>Feature sequence001 <1 1471 gene locus_tag LOCUS_00010 <1 1471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080135.1:beta-galactosidase LacZ 1553 4012 gene locus_tag LOCUS_00020 1553 4012 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_00020 5045 4083 gene locus_tag LOCUS_00030 5045 4083 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 protein_id gnl|my_center|LOCUS_00030 5906 5208 gene locus_tag LOCUS_00040 5906 5208 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_00040 6039 7529 gene locus_tag LOCUS_00050 6039 7529 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 protein_id gnl|my_center|LOCUS_00050 7540 8850 gene locus_tag LOCUS_00060 gene xylA 7540 8850 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107447.1 protein_id gnl|my_center|LOCUS_00060 9293 9565 gene locus_tag LOCUS_00070 9293 9565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9869 10327 gene locus_tag LOCUS_00080 9869 10327 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965852.1 protein_id gnl|my_center|LOCUS_00080 11233 10343 gene locus_tag LOCUS_00090 11233 10343 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407851.1 protein_id gnl|my_center|LOCUS_00090 13794 11233 gene locus_tag LOCUS_00100 13794 11233 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105233.1 protein_id gnl|my_center|LOCUS_00100 17163 13810 gene locus_tag LOCUS_00110 17163 13810 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266501.1 protein_id gnl|my_center|LOCUS_00110 18394 17369 gene locus_tag LOCUS_00120 18394 17369 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_00120 19265 18456 gene locus_tag LOCUS_00130 19265 18456 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_00130 20356 19259 gene locus_tag LOCUS_00140 gene bpsA 20356 19259 CDS product type III polyketide synthase BpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230750.1 protein_id gnl|my_center|LOCUS_00140 21003 20332 gene locus_tag LOCUS_00150 21003 20332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 22178 21030 gene locus_tag LOCUS_00160 22178 21030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 23006 22302 gene locus_tag LOCUS_00170 23006 22302 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963625.1 protein_id gnl|my_center|LOCUS_00170 23545 23060 gene locus_tag LOCUS_00180 23545 23060 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963626.1 protein_id gnl|my_center|LOCUS_00180 25892 23886 gene locus_tag LOCUS_00190 25892 23886 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_00190 26041 26991 gene locus_tag LOCUS_00200 26041 26991 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_00200 26995 27327 gene locus_tag LOCUS_00210 26995 27327 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963176.1 protein_id gnl|my_center|LOCUS_00210 27339 28274 gene locus_tag LOCUS_00220 27339 28274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 28276 29148 gene locus_tag LOCUS_00230 28276 29148 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_00230 29222 31270 gene locus_tag LOCUS_00240 gene ppk1 29222 31270 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370393.1 protein_id gnl|my_center|LOCUS_00240 31275 32108 gene locus_tag LOCUS_00250 31275 32108 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963181.1 protein_id gnl|my_center|LOCUS_00250 32167 32376 gene locus_tag LOCUS_00260 32167 32376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 33100 32435 gene locus_tag LOCUS_00270 gene ung 33100 32435 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_00270 33177 35351 gene locus_tag LOCUS_00280 33177 35351 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963184.1 protein_id gnl|my_center|LOCUS_00280 35348 35749 gene locus_tag LOCUS_00290 35348 35749 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 protein_id gnl|my_center|LOCUS_00290 35812 37713 gene locus_tag LOCUS_00300 35812 37713 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962278.1 protein_id gnl|my_center|LOCUS_00300 37723 38385 gene locus_tag LOCUS_00310 37723 38385 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263006.1 protein_id gnl|my_center|LOCUS_00310 39489 38365 gene locus_tag LOCUS_00320 39489 38365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 41064 39613 gene locus_tag LOCUS_00330 41064 39613 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_00330 42279 41215 gene locus_tag LOCUS_00340 gene aroC 42279 41215 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962924.1 protein_id gnl|my_center|LOCUS_00340 42438 43262 gene locus_tag LOCUS_00350 42438 43262 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_00350 45580 43259 gene locus_tag LOCUS_00360 45580 43259 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963024.1 protein_id gnl|my_center|LOCUS_00360 45836 46381 gene locus_tag LOCUS_00370 45836 46381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 46407 47690 gene locus_tag LOCUS_00380 46407 47690 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_00380 47707 49323 gene locus_tag LOCUS_00390 47707 49323 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_00390 49327 49845 gene locus_tag LOCUS_00400 49327 49845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_00400 49857 50369 gene locus_tag LOCUS_00410 49857 50369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 50401 51867 gene locus_tag LOCUS_00420 50401 51867 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941860.1 protein_id gnl|my_center|LOCUS_00420 52854 51931 gene locus_tag LOCUS_00430 52854 51931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 54924 52855 gene locus_tag LOCUS_00440 54924 52855 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963153.1 protein_id gnl|my_center|LOCUS_00440 55125 57230 gene locus_tag LOCUS_00450 gene recG 55125 57230 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963155.1 protein_id gnl|my_center|LOCUS_00450 57350 59776 gene locus_tag LOCUS_00460 gene pheT 57350 59776 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963186.1 protein_id gnl|my_center|LOCUS_00460 59844 60563 gene locus_tag LOCUS_00470 59844 60563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 60563 61081 gene locus_tag LOCUS_00480 60563 61081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 62804 61179 gene locus_tag LOCUS_00490 62804 61179 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963187.1 protein_id gnl|my_center|LOCUS_00490 62981 64393 gene locus_tag LOCUS_00500 62981 64393 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963192.1 protein_id gnl|my_center|LOCUS_00500 65128 64472 gene locus_tag LOCUS_00510 gene fsa 65128 64472 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963193.1 protein_id gnl|my_center|LOCUS_00510 66060 65257 gene locus_tag LOCUS_00520 66060 65257 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963194.1 protein_id gnl|my_center|LOCUS_00520 66341 67354 gene locus_tag LOCUS_00530 66341 67354 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963196.1 protein_id gnl|my_center|LOCUS_00530 67395 68906 gene locus_tag LOCUS_00540 67395 68906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_00540 68907 71396 gene locus_tag LOCUS_00550 68907 71396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 71405 71746 gene locus_tag LOCUS_00560 71405 71746 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444506.1 protein_id gnl|my_center|LOCUS_00560 71987 73228 gene locus_tag LOCUS_00570 71987 73228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 78573 73249 gene locus_tag LOCUS_00580 78573 73249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 78678 79460 gene locus_tag LOCUS_00590 78678 79460 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927183.1 protein_id gnl|my_center|LOCUS_00590 79546 80598 gene locus_tag LOCUS_00600 79546 80598 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 protein_id gnl|my_center|LOCUS_00600 80703 81305 gene locus_tag LOCUS_00610 80703 81305 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072768.1 protein_id gnl|my_center|LOCUS_00610 81289 81855 gene locus_tag LOCUS_00620 81289 81855 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962897.1 protein_id gnl|my_center|LOCUS_00620 82113 82490 gene locus_tag LOCUS_00630 82113 82490 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888560.1 protein_id gnl|my_center|LOCUS_00630 82778 85072 gene locus_tag LOCUS_00640 gene katG 82778 85072 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814129.1 protein_id gnl|my_center|LOCUS_00640 85376 85876 gene locus_tag LOCUS_00650 85376 85876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 86030 86569 gene locus_tag LOCUS_00660 86030 86569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 87028 87393 gene locus_tag LOCUS_00670 87028 87393 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 protein_id gnl|my_center|LOCUS_00670 87445 90204 gene locus_tag LOCUS_00680 87445 90204 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467010.1 protein_id gnl|my_center|LOCUS_00680 90378 90304 gene locus_tag LOCUS_t00010 90378 90304 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 91182 90466 gene locus_tag LOCUS_00690 gene bshB1 91182 90466 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_00690 92497 91322 gene locus_tag LOCUS_00700 92497 91322 CDS product bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229810.1 protein_id gnl|my_center|LOCUS_00700 92617 93078 gene locus_tag LOCUS_00710 92617 93078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 93238 93993 gene locus_tag LOCUS_00720 93238 93993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 94178 95230 gene locus_tag LOCUS_00730 gene pgl 94178 95230 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244689.1 protein_id gnl|my_center|LOCUS_00730 96985 95351 gene locus_tag LOCUS_00740 96985 95351 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838626.1 protein_id gnl|my_center|LOCUS_00740 98877 97087 gene locus_tag LOCUS_00750 98877 97087 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962685.1 protein_id gnl|my_center|LOCUS_00750 101963 98946 gene locus_tag LOCUS_00760 101963 98946 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 protein_id gnl|my_center|LOCUS_00760 102189 102872 gene locus_tag LOCUS_00770 102189 102872 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_00770 102885 103775 gene locus_tag LOCUS_00780 102885 103775 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963966.1 protein_id gnl|my_center|LOCUS_00780 103765 104700 gene locus_tag LOCUS_00790 103765 104700 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963967.1 protein_id gnl|my_center|LOCUS_00790 105735 104719 gene locus_tag LOCUS_00800 105735 104719 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963969.1 protein_id gnl|my_center|LOCUS_00800 105848 106996 gene locus_tag LOCUS_00810 105848 106996 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963970.1 protein_id gnl|my_center|LOCUS_00810 108291 106993 gene locus_tag LOCUS_00820 108291 106993 CDS product O-antigen translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963976.1 protein_id gnl|my_center|LOCUS_00820 109387 108284 gene locus_tag LOCUS_00830 109387 108284 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963975.1 protein_id gnl|my_center|LOCUS_00830 110346 109384 gene locus_tag LOCUS_00840 110346 109384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963974.1 protein_id gnl|my_center|LOCUS_00840 110948 110487 gene locus_tag LOCUS_00850 110948 110487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 112904 111108 gene locus_tag LOCUS_00860 gene typA 112904 111108 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962640.1 protein_id gnl|my_center|LOCUS_00860 113370 114188 gene locus_tag LOCUS_00870 gene kdsA 113370 114188 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962665.1 protein_id gnl|my_center|LOCUS_00870 114390 116303 gene locus_tag LOCUS_00880 114390 116303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 116721 116371 gene locus_tag LOCUS_00890 116721 116371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 116847 117989 gene locus_tag LOCUS_00900 116847 117989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037925.1 protein_id gnl|my_center|LOCUS_00900 118004 119614 gene locus_tag LOCUS_00910 118004 119614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 119617 120474 gene locus_tag LOCUS_00920 119617 120474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 120596 121645 gene locus_tag LOCUS_00930 gene meaB 120596 121645 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503589.1 protein_id gnl|my_center|LOCUS_00930 122660 121650 gene locus_tag LOCUS_00940 122660 121650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 122975 122712 gene locus_tag LOCUS_00950 122975 122712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 123947 123003 gene locus_tag LOCUS_00960 123947 123003 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229036.1 protein_id gnl|my_center|LOCUS_00960 124569 124003 gene locus_tag LOCUS_00970 124569 124003 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964181.1 protein_id gnl|my_center|LOCUS_00970 124800 124570 gene locus_tag LOCUS_00980 124800 124570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962732.1 protein_id gnl|my_center|LOCUS_00980 124955 126400 gene locus_tag LOCUS_00990 124955 126400 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768517.1 protein_id gnl|my_center|LOCUS_00990 126733 126371 gene locus_tag LOCUS_01000 126733 126371 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_01000 127313 129649 gene locus_tag LOCUS_01010 127313 129649 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 protein_id gnl|my_center|LOCUS_01010 130255 129863 gene locus_tag LOCUS_01020 gene ytxJ 130255 129863 CDS product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_01020 130486 133089 gene locus_tag LOCUS_01030 gene clpB 130486 133089 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963875.1 protein_id gnl|my_center|LOCUS_01030 133255 133938 gene locus_tag LOCUS_01040 133255 133938 CDS product toll/interleukin-1 receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023004221.1 protein_id gnl|my_center|LOCUS_01040 134335 135363 gene locus_tag LOCUS_01050 134335 135363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 135479 135943 gene locus_tag LOCUS_01060 135479 135943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 136024 136431 gene locus_tag LOCUS_01070 136024 136431 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890794.1 protein_id gnl|my_center|LOCUS_01070 136657 137169 gene locus_tag LOCUS_01080 136657 137169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 137322 137561 gene locus_tag LOCUS_01090 137322 137561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 137771 138130 gene locus_tag LOCUS_01100 137771 138130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 138187 138897 gene locus_tag LOCUS_01110 138187 138897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 139033 139287 gene locus_tag LOCUS_01120 139033 139287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 139463 139723 gene locus_tag LOCUS_01130 139463 139723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 139725 140009 gene locus_tag LOCUS_01140 139725 140009 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918758.1 protein_id gnl|my_center|LOCUS_01140 140068 140436 gene locus_tag LOCUS_01150 140068 140436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 140963 140520 gene locus_tag LOCUS_01160 140963 140520 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173977.1 protein_id gnl|my_center|LOCUS_01160 143323 141134 gene locus_tag LOCUS_01170 143323 141134 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_01170 143793 143329 gene locus_tag LOCUS_01180 143793 143329 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971001.1 protein_id gnl|my_center|LOCUS_01180 145639 144185 gene locus_tag LOCUS_01190 145639 144185 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012297.1 protein_id gnl|my_center|LOCUS_01190 146585 145767 gene locus_tag LOCUS_01200 146585 145767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 147059 146631 gene locus_tag LOCUS_01210 147059 146631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 150178 147134 gene locus_tag LOCUS_01220 150178 147134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 150530 151669 gene locus_tag LOCUS_01230 150530 151669 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789721.1 protein_id gnl|my_center|LOCUS_01230 151930 153147 gene locus_tag LOCUS_01240 151930 153147 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038876.1 protein_id gnl|my_center|LOCUS_01240 153151 156174 gene locus_tag LOCUS_01250 153151 156174 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038877.1 protein_id gnl|my_center|LOCUS_01250 156281 156670 gene locus_tag LOCUS_01260 156281 156670 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963098.1 protein_id gnl|my_center|LOCUS_01260 157321 156743 gene locus_tag LOCUS_01270 157321 156743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 157574 158974 gene locus_tag LOCUS_01280 157574 158974 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_01280 158980 161232 gene locus_tag LOCUS_01290 158980 161232 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921395.1 protein_id gnl|my_center|LOCUS_01290 161808 161305 gene locus_tag LOCUS_01300 161808 161305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 162288 161914 gene locus_tag LOCUS_01310 162288 161914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 164174 162354 gene locus_tag LOCUS_01320 164174 162354 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962729.1 protein_id gnl|my_center|LOCUS_01320 165808 164255 gene locus_tag LOCUS_01330 165808 164255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962728.1 protein_id gnl|my_center|LOCUS_01330 166530 166075 gene locus_tag LOCUS_01340 gene bcp 166530 166075 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963239.1 protein_id gnl|my_center|LOCUS_01340 166618 167274 gene locus_tag LOCUS_01350 166618 167274 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963240.1 protein_id gnl|my_center|LOCUS_01350 167408 167602 gene locus_tag LOCUS_01360 167408 167602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 167603 168514 gene locus_tag LOCUS_01370 167603 168514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 168673 169212 gene locus_tag LOCUS_01380 168673 169212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 170078 169494 gene locus_tag LOCUS_01390 170078 169494 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_01390 170271 173096 gene locus_tag LOCUS_01400 gene uvrA 170271 173096 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963246.1 protein_id gnl|my_center|LOCUS_01400 173416 173976 gene locus_tag LOCUS_01410 173416 173976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 174101 175540 gene locus_tag LOCUS_01420 gene mnmE 174101 175540 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962791.1 protein_id gnl|my_center|LOCUS_01420 175606 176448 gene locus_tag LOCUS_01430 gene blaOXA 175606 176448 CDS product OXA-48 family carbapenem-hydrolyzing class D beta-lactamase OXA-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071128.1 protein_id gnl|my_center|LOCUS_01430 176543 177571 gene locus_tag LOCUS_01440 176543 177571 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946852.1 protein_id gnl|my_center|LOCUS_01440 177785 179164 gene locus_tag LOCUS_01450 177785 179164 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890799.1 protein_id gnl|my_center|LOCUS_01450 179959 179300 gene locus_tag LOCUS_01460 179959 179300 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062803978.1 protein_id gnl|my_center|LOCUS_01460 180866 180525 gene locus_tag LOCUS_01470 180866 180525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 181304 182515 gene locus_tag LOCUS_01480 181304 182515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 182651 184798 gene locus_tag LOCUS_01490 182651 184798 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767003.1 protein_id gnl|my_center|LOCUS_01490 185124 185327 gene locus_tag LOCUS_01500 185124 185327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 187052 185496 gene locus_tag LOCUS_01510 187052 185496 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_01510 187177 187971 gene locus_tag LOCUS_01520 187177 187971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 190322 188043 gene locus_tag LOCUS_01530 gene bglX 190322 188043 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_01530 193178 190404 gene locus_tag LOCUS_01540 193178 190404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 194040 193189 gene locus_tag LOCUS_01550 194040 193189 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256962.1 protein_id gnl|my_center|LOCUS_01550 195448 194054 gene locus_tag LOCUS_01560 195448 194054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 198581 195453 gene locus_tag LOCUS_01570 198581 195453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 199584 198814 gene locus_tag LOCUS_01580 199584 198814 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256962.1 protein_id gnl|my_center|LOCUS_01580 201365 199698 gene locus_tag LOCUS_01590 201365 199698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 203527 201380 gene locus_tag LOCUS_01600 203527 201380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 205021 203546 gene locus_tag LOCUS_01610 205021 203546 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_01610 208046 205032 gene locus_tag LOCUS_01620 208046 205032 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_01620 211067 208317 gene locus_tag LOCUS_01630 211067 208317 CDS product triple tyrosine motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091372500.1 protein_id gnl|my_center|LOCUS_01630 212480 211161 gene locus_tag LOCUS_01640 212480 211161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 212604 213341 gene locus_tag LOCUS_01650 212604 213341 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_01650 214337 213345 gene locus_tag LOCUS_01660 214337 213345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 215479 214340 gene locus_tag LOCUS_01670 215479 214340 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963410.1 protein_id gnl|my_center|LOCUS_01670 216541 215492 gene locus_tag LOCUS_01680 216541 215492 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722780.1 protein_id gnl|my_center|LOCUS_01680 217078 216659 gene locus_tag LOCUS_01690 217078 216659 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768138.1 protein_id gnl|my_center|LOCUS_01690 217214 217687 gene locus_tag LOCUS_01700 217214 217687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340546.1 protein_id gnl|my_center|LOCUS_01700 217689 218462 gene locus_tag LOCUS_01710 217689 218462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 221389 218465 gene locus_tag LOCUS_01720 221389 218465 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_01720 221535 222020 gene locus_tag LOCUS_01730 221535 222020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 223272 222115 gene locus_tag LOCUS_01740 gene bshA 223272 222115 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 protein_id gnl|my_center|LOCUS_01740 226235 223344 gene locus_tag LOCUS_01750 226235 223344 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_01750 226752 226267 gene locus_tag LOCUS_01760 226752 226267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_01760 227515 226895 gene locus_tag LOCUS_01770 227515 226895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 228173 227535 gene locus_tag LOCUS_01780 228173 227535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 228748 228185 gene locus_tag LOCUS_01790 228748 228185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 229845 229054 gene locus_tag LOCUS_01800 229845 229054 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_01800 230299 229865 gene locus_tag LOCUS_01810 230299 229865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962914.1 protein_id gnl|my_center|LOCUS_01810 231674 230331 gene locus_tag LOCUS_01820 231674 230331 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_01820 232630 231680 gene locus_tag LOCUS_01830 232630 231680 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962912.1 protein_id gnl|my_center|LOCUS_01830 233787 232690 gene locus_tag LOCUS_01840 233787 232690 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962911.1 protein_id gnl|my_center|LOCUS_01840 233983 236700 gene locus_tag LOCUS_01850 233983 236700 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 protein_id gnl|my_center|LOCUS_01850 236740 237120 gene locus_tag LOCUS_01860 236740 237120 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_01860 238059 237196 gene locus_tag LOCUS_01870 238059 237196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963724.1 protein_id gnl|my_center|LOCUS_01870 239121 238120 gene locus_tag LOCUS_01880 gene gap 239121 238120 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963725.1 protein_id gnl|my_center|LOCUS_01880 240172 239150 gene locus_tag LOCUS_01890 gene pfkA 240172 239150 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963726.1 protein_id gnl|my_center|LOCUS_01890 244714 240359 gene locus_tag LOCUS_01900 244714 240359 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 protein_id gnl|my_center|LOCUS_01900 244911 245963 gene locus_tag LOCUS_01910 gene tsaD 244911 245963 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503448.1 protein_id gnl|my_center|LOCUS_01910 245966 246679 gene locus_tag LOCUS_01920 245966 246679 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963729.1 protein_id gnl|my_center|LOCUS_01920 247766 246738 gene locus_tag LOCUS_01930 gene holA 247766 246738 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_01930 247862 248308 gene locus_tag LOCUS_01940 247862 248308 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_01940 248318 249325 gene locus_tag LOCUS_01950 248318 249325 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_01950 249420 250238 gene locus_tag LOCUS_01960 249420 250238 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_01960 251012 250395 gene locus_tag LOCUS_01970 251012 250395 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_01970 251226 251017 gene locus_tag LOCUS_01980 251226 251017 CDS product DUF2945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973278.1 protein_id gnl|my_center|LOCUS_01980 251936 251307 gene locus_tag LOCUS_01990 251936 251307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 253237 251933 gene locus_tag LOCUS_02000 253237 251933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_02000 253886 253326 gene locus_tag LOCUS_02010 253886 253326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 255536 253974 gene locus_tag LOCUS_02020 gene dnaB 255536 253974 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962775.1 protein_id gnl|my_center|LOCUS_02020 256659 255706 gene locus_tag LOCUS_02030 256659 255706 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962774.1 protein_id gnl|my_center|LOCUS_02030 257723 256806 gene locus_tag LOCUS_02040 257723 256806 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_02040 258786 257710 gene locus_tag LOCUS_02050 258786 257710 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962772.1 protein_id gnl|my_center|LOCUS_02050 259917 258787 gene locus_tag LOCUS_02060 gene tgt 259917 258787 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962771.1 protein_id gnl|my_center|LOCUS_02060 260116 260961 gene locus_tag LOCUS_02070 260116 260961 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_02070 261047 262000 gene locus_tag LOCUS_02080 261047 262000 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_02080 262068 262700 gene locus_tag LOCUS_02090 262068 262700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 263683 262778 gene locus_tag LOCUS_02100 263683 262778 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963560.1 protein_id gnl|my_center|LOCUS_02100 263762 264145 gene locus_tag LOCUS_02110 263762 264145 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963561.1 protein_id gnl|my_center|LOCUS_02110 264123 264743 gene locus_tag LOCUS_02120 264123 264743 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_02120 