag LOCUS_30420 4628 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 5571 4864 gene locus_tag LOCUS_30430 5571 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 6139 5612 gene locus_tag LOCUS_30440 6139 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 >Feature sequence126 1845 934 gene locus_tag LOCUS_30450 1845 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30450 2112 3077 gene locus_tag LOCUS_30460 2112 3077 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099197.1 protein_id gnl|my_center|LOCUS_30460 3077 3898 gene locus_tag LOCUS_30470 gene tatC 3077 3898 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963367.1 protein_id gnl|my_center|LOCUS_30470 3891 4247 gene locus_tag LOCUS_30480 3891 4247 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963368.1 protein_id gnl|my_center|LOCUS_30480 4307 5047 gene locus_tag LOCUS_30490 gene lptB 4307 5047 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_30490 5923 5051 gene locus_tag LOCUS_30500 5923 5051 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263160.1 protein_id gnl|my_center|LOCUS_30500 >Feature sequence127 449 21 gene locus_tag LOCUS_30510 449 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 1309 767 gene locus_tag LOCUS_30520 1309 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 2285 1572 gene locus_tag LOCUS_30530 2285 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 2948 2442 gene locus_tag LOCUS_30540 2948 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 4579 3692 gene locus_tag LOCUS_30550 4579 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 5265 4792 gene locus_tag LOCUS_30560 5265 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 6096 5476 gene locus_tag LOCUS_30570 6096 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 >Feature sequence128 36 392 gene locus_tag LOCUS_30580 gene rplR 36 392 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963454.1 protein_id gnl|my_center|LOCUS_30580 399 923 gene locus_tag LOCUS_30590 gene rpsE 399 923 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963453.1 protein_id gnl|my_center|LOCUS_30590 935 1117 gene locus_tag LOCUS_30600 gene rpmD 935 1117 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963452.1 protein_id gnl|my_center|LOCUS_30600 1132 1584 gene locus_tag LOCUS_30610 gene rplO 1132 1584 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963451.1 protein_id gnl|my_center|LOCUS_30610 1600 2946 gene locus_tag LOCUS_30620 gene secY 1600 2946 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963450.1 protein_id gnl|my_center|LOCUS_30620 2951 3166 gene locus_tag LOCUS_30630 gene infA 2951 3166 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963449.1 protein_id gnl|my_center|LOCUS_30630 3341 3715 gene locus_tag LOCUS_30640 gene rpsM 3341 3715 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963448.1 protein_id gnl|my_center|LOCUS_30640 3727 4110 gene locus_tag LOCUS_30650 gene rpsK 3727 4110 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963447.1 protein_id gnl|my_center|LOCUS_30650 4233 4838 gene locus_tag LOCUS_30660 gene rpsD 4233 4838 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963446.1 protein_id gnl|my_center|LOCUS_30660 4976 5929 gene locus_tag LOCUS_30670 4976 5929 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963445.1 protein_id gnl|my_center|LOCUS_30670 >Feature sequence129 877 467 gene locus_tag LOCUS_30680 877 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 3036 1039 gene locus_tag LOCUS_30690 3036 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 3540 3328 gene locus_tag LOCUS_30700 3540 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 3773 3537 gene locus_tag LOCUS_30710 3773 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30710 5208 3766 gene locus_tag LOCUS_30720 5208 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 6008 5346 gene locus_tag LOCUS_30730 6008 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 >Feature sequence130 89 715 gene locus_tag LOCUS_30740 89 715 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962365.1 protein_id gnl|my_center|LOCUS_30740 716 1447 gene locus_tag LOCUS_30750 716 1447 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_30750 1447 1707 gene locus_tag LOCUS_30760 1447 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 1667 2323 gene locus_tag LOCUS_30770 gene pnuC 1667 2323 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_30770 2284 2853 gene locus_tag LOCUS_30780 2284 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30780 2850 4406 gene locus_tag LOCUS_30790 2850 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30790 4403 4810 gene locus_tag LOCUS_30800 gene arfB 4403 4810 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_30800 >Feature sequence131 109 579 gene locus_tag LOCUS_30810 109 579 CDS product thioredoxin fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 protein_id gnl|my_center|LOCUS_30810 1868 1020 gene locus_tag LOCUS_30820 1868 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 3327 1873 gene locus_tag LOCUS_30830 3327 1873 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771063.1 protein_id gnl|my_center|LOCUS_30830 4409 3327 gene locus_tag LOCUS_30840 4409 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 4788 4390 gene locus_tag LOCUS_30850 4788 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 5658 5239 gene