264740 265243 gene locus_tag LOCUS_02130 264740 265243 CDS product phosphoribosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_02130 265753 265235 gene locus_tag LOCUS_02140 265753 265235 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963564.1 protein_id gnl|my_center|LOCUS_02140 265916 266222 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 266335 266418 gene locus_tag LOCUS_t00020 266335 266418 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 267129 266482 gene locus_tag LOCUS_02150 267129 266482 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245344.1 protein_id gnl|my_center|LOCUS_02150 267283 267585 gene locus_tag LOCUS_02160 gene trxA 267283 267585 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963919.1 protein_id gnl|my_center|LOCUS_02160 267614 268021 gene locus_tag LOCUS_02170 267614 268021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 269155 268037 gene locus_tag LOCUS_02180 269155 268037 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963093.1 protein_id gnl|my_center|LOCUS_02180 269265 270122 gene locus_tag LOCUS_02190 269265 270122 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604121.1 protein_id gnl|my_center|LOCUS_02190 270241 270915 gene locus_tag LOCUS_02200 270241 270915 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_02200 270919 272583 gene locus_tag LOCUS_02210 270919 272583 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_02210 272589 273944 gene locus_tag LOCUS_02220 272589 273944 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_02220 273941 275356 gene locus_tag LOCUS_02230 273941 275356 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 protein_id gnl|my_center|LOCUS_02230 275506 276324 gene locus_tag LOCUS_02240 gene map 275506 276324 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962588.1 protein_id gnl|my_center|LOCUS_02240 276343 276882 gene locus_tag LOCUS_02250 276343 276882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 276972 277655 gene locus_tag LOCUS_02260 276972 277655 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 protein_id gnl|my_center|LOCUS_02260 277679 279721 gene locus_tag LOCUS_02270 277679 279721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 280664 279711 gene locus_tag LOCUS_02280 280664 279711 CDS product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705065.1 protein_id gnl|my_center|LOCUS_02280 281130 280768 gene locus_tag LOCUS_02290 281130 280768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 282520 281213 gene locus_tag LOCUS_02300 gene nqrF 282520 281213 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337386.1 protein_id gnl|my_center|LOCUS_02300 283250 282522 gene locus_tag LOCUS_02310 gene nqrE 283250 282522 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763480.1 protein_id gnl|my_center|LOCUS_02310 283946 283299 gene locus_tag LOCUS_02320 283946 283299 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763479.1 protein_id gnl|my_center|LOCUS_02320 284683 283949 gene locus_tag LOCUS_02330 284683 283949 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765873.1 protein_id gnl|my_center|LOCUS_02330 285897 284686 gene locus_tag LOCUS_02340 285897 284686 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787201.1 protein_id gnl|my_center|LOCUS_02340 287255 285903 gene locus_tag LOCUS_02350 287255 285903 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765874.1 protein_id gnl|my_center|LOCUS_02350 287569 288759 gene locus_tag LOCUS_02360 287569 288759 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_02360 288849 290081 gene locus_tag LOCUS_02370 288849 290081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 290084 290470 gene locus_tag LOCUS_02380 gene apaG 290084 290470 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962585.1 protein_id gnl|my_center|LOCUS_02380 290660 292288 gene locus_tag LOCUS_02390 gene pruA 290660 292288 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_02390 292389 292715 gene locus_tag LOCUS_02400 292389 292715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 293377 292748 gene locus_tag LOCUS_02410 gene rsmG 293377 292748 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962583.1 protein_id gnl|my_center|LOCUS_02410 293517 294623 gene locus_tag LOCUS_02420 293517 294623 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_02420 294636 295832 gene locus_tag LOCUS_02430 294636 295832 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962581.1 protein_id gnl|my_center|LOCUS_02430 296471 295911 gene locus_tag LOCUS_02440 296471 295911 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816758.1 protein_id gnl|my_center|LOCUS_02440 297538 296561 gene locus_tag LOCUS_02450 297538 296561 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_02450 299120 297612 gene locus_tag LOCUS_02460 299120 297612 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012843245.1 protein_id gnl|my_center|LOCUS_02460 300469 299120 gene locus_tag LOCUS_02470 gene trkA 300469 299120 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_02470 300677 301438 gene locus_tag LOCUS_02480 gene ubiE 300677 301438 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024980308.1 protein_id gnl|my_center|LOCUS_02480 301443 302144 gene locus_tag LOCUS_02490 301443 302144 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 protein_id gnl|my_center|LOCUS_02490 302144 302893 gene locus_tag LOCUS_02500 302144 302893 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479544.1 protein_id gnl|my_center|LOCUS_02500 303407 302886 gene locus_tag LOCUS_02510 303407 302886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 303604 306210 gene locus_tag LOCUS_02520 303604 306210 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962495.1 protein_id gnl|my_center|LOCUS_02520 306276 307343 gene locus_tag LOCUS_02530 gene fbaA 306276 307343 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_02530 307464 308321 gene locus_tag LOCUS_02540 gene accD 307464 308321 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962493.1 protein_id gnl|my_center|LOCUS_02540 308447 308716 gene locus_tag LOCUS_02550 gene rpsO 308447 308716 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791955.1 protein_id gnl|my_center|LOCUS_02550 308969 311197 gene locus_tag LOCUS_02560 308969 311197 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964146.1 protein_id gnl|my_center|LOCUS_02560 311558 312364 gene locus_tag LOCUS_02570 gene proC 311558 312364 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769432.1 protein_id gnl|my_center|LOCUS_02570 312366 313145 gene locus_tag LOCUS_02580 312366 313145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 313182 314381 gene locus_tag LOCUS_02590 313182 314381 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083010.1 protein_id gnl|my_center|LOCUS_02590 314597 317329 gene locus_tag LOCUS_02600 314597 317329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 317483 318346 gene locus_tag LOCUS_02610 317483 318346 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_02610 318525 318935 gene locus_tag LOCUS_02620 318525 318935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 318954 319613 gene locus_tag LOCUS_02630 gene rpe 318954 319613 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964149.1 protein_id gnl|my_center|LOCUS_02630 319699 320823 gene locus_tag LOCUS_02640 319699 320823 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706477.1 protein_id gnl|my_center|LOCUS_02640 320825 322168 gene locus_tag LOCUS_02650 320825 322168 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392414.1 protein_id gnl|my_center|LOCUS_02650 324439 322520 gene locus_tag LOCUS_02660 324439 322520 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_02660 325382 324450 gene locus_tag LOCUS_02670 325382 324450 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_02670 327199 325397 gene locus_tag LOCUS_02680 327199 325397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 327225 327579 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 332805 328153 gene locus_tag LOCUS_02690 332805 328153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 328159 328540 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 334512 333253 gene locus_tag LOCUS_02700 334512 333253 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786418.1 protein_id gnl|my_center|LOCUS_02700 334839 335846 gene locus_tag LOCUS_02710 gene fbp 334839 335846 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962470.1 protein_id gnl|my_center|LOCUS_02710 336750 335872 gene locus_tag LOCUS_02720 336750 335872 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816233.1 protein_id gnl|my_center|LOCUS_02720 337418 336747 gene locus_tag LOCUS_02730 gene modB 337418 336747 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857391.1 protein_id gnl|my_center|LOCUS_02730 337819 337415 gene locus_tag LOCUS_02740 337819 337415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 338471 337812 gene locus_tag LOCUS_02750 gene modA 338471 337812 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798928.1 protein_id gnl|my_center|LOCUS_02750 339028 338618 gene locus_tag LOCUS_02760 339028 338618 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289210.1 protein_id gnl|my_center|LOCUS_02760 339125 339462 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 340167 339682 gene locus_tag LOCUS_02770 340167 339682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 340900 340286 gene locus_tag LOCUS_02780 340900 340286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 340973 341407 gene locus_tag LOCUS_02790 340973 341407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 342303 341584 gene locus_tag LOCUS_02800 342303 341584 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015217.1 protein_id gnl|my_center|LOCUS_02800 343024 342371 gene locus_tag LOCUS_02810 343024 342371 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120174.1 protein_id gnl|my_center|LOCUS_02810 344013 343069 gene locus_tag LOCUS_02820 344013 343069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 345275 344229 gene locus_tag LOCUS_02830 345275 344229 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091411521.1 protein_id gnl|my_center|LOCUS_02830 346923 345331 gene locus_tag LOCUS_02840 346923 345331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 348058 347243 gene locus_tag LOCUS_02850 348058 347243 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762343.1 protein_id gnl|my_center|LOCUS_02850 348295 349341 gene locus_tag LOCUS_02860 348295 349341 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_02860 350974 349358 gene locus_tag LOCUS_02870 350974 349358 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703566.1 protein_id gnl|my_center|LOCUS_02870 352462 351008 gene locus_tag LOCUS_02880 352462 351008 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964014.1 protein_id gnl|my_center|LOCUS_02880 353763 352477 gene locus_tag LOCUS_02890 353763 352477 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 protein_id gnl|my_center|LOCUS_02890 354230 353760 gene locus_tag LOCUS_02900 354230 353760 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577041.1 protein_id gnl|my_center|LOCUS_02900 355221 354232 gene locus_tag LOCUS_02910 355221 354232 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_02910 355889 355218 gene locus_tag LOCUS_02920 355889 355218 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788379.1 protein_id gnl|my_center|LOCUS_02920 356913 355900 gene locus_tag LOCUS_02930 356913 355900 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793314.1 protein_id gnl|my_center|LOCUS_02930 358340 356913 gene locus_tag LOCUS_02940 gene uxaC 358340 356913 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793937.1 protein_id gnl|my_center|LOCUS_02940 359122 358361 gene locus_tag LOCUS_02950 gene kduD 359122 358361 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 protein_id gnl|my_center|LOCUS_02950 359955 359122 gene locus_tag LOCUS_02960 gene kduI 359955 359122 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201855.1 protein_id gnl|my_center|LOCUS_02960 361079 360120 gene locus_tag LOCUS_02970 361079 360120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 361476 363713 gene locus_tag LOCUS_02980 361476 363713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 363715 366999 gene locus_tag LOCUS_02990 363715 366999 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764381.1 protein_id gnl|my_center|LOCUS_02990 367002 368504 gene locus_tag LOCUS_03000 367002 368504 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_03000 368514 370199 gene locus_tag LOCUS_03010 368514 370199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 370232 371689 gene locus_tag LOCUS_03020 370232 371689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 371710 374895 gene locus_tag LOCUS_03030 371710 374895 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764385.1 protein_id gnl|my_center|LOCUS_03030 374925 376685 gene locus_tag LOCUS_03040 374925 376685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 376721 378094 gene locus_tag LOCUS_03050 376721 378094 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767667.1 protein_id gnl|my_center|LOCUS_03050 378101 378430 gene locus_tag LOCUS_03060 gene rhaM 378101 378430 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759851.1 protein_id gnl|my_center|LOCUS_03060 378964 378431 gene locus_tag LOCUS_03070 378964 378431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 379743 379003 gene locus_tag LOCUS_03080 379743 379003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 380820 379825 gene locus_tag LOCUS_03090 380820 379825 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_03090 382019 380841 gene locus_tag LOCUS_03100 382019 380841 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_03100 383604 382102 gene locus_tag LOCUS_03110 383604 382102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 384941 383604 gene locus_tag LOCUS_03120 384941 383604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 385437 385027 gene locus_tag LOCUS_03130 385437 385027 CDS product curli assembly protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421309.1 protein_id gnl|my_center|LOCUS_03130 386212 385442 gene locus_tag LOCUS_03140 386212 385442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 386712 386227 gene locus_tag LOCUS_03150 386712 386227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 387879 386926 gene locus_tag LOCUS_03160 387879 386926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 389457 388279 gene locus_tag LOCUS_03170 389457 388279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 390641 389868 gene locus_tag LOCUS_03180 390641 389868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 393221 391038 gene locus_tag LOCUS_03190 393221 391038 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_03190 393421 394437 gene locus_tag LOCUS_03200 393421 394437 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922049.1 protein_id gnl|my_center|LOCUS_03200 395512 394559 gene locus_tag LOCUS_03210 395512 394559 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 protein_id gnl|my_center|LOCUS_03210 396433 395582 gene locus_tag LOCUS_03220 gene folP 396433 395582 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963546.1 protein_id gnl|my_center|LOCUS_03220 396571 397119 gene locus_tag LOCUS_03230 396571 397119 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_03230 397122 398834 gene locus_tag LOCUS_03240 397122 398834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 398831 399907 gene locus_tag LOCUS_03250 398831 399907 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383124.1 protein_id gnl|my_center|LOCUS_03250 400132 400881 gene locus_tag LOCUS_03260 gene tpiA 400132 400881 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963550.1 protein_id gnl|my_center|LOCUS_03260 400885 401721 gene locus_tag LOCUS_03270 gene prmA 400885 401721 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_03270 401727 402023 gene locus_tag LOCUS_03280 401727 402023 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_03280 402202 403071 gene locus_tag LOCUS_03290 402202 403071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 403210 403284 gene locus_tag LOCUS_t00030 403210 403284 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 403518 404786 gene locus_tag LOCUS_03300 403518 404786 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_03300 405327 405650 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence002 <1 662 gene locus_tag LOCUS_03310 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963589.1:ATP-binding protein 1732 659 gene locus_tag LOCUS_03320 gene lpxK 1732 659 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963591.1 protein_id gnl|my_center|LOCUS_03320 1800 2894 gene locus_tag LOCUS_03330 1800 2894 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963351.1 protein_id gnl|my_center|LOCUS_03330 2896 3675 gene locus_tag LOCUS_03340 2896 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963352.1 protein_id gnl|my_center|LOCUS_03340 3805 4467 gene locus_tag LOCUS_03350 gene msrA 3805 4467 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013187310.1 protein_id gnl|my_center|LOCUS_03350 4467 4901 gene locus_tag LOCUS_03360 4467 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 5086 6249 gene locus_tag LOCUS_03370 5086 6249 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337792.1 protein_id gnl|my_center|LOCUS_03370 6344 6991 gene locus_tag LOCUS_03380 6344 6991 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_03380 7121 8416 gene locus_tag LOCUS_03390 7121 8416 CDS product DASH family cryptochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964143.1 protein_id gnl|my_center|LOCUS_03390 8460 9995 gene locus_tag LOCUS_03400 8460 9995 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503887.1 protein_id gnl|my_center|LOCUS_03400 10012 10239 gene locus_tag LOCUS_03410 10012 10239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 10259 10396 gene locus_tag LOCUS_03420 10259 10396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 10545 11399 gene locus_tag LOCUS_03430 10545 11399 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793532.1 protein_id gnl|my_center|LOCUS_03430 11538 12296 gene locus_tag LOCUS_03440 11538 12296 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038842.1 protein_id gnl|my_center|LOCUS_03440 13984 12317 gene locus_tag LOCUS_03450 13984 12317 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057672901.1 protein_id gnl|my_center|LOCUS_03450 14934 14203 gene locus_tag LOCUS_03460 14934 14203 CDS product DUF6089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964193.1 protein_id gnl|my_center|LOCUS_03460 15177 16049 gene locus_tag LOCUS_03470 15177 16049 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309798.1 protein_id gnl|my_center|LOCUS_03470 17267 16053 gene locus_tag LOCUS_03480 17267 16053 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940937.1 protein_id gnl|my_center|LOCUS_03480 17737 17516 gene locus_tag LOCUS_03490 17737 17516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 18565 17843 gene locus_tag LOCUS_03500 18565 17843 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_03500 18731 19468 gene locus_tag LOCUS_03510 18731 19468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 20780 19629 gene locus_tag LOCUS_03520 20780 19629 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529200.1 protein_id gnl|my_center|LOCUS_03520 20951 22240 gene locus_tag LOCUS_03530 gene kynU 20951 22240 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964305.1 protein_id gnl|my_center|LOCUS_03530 22275 23681 gene locus_tag LOCUS_03540 22275 23681 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946627.1 protein_id gnl|my_center|LOCUS_03540 23684 24328 gene locus_tag LOCUS_03550 23684 24328 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_03550 24910 24629 gene locus_tag LOCUS_03560 24910 24629 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964182.1 protein_id gnl|my_center|LOCUS_03560 27303 25000 gene locus_tag LOCUS_03570 27303 25000 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_03570 27875 27369 gene locus_tag LOCUS_03580 27875 27369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 28712 27936 gene locus_tag LOCUS_03590 28712 27936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 29668 28901 gene locus_tag LOCUS_03600 29668 28901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 30240 29833 gene locus_tag LOCUS_03610 30240 29833 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231200.1 protein_id gnl|my_center|LOCUS_03610 30392 31096 gene locus_tag LOCUS_03620 gene pepE 30392 31096 CDS product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964229.1 protein_id gnl|my_center|LOCUS_03620 31521 31093 gene locus_tag LOCUS_03630 31521 31093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 31580 31867 gene locus_tag LOCUS_03640 31580 31867 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025680.1 protein_id gnl|my_center|LOCUS_03640 31854 32312 gene locus_tag LOCUS_03650 31854 32312 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633757.1 protein_id gnl|my_center|LOCUS_03650 32312 33046 gene locus_tag LOCUS_03660 32312 33046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 33087 33851 gene locus_tag LOCUS_03670 33087 33851 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928819.1 protein_id gnl|my_center|LOCUS_03670 34583 36100 gene locus_tag LOCUS_03680 gene gpmI 34583 36100 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964233.1 protein_id gnl|my_center|LOCUS_03680 36112 36729 gene locus_tag LOCUS_03690 36112 36729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 36969 39587 gene locus_tag LOCUS_03700 36969 39587 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146312796.1 protein_id gnl|my_center|LOCUS_03700 39760 40458 gene locus_tag LOCUS_03710 39760 40458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 40584 41117 gene locus_tag LOCUS_03720 40584 41117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 41465 42682 gene locus_tag LOCUS_03730 41465 42682 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268636.1 protein_id gnl|my_center|LOCUS_03730 42757 43503 gene locus_tag LOCUS_03740 42757 43503 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_03740 44304 44645 gene locus_tag LOCUS_03750 44304 44645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 44590 44901 gene locus_tag LOCUS_03760 44590 44901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 45106 46074 gene locus_tag LOCUS_03770 45106 46074 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204065824.1 protein_id gnl|my_center|LOCUS_03770 46076 46987 gene locus_tag LOCUS_03780 46076 46987 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_03780 47550 47963 gene locus_tag LOCUS_03790 47550 47963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 47960 48670 gene locus_tag LOCUS_03800 47960 48670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 48663 49124 gene locus_tag LOCUS_03810 48663 49124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 49208 49618 gene locus_tag LOCUS_03820 49208 49618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 50406 51065 gene locus_tag LOCUS_03830 50406 51065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 51070 51825 gene locus_tag LOCUS_03840 51070 51825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 52097 52477 gene locus_tag LOCUS_03850 52097 52477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 52587 53375 gene locus_tag LOCUS_03860 52587 53375 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941331.1 protein_id gnl|my_center|LOCUS_03860 53670 54584 gene locus_tag LOCUS_03870 53670 54584 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104808194.1 protein_id gnl|my_center|LOCUS_03870 54891 55526 gene locus_tag LOCUS_03880 54891 55526 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110587.1 protein_id gnl|my_center|LOCUS_03880 55563 55934 gene locus_tag LOCUS_03890 55563 55934 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_03890 55924 56337 gene locus_tag LOCUS_03900 55924 56337 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966951.1 protein_id gnl|my_center|LOCUS_03900 57074 56334 gene locus_tag LOCUS_03910 57074 56334 CDS product DUF5995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728394.1 protein_id gnl|my_center|LOCUS_03910 57540 60080 gene locus_tag LOCUS_03920 gene uvrA 57540 60080 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349876.1 protein_id gnl|my_center|LOCUS_03920 60188 61180 gene locus_tag LOCUS_03930 gene ldhA 60188 61180 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762236.1 protein_id gnl|my_center|LOCUS_03930 61228 62157 gene locus_tag LOCUS_03940 gene rlmF 61228 62157 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705227.1 protein_id gnl|my_center|LOCUS_03940 62428 62279 gene locus_tag LOCUS_03950 62428 62279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 64303 62489 gene locus_tag LOCUS_03960 64303 62489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 66741 64495 gene locus_tag LOCUS_03970 gene katG 66741 64495 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963840.1 protein_id gnl|my_center|LOCUS_03970 67067 67402 gene locus_tag LOCUS_03980 67067 67402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 67444 67941 gene locus_tag LOCUS_03990 67444 67941 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266812.1 protein_id gnl|my_center|LOCUS_03990 68846 67938 gene locus_tag LOCUS_04000 68846 67938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 69118 70641 gene locus_tag LOCUS_04010 69118 70641 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889607.1 protein_id gnl|my_center|LOCUS_04010 70652 71026 gene locus_tag LOCUS_04020 70652 71026 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070936545.1 protein_id gnl|my_center|LOCUS_04020 71514 71176 gene locus_tag LOCUS_04030 71514 71176 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962694.1 protein_id gnl|my_center|LOCUS_04030 71819 71514 gene locus_tag LOCUS_04040 71819 71514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 71993 72601 gene locus_tag LOCUS_04050 71993 72601 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947316.1 protein_id gnl|my_center|LOCUS_04050 72605 73258 gene locus_tag LOCUS_04060 72605 73258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 73319 75073 gene locus_tag LOCUS_04070 73319 75073 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_04070 75707 75075 gene locus_tag LOCUS_04080 75707 75075 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097944.1 protein_id gnl|my_center|LOCUS_04080 75706 76353 gene locus_tag LOCUS_04090 gene pyrE 75706 76353 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962823.1 protein_id gnl|my_center|LOCUS_04090 76379 76771 gene locus_tag LOCUS_04100 76379 76771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962824.1 protein_id gnl|my_center|LOCUS_04100 77500 76772 gene locus_tag LOCUS_04110 77500 76772 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361998.1 protein_id gnl|my_center|LOCUS_04110 77584 77955 gene locus_tag LOCUS_04120 gene rsfS 77584 77955 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962763.1 protein_id gnl|my_center|LOCUS_04120 77964 79949 gene locus_tag LOCUS_04130 gene ftsH 77964 79949 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962764.1 protein_id gnl|my_center|LOCUS_04130 80053 80667 gene locus_tag LOCUS_04140 80053 80667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962765.1 protein_id gnl|my_center|LOCUS_04140 80669 81472 gene locus_tag LOCUS_04150 80669 81472 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962766.1 protein_id gnl|my_center|LOCUS_04150 81462 82118 gene locus_tag LOCUS_04160 81462 82118 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_04160 82126 82401 gene locus_tag LOCUS_04170 82126 82401 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962768.1 protein_id gnl|my_center|LOCUS_04170 85056 82423 gene locus_tag LOCUS_04180 85056 82423 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963808.1 protein_id gnl|my_center|LOCUS_04180 85265 85651 gene locus_tag LOCUS_04190 85265 85651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 87074 85701 gene locus_tag LOCUS_04200 87074 85701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 87185 88375 gene locus_tag LOCUS_04210 87185 88375 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963806.1 protein_id gnl|my_center|LOCUS_04210 88375 89391 gene locus_tag LOCUS_04220 gene murB 88375 89391 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964097.1 protein_id gnl|my_center|LOCUS_04220 89481 89681 gene locus_tag LOCUS_04230 89481 89681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 89711 90805 gene locus_tag LOCUS_04240 89711 90805 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_04240 90796 91353 gene locus_tag LOCUS_04250 90796 91353 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963584.1 protein_id gnl|my_center|LOCUS_04250 91358 92569 gene locus_tag LOCUS_04260 91358 92569 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478826.1 protein_id gnl|my_center|LOCUS_04260 93031 92528 gene locus_tag LOCUS_04270 93031 92528 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869023.1 protein_id gnl|my_center|LOCUS_04270 93130 93528 gene locus_tag LOCUS_04280 93130 93528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 93619 94143 gene locus_tag LOCUS_04290 93619 94143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 98056 94607 gene locus_tag LOCUS_04300 98056 94607 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964044.1 protein_id gnl|my_center|LOCUS_04300 98222 99076 gene locus_tag LOCUS_04310 gene purU 98222 99076 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762395.1 protein_id gnl|my_center|LOCUS_04310 99188 99889 gene locus_tag LOCUS_04320 99188 99889 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_04320 99894 100874 gene locus_tag LOCUS_04330 99894 100874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 101301 104291 gene locus_tag LOCUS_04340 101301 104291 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_04340 104302 105663 gene locus_tag LOCUS_04350 104302 105663 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022835601.1 protein_id gnl|my_center|LOCUS_04350 106496 105717 gene locus_tag LOCUS_04360 106496 105717 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962702.1 protein_id gnl|my_center|LOCUS_04360 107336 106515 gene locus_tag LOCUS_04370 gene pyrF 107336 106515 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_04370 108432 107356 gene locus_tag LOCUS_04380 gene prfA 108432 107356 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964025.1 protein_id gnl|my_center|LOCUS_04380 109263 108544 gene locus_tag LOCUS_04390 109263 108544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 109898 109386 gene locus_tag LOCUS_04400 109898 109386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 111507 110512 gene locus_tag LOCUS_04410 111507 110512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 111752 112591 gene locus_tag LOCUS_04420 111752 112591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 112777 113076 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 113678 113154 gene locus_tag LOCUS_04430 113678 113154 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_04430 115751 113730 gene locus_tag LOCUS_04440 gene ftsZ 115751 113730 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964152.1 protein_id gnl|my_center|LOCUS_04440 117186 115840 gene locus_tag LOCUS_04450 gene ftsA 117186 115840 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098846.1 protein_id gnl|my_center|LOCUS_04450 117879 117190 gene locus_tag LOCUS_04460 117879 117190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 119195 117903 gene locus_tag LOCUS_04470 gene murC 119195 117903 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964155.1 protein_id gnl|my_center|LOCUS_04470 120374 119262 gene locus_tag LOCUS_04480 gene murG 120374 119262 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964156.1 protein_id gnl|my_center|LOCUS_04480 121639 120437 gene locus_tag LOCUS_04490 121639 120437 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_04490 123042 121708 gene locus_tag LOCUS_04500 gene murD 123042 121708 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964158.1 protein_id gnl|my_center|LOCUS_04500 124272 123043 gene locus_tag LOCUS_04510 gene mraY 124272 123043 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_04510 125768 124305 gene locus_tag LOCUS_04520 125768 124305 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964160.1 protein_id gnl|my_center|LOCUS_04520 127756 125765 gene locus_tag LOCUS_04530 127756 125765 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_04530 128081 127764 gene locus_tag LOCUS_04540 128081 127764 CDS product FtsL-like putative cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964162.1 protein_id gnl|my_center|LOCUS_04540 128984 128088 gene locus_tag LOCUS_04550 gene rsmH 128984 128088 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172605046.1 protein_id gnl|my_center|LOCUS_04550 129390 128971 gene locus_tag LOCUS_04560 gene mraZ 129390 128971 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964164.1 protein_id gnl|my_center|LOCUS_04560 129695 130459 gene locus_tag LOCUS_04570 129695 130459 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_04570 130472 131080 gene locus_tag LOCUS_04580 gene yihA 130472 131080 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964166.1 protein_id gnl|my_center|LOCUS_04580 131429 131055 gene locus_tag LOCUS_04590 131429 131055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 131758 131435 gene locus_tag LOCUS_04600 gene gldC 131758 131435 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_04600 132746 131808 gene locus_tag LOCUS_04610 gene gldB 132746 131808 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 protein_id gnl|my_center|LOCUS_04610 132875 133666 gene locus_tag LOCUS_04620 gene nadE 132875 133666 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964169.1 protein_id gnl|my_center|LOCUS_04620 133763 134401 gene locus_tag LOCUS_04630 133763 134401 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964170.1 protein_id gnl|my_center|LOCUS_04630 136359 134398 gene locus_tag LOCUS_04640 gene dnaG 136359 134398 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964171.1 protein_id gnl|my_center|LOCUS_04640 136539 136925 gene locus_tag LOCUS_04650 136539 136925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 138066 137032 gene locus_tag LOCUS_04660 138066 137032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964174.1 protein_id gnl|my_center|LOCUS_04660 138880 138149 gene locus_tag LOCUS_04670 138880 138149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 139430 138861 gene locus_tag LOCUS_04680 139430 138861 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_04680 140569 139592 gene locus_tag LOCUS_04690 140569 139592 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_04690 141646 140603 gene locus_tag LOCUS_04700 gene rlmN 141646 140603 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964179.1 protein_id gnl|my_center|LOCUS_04700 142913 141858 gene locus_tag LOCUS_04710 gene queA 142913 141858 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962415.1 protein_id gnl|my_center|LOCUS_04710 144278 143055 gene locus_tag LOCUS_04720 144278 143055 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962416.1 protein_id gnl|my_center|LOCUS_04720 144630 144304 gene locus_tag LOCUS_04730 144630 144304 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 protein_id gnl|my_center|LOCUS_04730 146689 144719 gene locus_tag LOCUS_04740 146689 144719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 148755 146740 gene locus_tag LOCUS_04750 148755 146740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 150666 148759 gene locus_tag LOCUS_04760 150666 148759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 151155 150703 gene locus_tag LOCUS_04770 gene dtd 151155 150703 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962422.1 protein_id gnl|my_center|LOCUS_04770 152125 151172 gene locus_tag LOCUS_04780 gene rsgA 152125 151172 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962423.1 protein_id gnl|my_center|LOCUS_04780 152205 152663 gene locus_tag LOCUS_04790 152205 152663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 153797 152706 gene locus_tag LOCUS_04800 153797 152706 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_04800 154686 153826 gene locus_tag LOCUS_04810 154686 153826 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179240768.1 protein_id gnl|my_center|LOCUS_04810 155840 154686 gene locus_tag LOCUS_04820 155840 154686 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962425.1 protein_id gnl|my_center|LOCUS_04820 156661 155837 gene locus_tag LOCUS_04830 156661 155837 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962426.1 protein_id gnl|my_center|LOCUS_04830 157101 157997 gene locus_tag LOCUS_04840 gene gldA 157101 157997 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_04840 158006 159061 gene locus_tag LOCUS_04850 158006 159061 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_04850 160908 159631 gene locus_tag LOCUS_04860 160908 159631 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405216.1 protein_id gnl|my_center|LOCUS_04860 161382 160915 gene locus_tag LOCUS_04870 161382 160915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 164005 161369 gene locus_tag LOCUS_04880 164005 161369 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_04880 164816 163998 gene locus_tag LOCUS_04890 164816 163998 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141114.1 protein_id gnl|my_center|LOCUS_04890 169178 165012 gene locus_tag LOCUS_04900 169178 165012 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108607.1 protein_id gnl|my_center|LOCUS_04900 169340 172432 gene locus_tag LOCUS_04910 169340 172432 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130856111.1 protein_id gnl|my_center|LOCUS_04910 172454 174142 gene locus_tag LOCUS_04920 172454 174142 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108525.1 protein_id gnl|my_center|LOCUS_04920 174216 176636 gene locus_tag LOCUS_04930 174216 176636 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582505.1 protein_id gnl|my_center|LOCUS_04930 177939 176689 gene locus_tag LOCUS_04940 177939 176689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 179011 179295 gene locus_tag LOCUS_04950 179011 179295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 179314 180492 gene locus_tag LOCUS_04960 179314 180492 CDS product VapE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962655.1 protein_id gnl|my_center|LOCUS_04960 180733 181587 gene locus_tag LOCUS_04970 180733 181587 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202327.1 protein_id gnl|my_center|LOCUS_04970 181787 181972 gene locus_tag LOCUS_04980 181787 181972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 181969 182796 gene locus_tag LOCUS_04990 181969 182796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 182793 183107 gene locus_tag LOCUS_05000 182793 183107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 186484 183221 gene locus_tag LOCUS_05010 186484 183221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 187040 186504 gene locus_tag LOCUS_05020 187040 186504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962459.1 protein_id gnl|my_center|LOCUS_05020 187380 187177 gene locus_tag LOCUS_05030 187380 187177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 187941 187399 gene locus_tag LOCUS_05040 187941 187399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962459.1 protein_id gnl|my_center|LOCUS_05040 189683 188460 gene locus_tag LOCUS_05050 189683 188460 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_05050 190003 189928 gene locus_tag LOCUS_t00040 190003 189928 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 191291 190068 gene locus_tag LOCUS_05060 191291 190068 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_05060 192121 191291 gene locus_tag LOCUS_05070 192121 191291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964028.1 protein_id gnl|my_center|LOCUS_05070 192655 192263 gene locus_tag LOCUS_05080 192655 192263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 193361 192657 gene locus_tag LOCUS_05090 193361 192657 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_05090 194875 193442 gene locus_tag LOCUS_05100 gene nhaB 194875 193442 CDS product sodium/proton antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113594.1 protein_id gnl|my_center|LOCUS_05100 196176 194950 gene locus_tag LOCUS_05110 196176 194950 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_05110 197319 196243 gene locus_tag LOCUS_05120 197319 196243 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_05120 197600 198742 gene locus_tag LOCUS_05130 197600 198742 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_05130 201142 199493 gene locus_tag LOCUS_05140 201142 199493 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087177.1 protein_id gnl|my_center|LOCUS_05140 201451 202614 gene locus_tag LOCUS_05150 gene galK 201451 202614 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 protein_id gnl|my_center|LOCUS_05150 202657 203694 gene locus_tag LOCUS_05160 gene galT 202657 203694 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693184.1 protein_id gnl|my_center|LOCUS_05160 203696 204712 gene locus_tag LOCUS_05170 203696 204712 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_05170 205741 204719 gene locus_tag LOCUS_05180 gene galE 205741 204719 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962575.1 protein_id gnl|my_center|LOCUS_05180 206593 205787 gene locus_tag LOCUS_05190 206593 205787 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664611.1 protein_id gnl|my_center|LOCUS_05190 209836 206660 gene locus_tag LOCUS_05200 209836 206660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 210845 209829 gene locus_tag LOCUS_05210 210845 209829 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082991.1 protein_id gnl|my_center|LOCUS_05210 211087 211581 gene locus_tag LOCUS_05220 211087 211581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 211609 212298 gene locus_tag LOCUS_05230 211609 212298 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_05230 212295 213107 gene locus_tag LOCUS_05240 212295 213107 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933475.1 protein_id gnl|my_center|LOCUS_05240 213274 213612 gene locus_tag LOCUS_05250 213274 213612 CDS product arsenosugar biosynthesis-associated peroxidase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986517.1 protein_id gnl|my_center|LOCUS_05250 213676 214749 gene locus_tag LOCUS_05260 gene arsS 213676 214749 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272562.1 protein_id gnl|my_center|LOCUS_05260 214911 215447 gene locus_tag LOCUS_05270 214911 215447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 215541 218732 gene locus_tag LOCUS_05280 215541 218732 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_05280 218763 220205 gene locus_tag LOCUS_05290 218763 220205 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_05290 220352 221557 gene locus_tag LOCUS_05300 220352 221557 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943755.1 protein_id gnl|my_center|LOCUS_05300 221539 222420 gene locus_tag LOCUS_05310 221539 222420 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_05310 222469 223437 gene locus_tag LOCUS_05320 gene arsM 222469 223437 CDS product arsenosugar biosynthesis arsenite methyltransferase ArsM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143344.1 protein_id gnl|my_center|LOCUS_05320 224992 223511 gene locus_tag LOCUS_05330 224992 223511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 225178 225639 gene locus_tag LOCUS_05340 225178 225639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 226674 225742 gene locus_tag LOCUS_05350 gene era 226674 225742 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964066.1 protein_id gnl|my_center|LOCUS_05350 227616 226831 gene locus_tag LOCUS_05360 227616 226831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 228916 227699 gene locus_tag LOCUS_05370 228916 227699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 229552 228923 gene locus_tag LOCUS_05380 229552 228923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 230287 229571 gene locus_tag LOCUS_05390 230287 229571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 230314 230646 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 231737 231375 gene locus_tag LOCUS_05400 231737 231375 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_05400 232699 231902 gene locus_tag LOCUS_05410 232699 231902 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962570.1 protein_id gnl|my_center|LOCUS_05410 232858 234339 gene locus_tag LOCUS_05420 232858 234339 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_05420 234385 235386 gene locus_tag LOCUS_05430 234385 235386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 236683 235451 gene locus_tag LOCUS_05440 gene clpX 236683 235451 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964183.1 protein_id gnl|my_center|LOCUS_05440 237455 236748 gene locus_tag LOCUS_05450 gene clpP 237455 236748 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964184.1 protein_id gnl|my_center|LOCUS_05450 238896 237574 gene locus_tag LOCUS_05460 238896 237574 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964185.1 protein_id gnl|my_center|LOCUS_05460 239333 238992 gene locus_tag LOCUS_05470 239333 238992 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 protein_id gnl|my_center|LOCUS_05470 240972 239413 gene locus_tag LOCUS_05480 240972 239413 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962292.1 protein_id gnl|my_center|LOCUS_05480 242225 240990 gene locus_tag LOCUS_05490 242225 240990 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839408.1 protein_id gnl|my_center|LOCUS_05490 243251 242475 gene locus_tag LOCUS_05500 243251 242475 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_05500 243964 243251 gene locus_tag LOCUS_05510 243964 243251 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964190.1 protein_id gnl|my_center|LOCUS_05510 244052 244714 gene locus_tag LOCUS_05520 244052 244714 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964191.1 protein_id gnl|my_center|LOCUS_05520 244724 245608 gene locus_tag LOCUS_05530 244724 245608 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_05530 245705 246397 gene locus_tag LOCUS_05540 245705 246397 CDS product DUF6089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964193.1 protein_id gnl|my_center|LOCUS_05540 247096 247401 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 247479 250064 gene locus_tag LOCUS_05550 gene bamA 247479 250064 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100221.1 protein_id gnl|my_center|LOCUS_05550 250099 251043 gene locus_tag LOCUS_05560 250099 251043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 251115 251627 gene locus_tag LOCUS_05570 251115 251627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 251698 252486 gene locus_tag LOCUS_05580 gene murI 251698 252486 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964198.1 protein_id gnl|my_center|LOCUS_05580 253481 252483 gene locus_tag LOCUS_05590 253481 252483 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964200.1 protein_id gnl|my_center|LOCUS_05590 253622 254524 gene locus_tag LOCUS_05600 253622 254524 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964201.1 protein_id gnl|my_center|LOCUS_05600 254610 254810 gene locus_tag LOCUS_05610 254610 254810 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_05610 254989 255846 gene locus_tag LOCUS_05620 254989 255846 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902661.1 protein_id gnl|my_center|LOCUS_05620 256521 255850 gene locus_tag LOCUS_05630 gene tsaB 256521 255850 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_05630 257790 256525 gene locus_tag LOCUS_05640 257790 256525 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_05640 259265 257823 gene locus_tag LOCUS_05650 259265 257823 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_05650 260482 259331 gene locus_tag LOCUS_05660 260482 259331 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_05660 261769 260510 gene locus_tag LOCUS_05670 261769 260510 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108314.1 protein_id gnl|my_center|LOCUS_05670 263031 261787 gene locus_tag LOCUS_05680 263031 261787 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_05680 263689 263024 gene locus_tag LOCUS_05690 263689 263024 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_05690 263669 263833 gene locus_tag LOCUS_05700 263669 263833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 264079 263864 gene locus_tag LOCUS_05710 264079 263864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 264661 264086 gene locus_tag LOCUS_05720 264661 264086 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_05720 265411 264662 gene locus_tag LOCUS_05730 265411 264662 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964210.1 protein_id gnl|my_center|LOCUS_05730 266043 265417 gene locus_tag LOCUS_05740 266043 265417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964209.1 protein_id gnl|my_center|LOCUS_05740 266559 266200 gene locus_tag LOCUS_05750 266559 266200 CDS product cytochrome C oxidase subunit IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964208.1 protein_id gnl|my_center|LOCUS_05750 267591 266608 gene locus_tag LOCUS_05760 267591 266608 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 protein_id gnl|my_center|LOCUS_05760 268314 267721 gene locus_tag LOCUS_05770 268314 267721 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_05770 269141 268314 gene locus_tag LOCUS_05780 gene cyoE 269141 268314 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964205.1 protein_id gnl|my_center|LOCUS_05780 269802 269389 gene locus_tag LOCUS_05790 269802 269389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 271914 269812 gene locus_tag LOCUS_05800 271914 269812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964216.1 protein_id gnl|my_center|LOCUS_05800 272828 272049 gene locus_tag LOCUS_05810 272828 272049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 273667 272939 gene locus_tag LOCUS_05820 273667 272939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 273963 273721 gene locus_tag LOCUS_05830 273963 273721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 274480 274100 gene locus_tag LOCUS_05840 gene gcvH 274480 274100 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964219.1 protein_id gnl|my_center|LOCUS_05840 281803 274493 gene locus_tag LOCUS_05850 gene sprA 281803 274493 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100614127.1 protein_id gnl|my_center|LOCUS_05850 282391 281810 gene locus_tag LOCUS_05860 gene ruvA 282391 281810 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964221.1 protein_id gnl|my_center|LOCUS_05860 284771 282468 gene locus_tag LOCUS_05870 284771 282468 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_05870 286422 284941 gene locus_tag LOCUS_05880 286422 284941 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038455.1 protein_id gnl|my_center|LOCUS_05880 287510 286581 gene locus_tag LOCUS_05890 gene queG 287510 286581 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_05890 288832 287507 gene locus_tag LOCUS_05900 288832 287507 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_05900 289875 288853 gene locus_tag LOCUS_05910 gene ruvB 289875 288853 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964224.1 protein_id gnl|my_center|LOCUS_05910 291841 290012 gene locus_tag LOCUS_05920 291841 290012 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_05920 292939 291872 gene locus_tag LOCUS_05930 292939 291872 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_05930 294349 292967 gene locus_tag LOCUS_05940 294349 292967 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962548.1 protein_id gnl|my_center|LOCUS_05940 295042 294371 gene locus_tag LOCUS_05950 295042 294371 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 protein_id gnl|my_center|LOCUS_05950 295585 295046 gene locus_tag LOCUS_05960 295585 295046 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_05960 297378 295588 gene locus_tag LOCUS_05970 gene nrfD 297378 295588 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_05970 300507 297412 gene locus_tag LOCUS_05980 300507 297412 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_05980 301917 300565 gene locus_tag LOCUS_05990 301917 300565 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_05990 302329 302630 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 303229 303539 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence003 87 13 gene locus_tag LOCUS_t00050 87 13 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1588 257 gene locus_tag LOCUS_06000 gene rseP 1588 257 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766369.1 protein_id gnl|my_center|LOCUS_06000 1809 2489 gene locus_tag LOCUS_06010 1809 2489 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099939.1 protein_id gnl|my_center|LOCUS_06010 2852 3088 gene locus_tag LOCUS_06020 2852 3088 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962269.1 protein_id gnl|my_center|LOCUS_06020 3081 5183 gene locus_tag LOCUS_06030 gene feoB 3081 5183 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962270.1 protein_id gnl|my_center|LOCUS_06030 5816 5370 gene locus_tag LOCUS_06040 5816 5370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 6810 5989 gene locus_tag LOCUS_06050 6810 5989 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_06050 8695 6830 gene locus_tag LOCUS_06060 8695 6830 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962257.1 protein_id gnl|my_center|LOCUS_06060 9365 8715 gene locus_tag LOCUS_06070 9365 8715 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_06070 9459 11813 gene locus_tag LOCUS_06080 9459 11813 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769027.1 protein_id gnl|my_center|LOCUS_06080 11758 12312 gene locus_tag LOCUS_06090 11758 12312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 12363 13511 gene locus_tag LOCUS_06100 12363 13511 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963565.1 protein_id gnl|my_center|LOCUS_06100 14315 13536 gene locus_tag LOCUS_06110 14315 13536 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 protein_id gnl|my_center|LOCUS_06110 15578 14436 gene locus_tag LOCUS_06120 15578 14436 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_06120 18118 15620 gene locus_tag LOCUS_06130 18118 15620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06130 19966 18215 gene locus_tag LOCUS_06140 19966 18215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06140 20446 20045 gene locus_tag LOCUS_06150 20446 20045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 24608 20544 gene locus_tag LOCUS_06160 24608 20544 CDS product T9SS type B sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963617.1 protein_id gnl|my_center|LOCUS_06160 25584 24838 gene locus_tag LOCUS_06170 gene djlA 25584 24838 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073436.1 protein_id gnl|my_center|LOCUS_06170 25959 26369 gene locus_tag LOCUS_06180 25959 26369 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_06180 26494 28284 gene locus_tag LOCUS_06190 26494 28284 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029327287.1 protein_id gnl|my_center|LOCUS_06190 28400 28690 gene locus_tag LOCUS_06200 28400 28690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 28849 29046 gene locus_tag LOCUS_06210 28849 29046 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_06210 29316 30089 gene locus_tag LOCUS_06220 29316 30089 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143916869.1 protein_id gnl|my_center|LOCUS_06220 31707 30091 gene locus_tag LOCUS_06230 31707 30091 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_06230 32322 31762 gene locus_tag LOCUS_06240 32322 31762 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964515.1 protein_id gnl|my_center|LOCUS_06240 32494 33375 gene locus_tag LOCUS_06250 32494 33375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962608.1 