locus_tag LOCUS_30860 5658 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 >Feature sequence132 1847 1209 gene locus_tag LOCUS_30870 1847 1209 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262987.1 protein_id gnl|my_center|LOCUS_30870 2520 1876 gene locus_tag LOCUS_30880 2520 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 3396 2530 gene locus_tag LOCUS_30890 3396 2530 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528293.1 protein_id gnl|my_center|LOCUS_30890 5119 3587 gene locus_tag LOCUS_30900 gene htpG 5119 3587 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963627.1 protein_id gnl|my_center|LOCUS_30900 5073 5109 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence133 557 757 gene locus_tag LOCUS_30910 557 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 754 3132 gene locus_tag LOCUS_30920 754 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 3136 4434 gene locus_tag LOCUS_30930 3136 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 4361 4651 gene locus_tag LOCUS_30940 4361 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 4645 4875 gene locus_tag LOCUS_30950 4645 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 5001 5345 gene locus_tag LOCUS_30960 5001 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 5380 5529 gene locus_tag LOCUS_30970 5380 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 5526 5759 gene locus_tag LOCUS_30980 5526 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 >Feature sequence134 150 154 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3580 167 gene locus_tag LOCUS_30990 3580 167 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30990 4634 3828 gene locus_tag LOCUS_31000 4634 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 5280 4729 gene locus_tag LOCUS_31010 5280 4729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 >Feature sequence135 <1 3687 gene locus_tag LOCUS_31020 <1 3687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_150939794.1:T9SS type A sorting domain-containing protein 3868 4665 gene locus_tag LOCUS_31030 3868 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 <5690 4719 gene locus_tag LOCUS_31040 <5690 4719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964121.1:histidine--tRNA ligase >Feature sequence136 749 1114 gene locus_tag LOCUS_31050 749 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 1309 1103 gene locus_tag LOCUS_31060 1309 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 2776 1361 gene locus_tag LOCUS_31070 2776 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 3627 2797 gene locus_tag LOCUS_31080 3627 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 4344 4718 gene locus_tag LOCUS_31090 4344 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 4715 5314 gene locus_tag LOCUS_31100 4715 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 >Feature sequence137 1878 1219 gene locus_tag LOCUS_31110 1878 1219 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962231.1 protein_id gnl|my_center|LOCUS_31110 2930 1938 gene locus_tag LOCUS_31120 2930 1938 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962232.1 protein_id gnl|my_center|LOCUS_31120 3677 2940 gene locus_tag LOCUS_31130 3677 2940 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962233.1 protein_id gnl|my_center|LOCUS_31130 4049 3699 gene locus_tag LOCUS_31140 4049 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 4610 4200 gene locus_tag LOCUS_31150 4610 4200 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_31150 4775 5563 gene locus_tag LOCUS_31160 4775 5563 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 protein_id gnl|my_center|LOCUS_31160 >Feature sequence138 1051 545 gene locus_tag LOCUS_31170 1051 545 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964083.1 protein_id gnl|my_center|LOCUS_31170 2369 1107 gene locus_tag LOCUS_31180 2369 1107 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 protein_id gnl|my_center|LOCUS_31180 3817 2372 gene locus_tag LOCUS_31190 gene miaB 3817 2372 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964081.1 protein_id gnl|my_center|LOCUS_31190 3922 4737 gene locus_tag LOCUS_31200 3922 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 >Feature sequence139 1330 1485 gene locus_tag LOCUS_31210 1330 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 1767 1513 gene locus_tag LOCUS_31220 1767 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 2125 1835 gene locus_tag LOCUS_31230 2125 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 3076 2165 gene locus_tag LOCUS_31240 3076 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 3790 3158 gene locus_tag LOCUS_31250 3790 3158 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220465.1 protein_id gnl|my_center|LOCUS_31250 4048 5304 gene locus_tag LOCUS_31260 gene opdQ 4048 5304 CDS product porin OpdQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091257.1 protein_id gnl|my_center|LOCUS_31260 >Feature sequence140 1325 2188 gene locus_tag LOCUS_31270 1325 2188 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_31270 2293 3471 gene locus_tag LOCUS_31280 2293 3471 CDS product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930692.1 protein_id gnl|my_center|LOCUS_31280 3571 4098 gene locus_tag LOCUS_31290 3571 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 4099 4590 gene locus_tag LOCUS_31300 4099 