protein_id gnl|my_center|LOCUS_06250 33579 35114 gene locus_tag LOCUS_06260 33579 35114 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964517.1 protein_id gnl|my_center|LOCUS_06260 35216 38230 gene locus_tag LOCUS_06270 35216 38230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 41642 38232 gene locus_tag LOCUS_06280 41642 38232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_06280 41939 42706 gene locus_tag LOCUS_06290 41939 42706 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962243.1 protein_id gnl|my_center|LOCUS_06290 42780 43739 gene locus_tag LOCUS_06300 42780 43739 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_06300 43831 44865 gene locus_tag LOCUS_06310 43831 44865 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104034.1 protein_id gnl|my_center|LOCUS_06310 45778 44873 gene locus_tag LOCUS_06320 45778 44873 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067957.1 protein_id gnl|my_center|LOCUS_06320 46095 45805 gene locus_tag LOCUS_06330 46095 45805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 47006 46095 gene locus_tag LOCUS_06340 47006 46095 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789714.1 protein_id gnl|my_center|LOCUS_06340 47845 47153 gene locus_tag LOCUS_06350 47845 47153 CDS product divalent heavy-metal cations transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775812.1 protein_id gnl|my_center|LOCUS_06350 48580 47846 gene locus_tag LOCUS_06360 48580 47846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 49414 48692 gene locus_tag LOCUS_06370 49414 48692 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 protein_id gnl|my_center|LOCUS_06370 50849 49485 gene locus_tag LOCUS_06380 50849 49485 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228249.1 protein_id gnl|my_center|LOCUS_06380 52070 50976 gene locus_tag LOCUS_06390 52070 50976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 53231 52155 gene locus_tag LOCUS_06400 53231 52155 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958153.1 protein_id gnl|my_center|LOCUS_06400 55158 53407 gene locus_tag LOCUS_06410 55158 53407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 55807 55343 gene locus_tag LOCUS_06420 55807 55343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 56255 55800 gene locus_tag LOCUS_06430 56255 55800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 57180 56398 gene locus_tag LOCUS_06440 57180 56398 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_06440 58754 57291 gene locus_tag LOCUS_06450 58754 57291 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962229.1 protein_id gnl|my_center|LOCUS_06450 59336 58785 gene locus_tag LOCUS_06460 59336 58785 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_06460 62556 59461 gene locus_tag LOCUS_06470 62556 59461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_06470 63956 62592 gene locus_tag LOCUS_06480 63956 62592 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_06480 65060 64020 gene locus_tag LOCUS_06490 gene hemH 65060 64020 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962227.1 protein_id gnl|my_center|LOCUS_06490 65476 65171 gene locus_tag LOCUS_06500 65476 65171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 65694 65476 gene locus_tag LOCUS_06510 65694 65476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 66557 65832 gene locus_tag LOCUS_06520 66557 65832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 67449 66562 gene locus_tag LOCUS_06530 67449 66562 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962226.1 protein_id gnl|my_center|LOCUS_06530 67641 68906 gene locus_tag LOCUS_06540 gene hemA 67641 68906 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962225.1 protein_id gnl|my_center|LOCUS_06540 68910 69827 gene locus_tag LOCUS_06550 gene hemC 68910 69827 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962224.1 protein_id gnl|my_center|LOCUS_06550 69874 71013 gene locus_tag LOCUS_06560 69874 71013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 71050 72081 gene locus_tag LOCUS_06570 gene hemE 71050 72081 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962222.1 protein_id gnl|my_center|LOCUS_06570 72078 72569 gene locus_tag LOCUS_06580 72078 72569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 72566 73318 gene locus_tag LOCUS_06590 72566 73318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 73311 73841 gene locus_tag LOCUS_06600 73311 73841 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962220.1 protein_id gnl|my_center|LOCUS_06600 73845 74747 gene locus_tag LOCUS_06610 gene hemF 73845 74747 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962218.1 protein_id gnl|my_center|LOCUS_06610 74766 76061 gene locus_tag LOCUS_06620 74766 76061 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104227.1 protein_id gnl|my_center|LOCUS_06620 76061 77272 gene locus_tag LOCUS_06630 76061 77272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 77354 78343 gene locus_tag LOCUS_06640 gene hemB 77354 78343 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962216.1 protein_id gnl|my_center|LOCUS_06640 78346 78855 gene locus_tag LOCUS_06650 78346 78855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 78953 80131 gene locus_tag LOCUS_06660 78953 80131 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_06660 80128 80601 gene locus_tag LOCUS_06670 80128 80601 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962214.1 protein_id gnl|my_center|LOCUS_06670 80653 81792 gene locus_tag LOCUS_06680 80653 81792 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130543805.1 protein_id gnl|my_center|LOCUS_06680 81795 82508 gene locus_tag LOCUS_06690 81795 82508 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_06690 86332 82568 gene locus_tag LOCUS_06700 86332 82568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 86681 88369 gene locus_tag LOCUS_06710 86681 88369 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206616.1 protein_id gnl|my_center|LOCUS_06710 89498 88842 gene locus_tag LOCUS_06720 89498 88842 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_06720 90141 89503 gene locus_tag LOCUS_06730 90141 89503 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186345.1 protein_id gnl|my_center|LOCUS_06730 90875 90171 gene locus_tag LOCUS_06740 90875 90171 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_06740 93423 91087 gene locus_tag LOCUS_06750 93423 91087 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_06750 93910 93428 gene locus_tag LOCUS_06760 93910 93428 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962205.1 protein_id gnl|my_center|LOCUS_06760 95072 93903 gene locus_tag LOCUS_06770 gene ricT 95072 93903 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_06770 96373 95339 gene locus_tag LOCUS_06780 96373 95339 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962203.1 protein_id gnl|my_center|LOCUS_06780 96534 97010 gene locus_tag LOCUS_06790 96534 97010 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389994.1 protein_id gnl|my_center|LOCUS_06790 97496 98506 gene locus_tag LOCUS_06800 gene recA 97496 98506 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_06800 98572 98985 gene locus_tag LOCUS_06810 98572 98985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150543285.1 protein_id gnl|my_center|LOCUS_06810 99007 99543 gene locus_tag LOCUS_06820 99007 99543 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_06820 99565 101067 gene locus_tag LOCUS_06830 99565 101067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 101940 101176 gene locus_tag LOCUS_06840 101940 101176 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_06840 102057 103025 gene locus_tag LOCUS_06850 gene trpS 102057 103025 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_06850 104122 103022 gene locus_tag LOCUS_06860 gene dprA 104122 103022 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_06860 104251 105180 gene locus_tag LOCUS_06870 104251 105180 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964525.1 protein_id gnl|my_center|LOCUS_06870 105372 105887 gene locus_tag LOCUS_06880 105372 105887 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_06880 106458 105889 gene locus_tag LOCUS_06890 106458 105889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 107188 106493 gene locus_tag LOCUS_06900 107188 106493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 107795 107199 gene locus_tag LOCUS_06910 107795 107199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 108486 107803 gene locus_tag LOCUS_06920 108486 107803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 109794 108547 gene locus_tag LOCUS_06930 109794 108547 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_06930 110561 109794 gene locus_tag LOCUS_06940 110561 109794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 111908 110562 gene locus_tag LOCUS_06950 111908 110562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964529.1 protein_id gnl|my_center|LOCUS_06950 112910 111918 gene locus_tag LOCUS_06960 112910 111918 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_06960 113836 113033 gene locus_tag LOCUS_06970 113836 113033 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_06970 114469 114035 gene locus_tag LOCUS_06980 gene dut 114469 114035 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964537.1 protein_id gnl|my_center|LOCUS_06980 115908 114472 gene locus_tag LOCUS_06990 115908 114472 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_06990 116406 115984 gene locus_tag LOCUS_07000 116406 115984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 117385 116510 gene locus_tag LOCUS_07010 gene atpG 117385 116510 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964544.1 protein_id gnl|my_center|LOCUS_07010 119011 117431 gene locus_tag LOCUS_07020 gene atpA 119011 117431 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964545.1 protein_id gnl|my_center|LOCUS_07020 119600 119061 gene locus_tag LOCUS_07030 gene atpH 119600 119061 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964546.1 protein_id gnl|my_center|LOCUS_07030 120213 119614 gene locus_tag LOCUS_07040 120213 119614 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964547.1 protein_id gnl|my_center|LOCUS_07040 120463 120236 gene locus_tag LOCUS_07050 120463 120236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 121743 120499 gene locus_tag LOCUS_07060 gene atpB 121743 120499 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964549.1 protein_id gnl|my_center|LOCUS_07060 122177 121776 gene locus_tag LOCUS_07070 122177 121776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 122392 122177 gene locus_tag LOCUS_07080 122392 122177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 122765 122361 gene locus_tag LOCUS_07090 122765 122361 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964553.1 protein_id gnl|my_center|LOCUS_07090 125257 122765 gene locus_tag LOCUS_07100 125257 122765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 protein_id gnl|my_center|LOCUS_07100 126513 125800 gene locus_tag LOCUS_07110 126513 125800 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_07110 128045 126576 gene locus_tag LOCUS_07120 128045 126576 CDS product DUF5687 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079703094.1 protein_id gnl|my_center|LOCUS_07120 128152 129204 gene locus_tag LOCUS_07130 128152 129204 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964555.1 protein_id gnl|my_center|LOCUS_07130 130271 129327 gene locus_tag LOCUS_07140 130271 129327 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983101.1 protein_id gnl|my_center|LOCUS_07140 131494 130502 gene locus_tag LOCUS_07150 131494 130502 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043924886.1 protein_id gnl|my_center|LOCUS_07150 132157 131543 gene locus_tag LOCUS_07160 132157 131543 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_07160 133159 132164 gene locus_tag LOCUS_07170 133159 132164 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106543.1 protein_id gnl|my_center|LOCUS_07170 133800 133156 gene locus_tag LOCUS_07180 133800 133156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111525078.1 protein_id gnl|my_center|LOCUS_07180 134720 133788 gene locus_tag LOCUS_07190 134720 133788 CDS product DUF6427 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964559.1 protein_id gnl|my_center|LOCUS_07190 134802 135017 gene locus_tag LOCUS_07200 134802 135017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 136358 135087 gene locus_tag LOCUS_07210 gene purD 136358 135087 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964560.1 protein_id gnl|my_center|LOCUS_07210 136429 137721 gene locus_tag LOCUS_07220 136429 137721 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964561.1 protein_id gnl|my_center|LOCUS_07220 138485 137718 gene locus_tag LOCUS_07230 138485 137718 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426498.1 protein_id gnl|my_center|LOCUS_07230 139815 138463 gene locus_tag LOCUS_07240 139815 138463 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 protein_id gnl|my_center|LOCUS_07240 140006 141094 gene locus_tag LOCUS_07250 140006 141094 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824469.1 protein_id gnl|my_center|LOCUS_07250 142308 141109 gene locus_tag LOCUS_07260 142308 141109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 144755 143445 gene locus_tag LOCUS_07270 144755 143445 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148882924.1 protein_id gnl|my_center|LOCUS_07270 144856 145950 gene locus_tag LOCUS_07280 144856 145950 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478388.1 protein_id gnl|my_center|LOCUS_07280 146907 145939 gene locus_tag LOCUS_07290 146907 145939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 148598 146907 gene locus_tag LOCUS_07300 148598 146907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_07300 150109 148616 gene locus_tag LOCUS_07310 150109 148616 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_07310 150975 150109 gene locus_tag LOCUS_07320 150975 150109 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_07320 151162 151341 gene locus_tag LOCUS_07330 151162 151341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 152390 151413 gene locus_tag LOCUS_07340 152390 151413 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404416.1 protein_id gnl|my_center|LOCUS_07340 154013 152409 gene locus_tag LOCUS_07350 154013 152409 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962200.1 protein_id gnl|my_center|LOCUS_07350 155286 154099 gene locus_tag LOCUS_07360 155286 154099 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962199.1 protein_id gnl|my_center|LOCUS_07360 155418 156566 gene locus_tag LOCUS_07370 155418 156566 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962192.1 protein_id gnl|my_center|LOCUS_07370 157182 156610 gene locus_tag LOCUS_07380 157182 156610 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962186.1 protein_id gnl|my_center|LOCUS_07380 158231 157401 gene locus_tag LOCUS_07390 158231 157401 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_07390 160166 158289 gene locus_tag LOCUS_07400 gene mnmG 160166 158289 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962184.1 protein_id gnl|my_center|LOCUS_07400 160657 160238 gene locus_tag LOCUS_07410 gene ybeY 160657 160238 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962183.1 protein_id gnl|my_center|LOCUS_07410 164051 160650 gene locus_tag LOCUS_07420 164051 160650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_215436752.1 protein_id gnl|my_center|LOCUS_07420 164243 165757 gene locus_tag LOCUS_07430 gene gltX 164243 165757 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964585.1 protein_id gnl|my_center|LOCUS_07430 166366 165752 gene locus_tag LOCUS_07440 166366 165752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 166554 167492 gene locus_tag LOCUS_07450 166554 167492 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_07450 167784 167548 gene locus_tag LOCUS_07460 167784 167548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 168185 167787 gene locus_tag LOCUS_07470 168185 167787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 168566 168192 gene locus_tag LOCUS_07480 168566 168192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 170744 168714 gene locus_tag LOCUS_07490 170744 168714 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964580.1 protein_id gnl|my_center|LOCUS_07490 170931 171287 gene locus_tag LOCUS_07500 gene folB 170931 171287 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964579.1 protein_id gnl|my_center|LOCUS_07500 171339 171410 gene locus_tag LOCUS_t00060 171339 171410 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 172326 171616 gene locus_tag LOCUS_07510 172326 171616 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964578.1 protein_id gnl|my_center|LOCUS_07510 173130 172486 gene locus_tag LOCUS_07520 173130 172486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 175424 173220 gene locus_tag LOCUS_07530 gene rnr 175424 173220 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964576.1 protein_id gnl|my_center|LOCUS_07530 176479 177402 gene locus_tag LOCUS_07540 176479 177402 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964573.1 protein_id gnl|my_center|LOCUS_07540 177412 177852 gene locus_tag LOCUS_07550 177412 177852 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962201.1 protein_id gnl|my_center|LOCUS_07550 178287 177910 gene locus_tag LOCUS_07560 178287 177910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 180053 178425 gene locus_tag LOCUS_07570 180053 178425 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964434.1 protein_id gnl|my_center|LOCUS_07570 180889 180071 gene locus_tag LOCUS_07580 180889 180071 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680721.1 protein_id gnl|my_center|LOCUS_07580 181285 180908 gene locus_tag LOCUS_07590 181285 180908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 183313 181430 gene locus_tag LOCUS_07600 183313 181430 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_07600 184977 183319 gene locus_tag LOCUS_07610 184977 183319 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964485.1 protein_id gnl|my_center|LOCUS_07610 185897 185040 gene locus_tag LOCUS_07620 185897 185040 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_07620 186189 188054 gene locus_tag LOCUS_07630 186189 188054 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100653.1 protein_id gnl|my_center|LOCUS_07630 188123 189217 gene locus_tag LOCUS_07640 188123 189217 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838427.1 protein_id gnl|my_center|LOCUS_07640 191243 189447 gene locus_tag LOCUS_07650 gene lepA 191243 189447 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964332.1 protein_id gnl|my_center|LOCUS_07650 191500 193923 gene locus_tag LOCUS_07660 191500 193923 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_07660 194044 195051 gene locus_tag LOCUS_07670 gene dusB 194044 195051 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964342.1 protein_id gnl|my_center|LOCUS_07670 196250 195048 gene locus_tag LOCUS_07680 196250 195048 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962414.1 protein_id gnl|my_center|LOCUS_07680 196650 196258 gene locus_tag LOCUS_07690 gene rbfA 196650 196258 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962413.1 protein_id gnl|my_center|LOCUS_07690 196829 197230 gene locus_tag LOCUS_07700 gene mce 196829 197230 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_07700 197318 197392 gene locus_tag LOCUS_t00070 197318 197392 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 197562 198497 gene locus_tag LOCUS_07710 197562 198497 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015940983.1 protein_id gnl|my_center|LOCUS_07710 198508 199122 gene locus_tag LOCUS_07720 198508 199122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 199481 199128 gene locus_tag LOCUS_07730 199481 199128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 200317 199484 gene locus_tag LOCUS_07740 200317 199484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 200631 200413 gene locus_tag LOCUS_07750 200631 200413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 200924 200625 gene locus_tag LOCUS_07760 200924 200625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 201677 201006 gene locus_tag LOCUS_07770 201677 201006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 202912 201677 gene locus_tag LOCUS_07780 202912 201677 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767676.1 protein_id gnl|my_center|LOCUS_07780 203541 203777 gene locus_tag LOCUS_07790 203541 203777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 204339 203749 gene locus_tag LOCUS_07800 204339 203749 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_07800 204480 205556 gene locus_tag LOCUS_07810 gene pdxA 204480 205556 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964471.1 protein_id gnl|my_center|LOCUS_07810 205654 206205 gene locus_tag LOCUS_07820 205654 206205 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_07820 206215 206415 gene locus_tag LOCUS_07830 gene rpmF 206215 206415 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964469.1 protein_id gnl|my_center|LOCUS_07830 206578 207573 gene locus_tag LOCUS_07840 206578 207573 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964468.1 protein_id gnl|my_center|LOCUS_07840 207601 208101 gene locus_tag LOCUS_07850 gene accB 207601 208101 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_07850 208195 209547 gene locus_tag LOCUS_07860 gene accC 208195 209547 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_07860 209811 210929 gene locus_tag LOCUS_07870 209811 210929 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 protein_id gnl|my_center|LOCUS_07870 211670 210933 gene locus_tag LOCUS_07880 211670 210933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 212660 211737 gene locus_tag LOCUS_07890 212660 211737 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963622.1 protein_id gnl|my_center|LOCUS_07890 214906 212741 gene locus_tag LOCUS_07900 214906 212741 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479228.1 protein_id gnl|my_center|LOCUS_07900 215990 215001 gene locus_tag LOCUS_07910 215990 215001 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962688.1 protein_id gnl|my_center|LOCUS_07910 216733 216314 gene locus_tag LOCUS_07920 gene mscL 216733 216314 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963210.1 protein_id gnl|my_center|LOCUS_07920 217903 216788 gene locus_tag LOCUS_07930 217903 216788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 218549 217908 gene locus_tag LOCUS_07940 218549 217908 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963208.1 protein_id gnl|my_center|LOCUS_07940 218651 219508 gene locus_tag LOCUS_07950 218651 219508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963207.1 protein_id gnl|my_center|LOCUS_07950 219465 220190 gene locus_tag LOCUS_07960 gene rsmI 219465 220190 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963206.1 protein_id gnl|my_center|LOCUS_07960 220781 220194 gene locus_tag LOCUS_07970 220781 220194 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146459507.1 protein_id gnl|my_center|LOCUS_07970 220950 222509 gene locus_tag LOCUS_07980 220950 222509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 222511 224205 gene locus_tag LOCUS_07990 gene recJ 222511 224205 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_07990 224265 224612 gene locus_tag LOCUS_08000 224265 224612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 225388 224609 gene locus_tag LOCUS_08010 225388 224609 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_08010 225862 225398 gene locus_tag LOCUS_08020 225862 225398 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 protein_id gnl|my_center|LOCUS_08020 226078 226725 gene locus_tag LOCUS_08030 226078 226725 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025312.1 protein_id gnl|my_center|LOCUS_08030 228106 226766 gene locus_tag LOCUS_08040 228106 226766 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 protein_id gnl|my_center|LOCUS_08040 228655 228152 gene locus_tag LOCUS_08050 228655 228152 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964325.1 protein_id gnl|my_center|LOCUS_08050 228701 229501 gene locus_tag LOCUS_08060 228701 229501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 229542 229616 gene locus_tag LOCUS_t00080 229542 229616 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 230005 229706 gene locus_tag LOCUS_08070 230005 229706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 230602 230201 gene locus_tag LOCUS_08080 230602 230201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 231140 230694 gene locus_tag LOCUS_08090 231140 230694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 231427 231146 gene locus_tag LOCUS_08100 231427 231146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 232258 231509 gene locus_tag LOCUS_08110 232258 231509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 232452 232273 gene locus_tag LOCUS_08120 232452 232273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 233777 232464 gene locus_tag LOCUS_08130 233777 232464 CDS product phage integrase SAM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362019.1 protein_id gnl|my_center|LOCUS_08130 235311 234034 gene locus_tag LOCUS_08140 235311 234034 CDS product DUF3570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963601.1 protein_id gnl|my_center|LOCUS_08140 235539 235327 gene locus_tag LOCUS_08150 235539 235327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 236432 235536 gene locus_tag LOCUS_08160 236432 235536 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059223299.1 protein_id gnl|my_center|LOCUS_08160 236964 236524 gene locus_tag LOCUS_08170 236964 236524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 237796 237131 gene locus_tag LOCUS_08180 237796 237131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 239402 237798 gene locus_tag LOCUS_08190 239402 237798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 239659 239492 gene locus_tag LOCUS_08200 239659 239492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 240007 240381 gene locus_tag LOCUS_08210 240007 240381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 240830 240441 gene locus_tag LOCUS_08220 240830 240441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 243643 240944 gene locus_tag LOCUS_08230 243643 240944 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962332.1 protein_id gnl|my_center|LOCUS_08230 245099 243723 gene locus_tag LOCUS_08240 245099 243723 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962333.1 protein_id gnl|my_center|LOCUS_08240 246622 245246 gene locus_tag LOCUS_08250 246622 245246 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962333.1 protein_id gnl|my_center|LOCUS_08250 250004 246864 gene locus_tag LOCUS_08260 250004 246864 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962336.1 protein_id gnl|my_center|LOCUS_08260 250094 250774 gene locus_tag LOCUS_08270 250094 250774 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962337.1 protein_id gnl|my_center|LOCUS_08270 251561 251891 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 253891 251993 gene locus_tag LOCUS_08280 253891 251993 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_08280 254866 253943 gene locus_tag LOCUS_08290 254866 253943 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_08290 255659 255024 gene locus_tag LOCUS_08300 255659 255024 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108811.1 protein_id gnl|my_center|LOCUS_08300 256416 255850 gene locus_tag LOCUS_08310 gene purN 256416 255850 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796813.1 protein_id gnl|my_center|LOCUS_08310 >Feature sequence004 161 524 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 716 1774 gene locus_tag LOCUS_08320 716 1774 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_08320 1969 3033 gene locus_tag LOCUS_08330 gene serC 1969 3033 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962801.1 protein_id gnl|my_center|LOCUS_08330 3064 4014 gene locus_tag LOCUS_08340 3064 4014 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 protein_id gnl|my_center|LOCUS_08340 4143 4778 gene locus_tag LOCUS_08350 4143 4778 CDS product DUF937 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962799.1 protein_id gnl|my_center|LOCUS_08350 4947 5303 gene locus_tag LOCUS_08360 4947 5303 CDS product DUF6146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962798.1 protein_id gnl|my_center|LOCUS_08360 5348 5863 gene locus_tag LOCUS_08370 5348 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 7629 6076 gene locus_tag LOCUS_08380 7629 6076 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109230.1 protein_id gnl|my_center|LOCUS_08380 7962 10400 gene locus_tag LOCUS_08390 gene thrA 7962 10400 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_08390 10412 11341 gene locus_tag LOCUS_08400 10412 11341 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_08400 11429 12727 gene locus_tag LOCUS_08410 gene thrC 11429 12727 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_08410 12782 13864 gene locus_tag LOCUS_08420 gene gcvT 12782 13864 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962992.1 protein_id gnl|my_center|LOCUS_08420 14081 14710 gene locus_tag LOCUS_08430 14081 14710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 14721 15794 gene locus_tag LOCUS_08440 14721 15794 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964034.1 protein_id gnl|my_center|LOCUS_08440 17404 15875 gene locus_tag LOCUS_08450 17404 15875 CDS product curlin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071155.1 protein_id gnl|my_center|LOCUS_08450 19230 18025 gene locus_tag LOCUS_08460 19230 18025 CDS product curlin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071155.1 protein_id gnl|my_center|LOCUS_08460 19906 22884 gene locus_tag LOCUS_08470 19906 22884 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_08470 22887 24185 gene locus_tag LOCUS_08480 22887 24185 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_08480 25528 24260 gene locus_tag LOCUS_08490 25528 24260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962908.1 protein_id gnl|my_center|LOCUS_08490 28091 25557 gene locus_tag LOCUS_08500 gene gyrA 28091 25557 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962907.1 protein_id gnl|my_center|LOCUS_08500 28337 30883 gene locus_tag LOCUS_08510 28337 30883 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_08510 30981 31148 gene locus_tag LOCUS_08520 30981 31148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 31173 31373 gene locus_tag LOCUS_08530 31173 31373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 31699 31397 gene locus_tag LOCUS_08540 31699 31397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 32343 31744 gene locus_tag LOCUS_08550 gene folE 32343 31744 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791113.1 protein_id gnl|my_center|LOCUS_08550 32929 32378 gene locus_tag LOCUS_08560 gene msrA 32929 32378 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_08560 33173 33835 gene locus_tag LOCUS_08570 33173 33835 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962793.1 protein_id gnl|my_center|LOCUS_08570 33816 34607 gene locus_tag LOCUS_08580 33816 34607 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503931.1 protein_id gnl|my_center|LOCUS_08580 34713 35921 gene locus_tag LOCUS_08590 34713 35921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 35961 37871 gene locus_tag LOCUS_08600 35961 37871 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_08600 37868 39121 gene locus_tag LOCUS_08610 37868 39121 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_08610 39125 39454 gene locus_tag LOCUS_08620 39125 39454 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963234.1 protein_id gnl|my_center|LOCUS_08620 39456 40109 gene locus_tag LOCUS_08630 39456 40109 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963235.1 protein_id gnl|my_center|LOCUS_08630 40588 40106 gene locus_tag LOCUS_08640 40588 40106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963236.1 protein_id gnl|my_center|LOCUS_08640 41376 40594 gene locus_tag LOCUS_08650 41376 40594 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_08650 41468 42925 gene locus_tag LOCUS_08660 41468 42925 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 protein_id gnl|my_center|LOCUS_08660 44629 42971 gene locus_tag LOCUS_08670 44629 42971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 44785 46026 gene locus_tag LOCUS_08680 44785 46026 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_08680 46523 46047 gene locus_tag LOCUS_08690 46523 46047 CDS product DUF6495 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963953.1 protein_id gnl|my_center|LOCUS_08690 47039 46590 gene locus_tag LOCUS_08700 gene rplI 47039 46590 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963954.1 protein_id gnl|my_center|LOCUS_08700 47353 47054 gene locus_tag LOCUS_08710 gene rpsR 47353 47054 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963955.1 protein_id gnl|my_center|LOCUS_08710 47694 47356 gene locus_tag LOCUS_08720 gene rpsF 47694 47356 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963956.1 protein_id gnl|my_center|LOCUS_08720 47902 48603 gene locus_tag LOCUS_08730 47902 48603 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963957.1 protein_id gnl|my_center|LOCUS_08730 51107 48654 gene locus_tag LOCUS_08740 gene priA 51107 48654 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963958.1 protein_id gnl|my_center|LOCUS_08740 51605 51177 gene locus_tag LOCUS_08750 51605 51177 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179084.1 protein_id gnl|my_center|LOCUS_08750 52665 51667 gene locus_tag LOCUS_08760 52665 51667 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_08760 53523 52666 gene locus_tag LOCUS_08770 gene nadC 53523 52666 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963961.1 protein_id gnl|my_center|LOCUS_08770 53647 54120 gene locus_tag LOCUS_08780 gene rlmH 53647 54120 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963965.1 protein_id gnl|my_center|LOCUS_08780 54776 54267 gene locus_tag LOCUS_08790 54776 54267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 56320 54785 gene locus_tag LOCUS_08800 56320 54785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 61573 56660 gene locus_tag LOCUS_08810 61573 56660 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121034.1 protein_id gnl|my_center|LOCUS_08810 63783 61717 gene locus_tag LOCUS_08820 63783 61717 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121033.1 protein_id gnl|my_center|LOCUS_08820 64419 63799 gene locus_tag LOCUS_08830 64419 63799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 65234 64515 gene locus_tag LOCUS_08840 65234 64515 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930705.1 protein_id gnl|my_center|LOCUS_08840 65642 65247 gene locus_tag LOCUS_08850 65642 65247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 65912 66667 gene locus_tag LOCUS_08860 65912 66667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 67009 66650 gene locus_tag LOCUS_08870 67009 66650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 68020 67067 gene locus_tag LOCUS_08880 68020 67067 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919320.1 protein_id gnl|my_center|LOCUS_08880 69004 68195 gene locus_tag LOCUS_08890 gene mazG 69004 68195 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_08890 69692 69147 gene locus_tag LOCUS_08900 69692 69147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 70400 69813 gene locus_tag LOCUS_08910 gene def 70400 69813 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963863.1 protein_id gnl|my_center|LOCUS_08910 70852 70445 gene locus_tag LOCUS_08920 gene ruvX 70852 70445 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786562.1 protein_id gnl|my_center|LOCUS_08920 71046 71861 gene locus_tag LOCUS_08930 71046 71861 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_08930 72635 71874 gene locus_tag LOCUS_08940 72635 71874 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963748.1 protein_id gnl|my_center|LOCUS_08940 72680 73762 gene locus_tag LOCUS_08950 72680 73762 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016813.1 protein_id gnl|my_center|LOCUS_08950 74583 73759 gene locus_tag LOCUS_08960 74583 73759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 74617 75651 gene locus_tag LOCUS_08970 74617 75651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 75699 76751 gene locus_tag LOCUS_08980 75699 76751 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355946.1 protein_id gnl|my_center|LOCUS_08980 76770 77618 gene locus_tag LOCUS_08990 76770 77618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 77642 78541 gene locus_tag LOCUS_09000 77642 78541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 78545 79132 gene locus_tag LOCUS_09010 78545 79132 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963755.1 protein_id gnl|my_center|LOCUS_09010 79139 80560 gene locus_tag LOCUS_09020 79139 80560 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963756.1 protein_id gnl|my_center|LOCUS_09020 80724 81755 gene locus_tag LOCUS_09030 80724 81755 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087694.1 protein_id gnl|my_center|LOCUS_09030 81788 82309 gene locus_tag LOCUS_09040 81788 82309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963768.1 protein_id gnl|my_center|LOCUS_09040 82413 83471 gene locus_tag LOCUS_09050 82413 83471 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_09050 83865 83518 gene locus_tag LOCUS_09060 83865 83518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 84051 85106 gene locus_tag LOCUS_09070 84051 85106 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_09070 85099 85821 gene locus_tag LOCUS_09080 85099 85821 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_09080 87871 85871 gene locus_tag LOCUS_09090 gene uvrB 87871 85871 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963054.1 protein_id gnl|my_center|LOCUS_09090 90703 88013 gene locus_tag LOCUS_09100 90703 88013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 91671 90841 gene locus_tag LOCUS_09110 91671 90841 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963772.1 protein_id gnl|my_center|LOCUS_09110 92605 91679 gene locus_tag LOCUS_09120 92605 91679 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 protein_id gnl|my_center|LOCUS_09120 92672 93745 gene locus_tag LOCUS_09130 92672 93745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 95584 93782 gene locus_tag LOCUS_09140 95584 93782 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403165.1 protein_id gnl|my_center|LOCUS_09140 95690 97894 gene locus_tag LOCUS_09150 95690 97894 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_09150 97928 99283 gene locus_tag LOCUS_09160 97928 99283 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_09160 99334 99822 gene locus_tag LOCUS_09170 99334 99822 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811295.1 protein_id gnl|my_center|LOCUS_09170 99822 100280 gene locus_tag LOCUS_09180 99822 100280 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454240.1 protein_id gnl|my_center|LOCUS_09180 100216 101913 gene locus_tag LOCUS_09190 100216 101913 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093328686.1 protein_id gnl|my_center|LOCUS_09190 101921 102490 gene locus_tag LOCUS_09200 101921 102490 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_09200 103739 102549 gene locus_tag LOCUS_09210 103739 102549 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_09210 105270 103759 gene locus_tag LOCUS_09220 gene araA 105270 103759 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368279.1 protein_id gnl|my_center|LOCUS_09220 106962 105313 gene locus_tag LOCUS_09230 106962 105313 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087135.1 protein_id gnl|my_center|LOCUS_09230 107690 106992 gene locus_tag LOCUS_09240 107690 106992 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642916.1 protein_id gnl|my_center|LOCUS_09240 109380 107683 gene locus_tag LOCUS_09250 109380 107683 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298170.1 protein_id gnl|my_center|LOCUS_09250 111823 109463 gene locus_tag LOCUS_09260 111823 109463 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107211.1 protein_id gnl|my_center|LOCUS_09260 112805 111825 gene locus_tag LOCUS_09270 112805 111825 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083685838.1 protein_id gnl|my_center|LOCUS_09270 113810 112809 gene locus_tag LOCUS_09280 113810 112809 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107223.1 protein_id gnl|my_center|LOCUS_09280 115324 113840 gene locus_tag LOCUS_09290 gene abfB 115324 113840 CDS product alpha-L-arabinofuranosidase AbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398654.1 protein_id gnl|my_center|LOCUS_09290 115582 116271 gene locus_tag LOCUS_09300 115582 116271 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_09300 116436 117341 gene locus_tag LOCUS_09310 116436 117341 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_09310 117350 118813 gene locus_tag LOCUS_09320 gene crtI 117350 118813 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_09320 118820 119659 gene locus_tag LOCUS_09330 118820 119659 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_09330 119661 120110 gene locus_tag LOCUS_09340 119661 120110 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_09340 120111 120824 gene locus_tag LOCUS_09350 120111 120824 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120331.1 protein_id gnl|my_center|LOCUS_09350 122418 120814 gene locus_tag LOCUS_09360 gene bshC 122418 120814 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963529.1 protein_id gnl|my_center|LOCUS_09360 122542 125022 gene locus_tag LOCUS_09370 122542 125022 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404969.1 protein_id gnl|my_center|LOCUS_09370 125029 125595 gene locus_tag LOCUS_09380 125029 125595 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704518.1 protein_id gnl|my_center|LOCUS_09380 125614 128460 gene locus_tag LOCUS_09390 125614 128460 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_09390 128530 129528 gene locus_tag LOCUS_09400 128530 129528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 129947 129525 gene locus_tag LOCUS_09410 129947 129525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 131268 129958 gene locus_tag LOCUS_09420 gene rimO 131268 129958 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963524.1 protein_id gnl|my_center|LOCUS_09420 131352 132431 gene locus_tag LOCUS_09430 131352 132431 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_09430 132813 132538 gene locus_tag LOCUS_09440 132813 132538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 134531 132885 gene locus_tag LOCUS_09450 134531 132885 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759455.1 protein_id gnl|my_center|LOCUS_09450 135566 134613 gene locus_tag LOCUS_09460 gene ftsY 135566 134613 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963551.1 protein_id gnl|my_center|LOCUS_09460 135852 135700 gene locus_tag LOCUS_09470 135852 135700 CDS product DUF4295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963552.1 protein_id gnl|my_center|LOCUS_09470 136038 135856 gene locus_tag LOCUS_09480 gene rpmG 136038 135856 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963553.1 protein_id gnl|my_center|LOCUS_09480 136301 136062 gene locus_tag LOCUS_09490 gene rpmB 136301 136062 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963554.1 protein_id gnl|my_center|LOCUS_09490 137628 136381 gene locus_tag LOCUS_09500 137628 136381 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963555.1 protein_id gnl|my_center|LOCUS_09500 137969 137628 gene locus_tag LOCUS_09510 137969 137628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 138597 137986 gene locus_tag LOCUS_09520 138597 137986 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_09520 139554 138601 gene locus_tag LOCUS_09530 139554 138601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 140333 139557 gene locus_tag LOCUS_09540 140333 139557 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963559.1 protein_id gnl|my_center|LOCUS_09540 141887 140541 gene locus_tag LOCUS_09550 141887 140541 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962751.1 protein_id gnl|my_center|LOCUS_09550 143085 141967 gene locus_tag LOCUS_09560 143085 141967 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962750.1 protein_id gnl|my_center|LOCUS_09560 143706 143089 gene locus_tag LOCUS_09570 gene recR 143706 143089 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963432.1 protein_id gnl|my_center|LOCUS_09570 144609 143746 gene locus_tag LOCUS_09580 gene rfbD 144609 143746 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964565.1 protein_id gnl|my_center|LOCUS_09580 145156 144602 gene locus_tag LOCUS_09590 gene rfbC 145156 144602 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023680.1 protein_id gnl|my_center|LOCUS_09590 146013 145156 gene locus_tag LOCUS_09600 gene rfbA 146013 145156 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721498.1 protein_id gnl|my_center|LOCUS_09600 147072 146023 gene locus_tag LOCUS_09610 gene rfbB 147072 146023 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963426.1 protein_id gnl|my_center|LOCUS_09610 148196 147069 gene locus_tag LOCUS_09620 gene wecB 148196 147069 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866670.1 protein_id gnl|my_center|LOCUS_09620 149454 148183 gene locus_tag LOCUS_09630 149454 148183 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963428.1 protein_id gnl|my_center|LOCUS_09630 150463 149465 gene locus_tag LOCUS_09640 150463 149465 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_09640 150652 151140 gene locus_tag LOCUS_09650 150652 151140 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461991.1 protein_id gnl|my_center|LOCUS_09650 151165 152106 gene locus_tag LOCUS_09660 gene mscS 151165 152106 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896747.1 protein_id gnl|my_center|LOCUS_09660 152291 153430 gene locus_tag LOCUS_09670 152291 153430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 154996 153431 gene locus_tag LOCUS_09680 154996 153431 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_09680 158729 155019 gene locus_tag LOCUS_09690 158729 155019 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163515044.1 protein_id gnl|my_center|LOCUS_09690 158790 159995 gene locus_tag LOCUS_09700 158790 159995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 162384 160006 gene locus_tag LOCUS_09710 162384 160006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 162601 163743 gene locus_tag LOCUS_09720 162601 163743 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_09720 166276 163823 gene locus_tag LOCUS_09730 166276 163823 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303124.1 protein_id gnl|my_center|LOCUS_09730 169635 166396 gene locus_tag LOCUS_09740 169635 166396 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_09740 171672 169714 gene locus_tag LOCUS_09750 171672 169714 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203328.1 protein_id gnl|my_center|LOCUS_09750 173844 171679 gene locus_tag LOCUS_09760 173844 171679 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_09760 174565 177684 gene locus_tag LOCUS_09770 174565 177684 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_09770 177697 179625 gene locus_tag LOCUS_09780 177697 179625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 179736 181463 gene locus_tag LOCUS_09790 179736 181463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 181835 181476 gene locus_tag LOCUS_09800 181835 181476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 183791 181992 gene locus_tag LOCUS_09810 183791 181992 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_09810 185691 183958 gene locus_tag LOCUS_09820 185691 183958 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640593.1 protein_id gnl|my_center|LOCUS_09820 187757 185739 gene locus_tag LOCUS_09830 187757 185739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 189346 187955 gene locus_tag LOCUS_09840 189346 187955 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890799.1 protein_id gnl|my_center|LOCUS_09840 191316 189370 gene locus_tag LOCUS_09850 191316 189370 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767036.1 protein_id gnl|my_center|LOCUS_09850 194003 191325 gene locus_tag LOCUS_09860 194003 191325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 195160 194021 gene locus_tag LOCUS_09870 195160 194021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 196266 195166 gene locus_tag LOCUS_09880 196266 195166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 198872 196263 gene locus_tag LOCUS_09890 198872 196263 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108580.1 protein_id gnl|my_center|LOCUS_09890 201299 198885 gene locus_tag LOCUS_09900 201299 198885 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107211.1 protein_id gnl|my_center|LOCUS_09900 203763 201307 gene locus_tag LOCUS_09910 203763 201307 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303191.1 protein_id gnl|my_center|LOCUS_09910 205125 203764 gene locus_tag LOCUS_09920 205125 203764 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890799.1 protein_id gnl|my_center|LOCUS_09920 207024 205129 gene locus_tag LOCUS_09930 207024 205129 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767043.1 protein_id gnl|my_center|LOCUS_09930 207450 211580 gene locus_tag LOCUS_09940 207450 211580 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_09940 212662 211583 gene locus_tag LOCUS_09950 212662 211583 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640639.1 protein_id gnl|my_center|LOCUS_09950 214166 212682 gene locus_tag LOCUS_09960 214166 212682 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089742.1 protein_id gnl|my_center|LOCUS_09960 217579 214244 gene locus_tag LOCUS_09970 217579 214244 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_09970 219154 217670 gene locus_tag LOCUS_09980 219154 217670 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_09980 222154 219167 gene locus_tag LOCUS_09990 222154 219167 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_09990 222499 224559 gene locus_tag LOCUS_10000 222499 224559 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_10000 224732 225853 gene locus_tag LOCUS_10010 224732 225853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 225841 228279 gene locus_tag LOCUS_10020 225841 228279 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_10020 228661 228962 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 229038 228963 gene locus_tag LOCUS_t00090 229038 228963 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 229148 229064 gene locus_tag LOCUS_t00100 229148 229064 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 231334 229289 gene locus_tag LOCUS_10030 231334 229289 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_10030 231591 232766 gene locus_tag LOCUS_10040 231591 232766 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_10040 232937 233686 gene locus_tag LOCUS_10050 232937 233686 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_10050 234921 233761 gene locus_tag LOCUS_10060 234921 233761 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962888.1 protein_id gnl|my_center|LOCUS_10060 234997 235665 gene locus_tag LOCUS_10070 234997 235665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 protein_id gnl|my_center|LOCUS_10070 235667 236095 gene locus_tag LOCUS_10080 235667 236095 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964040.1 protein_id gnl|my_center|LOCUS_10080 236727 236092 gene locus_tag LOCUS_10090 236727 236092 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072423.1 protein_id gnl|my_center|LOCUS_10090 236909 237553 gene locus_tag LOCUS_10100 236909 237553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10100 237719 239197 gene locus_tag LOCUS_10110 237719 239197 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119999.1 protein_id gnl|my_center|LOCUS_10110 >Feature sequence005 748 673 gene locus_tag LOCUS_t00110 748 673 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 981 1427 gene locus_tag LOCUS_10120 981 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 1876 1433 gene locus_tag LOCUS_10130 1876 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 3003 1873 gene locus_tag LOCUS_10140 3003 1873 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_10140 3289 4149 gene locus_tag LOCUS_10150 gene trxB 3289 4149 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_10150 4554 4219 gene locus_tag LOCUS_10160 4554 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 5708 4629 gene locus_tag LOCUS_10170 gene aroB 5708 4629 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963817.1 protein_id gnl|my_center|LOCUS_10170 5798 6970 gene locus_tag LOCUS_10180 5798 6970 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_10180 7376 6993 gene locus_tag LOCUS_10190 7376 6993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 8588 7392 gene locus_tag LOCUS_10200 8588 7392 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_10200 9199 8666 gene locus_tag LOCUS_10210 9199 8666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 9320 9180 gene locus_tag LOCUS_10220 9320 9180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 9990 9583 gene locus_tag LOCUS_10230 gene tsaE 9990 9583 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 protein_id gnl|my_center|LOCUS_10230 11554 10007 gene locus_tag LOCUS_10240 11554 10007 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_10240 11760 12863 gene locus_tag LOCUS_10250 11760 12863 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_10250 12888 13916 gene locus_tag LOCUS_10260 gene lpxD 12888 13916 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963125.1 protein_id gnl|my_center|LOCUS_10260 13906 15315 gene locus_tag LOCUS_10270 13906 15315 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963124.1 protein_id gnl|my_center|LOCUS_10270 15319 16104 gene locus_tag LOCUS_10280 gene lpxA 15319 16104 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_10280 16136 16702 gene locus_tag LOCUS_10290 gene efp 16136 16702 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963122.1 protein_id gnl|my_center|LOCUS_10290 16706 17641 gene locus_tag LOCUS_10300 16706 17641 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_10300 17643 18056 gene locus_tag LOCUS_10310 17643 18056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963120.1 protein_id gnl|my_center|LOCUS_10310 18208 19080 gene locus_tag LOCUS_10320 gene sucD 18208 19080 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963119.1 protein_id gnl|my_center|LOCUS_10320 19204 19950 gene locus_tag LOCUS_10330 gene fabG 19204 19950 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_10330 19973 22012 gene locus_tag LOCUS_10340 19973 22012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_10340 22059 22922 gene locus_tag LOCUS_10350 22059 22922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 23567 22980 gene locus_tag LOCUS_10360 23567 22980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 24292 23564 gene locus_tag LOCUS_10370 24292 23564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 24569 25429 gene locus_tag LOCUS_10380 gene hisG 24569 25429 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963108.1 protein_id gnl|my_center|LOCUS_10380 25456 26748 gene locus_tag LOCUS_10390 gene hisD 25456 26748 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963107.1 protein_id gnl|my_center|LOCUS_10390 26748 27797 gene locus_tag LOCUS_10400 gene hisC 26748 27797 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963106.1 protein_id gnl|my_center|LOCUS_10400 27806 28963 gene locus_tag LOCUS_10410 gene hisB 27806 28963 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963105.1 protein_id gnl|my_center|LOCUS_10410 28974 29555 gene locus_tag LOCUS_10420 gene hisH 28974 29555 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963104.1 protein_id gnl|my_center|LOCUS_10420 29585 29950 gene locus_tag LOCUS_10430 29585 29950 