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 >Feature sequence141 1275 715 gene locus_tag LOCUS_31310 1275 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 2140 1412 gene locus_tag LOCUS_31320 2140 1412 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019891.1 protein_id gnl|my_center|LOCUS_31320 3475 2240 gene locus_tag LOCUS_31330 gene glpK 3475 2240 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556718.1 protein_id gnl|my_center|LOCUS_31330 2289 2306 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5086 3524 gene locus_tag LOCUS_31340 5086 3524 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_31340 >Feature sequence142 2743 557 gene locus_tag LOCUS_31350 2743 557 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_31350 3017 4042 gene locus_tag LOCUS_31360 3017 4042 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922049.1 protein_id gnl|my_center|LOCUS_31360 4953 4123 gene locus_tag LOCUS_31370 4953 4123 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261186.1 protein_id gnl|my_center|LOCUS_31370 4844 5152 gene locus_tag LOCUS_31380 4844 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 >Feature sequence143 1023 1265 gene locus_tag LOCUS_31390 1023 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 1361 5110 gene locus_tag LOCUS_31400 1361 5110 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864285.1 protein_id gnl|my_center|LOCUS_31400 >Feature sequence144 1137 109 gene locus_tag LOCUS_31410 1137 109 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782642.1 protein_id gnl|my_center|LOCUS_31410 2457 1240 gene locus_tag LOCUS_31420 gene hemA 2457 1240 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933093.1 protein_id gnl|my_center|LOCUS_31420 2993 3445 gene locus_tag LOCUS_31430 2993 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 3427 4206 gene locus_tag LOCUS_31440 3427 4206 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940747.1 protein_id gnl|my_center|LOCUS_31440 >Feature sequence145 <1 832 gene locus_tag LOCUS_31450 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963296.1:cbb3-type cytochrome c oxidase N-terminal domain-containing protein 907 2331 gene locus_tag LOCUS_31460 gene ccoG 907 2331 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_31460 2345 2791 gene locus_tag LOCUS_31470 2345 2791 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963298.1 protein_id gnl|my_center|LOCUS_31470 2794 3495 gene locus_tag LOCUS_31480 2794 3495 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_31480 3652 4065 gene locus_tag LOCUS_31490 3652 4065 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089002.1 protein_id gnl|my_center|LOCUS_31490 <5176 4145 gene locus_tag LOCUS_31500 <5176 4145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963301.1:oxygen-independent coproporphyrinogen III oxidase >Feature sequence146 1404 2507 gene locus_tag LOCUS_31510 gene dprA 1404 2507 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_31510 3637 2669 gene locus_tag LOCUS_31520 gene trpS 3637 2669 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_31520 3828 4487 gene locus_tag LOCUS_31530 3828 4487 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_31530 >Feature sequence147 684 1781 gene locus_tag LOCUS_31540 684 1781 CDS product PorV/PorQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099202.1 protein_id gnl|my_center|LOCUS_31540 1795 2982 gene locus_tag LOCUS_31550 1795 2982 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764530.1 protein_id gnl|my_center|LOCUS_31550 4403 3012 gene locus_tag LOCUS_31560 4403 3012 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963376.1 protein_id gnl|my_center|LOCUS_31560 <4980 4465 gene locus_tag LOCUS_31570 <4980 4465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228090.1:glycosyltransferase family 4 protein >Feature sequence148 4034 39 gene locus_tag LOCUS_31580 4034 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 <4877 4205 gene locus_tag LOCUS_31590 <4877 4205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785160.1:flotillin family protein >Feature sequence149 922 368 gene locus_tag LOCUS_31600 gene ruvC 922 368 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962385.1 protein_id gnl|my_center|LOCUS_31600 1028 1990 gene locus_tag LOCUS_31610 1028 1990 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962386.1 protein_id gnl|my_center|LOCUS_31610 1987 3117 gene locus_tag LOCUS_31620 1987 3117 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_31620 3171 4040 gene locus_tag LOCUS_31630 3171 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 4480 4043 gene locus_tag LOCUS_31640 4480 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962388.1 protein_id gnl|my_center|LOCUS_31640 >Feature sequence150 2473 395 gene locus_tag LOCUS_31650 2473 395 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_31650 4066 2729 gene locus_tag LOCUS_31660 gene gdhA 4066 2729 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_31660 <4837 4247 gene locus_tag LOCUS_31670 <4837 4247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790471.1:PEP/pyruvate-binding domain-containing protein >Feature sequence151 3217 272 gene locus_tag LOCUS_31680 3217 272 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_31680 3502 4575 gene locus_tag LOCUS_31690 3502 4575 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_31690 >Feature