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_10430 29982 30734 gene locus_tag LOCUS_10440 gene hisA 29982 30734 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963103.1 protein_id gnl|my_center|LOCUS_10440 30777 31532 gene locus_tag LOCUS_10450 gene hisF 30777 31532 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963102.1 protein_id gnl|my_center|LOCUS_10450 31565 32158 gene locus_tag LOCUS_10460 gene hisIE 31565 32158 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963101.1 protein_id gnl|my_center|LOCUS_10460 33565 32162 gene locus_tag LOCUS_10470 33565 32162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 34166 33660 gene locus_tag LOCUS_10480 34166 33660 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262936.1 protein_id gnl|my_center|LOCUS_10480 34500 35081 gene locus_tag LOCUS_10490 34500 35081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 37198 35078 gene locus_tag LOCUS_10500 gene recQ 37198 35078 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229616.1 protein_id gnl|my_center|LOCUS_10500 37445 38332 gene locus_tag LOCUS_10510 37445 38332 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909400.1 protein_id gnl|my_center|LOCUS_10510 38336 39373 gene locus_tag LOCUS_10520 38336 39373 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_10520 39578 40924 gene locus_tag LOCUS_10530 39578 40924 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_10530 41320 40946 gene locus_tag LOCUS_10540 41320 40946 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121396.1 protein_id gnl|my_center|LOCUS_10540 41584 41321 gene locus_tag LOCUS_10550 41584 41321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 42012 41665 gene locus_tag LOCUS_10560 42012 41665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 42210 43484 gene locus_tag LOCUS_10570 42210 43484 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_10570 44070 43492 gene locus_tag LOCUS_10580 44070 43492 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964094.1 protein_id gnl|my_center|LOCUS_10580 44270 44770 gene locus_tag LOCUS_10590 44270 44770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 44789 45832 gene locus_tag LOCUS_10600 44789 45832 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037063.1 protein_id gnl|my_center|LOCUS_10600 45985 47790 gene locus_tag LOCUS_10610 45985 47790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 47855 48304 gene locus_tag LOCUS_10620 47855 48304 CDS product KTSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964067.1 protein_id gnl|my_center|LOCUS_10620 48314 49174 gene locus_tag LOCUS_10630 48314 49174 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583014.1 protein_id gnl|my_center|LOCUS_10630 49308 50357 gene locus_tag LOCUS_10640 49308 50357 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971709.1 protein_id gnl|my_center|LOCUS_10640 53794 50432 gene locus_tag LOCUS_10650 gene treS 53794 50432 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257046.1 protein_id gnl|my_center|LOCUS_10650 54172 54420 gene locus_tag LOCUS_10660 54172 54420 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_10660 54534 56081 gene locus_tag LOCUS_10670 54534 56081 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983276.1 protein_id gnl|my_center|LOCUS_10670 56081 56296 gene locus_tag LOCUS_10680 56081 56296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 56869 57861 gene locus_tag LOCUS_10690 gene lpxD 56869 57861 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963712.1 protein_id gnl|my_center|LOCUS_10690 58760 57858 gene locus_tag LOCUS_10700 58760 57858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 61970 58839 gene locus_tag LOCUS_10710 61970 58839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 62369 62091 gene locus_tag LOCUS_10720 62369 62091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 62721 63254 gene locus_tag LOCUS_10730 62721 63254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 63389 64951 gene locus_tag LOCUS_10740 63389 64951 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122546.1 protein_id gnl|my_center|LOCUS_10740 64951 65214 gene locus_tag LOCUS_10750 64951 65214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 65277 67196 gene locus_tag LOCUS_10760 65277 67196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 67221 67745 gene locus_tag LOCUS_10770 gene msrA 67221 67745 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870242.1 protein_id gnl|my_center|LOCUS_10770 67842 68513 gene locus_tag LOCUS_10780 67842 68513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 68790 69719 gene locus_tag LOCUS_10790 gene yedA 68790 69719 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210807.1 protein_id gnl|my_center|LOCUS_10790 69866 72745 gene locus_tag LOCUS_10800 69866 72745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 72871 73617 gene locus_tag LOCUS_10810 72871 73617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 73918 74931 gene locus_tag LOCUS_10820 73918 74931 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643768.1 protein_id gnl|my_center|LOCUS_10820 75029 75220 gene locus_tag LOCUS_10830 75029 75220 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_10830 75949 75305 gene locus_tag LOCUS_10840 75949 75305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 76704 76153 gene locus_tag LOCUS_10850 76704 76153 CDS product DUF4494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964064.1 protein_id gnl|my_center|LOCUS_10850 77160 77633 gene locus_tag LOCUS_10860 77160 77633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 79241 77706 gene locus_tag LOCUS_10870 79241 77706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 81363 79525 gene locus_tag LOCUS_10880 81363 79525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 81907 82506 gene locus_tag LOCUS_10890 81907 82506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963138.1 protein_id gnl|my_center|LOCUS_10890 82865 83335 gene locus_tag LOCUS_10900 82865 83335 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387043.1 protein_id gnl|my_center|LOCUS_10900 84577 83819 gene locus_tag LOCUS_10910 84577 83819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 84832 86478 gene locus_tag LOCUS_10920 84832 86478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 87592 88512 gene locus_tag LOCUS_10930 87592 88512 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 protein_id gnl|my_center|LOCUS_10930 88705 88896 gene locus_tag LOCUS_10940 88705 88896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 89452 88898 gene locus_tag LOCUS_10950 89452 88898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 89676 89449 gene locus_tag LOCUS_10960 89676 89449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 90538 89684 gene locus_tag LOCUS_10970 90538 89684 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365532.1 protein_id gnl|my_center|LOCUS_10970 90993 90541 gene locus_tag LOCUS_10980 90993 90541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 93104 91137 gene locus_tag LOCUS_10990 93104 91137 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727420.1 protein_id gnl|my_center|LOCUS_10990 93315 94292 gene locus_tag LOCUS_11000 93315 94292 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962707.1 protein_id gnl|my_center|LOCUS_11000 94395 94700 gene locus_tag LOCUS_11010 94395 94700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 94710 95192 gene locus_tag LOCUS_11020 94710 95192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 95638 95267 gene locus_tag LOCUS_11030 95638 95267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 96241 95642 gene locus_tag LOCUS_11040 96241 95642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 96574 96323 gene locus_tag LOCUS_11050 96574 96323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 97947 96676 gene locus_tag LOCUS_11060 97947 96676 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770365.1 protein_id gnl|my_center|LOCUS_11060 98389 97934 gene locus_tag LOCUS_11070 98389 97934 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770367.1 protein_id gnl|my_center|LOCUS_11070 100760 98382 gene locus_tag LOCUS_11080 100760 98382 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839793.1 protein_id gnl|my_center|LOCUS_11080 101002 102474 gene locus_tag LOCUS_11090 101002 102474 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_11090 102516 103463 gene locus_tag LOCUS_11100 102516 103463 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_11100 103616 104608 gene locus_tag LOCUS_11110 103616 104608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 104697 105803 gene locus_tag LOCUS_11120 gene prfB 104697 105803 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117386928.1 protein_id gnl|my_center|LOCUS_11120 105806 106150 gene locus_tag LOCUS_11130 gene arsC 105806 106150 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963715.1 protein_id gnl|my_center|LOCUS_11130 106239 108755 gene locus_tag LOCUS_11140 106239 108755 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_11140 108975 109922 gene locus_tag LOCUS_11150 108975 109922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 110234 111613 gene locus_tag LOCUS_11160 110234 111613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 111887 111714 gene locus_tag LOCUS_11170 111887 111714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963717.1 protein_id gnl|my_center|LOCUS_11170 112015 113430 gene locus_tag LOCUS_11180 gene fumC 112015 113430 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963718.1 protein_id gnl|my_center|LOCUS_11180 113606 114148 gene locus_tag LOCUS_11190 113606 114148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 114181 114549 gene locus_tag LOCUS_11200 114181 114549 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760318.1 protein_id gnl|my_center|LOCUS_11200 114555 115112 gene locus_tag LOCUS_11210 114555 115112 CDS product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207713.1 protein_id gnl|my_center|LOCUS_11210 118506 115264 gene locus_tag LOCUS_11220 gene ccsA 118506 115264 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 protein_id gnl|my_center|LOCUS_11220 118620 119378 gene locus_tag LOCUS_11230 118620 119378 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963540.1 protein_id gnl|my_center|LOCUS_11230 119368 119901 gene locus_tag LOCUS_11240 119368 119901 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_11240 120718 119912 gene locus_tag LOCUS_11250 120718 119912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 121812 120724 gene locus_tag LOCUS_11260 121812 120724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 122462 121944 gene locus_tag LOCUS_11270 122462 121944 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963000.1 protein_id gnl|my_center|LOCUS_11270 125049 122464 gene locus_tag LOCUS_11280 gene ppc 125049 122464 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058155.1 protein_id gnl|my_center|LOCUS_11280 125615 125136 gene locus_tag LOCUS_11290 125615 125136 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962999.1 protein_id gnl|my_center|LOCUS_11290 126846 125683 gene locus_tag LOCUS_11300 126846 125683 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 protein_id gnl|my_center|LOCUS_11300 127137 127553 gene locus_tag LOCUS_11310 127137 127553 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962997.1 protein_id gnl|my_center|LOCUS_11310 127593 127970 gene locus_tag LOCUS_11320 127593 127970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962882.1 protein_id gnl|my_center|LOCUS_11320 128068 129999 gene locus_tag LOCUS_11330 128068 129999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 132062 129996 gene locus_tag LOCUS_11340 132062 129996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 132667 132221 gene locus_tag LOCUS_11350 gene mscL 132667 132221 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207584.1 protein_id gnl|my_center|LOCUS_11350 135313 132671 gene locus_tag LOCUS_11360 135313 132671 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_11360 137205 135349 gene locus_tag LOCUS_11370 137205 135349 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_11370 138182 137505 gene locus_tag LOCUS_11380 138182 137505 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902962.1 protein_id gnl|my_center|LOCUS_11380 138289 138729 gene locus_tag LOCUS_11390 138289 138729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071321.1 protein_id gnl|my_center|LOCUS_11390 139761 138724 gene locus_tag LOCUS_11400 gene corA 139761 138724 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838388.1 protein_id gnl|my_center|LOCUS_11400 140488 139916 gene locus_tag LOCUS_11410 140488 139916 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148770279.1 protein_id gnl|my_center|LOCUS_11410 141396 140599 gene locus_tag LOCUS_11420 gene truA 141396 140599 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_11420 141646 142437 gene locus_tag LOCUS_11430 141646 142437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 142459 143343 gene locus_tag LOCUS_11440 gene cysM 142459 143343 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208391.1 protein_id gnl|my_center|LOCUS_11440 143336 144169 gene locus_tag LOCUS_11450 143336 144169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 144639 144175 gene locus_tag LOCUS_11460 144639 144175 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765470.1 protein_id gnl|my_center|LOCUS_11460 144963 145574 gene locus_tag LOCUS_11470 144963 145574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 145576 146205 gene locus_tag LOCUS_11480 145576 146205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 146205 146861 gene locus_tag LOCUS_11490 146205 146861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 148129 146858 gene locus_tag LOCUS_11500 gene nreB 148129 146858 CDS product nickel resistance MFS transporter NreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117292.1 protein_id gnl|my_center|LOCUS_11500 148842 148237 gene locus_tag LOCUS_11510 148842 148237 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615927.1 protein_id gnl|my_center|LOCUS_11510 149328 148867 gene locus_tag LOCUS_11520 149328 148867 CDS product DUF6428 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_11520 149675 149340 gene locus_tag LOCUS_11530 149675 149340 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405177.1 protein_id gnl|my_center|LOCUS_11530 149833 150297 gene locus_tag LOCUS_11540 149833 150297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 150450 150806 gene locus_tag LOCUS_11550 150450 150806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 150806 151639 gene locus_tag LOCUS_11560 150806 151639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11560 151642 152793 gene locus_tag LOCUS_11570 151642 152793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 153507 152797 gene locus_tag LOCUS_11580 153507 152797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 154362 153511 gene locus_tag LOCUS_11590 154362 153511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 155672 154380 gene locus_tag LOCUS_11600 155672 154380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 156097 155876 gene locus_tag LOCUS_11610 156097 155876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 158349 156163 gene locus_tag LOCUS_11620 158349 156163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 158868 158359 gene locus_tag LOCUS_11630 158868 158359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 160920 158920 gene locus_tag LOCUS_11640 160920 158920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 163612 161198 gene locus_tag LOCUS_11650 163612 161198 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839988.1 protein_id gnl|my_center|LOCUS_11650 164732 163815 gene locus_tag LOCUS_11660 164732 163815 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529392.1 protein_id gnl|my_center|LOCUS_11660 165047 165346 gene locus_tag LOCUS_11670 165047 165346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 167737 165416 gene locus_tag LOCUS_11680 167737 165416 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729998.1 protein_id gnl|my_center|LOCUS_11680 167902 169077 gene locus_tag LOCUS_11690 167902 169077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 169081 169413 gene locus_tag LOCUS_11700 169081 169413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 169413 169991 gene locus_tag LOCUS_11710 169413 169991 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545242.1 protein_id gnl|my_center|LOCUS_11710 169991 170230 gene locus_tag LOCUS_11720 169991 170230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 170240 171295 gene locus_tag LOCUS_11730 gene moeB 170240 171295 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768795.1 protein_id gnl|my_center|LOCUS_11730 171292 171720 gene locus_tag LOCUS_11740 171292 171720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 171855 172772 gene locus_tag LOCUS_11750 gene moaCB 171855 172772 CDS product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207007.1 protein_id gnl|my_center|LOCUS_11750 172765 173772 gene locus_tag LOCUS_11760 gene moaA 172765 173772 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722673.1 protein_id gnl|my_center|LOCUS_11760 173859 175592 gene locus_tag LOCUS_11770 173859 175592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 177212 175677 gene locus_tag LOCUS_11780 177212 175677 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925847.1 protein_id gnl|my_center|LOCUS_11780 177681 179429 gene locus_tag LOCUS_11790 177681 179429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 180195 179431 gene locus_tag LOCUS_11800 180195 179431 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338392.1 protein_id gnl|my_center|LOCUS_11800 180325 180960 gene locus_tag LOCUS_11810 180325 180960 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963076.1 protein_id gnl|my_center|LOCUS_11810 182249 180957 gene locus_tag LOCUS_11820 182249 180957 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_11820 182568 182383 gene locus_tag LOCUS_11830 182568 182383 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704042.1 protein_id gnl|my_center|LOCUS_11830 182712 183230 gene locus_tag LOCUS_11840 182712 183230 CDS product phosphoglycerate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918364.1 protein_id gnl|my_center|LOCUS_11840 183967 183227 gene locus_tag LOCUS_11850 183967 183227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 184265 184729 gene locus_tag LOCUS_11860 gene smpB 184265 184729 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963988.1 protein_id gnl|my_center|LOCUS_11860 184812 187280 gene locus_tag LOCUS_11870 184812 187280 CDS product DUF5686 and carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964117.1 protein_id gnl|my_center|LOCUS_11870 187283 187798 gene locus_tag LOCUS_11880 187283 187798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 187855 189279 gene locus_tag LOCUS_11890 187855 189279 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963044.1 protein_id gnl|my_center|LOCUS_11890 189923 189276 gene locus_tag LOCUS_11900 189923 189276 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198408415.1 protein_id gnl|my_center|LOCUS_11900 190792 189998 gene locus_tag LOCUS_11910 190792 189998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 191485 190835 gene locus_tag LOCUS_11920 191485 190835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 192065 191571 gene locus_tag LOCUS_11930 192065 191571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 192279 192878 gene locus_tag LOCUS_11940 192279 192878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 192878 193729 gene locus_tag LOCUS_11950 192878 193729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 193741 195708 gene locus_tag LOCUS_11960 193741 195708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 195751 196188 gene locus_tag LOCUS_11970 195751 196188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 196188 196619 gene locus_tag LOCUS_11980 196188 196619 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_11980 196623 196784 gene locus_tag LOCUS_11990 196623 196784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 196785 197471 gene locus_tag LOCUS_12000 196785 197471 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941648.1 protein_id gnl|my_center|LOCUS_12000 197505 199253 gene locus_tag LOCUS_12010 197505 199253 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_12010 199258 199554 gene locus_tag LOCUS_12020 199258 199554 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226572031.1 protein_id gnl|my_center|LOCUS_12020 199633 200043 gene locus_tag LOCUS_12030 199633 200043 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_12030 200049 203228 gene locus_tag LOCUS_12040 200049 203228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 203222 205939 gene locus_tag LOCUS_12050 203222 205939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 205952 211150 gene locus_tag LOCUS_12060 205952 211150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 211154 212671 gene locus_tag LOCUS_12070 211154 212671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 212683 213129 gene locus_tag LOCUS_12080 212683 213129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 213140 213463 gene locus_tag LOCUS_12090 213140 213463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 213475 214083 gene locus_tag LOCUS_12100 213475 214083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 214088 218695 gene locus_tag LOCUS_12110 214088 218695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 218702 219529 gene locus_tag LOCUS_12120 218702 219529 CDS product N-acetylmuramidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788692.1 protein_id gnl|my_center|LOCUS_12120 219522 220841 gene locus_tag LOCUS_12130 219522 220841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 220942 221421 gene locus_tag LOCUS_12140 220942 221421 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905907.1 protein_id gnl|my_center|LOCUS_12140 224214 221440 gene locus_tag LOCUS_12150 224214 221440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 225211 224273 gene locus_tag LOCUS_12160 225211 224273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 226172 225369 gene locus_tag LOCUS_12170 226172 225369 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964038.1 protein_id gnl|my_center|LOCUS_12170 226879 226232 gene locus_tag LOCUS_12180 226879 226232 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_12180 226882 227610 gene locus_tag LOCUS_12190 226882 227610 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837255.1 protein_id gnl|my_center|LOCUS_12190 227625 228428 gene locus_tag LOCUS_12200 227625 228428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 228971 228429 gene locus_tag LOCUS_12210 228971 228429 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_12210 229607 228975 gene locus_tag LOCUS_12220 229607 228975 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_12220 230329 229607 gene locus_tag LOCUS_12230 230329 229607 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784744.1 protein_id gnl|my_center|LOCUS_12230 230520 231503 gene locus_tag LOCUS_12240 230520 231503 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108173.1 protein_id gnl|my_center|LOCUS_12240 231487 232344 gene locus_tag LOCUS_12250 231487 232344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 232344 233096 gene locus_tag LOCUS_12260 232344 233096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 233093 234313 gene locus_tag LOCUS_12270 233093 234313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 234313 235377 gene locus_tag LOCUS_12280 234313 235377 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108172.1 protein_id gnl|my_center|LOCUS_12280 235377 236717 gene locus_tag LOCUS_12290 235377 236717 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784758.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence006 321 1529 gene locus_tag LOCUS_12300 321 1529 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_12300 2040 1537 gene locus_tag LOCUS_12310 2040 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 2916 2719 gene locus_tag LOCUS_12320 2916 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 3221 2928 gene locus_tag LOCUS_12330 3221 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 3359 3734 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4328 4041 gene locus_tag LOCUS_12340 gene ssb 4328 4041 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361980.1 protein_id gnl|my_center|LOCUS_12340 4443 4825 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6621 5320 gene locus_tag LOCUS_12350 6621 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 7858 6938 gene locus_tag LOCUS_12360 7858 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 8902 7877 gene locus_tag LOCUS_12370 8902 7877 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225534.1 protein_id gnl|my_center|LOCUS_12370 11395 8951 gene locus_tag LOCUS_12380 11395 8951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 12894 11455 gene locus_tag LOCUS_12390 12894 11455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 14001 12904 gene locus_tag LOCUS_12400 14001 12904 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203436.1 protein_id gnl|my_center|LOCUS_12400 17277 14071 gene locus_tag LOCUS_12410 17277 14071 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769174.1 protein_id gnl|my_center|LOCUS_12410 20082 17284 gene locus_tag LOCUS_12420 20082 17284 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202204.1 protein_id gnl|my_center|LOCUS_12420 21634 20087 gene locus_tag LOCUS_12430 21634 20087 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107897.1 protein_id gnl|my_center|LOCUS_12430 23616 21646 gene locus_tag LOCUS_12440 23616 21646 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921615.1 protein_id gnl|my_center|LOCUS_12440 26962 23651 gene locus_tag LOCUS_12450 26962 23651 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_12450 29876 27012 gene locus_tag LOCUS_12460 29876 27012 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202548.1 protein_id gnl|my_center|LOCUS_12460 30577 29864 gene locus_tag LOCUS_12470 30577 29864 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921342.1 protein_id gnl|my_center|LOCUS_12470 31986 30577 gene locus_tag LOCUS_12480 31986 30577 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109239.1 protein_id gnl|my_center|LOCUS_12480 33647 32106 gene locus_tag LOCUS_12490 33647 32106 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791107.1 protein_id gnl|my_center|LOCUS_12490 35552 34062 gene locus_tag LOCUS_12500 35552 34062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 38641 35564 gene locus_tag LOCUS_12510 38641 35564 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_12510 40169 38937 gene locus_tag LOCUS_12520 40169 38937 CDS product DUF4998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108514.1 protein_id gnl|my_center|LOCUS_12520 41362 40196 gene locus_tag LOCUS_12530 41362 40196 CDS product DUF4959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108515.1 protein_id gnl|my_center|LOCUS_12530 43359 41425 gene locus_tag LOCUS_12540 43359 41425 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108516.1 protein_id gnl|my_center|LOCUS_12540 46570 43382 gene locus_tag LOCUS_12550 46570 43382 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767205.1 protein_id gnl|my_center|LOCUS_12550 47061 47966 gene locus_tag LOCUS_12560 47061 47966 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801276.1 protein_id gnl|my_center|LOCUS_12560 50587 48014 gene locus_tag LOCUS_12570 50587 48014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 52764 51319 gene locus_tag LOCUS_12580 52764 51319 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036277.1 protein_id gnl|my_center|LOCUS_12580 54182 52779 gene locus_tag LOCUS_12590 54182 52779 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 protein_id gnl|my_center|LOCUS_12590 55930 54200 gene locus_tag LOCUS_12600 55930 54200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 57511 55988 gene locus_tag LOCUS_12610 57511 55988 