sequence152 1273 230 gene locus_tag LOCUS_31700 1273 230 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_31700 <4805 1485 gene locus_tag LOCUS_31710 <4805 1485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_150939794.1:T9SS type A sorting domain-containing protein >Feature sequence153 <1 728 gene locus_tag LOCUS_31720 <1 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962398.1:excinuclease ABC subunit UvrC 725 2953 gene locus_tag LOCUS_31730 725 2953 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962399.1 protein_id gnl|my_center|LOCUS_31730 3133 4179 gene locus_tag LOCUS_31740 3133 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 >Feature sequence154 93 461 gene locus_tag LOCUS_31750 93 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 478 1350 gene locus_tag LOCUS_31760 478 1350 CDS product DUF5777 family beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_31760 1368 1637 gene locus_tag LOCUS_31770 1368 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 1660 2637 gene locus_tag LOCUS_31780 1660 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 2634 3944 gene locus_tag LOCUS_31790 gene nrfD 2634 3944 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063680.1 protein_id gnl|my_center|LOCUS_31790 >Feature sequence155 2039 1818 gene locus_tag LOCUS_31800 2039 1818 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962743.1 protein_id gnl|my_center|LOCUS_31800 2844 2272 gene locus_tag LOCUS_31810 2844 2272 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_31810 3654 2968 gene locus_tag LOCUS_31820 3654 2968 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_31820 4470 3697 gene locus_tag LOCUS_31830 4470 3697 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100725.1 protein_id gnl|my_center|LOCUS_31830 >Feature sequence156 823 98 gene locus_tag LOCUS_31840 823 98 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868122.1 protein_id gnl|my_center|LOCUS_31840 1489 911 gene locus_tag LOCUS_31850 1489 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 1848 1471 gene locus_tag LOCUS_31860 1848 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 2493 2059 gene locus_tag LOCUS_31870 2493 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 2792 2541 gene locus_tag LOCUS_31880 2792 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 >Feature sequence157 84 1130 gene locus_tag LOCUS_31890 84 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 1290 1150 gene locus_tag LOCUS_31900 1290 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 1529 2641 gene locus_tag LOCUS_31910 1529 2641 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249414.1 protein_id gnl|my_center|LOCUS_31910 2850 3452 gene locus_tag LOCUS_31920 2850 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 3453 4292 gene locus_tag LOCUS_31930 3453 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 >Feature sequence158 430 137 gene locus_tag LOCUS_31940 430 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 716 423 gene locus_tag LOCUS_31950 716 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 1856 1341 gene locus_tag LOCUS_31960 1856 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 2773 1862 gene locus_tag LOCUS_31970 2773 1862 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138475095.1 protein_id gnl|my_center|LOCUS_31970 3442 2777 gene locus_tag LOCUS_31980 3442 2777 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965313.1 protein_id gnl|my_center|LOCUS_31980 4402 3452 gene locus_tag LOCUS_31990 4402 3452 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120056.1 protein_id gnl|my_center|LOCUS_31990 >Feature sequence159 925 2526 gene locus_tag LOCUS_32000 925 2526 CDS product type IV secretion system DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051907092.1 protein_id gnl|my_center|LOCUS_32000 2531 3373 gene locus_tag LOCUS_32010 2531 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 3842 3618 gene locus_tag LOCUS_32020 3842 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 4309 3848 gene locus_tag LOCUS_32030 4309 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 >Feature sequence160 876 22 gene locus_tag LOCUS_32040 876 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 2832 877 gene locus_tag LOCUS_32050 2832 877 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_32050 2957 3193 gene locus_tag LOCUS_32060 2957 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963364.1 protein_id gnl|my_center|LOCUS_32060 3208 3744 gene locus_tag LOCUS_32070 3208 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 <4483 3884 gene locus_tag LOCUS_32080 <4483 3884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963927.1:IMP dehydrogenase >Feature sequence161 1770 298 gene locus_tag LOCUS_32090 1770 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 3941 1758 gene locus_tag LOCUS_32100 3941 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 4186 3938 gene locus_tag LOCUS_32110 4186 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 >Feature sequence162 <1 591 gene locus_tag LOCUS_32120 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108592.1:TonB-dependent receptor 598 2142 gene locus_tag LOCUS_32130 598 2142 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_32130 2802 2879 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2976 3143 gene locus_tag LOCUS_32140 2976 