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 protein_id gnl|my_center|LOCUS_12610 58378 57521 gene locus_tag LOCUS_12620 58378 57521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 59909 58395 gene locus_tag LOCUS_12630 59909 58395 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_12630 63038 59922 gene locus_tag LOCUS_12640 63038 59922 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_12640 63317 66235 gene locus_tag LOCUS_12650 63317 66235 CDS product triple tyrosine motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091372500.1 protein_id gnl|my_center|LOCUS_12650 66670 66861 gene locus_tag LOCUS_12660 66670 66861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12660 67620 67285 gene locus_tag LOCUS_12670 67620 67285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 69816 67816 gene locus_tag LOCUS_12680 69816 67816 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_12680 73143 69820 gene locus_tag LOCUS_12690 73143 69820 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_12690 74798 73275 gene locus_tag LOCUS_12700 74798 73275 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714626.1 protein_id gnl|my_center|LOCUS_12700 77907 74809 gene locus_tag LOCUS_12710 77907 74809 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121850300.1 protein_id gnl|my_center|LOCUS_12710 79468 78422 gene locus_tag LOCUS_12720 79468 78422 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038032.1 protein_id gnl|my_center|LOCUS_12720 80109 79474 gene locus_tag LOCUS_12730 80109 79474 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016415.1 protein_id gnl|my_center|LOCUS_12730 81991 80114 gene locus_tag LOCUS_12740 81991 80114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 83457 82003 gene locus_tag LOCUS_12750 83457 82003 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203259.1 protein_id gnl|my_center|LOCUS_12750 84909 83461 gene locus_tag LOCUS_12760 84909 83461 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_12760 87352 84920 gene locus_tag LOCUS_12770 87352 84920 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303180.1 protein_id gnl|my_center|LOCUS_12770 88182 87535 gene locus_tag LOCUS_12780 88182 87535 CDS product TIGR02117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938028.1 protein_id gnl|my_center|LOCUS_12780 88748 88212 gene locus_tag LOCUS_12790 88748 88212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 90712 88892 gene locus_tag LOCUS_12800 90712 88892 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_12800 92722 90791 gene locus_tag LOCUS_12810 92722 90791 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766195.1 protein_id gnl|my_center|LOCUS_12810 94100 92991 gene locus_tag LOCUS_12820 94100 92991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 95195 94134 gene locus_tag LOCUS_12830 95195 94134 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714630.1 protein_id gnl|my_center|LOCUS_12830 96167 95196 gene locus_tag LOCUS_12840 96167 95196 CDS product 1,4-beta-mannosyl-N-acetylglucosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107586.1 protein_id gnl|my_center|LOCUS_12840 98062 96188 gene locus_tag LOCUS_12850 98062 96188 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_12850 100355 98064 gene locus_tag LOCUS_12860 100355 98064 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109053.1 protein_id gnl|my_center|LOCUS_12860 100464 101549 gene locus_tag LOCUS_12870 100464 101549 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_12870 101546 102253 gene locus_tag LOCUS_12880 101546 102253 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_12880 104814 102265 gene locus_tag LOCUS_12890 104814 102265 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_12890 105497 104811 gene locus_tag LOCUS_12900 105497 104811 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083291.1 protein_id gnl|my_center|LOCUS_12900 105620 106276 gene locus_tag LOCUS_12910 105620 106276 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458621.1 protein_id gnl|my_center|LOCUS_12910 106301 107617 gene locus_tag LOCUS_12920 106301 107617 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 protein_id gnl|my_center|LOCUS_12920 108012 108611 gene locus_tag LOCUS_12930 108012 108611 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291519.1 protein_id gnl|my_center|LOCUS_12930 108614 109039 gene locus_tag LOCUS_12940 108614 109039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 109111 109908 gene locus_tag LOCUS_12950 109111 109908 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463551.1 protein_id gnl|my_center|LOCUS_12950 111402 110107 gene locus_tag LOCUS_12960 111402 110107 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_12960 111527 112021 gene locus_tag LOCUS_12970 111527 112021 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964036.1 protein_id gnl|my_center|LOCUS_12970 112028 112669 gene locus_tag LOCUS_12980 112028 112669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964037.1 protein_id gnl|my_center|LOCUS_12980 112879 115785 gene locus_tag LOCUS_12990 112879 115785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 115887 117170 gene locus_tag LOCUS_13000 115887 117170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 117429 117653 gene locus_tag LOCUS_13010 117429 117653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 117650 118609 gene locus_tag LOCUS_13020 117650 118609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 118809 119384 gene locus_tag LOCUS_13030 118809 119384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 119518 120201 gene locus_tag LOCUS_13040 119518 120201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 120240 120671 gene locus_tag LOCUS_13050 120240 120671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 120808 121620 gene locus_tag LOCUS_13060 120808 121620 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724514.1 protein_id gnl|my_center|LOCUS_13060 122017 123471 gene locus_tag LOCUS_13070 122017 123471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 124323 124949 gene locus_tag LOCUS_13080 124323 124949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 124951 125748 gene locus_tag LOCUS_13090 124951 125748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 127191 125926 gene locus_tag LOCUS_13100 127191 125926 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_13100 128320 127280 gene locus_tag LOCUS_13110 128320 127280 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098105.1 protein_id gnl|my_center|LOCUS_13110 130468 128408 gene locus_tag LOCUS_13120 130468 128408 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_13120 130594 130917 gene locus_tag LOCUS_13130 130594 130917 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963031.1 protein_id gnl|my_center|LOCUS_13130 130963 131229 gene locus_tag LOCUS_13140 130963 131229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 131223 131633 gene locus_tag LOCUS_13150 131223 131633 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227644.1 protein_id gnl|my_center|LOCUS_13150 131623 132651 gene locus_tag LOCUS_13160 131623 132651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 133669 132641 gene locus_tag LOCUS_13170 133669 132641 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768139.1 protein_id gnl|my_center|LOCUS_13170 133794 134228 gene locus_tag LOCUS_13180 133794 134228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 134394 135431 gene locus_tag LOCUS_13190 134394 135431 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_13190 136738 135551 gene locus_tag LOCUS_13200 gene kbl 136738 135551 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213845.1 protein_id gnl|my_center|LOCUS_13200 137711 136749 gene locus_tag LOCUS_13210 137711 136749 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_13210 137877 138338 gene locus_tag LOCUS_13220 137877 138338 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794261.1 protein_id gnl|my_center|LOCUS_13220 138768 138355 gene locus_tag LOCUS_13230 138768 138355 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_13230 140570 138765 gene locus_tag LOCUS_13240 140570 138765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 141547 140726 gene locus_tag LOCUS_13250 141547 140726 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921649.1 protein_id gnl|my_center|LOCUS_13250 141795 143243 gene locus_tag LOCUS_13260 141795 143243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 143240 143914 gene locus_tag LOCUS_13270 143240 143914 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_13270 143920 145059 gene locus_tag LOCUS_13280 143920 145059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 145219 145809 gene locus_tag LOCUS_13290 145219 145809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 145916 146362 gene locus_tag LOCUS_13300 145916 146362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 146766 146359 gene locus_tag LOCUS_13310 146766 146359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 148188 146914 gene locus_tag LOCUS_13320 148188 146914 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962841.1 protein_id gnl|my_center|LOCUS_13320 148298 149590 gene locus_tag LOCUS_13330 gene fahA 148298 149590 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_13330 149873 150475 gene locus_tag LOCUS_13340 gene pnuC 149873 150475 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_13340 150444 151460 gene locus_tag LOCUS_13350 150444 151460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 152587 151580 gene locus_tag LOCUS_13360 152587 151580 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963619.1 protein_id gnl|my_center|LOCUS_13360 152877 155366 gene locus_tag LOCUS_13370 152877 155366 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186922643.1 protein_id gnl|my_center|LOCUS_13370 155445 156158 gene locus_tag LOCUS_13380 155445 156158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 157670 156177 gene locus_tag LOCUS_13390 157670 156177 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108604.1 protein_id gnl|my_center|LOCUS_13390 157978 158955 gene locus_tag LOCUS_13400 157978 158955 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962232.1 protein_id gnl|my_center|LOCUS_13400 159115 160881 gene locus_tag LOCUS_13410 159115 160881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 163578 160900 gene locus_tag LOCUS_13420 163578 160900 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962501.1 protein_id gnl|my_center|LOCUS_13420 164290 163667 gene locus_tag LOCUS_13430 164290 163667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 165151 164426 gene locus_tag LOCUS_13440 165151 164426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 165964 165371 gene locus_tag LOCUS_13450 165964 165371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 166323 166084 gene locus_tag LOCUS_13460 166323 166084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 167124 166405 gene locus_tag LOCUS_13470 167124 166405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 167353 167195 gene locus_tag LOCUS_13480 167353 167195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 168190 167519 gene locus_tag LOCUS_13490 168190 167519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 170142 168187 gene locus_tag LOCUS_13500 170142 168187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 170427 170269 gene locus_tag LOCUS_13510 170427 170269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 171344 170604 gene locus_tag LOCUS_13520 171344 170604 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860653.1 protein_id gnl|my_center|LOCUS_13520 171553 172416 gene locus_tag LOCUS_13530 171553 172416 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755895.1 protein_id gnl|my_center|LOCUS_13530 172505 173809 gene locus_tag LOCUS_13540 172505 173809 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_13540 174045 174485 gene locus_tag LOCUS_13550 174045 174485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 174634 177336 gene locus_tag LOCUS_13560 174634 177336 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037073.1 protein_id gnl|my_center|LOCUS_13560 177372 180620 gene locus_tag LOCUS_13570 177372 180620 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_13570 180669 181274 gene locus_tag LOCUS_13580 180669 181274 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_13580 182506 181319 gene locus_tag LOCUS_13590 182506 181319 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767660.1 protein_id gnl|my_center|LOCUS_13590 183848 182511 gene locus_tag LOCUS_13600 183848 182511 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_13600 185198 183858 gene locus_tag LOCUS_13610 185198 183858 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_13610 188088 185395 gene locus_tag LOCUS_13620 188088 185395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 190459 188270 gene locus_tag LOCUS_13630 190459 188270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 192429 190600 gene locus_tag LOCUS_13640 192429 190600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 192699 193541 gene locus_tag LOCUS_13650 192699 193541 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194105476.1 protein_id gnl|my_center|LOCUS_13650 193672 196725 gene locus_tag LOCUS_13660 193672 196725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 198862 197264 gene locus_tag LOCUS_13670 198862 197264 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_13670 201869 198873 gene locus_tag LOCUS_13680 201869 198873 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_13680 202836 202138 gene locus_tag LOCUS_13690 202836 202138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 204681 202960 gene locus_tag LOCUS_13700 204681 202960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 205279 204683 gene locus_tag LOCUS_13710 205279 204683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 205754 205263 gene locus_tag LOCUS_13720 gene rpoE 205754 205263 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813797.1 protein_id gnl|my_center|LOCUS_13720 206480 206055 gene locus_tag LOCUS_13730 206480 206055 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359781.1 protein_id gnl|my_center|LOCUS_13730 206798 207436 gene locus_tag LOCUS_13740 206798 207436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303162.1 protein_id gnl|my_center|LOCUS_13740 207497 207796 gene locus_tag LOCUS_13750 207497 207796 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_13750 207789 208298 gene locus_tag LOCUS_13760 207789 208298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 208310 209686 gene locus_tag LOCUS_13770 gene creD 208310 209686 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107678.1 protein_id gnl|my_center|LOCUS_13770 209798 210508 gene locus_tag LOCUS_13780 209798 210508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 210545 211222 gene locus_tag LOCUS_13790 210545 211222 CDS product DUF1361 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680079.1 protein_id gnl|my_center|LOCUS_13790 211206 211577 gene locus_tag LOCUS_13800 211206 211577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 212929 211715 gene locus_tag LOCUS_13810 212929 211715 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_13810 213069 213890 gene locus_tag LOCUS_13820 213069 213890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 214053 214452 gene locus_tag LOCUS_tm00010 214053 214452 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 217520 214875 gene locus_tag LOCUS_13830 217520 214875 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_13830 218345 217545 gene locus_tag LOCUS_13840 218345 217545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 219041 219508 gene locus_tag LOCUS_13850 219041 219508 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105103.1 protein_id gnl|my_center|LOCUS_13850 219512 220489 gene locus_tag LOCUS_13860 219512 220489 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105102.1 protein_id gnl|my_center|LOCUS_13860 220489 222678 gene locus_tag LOCUS_13870 220489 222678 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268937.1 protein_id gnl|my_center|LOCUS_13870 223950 223303 gene locus_tag LOCUS_13880 223950 223303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 224386 224580 gene locus_tag LOCUS_13890 224386 224580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 225476 224541 gene locus_tag LOCUS_13900 225476 224541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 226421 225504 gene locus_tag LOCUS_13910 226421 225504 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_13910 226900 226475 gene locus_tag LOCUS_13920 226900 226475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 <228509 226931 gene locus_tag LOCUS_13930 <228509 226931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403859.1:type I restriction endonuclease subunit R >Feature sequence007 282 551 gene locus_tag LOCUS_13940 282 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 717 1889 gene locus_tag LOCUS_13950 717 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 3133 4086 gene locus_tag LOCUS_13960 3133 4086 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964090.1 protein_id gnl|my_center|LOCUS_13960 4185 4922 gene locus_tag LOCUS_13970 4185 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 7281 4999 gene locus_tag LOCUS_13980 7281 4999 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_13980 12244 7268 gene locus_tag LOCUS_13990 12244 7268 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161799605.1 protein_id gnl|my_center|LOCUS_13990 12420 12698 gene locus_tag LOCUS_14000 12420 12698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 13501 12767 gene locus_tag LOCUS_14010 13501 12767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 13650 14945 gene locus_tag LOCUS_14020 13650 14945 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818018.1 protein_id gnl|my_center|LOCUS_14020 15039 15566 gene locus_tag LOCUS_14030 15039 15566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 17817 15556 gene locus_tag LOCUS_14040 17817 15556 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963589.1 protein_id gnl|my_center|LOCUS_14040 17999 18652 gene locus_tag LOCUS_14050 17999 18652 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963263.1 protein_id gnl|my_center|LOCUS_14050 19669 18641 gene locus_tag LOCUS_14060 19669 18641 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_14060 20556 19669 gene locus_tag LOCUS_14070 20556 19669 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_14070 21332 20559 gene locus_tag LOCUS_14080 21332 20559 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_14080 23258 21378 gene locus_tag LOCUS_14090 gene mutL 23258 21378 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963285.1 protein_id gnl|my_center|LOCUS_14090 23628 23347 gene locus_tag LOCUS_14100 23628 23347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 24269 23778 gene locus_tag LOCUS_14110 gene ribH 24269 23778 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964104.1 protein_id gnl|my_center|LOCUS_14110 25063 24299 gene locus_tag LOCUS_14120 25063 24299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964103.1 protein_id gnl|my_center|LOCUS_14120 25216 26295 gene locus_tag LOCUS_14130 gene recF 25216 26295 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964102.1 protein_id gnl|my_center|LOCUS_14130 26292 26717 gene locus_tag LOCUS_14140 26292 26717 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963536.1 protein_id gnl|my_center|LOCUS_14140 26717 27013 gene locus_tag LOCUS_14150 26717 27013 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963535.1 protein_id gnl|my_center|LOCUS_14150 27561 27142 gene locus_tag LOCUS_14160 27561 27142 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963530.1 protein_id gnl|my_center|LOCUS_14160 28692 27670 gene locus_tag LOCUS_14170 28692 27670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 28771 29787 gene locus_tag LOCUS_14180 28771 29787 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_14180 29780 30337 gene locus_tag LOCUS_14190 gene gldI 29780 30337 CDS product gliding motility-associated peptidyl-prolyl isomerase GldI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963996.1 protein_id gnl|my_center|LOCUS_14190 30433 31605 gene locus_tag LOCUS_14200 30433 31605 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963995.1 protein_id gnl|my_center|LOCUS_14200 31769 32275 gene locus_tag LOCUS_14210 31769 32275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 33778 32315 gene locus_tag LOCUS_14220 33778 32315 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130286390.1 protein_id gnl|my_center|LOCUS_14220 33926 34210 gene locus_tag LOCUS_14230 33926 34210 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970501.1 protein_id gnl|my_center|LOCUS_14230 34286 35011 gene locus_tag LOCUS_14240 34286 35011 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962991.1 protein_id gnl|my_center|LOCUS_14240 35125 36342 gene locus_tag LOCUS_14250 35125 36342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 36345 36851 gene locus_tag LOCUS_14260 36345 36851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 38524 36959 gene locus_tag LOCUS_14270 gene rny 38524 36959 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963284.1 protein_id gnl|my_center|LOCUS_14270 39036 38746 gene locus_tag LOCUS_14280 39036 38746 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963283.1 protein_id gnl|my_center|LOCUS_14280 39337 39047 gene locus_tag LOCUS_14290 39337 39047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963282.1 protein_id gnl|my_center|LOCUS_14290 39706 41397 gene locus_tag LOCUS_14300 39706 41397 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_14300 41403 43859 gene locus_tag LOCUS_14310 41403 43859 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_14310 45017 43872 gene locus_tag LOCUS_14320 45017 43872 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_14320 45124 46071 gene locus_tag LOCUS_14330 45124 46071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 46622 46068 gene locus_tag LOCUS_14340 46622 46068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963034.1 protein_id gnl|my_center|LOCUS_14340 46767 48665 gene locus_tag LOCUS_14350 46767 48665 CDS product T9SS sorting signal type C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962777.1 protein_id gnl|my_center|LOCUS_14350 48754 48948 gene locus_tag LOCUS_14360 48754 48948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 48952 49278 gene locus_tag LOCUS_14370 48952 49278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 50741 49374 gene locus_tag LOCUS_14380 50741 49374 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_14380 51741 50788 gene locus_tag LOCUS_14390 51741 50788 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963218.1 protein_id gnl|my_center|LOCUS_14390 52712 51759 gene locus_tag LOCUS_14400 52712 51759 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963220.1 protein_id gnl|my_center|LOCUS_14400 52820 53650 gene locus_tag LOCUS_14410 52820 53650 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_14410 53643 53981 gene locus_tag LOCUS_14420 53643 53981 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963226.1 protein_id gnl|my_center|LOCUS_14420 54047 54937 gene locus_tag LOCUS_14430 54047 54937 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_14430 55002 55661 gene locus_tag LOCUS_14440 55002 55661 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_14440 55690 57036 gene locus_tag LOCUS_14450 55690 57036 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_14450 57047 57892 gene locus_tag LOCUS_14460 57047 57892 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_14460 57885 58793 gene locus_tag LOCUS_14470 gene miaA 57885 58793 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964020.1 protein_id gnl|my_center|LOCUS_14470 59539 58820 gene locus_tag LOCUS_14480 59539 58820 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_14480 61116 59545 gene locus_tag LOCUS_14490 61116 59545 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963934.1 protein_id gnl|my_center|LOCUS_14490 61776 61183 gene locus_tag LOCUS_14500 gene coaE 61776 61183 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963935.1 protein_id gnl|my_center|LOCUS_14500 62714 61773 gene locus_tag LOCUS_14510 62714 61773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 63736 62738 gene locus_tag LOCUS_14520 63736 62738 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963936.1 protein_id gnl|my_center|LOCUS_14520 64669 63845 gene locus_tag LOCUS_14530 64669 63845 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775707.1 protein_id gnl|my_center|LOCUS_14530 66360 64708 gene locus_tag LOCUS_14540 gene recN 66360 64708 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963946.1 protein_id gnl|my_center|LOCUS_14540 67347 66463 gene locus_tag LOCUS_14550 67347 66463 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_14550 68551 67340 gene locus_tag LOCUS_14560 gene coaBC 68551 67340 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 protein_id gnl|my_center|LOCUS_14560 68877 68554 gene locus_tag LOCUS_14570 68877 68554 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963943.1 protein_id gnl|my_center|LOCUS_14570 69667 68897 gene locus_tag LOCUS_14580 gene bamD 69667 68897 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 protein_id gnl|my_center|LOCUS_14580 70621 69740 gene locus_tag LOCUS_14590 gene dapA 70621 69740 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963941.1 protein_id gnl|my_center|LOCUS_14590 71078 70623 gene locus_tag LOCUS_14600 71078 70623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 71212 71961 gene locus_tag LOCUS_14610 71212 71961 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963939.1 protein_id gnl|my_center|LOCUS_14610 71962 72879 gene locus_tag LOCUS_14620 71962 72879 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_14620 74071 74226 gene locus_tag LOCUS_14630 74071 74226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 76389 74398 gene locus_tag LOCUS_14640 gene ligA 76389 74398 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963952.1 protein_id gnl|my_center|LOCUS_14640 77005 76412 gene locus_tag LOCUS_14650 77005 76412 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222951.1 protein_id gnl|my_center|LOCUS_14650 77847 77002 gene locus_tag LOCUS_14660 gene prmC 77847 77002 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964123.1 protein_id gnl|my_center|LOCUS_14660 78328 77837 gene locus_tag LOCUS_14670 78328 77837 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964124.1 protein_id gnl|my_center|LOCUS_14670 78385 79410 gene locus_tag LOCUS_14680 gene ribD 78385 79410 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964125.1 protein_id gnl|my_center|LOCUS_14680 79407 80021 gene locus_tag LOCUS_14690 79407 80021 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964126.1 protein_id gnl|my_center|LOCUS_14690 80018 80893 gene locus_tag LOCUS_14700 80018 80893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693980.1 protein_id gnl|my_center|LOCUS_14700 80893 81501 gene locus_tag LOCUS_14710 80893 81501 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964127.1 protein_id gnl|my_center|LOCUS_14710 81896 81498 gene locus_tag LOCUS_14720 81896 81498 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_14720 82098 83528 gene locus_tag LOCUS_14730 gene dnaA 82098 83528 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_14730 83598 84053 gene locus_tag LOCUS_14740 83598 84053 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100664.1 protein_id gnl|my_center|LOCUS_14740 84070 84789 gene locus_tag LOCUS_14750 84070 84789 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_14750 85501 84842 gene locus_tag LOCUS_14760 85501 84842 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963343.1 protein_id gnl|my_center|LOCUS_14760 86851 85808 gene locus_tag LOCUS_14770 gene mltG 86851 85808 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963345.1 protein_id gnl|my_center|LOCUS_14770 87383 86841 gene locus_tag LOCUS_14780 87383 86841 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 protein_id gnl|my_center|LOCUS_14780 88099 