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 3221 4069 gene locus_tag LOCUS_32150 3221 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 >Feature sequence163 <1 870 gene locus_tag LOCUS_32160 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013087339.1:conjugal transfer protein TraN 882 3011 gene locus_tag LOCUS_32170 882 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 3149 3922 gene locus_tag LOCUS_32180 3149 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 >Feature sequence164 1683 703 gene locus_tag LOCUS_32190 1683 703 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097278.1 protein_id gnl|my_center|LOCUS_32190 3558 1810 gene locus_tag LOCUS_32200 3558 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 >Feature sequence165 3080 2778 gene locus_tag LOCUS_32210 3080 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 3366 3064 gene locus_tag LOCUS_32220 3366 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 3687 3747 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence166 684 286 gene locus_tag LOCUS_32230 684 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 1600 704 gene locus_tag LOCUS_32240 1600 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 2943 1606 gene locus_tag LOCUS_32250 gene nrfD 2943 1606 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228899.1 protein_id gnl|my_center|LOCUS_32250 <3909 2962 gene locus_tag LOCUS_32260 <3909 2962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_202320694.1:4Fe-4S dicluster domain-containing protein >Feature sequence167 433 179 gene locus_tag LOCUS_32270 433 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962210.1 protein_id gnl|my_center|LOCUS_32270 3593 426 gene locus_tag LOCUS_32280 3593 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 >Feature sequence168 72 317 gene locus_tag LOCUS_32290 72 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 483 875 gene locus_tag LOCUS_32300 483 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 878 2140 gene locus_tag LOCUS_32310 878 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 2146 3057 gene locus_tag LOCUS_32320 2146 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 3070 3447 gene locus_tag LOCUS_32330 3070 3447 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962885.1 protein_id gnl|my_center|LOCUS_32330 >Feature sequence169 313 1128 gene locus_tag LOCUS_32340 313 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 1249 1593 gene locus_tag LOCUS_32350 1249 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32350 1574 1702 gene locus_tag LOCUS_32360 1574 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32360 1704 1829 gene locus_tag LOCUS_32370 1704 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 1980 1849 gene locus_tag LOCUS_32380 1980 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 2827 1982 gene locus_tag LOCUS_32390 2827 1982 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194105476.1 protein_id gnl|my_center|LOCUS_32390 2953 3636 gene locus_tag LOCUS_32400 2953 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32400 >Feature sequence170 170 694 gene locus_tag LOCUS_32410 170 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 1121 972 gene locus_tag LOCUS_32420 1121 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 1214 1888 gene locus_tag LOCUS_32430 1214 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 1952 2800 gene locus_tag LOCUS_32440 1952 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 2877 3689 gene locus_tag LOCUS_32450 2877 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 >Feature sequence171 653 498 gene locus_tag LOCUS_32460 653 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 1470 823 gene locus_tag LOCUS_32470 1470 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 3477 1501 gene locus_tag LOCUS_32480 3477 1501 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681239.1 protein_id gnl|my_center|LOCUS_32480 >Feature sequence172 746 309 gene locus_tag LOCUS_32490 746 309 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173977.1 protein_id gnl|my_center|LOCUS_32490 1148 777 gene locus_tag LOCUS_32500 1148 777 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146729243.1 protein_id gnl|my_center|LOCUS_32500 1628 1161 gene locus_tag LOCUS_32510 1628 1161 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948145.1 protein_id gnl|my_center|LOCUS_32510 2032 1598 gene locus_tag LOCUS_32520 2032 1598 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072758.1 protein_id gnl|my_center|LOCUS_32520 2505 2056 gene locus_tag LOCUS_32530 2505 2056 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970037.1 protein_id gnl|my_center|LOCUS_32530 2644 3618 gene locus_tag LOCUS_32540 2644 3618 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448438.1 protein_id gnl|my_center|LOCUS_32540 >Feature sequence173 <1 729 gene locus_tag LOCUS_32550 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941119.1:ATP-binding protein 775 1524 gene locus_tag LOCUS_32560 775 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 1620 2135 gene locus_tag LOCUS_32570 1620 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963109.1 protein_id gnl|my_center|LOCUS_32570 2167 2739 gene locus_tag LOCUS_32580 2167 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 2640 3650 gene locus_tag LOCUS_32590 2640 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 >Feature sequence174 1783 923 gene locus_tag LOCUS_32600 1783 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 2507 1821 gene locus_tag LOCUS_32610 2507 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 2921 2571 gene locus_tag LOCUS_32620 2921 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32620 3321 3043 gene locus_tag LOCUS_32630 3321 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32630 3641 3459 gene locus_tag LOCUS_32640 3641 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 >Feature sequence175 195 2291 gene locus_tag LOCUS_32650 195 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 2288 3382 gene locus_tag LOCUS_32660 2288 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 >Feature sequence176 1288 284 gene locus_tag LOCUS_32670 gene recA 1288 284 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_32670 1627 2703 gene locus_tag LOCUS_32680 1627 2703 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962203.1 protein_id gnl|my_center|LOCUS_32680 >Feature sequence177 1705 1121 gene locus_tag LOCUS_32690 1705 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 1804 2286 gene locus_tag LOCUS_32700 1804 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 2311 2466 gene locus_tag LOCUS_32710 2311 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 2763 3125 gene locus_tag LOCUS_32720 2763 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 >Feature sequence178 <1 1224 gene locus_tag LOCUS_32730 <1 1224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202190.1:sensor histidine kinase 1238 1915 gene locus_tag LOCUS_32740 1238 1915 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726671.1 protein_id gnl|my_center|LOCUS_32740 2624 2121 gene locus_tag LOCUS_32750 2624 2121 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962389.1 protein_id gnl|my_center|LOCUS_32750 2757 3116 gene locus_tag LOCUS_32760 2757 3116 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_32760 >Feature sequence179 338 2047 gene locus_tag LOCUS_32770 338 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 2752 2039 gene locus_tag LOCUS_32780 2752 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 2978 2733 gene locus_tag LOCUS_32790 2978 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 3144 3386 gene locus_tag LOCUS_32800 3144 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 >Feature sequence180 2064 433 gene locus_tag LOCUS_32810 gene groL 2064 433 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964087.1 protein_id gnl|my_center|LOCUS_32810 2444 2169 gene locus_tag LOCUS_32820 2444 2169 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964086.1 protein_id gnl|my_center|LOCUS_32820 2945 2592 gene locus_tag LOCUS_32830 gene secG 2945 2592 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964085.1 protein_id gnl|my_center|LOCUS_32830 >Feature sequence181 463 194 gene locus_tag LOCUS_32840 gene rpsO 463 194 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964145.1 protein_id gnl|my_center|LOCUS_32840 1433 576 gene locus_tag LOCUS_32850 gene accD 1433 576 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962493.1 protein_id gnl|my_center|LOCUS_32850 1838 1614 gene locus_tag LOCUS_32860 1838 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 2325 2071 gene locus_tag LOCUS_32870 2325 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32870 2105 2128 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2503 2294 gene locus_tag LOCUS_32880 2503 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32880 <3368 2638 gene locus_tag LOCUS_32890 <3368 2638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962495.1:BamA/TamA family outer membrane protein >Feature sequence182 1277 396 gene locus_tag LOCUS_32900 1277 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 1783 1274 gene locus_tag LOCUS_32910 1783 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 2030 1788 gene locus_tag LOCUS_32920 2030 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 2615 2046 gene locus_tag LOCUS_32930 2615 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 3165 2599 gene locus_tag LOCUS_32940 3165 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 >Feature sequence183 250 23 gene locus_tag LOCUS_32950 250 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 453 262 gene locus_tag LOCUS_32960 453 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 702 475 gene locus_tag LOCUS_32970 702 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 1009 713 gene locus_tag LOCUS_32980 1009 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 1548 1027 gene locus_tag LOCUS_32990 1548 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 2321 1560 gene locus_tag LOCUS_33000 2321 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 2666 2415 gene locus_tag LOCUS_33010 2666 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 3062 2676 gene locus_tag LOCUS_33020 3062 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 3303 3037 gene locus_tag LOCUS_33030 3303 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 >Feature sequence184 246 73 gene locus_tag LOCUS_33040 246 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 1024 323 gene locus_tag LOCUS_33050 1024 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 338 393 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1317 1036 gene locus_tag LOCUS_33060 1317 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 2432 1317 gene locus_tag LOCUS_33070 2432 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 2578 2429 gene locus_tag LOCUS_33080 2578 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 2678 2821 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence185 1958 1608 gene locus_tag LOCUS_33090 1958 1608 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_33090 >Feature sequence186 1431 274 gene locus_tag LOCUS_33100 1431 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33100 1955 1437 gene locus_tag LOCUS_33110 1955 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 <3075 2016 gene locus_tag LOCUS_33120 <3075 2016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584106.1:GGDEF domain-containing protein >Feature sequence187 505 1344 gene locus_tag LOCUS_33130 505 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 1365 1961 gene locus_tag LOCUS_33140 1365 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 1949 2716 gene locus_tag LOCUS_33150 1949 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 >Feature sequence188 <1 906 gene locus_tag LOCUS_33160 <1 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963392.1:glycosyltransferase family 2 protein 899 1753 gene locus_tag LOCUS_33170 899 1753 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282880.1 protein_id gnl|my_center|LOCUS_33170 1774 2631 gene locus_tag LOCUS_33180 1774 2631 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943077.1 protein_id gnl|my_center|LOCUS_33180 >Feature sequence189 >Feature sequence190 468 1148 gene locus_tag LOCUS_33190 468 1148 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_33190 1148 2191 gene locus_tag LOCUS_33200 1148 2191 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072879556.1 protein_id gnl|my_center|LOCUS_33200 <2894 2174 gene locus_tag LOCUS_33210 <2894 2174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962537.1:glycosyltransferase >Feature sequence191 1141 149 gene locus_tag LOCUS_33220 1141 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 2551 1244 gene locus_tag LOCUS_33230 2551 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 >Feature sequence192 238 324 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 732 1586 gene locus_tag LOCUS_33240 732 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 >Feature sequence193 <1 1028 gene locus_tag LOCUS_33250 <1 1028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927068.1:fibrobacter succinogenes major paralogous domain-containing protein 1247 1864 gene locus_tag LOCUS_33260 1247 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 >Feature sequence194 75 147 gene locus_tag LOCUS_t00510 75 147 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 247 510 gene locus_tag LOCUS_33270 247 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 755 1447 gene locus_tag LOCUS_33280 755 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 1549 2538 gene locus_tag LOCUS_33290 1549 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 >Feature sequence195 1619 333 gene locus_tag LOCUS_33300 gene hemL 1619 333 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963336.1 protein_id gnl|my_center|LOCUS_33300 2509 1619 gene locus_tag LOCUS_33310 2509 1619 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963337.1 protein_id gnl|my_center|LOCUS_33310 >Feature sequence196 536 2257 gene locus_tag LOCUS_33320 536 2257 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963882.1 protein_id gnl|my_center|LOCUS_33320 >Feature sequence197 336 85 gene locus_tag LOCUS_33330 336 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 897 361 gene locus_tag LOCUS_33340 897 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 1880 1593 gene locus_tag LOCUS_33350 1880 1593 CDS product DUF3846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272736.1 protein_id gnl|my_center|LOCUS_33350 2410 2102 gene locus_tag LOCUS_33360 2410 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 >Feature sequence198 <1 751 gene locus_tag LOCUS_33370 <1 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008657498.1:FISUMP domain-containing protein 913 1620 gene locus_tag LOCUS_33380 913 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 >Feature sequence199 407 535 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 756 2144 gene locus_tag LOCUS_33390 756 2144 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_33390 >Feature sequence200 698 33 gene locus_tag LOCUS_33400 698 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 2141 1434 gene locus_tag LOCUS_33410 2141 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 >Feature sequence201 538 209 gene locus_tag LOCUS_33420 538 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 1485 625 gene locus_tag LOCUS_33430 1485 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 <2531 1489 gene locus_tag LOCUS_33440 <2531 1489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256519.1:polysulfide reductase NrfD >Feature sequence202 <2501 438 gene locus_tag LOCUS_33450 <2501 438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962686.1:TonB-dependent receptor >Feature sequence203 <1 632 gene locus_tag LOCUS_33460 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000881300.1:peptidoglycan O-acetyltransferase 640 2145 gene locus_tag LOCUS_33470 640 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470