87371 gene locus_tag LOCUS_14790 gene dapF 88099 87371 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963347.1 protein_id gnl|my_center|LOCUS_14790 88281 89675 gene locus_tag LOCUS_14800 88281 89675 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 protein_id gnl|my_center|LOCUS_14800 89800 91248 gene locus_tag LOCUS_14810 89800 91248 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963349.1 protein_id gnl|my_center|LOCUS_14810 91420 92022 gene locus_tag LOCUS_14820 91420 92022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 92081 92758 gene locus_tag LOCUS_14830 gene trmD 92081 92758 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963979.1 protein_id gnl|my_center|LOCUS_14830 92858 93244 gene locus_tag LOCUS_14840 gene rplS 92858 93244 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963978.1 protein_id gnl|my_center|LOCUS_14840 93907 96132 gene locus_tag LOCUS_14850 93907 96132 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706412.1 protein_id gnl|my_center|LOCUS_14850 96238 98616 gene locus_tag LOCUS_14860 96238 98616 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_14860 98617 99426 gene locus_tag LOCUS_14870 98617 99426 CDS product DUF4249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962851.1 protein_id gnl|my_center|LOCUS_14870 99457 100275 gene locus_tag LOCUS_14880 gene murQ 99457 100275 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962884.1 protein_id gnl|my_center|LOCUS_14880 100262 100483 gene locus_tag LOCUS_14890 100262 100483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 100864 100556 gene locus_tag LOCUS_14900 100864 100556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 100986 101546 gene locus_tag LOCUS_14910 100986 101546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 101553 102500 gene locus_tag LOCUS_14920 101553 102500 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963275.1 protein_id gnl|my_center|LOCUS_14920 102650 104368 gene locus_tag LOCUS_14930 102650 104368 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963276.1 protein_id gnl|my_center|LOCUS_14930 104436 106268 gene locus_tag LOCUS_14940 104436 106268 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_14940 106694 107212 gene locus_tag LOCUS_14950 106694 107212 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_14950 107244 107744 gene locus_tag LOCUS_14960 107244 107744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 107765 108208 gene locus_tag LOCUS_14970 107765 108208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962782.1 protein_id gnl|my_center|LOCUS_14970 109293 108244 gene locus_tag LOCUS_14980 109293 108244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962781.1 protein_id gnl|my_center|LOCUS_14980 109370 110590 gene locus_tag LOCUS_14990 109370 110590 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_14990 110821 114477 gene locus_tag LOCUS_15000 gene purL 110821 114477 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962854.1 protein_id gnl|my_center|LOCUS_15000 114709 116481 gene locus_tag LOCUS_15010 114709 116481 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_15010 116636 117100 gene locus_tag LOCUS_15020 116636 117100 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_15020 117097 119505 gene locus_tag LOCUS_15030 117097 119505 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_15030 119612 120805 gene locus_tag LOCUS_15040 119612 120805 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_15040 120921 122729 gene locus_tag LOCUS_15050 120921 122729 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_15050 122993 123871 gene locus_tag LOCUS_15060 122993 123871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837916.1 protein_id gnl|my_center|LOCUS_15060 123864 125051 gene locus_tag LOCUS_15070 123864 125051 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814856.1 protein_id gnl|my_center|LOCUS_15070 125048 125791 gene locus_tag LOCUS_15080 125048 125791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 125797 126702 gene locus_tag LOCUS_15090 125797 126702 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442783.1 protein_id gnl|my_center|LOCUS_15090 129347 126699 gene locus_tag LOCUS_15100 129347 126699 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109197.1 protein_id gnl|my_center|LOCUS_15100 132568 129440 gene locus_tag LOCUS_15110 132568 129440 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764442.1 protein_id gnl|my_center|LOCUS_15110 134896 132860 gene locus_tag LOCUS_15120 134896 132860 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767024.1 protein_id gnl|my_center|LOCUS_15120 136093 134906 gene locus_tag LOCUS_15130 136093 134906 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767015.1 protein_id gnl|my_center|LOCUS_15130 136965 136090 gene locus_tag LOCUS_15140 136965 136090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 140367 136975 gene locus_tag LOCUS_15150 140367 136975 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_15150 142381 140423 gene locus_tag LOCUS_15160 142381 140423 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767043.1 protein_id gnl|my_center|LOCUS_15160 145515 142390 gene locus_tag LOCUS_15170 gene lacZ 145515 142390 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_15170 146838 145522 gene locus_tag LOCUS_15180 146838 145522 CDS product BNR repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767016.1 protein_id gnl|my_center|LOCUS_15180 148300 147098 gene locus_tag LOCUS_15190 148300 147098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 149641 148427 gene locus_tag LOCUS_15200 149641 148427 CDS product DUF4998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108514.1 protein_id gnl|my_center|LOCUS_15200 150862 149660 gene locus_tag LOCUS_15210 150862 149660 CDS product DUF5000 domain-containing lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767187.1 protein_id gnl|my_center|LOCUS_15210 152862 150895 gene locus_tag LOCUS_15220 152862 150895 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108516.1 protein_id gnl|my_center|LOCUS_15220 156089 152877 gene locus_tag LOCUS_15230 156089 152877 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767205.1 protein_id gnl|my_center|LOCUS_15230 157408 156248 gene locus_tag LOCUS_15240 157408 156248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 157636 161736 gene locus_tag LOCUS_15250 157636 161736 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108607.1 protein_id gnl|my_center|LOCUS_15250 163994 161811 gene locus_tag LOCUS_15260 163994 161811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 164235 165344 gene locus_tag LOCUS_15270 164235 165344 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403653.1 protein_id gnl|my_center|LOCUS_15270 165544 165924 gene locus_tag LOCUS_15280 165544 165924 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113301.1 protein_id gnl|my_center|LOCUS_15280 166220 166378 gene locus_tag LOCUS_15290 166220 166378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 166463 166807 gene locus_tag LOCUS_15300 166463 166807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 169251 166864 gene locus_tag LOCUS_15310 169251 166864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 170131 169418 gene locus_tag LOCUS_15320 gene pgl 170131 169418 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263331.1 protein_id gnl|my_center|LOCUS_15320 171805 170267 gene locus_tag LOCUS_15330 gene zwf 171805 170267 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477796.1 protein_id gnl|my_center|LOCUS_15330 172006 173418 gene locus_tag LOCUS_15340 gene gndA 172006 173418 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413557.1 protein_id gnl|my_center|LOCUS_15340 173502 174911 gene locus_tag LOCUS_15350 173502 174911 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_15350 175096 176583 gene locus_tag LOCUS_15360 175096 176583 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036501.1 protein_id gnl|my_center|LOCUS_15360 176654 177475 gene locus_tag LOCUS_15370 176654 177475 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464970.1 protein_id gnl|my_center|LOCUS_15370 177883 177461 gene locus_tag LOCUS_15380 177883 177461 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_15380 178020 179030 gene locus_tag LOCUS_15390 178020 179030 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964801.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence008 <1 3212 gene locus_tag LOCUS_15400 <1 3212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361986.1:Calx-beta domain-containing protein 3228 4172 gene locus_tag LOCUS_15410 3228 4172 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_15410 4190 6070 gene locus_tag LOCUS_15420 4190 6070 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_15420 7603 6140 gene locus_tag LOCUS_15430 7603 6140 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_15430 8446 7619 gene locus_tag LOCUS_15440 8446 7619 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477173.1 protein_id gnl|my_center|LOCUS_15440 9567 8446 gene locus_tag LOCUS_15450 9567 8446 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_15450 10334 9738 gene locus_tag LOCUS_15460 10334 9738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 10506 13730 gene locus_tag LOCUS_15470 10506 13730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_15470 14849 13869 gene locus_tag LOCUS_15480 14849 13869 CDS product App1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887835.1 protein_id gnl|my_center|LOCUS_15480 14915 15805 gene locus_tag LOCUS_15490 14915 15805 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_15490 15891 16478 gene locus_tag LOCUS_15500 15891 16478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 16565 17095 gene locus_tag LOCUS_15510 16565 17095 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977103.1 protein_id gnl|my_center|LOCUS_15510 17099 17908 gene locus_tag LOCUS_15520 17099 17908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 18276 19478 gene locus_tag LOCUS_15530 18276 19478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 19563 20891 gene locus_tag LOCUS_15540 19563 20891 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_15540 21646 20888 gene locus_tag LOCUS_15550 21646 20888 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_15550 21994 21680 gene locus_tag LOCUS_15560 21994 21680 CDS product 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963761.1 protein_id gnl|my_center|LOCUS_15560 23429 22089 gene locus_tag LOCUS_15570 23429 22089 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963763.1 protein_id gnl|my_center|LOCUS_15570 23608 23429 gene locus_tag LOCUS_15580 23608 23429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 23799 27467 gene locus_tag LOCUS_15590 23799 27467 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163515044.1 protein_id gnl|my_center|LOCUS_15590 27524 28966 gene locus_tag LOCUS_15600 27524 28966 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_15600 28971 29363 gene locus_tag LOCUS_15610 28971 29363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 29782 29414 gene locus_tag LOCUS_15620 29782 29414 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763033.1 protein_id gnl|my_center|LOCUS_15620 29912 30799 gene locus_tag LOCUS_15630 29912 30799 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206307.1 protein_id gnl|my_center|LOCUS_15630 31593 30916 gene locus_tag LOCUS_15640 gene rpiA 31593 30916 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052314.1 protein_id gnl|my_center|LOCUS_15640 32212 31631 gene locus_tag LOCUS_15650 gene mocA 32212 31631 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362242.1 protein_id gnl|my_center|LOCUS_15650 33237 32212 gene locus_tag LOCUS_15660 33237 32212 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525879.1 protein_id gnl|my_center|LOCUS_15660 34016 33327 gene locus_tag LOCUS_15670 34016 33327 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_15670 34141 34713 gene locus_tag LOCUS_15680 34141 34713 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963926.1 protein_id gnl|my_center|LOCUS_15680 34946 36760 gene locus_tag LOCUS_15690 34946 36760 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963925.1 protein_id gnl|my_center|LOCUS_15690 36835 37626 gene locus_tag LOCUS_15700 36835 37626 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963924.1 protein_id gnl|my_center|LOCUS_15700 37997 37623 gene locus_tag LOCUS_15710 37997 37623 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793035.1 protein_id gnl|my_center|LOCUS_15710 38282 38046 gene locus_tag LOCUS_15720 38282 38046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962659.1 protein_id gnl|my_center|LOCUS_15720 38935 38279 gene locus_tag LOCUS_15730 38935 38279 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963914.1 protein_id gnl|my_center|LOCUS_15730 41691 39001 gene locus_tag LOCUS_15740 41691 39001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 41805 42491 gene locus_tag LOCUS_15750 41805 42491 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 protein_id gnl|my_center|LOCUS_15750 42933 42460 gene locus_tag LOCUS_15760 42933 42460 CDS product heme-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726283.1 protein_id gnl|my_center|LOCUS_15760 42972 43523 gene locus_tag LOCUS_15770 42972 43523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963491.1 protein_id gnl|my_center|LOCUS_15770 43530 44939 gene locus_tag LOCUS_15780 gene purB 43530 44939 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963912.1 protein_id gnl|my_center|LOCUS_15780 46254 45118 gene locus_tag LOCUS_15790 gene ackA 46254 45118 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_15790 48476 46383 gene locus_tag LOCUS_15800 gene pta 48476 46383 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_15800 49140 48604 gene locus_tag LOCUS_15810 49140 48604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 49660 49142 gene locus_tag LOCUS_15820 49660 49142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 50114 49677 gene locus_tag LOCUS_15830 50114 49677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963572.1 protein_id gnl|my_center|LOCUS_15830 50610 50101 gene locus_tag LOCUS_15840 50610 50101 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963573.1 protein_id gnl|my_center|LOCUS_15840 50721 52214 gene locus_tag LOCUS_15850 50721 52214 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786996.1 protein_id gnl|my_center|LOCUS_15850 52228 53754 gene locus_tag LOCUS_15860 52228 53754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 55693 53825 gene locus_tag LOCUS_15870 gene btuB 55693 53825 CDS product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099293.1 protein_id gnl|my_center|LOCUS_15870 56238 57272 gene locus_tag LOCUS_15880 56238 57272 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963581.1 protein_id gnl|my_center|LOCUS_15880 57388 58290 gene locus_tag LOCUS_15890 57388 58290 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963582.1 protein_id gnl|my_center|LOCUS_15890 58294 59082 gene locus_tag LOCUS_15900 58294 59082 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964096.1 protein_id gnl|my_center|LOCUS_15900 59124 60458 gene locus_tag LOCUS_15910 59124 60458 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_15910 60600 60968 gene locus_tag LOCUS_15920 60600 60968 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964092.1 protein_id gnl|my_center|LOCUS_15920 61007 61552 gene locus_tag LOCUS_15930 61007 61552 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 protein_id gnl|my_center|LOCUS_15930 61670 62359 gene locus_tag LOCUS_15940 61670 62359 CDS product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079938.1 protein_id gnl|my_center|LOCUS_15940 62441 62833 gene locus_tag LOCUS_15950 62441 62833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 62997 64259 gene locus_tag LOCUS_15960 62997 64259 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_15960 64896 64333 gene locus_tag LOCUS_15970 64896 64333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 67905 65053 gene locus_tag LOCUS_15980 gene carB 67905 65053 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964089.1 protein_id gnl|my_center|LOCUS_15980 68388 68945 gene locus_tag LOCUS_15990 68388 68945 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964088.1 protein_id gnl|my_center|LOCUS_15990 69116 69823 gene locus_tag LOCUS_16000 69116 69823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 70836 69901 gene locus_tag LOCUS_16010 70836 69901 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_16010 71594 70944 gene locus_tag LOCUS_16020 71594 70944 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964116.1 protein_id gnl|my_center|LOCUS_16020 71748 72047 gene locus_tag LOCUS_16030 71748 72047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 73440 72097 gene locus_tag LOCUS_16040 gene mtaB 73440 72097 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_16040 73571 75205 gene locus_tag LOCUS_16050 73571 75205 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583496.1 protein_id gnl|my_center|LOCUS_16050 75277 75567 gene locus_tag LOCUS_16060 75277 75567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 75676 76299 gene locus_tag LOCUS_16070 75676 76299 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962669.1 protein_id gnl|my_center|LOCUS_16070 76289 77617 gene locus_tag LOCUS_16080 76289 77617 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962668.1 protein_id gnl|my_center|LOCUS_16080 77629 78711 gene locus_tag LOCUS_16090 77629 78711 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962667.1 protein_id gnl|my_center|LOCUS_16090 78718 80304 gene locus_tag LOCUS_16100 78718 80304 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962666.1 protein_id gnl|my_center|LOCUS_16100 81479 80301 gene locus_tag LOCUS_16110 81479 80301 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_16110 83646 81763 gene locus_tag LOCUS_16120 gene rpsA 83646 81763 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963900.1 protein_id gnl|my_center|LOCUS_16120 83844 84692 gene locus_tag LOCUS_16130 83844 84692 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_16130 86154 84724 gene locus_tag LOCUS_16140 86154 84724 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958071.1 protein_id gnl|my_center|LOCUS_16140 87565 86387 gene locus_tag LOCUS_16150 87565 86387 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786133.1 protein_id gnl|my_center|LOCUS_16150 88277 87582 gene locus_tag LOCUS_16160 gene cmk 88277 87582 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963822.1 protein_id gnl|my_center|LOCUS_16160 89325 88303 gene locus_tag LOCUS_16170 gene porQ 89325 88303 CDS product type IX secretion system protein PorQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_16170 91884 89434 gene locus_tag LOCUS_16180 gene lon 91884 89434 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963824.1 protein_id gnl|my_center|LOCUS_16180 92100 92654 gene locus_tag LOCUS_16190 92100 92654 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969824.1 protein_id gnl|my_center|LOCUS_16190 92666 93211 gene locus_tag LOCUS_16200 92666 93211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 93234 94292 gene locus_tag LOCUS_16210 93234 94292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 94312 95040 gene locus_tag LOCUS_16220 94312 95040 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796792.1 protein_id gnl|my_center|LOCUS_16220 96450 95119 gene locus_tag LOCUS_16230 96450 95119 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_16230 97356 96535 gene locus_tag LOCUS_16240 97356 96535 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_16240 99841 97448 gene locus_tag LOCUS_16250 99841 97448 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_16250 102051 100132 gene locus_tag LOCUS_16260 gene glgB 102051 100132 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_16260 103681 102044 gene locus_tag LOCUS_16270 103681 102044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 105655 103721 gene locus_tag LOCUS_16280 105655 103721 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933744.1 protein_id gnl|my_center|LOCUS_16280 105847 106317 gene locus_tag LOCUS_16290 gene msrB 105847 106317 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528493.1 protein_id gnl|my_center|LOCUS_16290 106445 106843 gene locus_tag LOCUS_16300 gene msrB 106445 106843 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963829.1 protein_id gnl|my_center|LOCUS_16300 106905 107462 gene locus_tag LOCUS_16310 106905 107462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 107487 108056 gene locus_tag LOCUS_16320 107487 108056 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894086.1 protein_id gnl|my_center|LOCUS_16320 108142 109518 gene locus_tag LOCUS_16330 gene lpdA 108142 109518 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_16330 110152 109727 gene locus_tag LOCUS_16340 gene aroQ 110152 109727 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964118.1 protein_id gnl|my_center|LOCUS_16340 110768 110196 gene locus_tag LOCUS_16350 110768 110196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 110689 110868 gene locus_tag LOCUS_16360 110689 110868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 111532 110930 gene locus_tag LOCUS_16370 111532 110930 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_16370 112449 111850 gene locus_tag LOCUS_16380 112449 111850 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402867.1 protein_id gnl|my_center|LOCUS_16380 112559 113455 gene locus_tag LOCUS_16390 gene xerD 112559 113455 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964120.1 protein_id gnl|my_center|LOCUS_16390 113989 113546 gene locus_tag LOCUS_16400 113989 113546 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763145.1 protein_id gnl|my_center|LOCUS_16400 114532 114179 gene locus_tag LOCUS_16410 114532 114179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 116035 114845 gene locus_tag LOCUS_16420 gene sucC 116035 114845 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963059.1 protein_id gnl|my_center|LOCUS_16420 116788 116129 gene locus_tag LOCUS_16430 116788 116129 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403957.1 protein_id gnl|my_center|LOCUS_16430 116937 118154 gene locus_tag LOCUS_16440 gene lysA 116937 118154 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_16440 118384 119034 gene locus_tag LOCUS_16450 118384 119034 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_16450 119018 119539 gene locus_tag LOCUS_16460 119018 119539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 119532 120629 gene locus_tag LOCUS_16470 119532 120629 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_16470 120689 121816 gene locus_tag LOCUS_16480 120689 121816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963733.1 protein_id gnl|my_center|LOCUS_16480 122382 121813 gene locus_tag LOCUS_16490 122382 121813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 122926 122339 gene locus_tag LOCUS_16500 122926 122339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 123338 122928 gene locus_tag LOCUS_16510 123338 122928 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878970.1 protein_id gnl|my_center|LOCUS_16510 125561 123348 gene locus_tag LOCUS_16520 125561 123348 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_16520 129194 125568 gene locus_tag LOCUS_16530 129194 125568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 130480 129398 gene locus_tag LOCUS_16540 130480 129398 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_16540 132444 130711 gene locus_tag LOCUS_16550 132444 130711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 133200 132460 gene locus_tag LOCUS_16560 133200 132460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 134549 133329 gene locus_tag LOCUS_16570 134549 133329 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227156.1 protein_id gnl|my_center|LOCUS_16570 135245 134631 gene locus_tag LOCUS_16580 135245 134631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 136501 135257 gene locus_tag LOCUS_16590 136501 135257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 140395 136655 gene locus_tag LOCUS_16600 140395 136655 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_16600 140889 140512 gene locus_tag LOCUS_16610 140889 140512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 142000 141005 gene locus_tag LOCUS_16620 142000 141005 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242607.1 protein_id gnl|my_center|LOCUS_16620 142445 142080 gene locus_tag LOCUS_16630 142445 142080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 142777 144819 gene locus_tag LOCUS_16640 142777 144819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 145993 144830 gene locus_tag LOCUS_16650 145993 144830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 147207 145993 gene locus_tag LOCUS_16660 147207 145993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 148691 147258 gene locus_tag LOCUS_16670 148691 147258 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771063.1 protein_id gnl|my_center|LOCUS_16670 149929 148832 gene locus_tag LOCUS_16680 149929 148832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 150375 150010 gene locus_tag LOCUS_16690 150375 150010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 151202 150372 gene locus_tag LOCUS_16700 151202 150372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 154780 151139 gene locus_tag LOCUS_16710 154780 151139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 156130 154892 gene locus_tag LOCUS_16720 156130 154892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 157108 156137 gene locus_tag LOCUS_16730 157108 156137 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 protein_id gnl|my_center|LOCUS_16730 158739 157333 gene locus_tag LOCUS_16740 gene lpdA 158739 157333 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963845.1 protein_id gnl|my_center|LOCUS_16740 160186 158804 gene locus_tag LOCUS_16750 160186 158804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 160176 160382 gene locus_tag LOCUS_16760 160176 160382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 162831 160594 gene locus_tag LOCUS_16770 162831 160594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 164183 164920 gene locus_tag LOCUS_16780 164183 164920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 165559 167040 gene locus_tag LOCUS_16790 165559 167040 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_16790 167364 168002 gene locus_tag LOCUS_16800 167364 168002 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963839.1 protein_id gnl|my_center|LOCUS_16800 168030 168344 gene locus_tag LOCUS_16810 168030 168344 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963838.1 protein_id gnl|my_center|LOCUS_16810 168325 168573 gene locus_tag LOCUS_16820 168325 168573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963837.1 protein_id gnl|my_center|LOCUS_16820 168744 169244 gene locus_tag LOCUS_16830 gene tpx 168744 169244 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963706.1 protein_id gnl|my_center|LOCUS_16830 169244 169615 gene locus_tag LOCUS_16840 169244 169615 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963705.1 protein_id gnl|my_center|LOCUS_16840 169737 172112 gene locus_tag LOCUS_16850 169737 172112 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_16850 172105 172770 gene locus_tag LOCUS_16860 172105 172770 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963703.1 protein_id gnl|my_center|LOCUS_16860 172847 174391 gene locus_tag LOCUS_16870 172847 174391 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963702.1 protein_id gnl|my_center|LOCUS_16870 174467 175612 gene locus_tag LOCUS_16880 gene ribB 174467 175612 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963701.1 protein_id gnl|my_center|LOCUS_16880 175684 176037 gene locus_tag LOCUS_16890 175684 176037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 176668 176039 gene locus_tag LOCUS_16900 176668 176039 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962679.1 protein_id gnl|my_center|LOCUS_16900 176865 177527 gene locus_tag LOCUS_16910 176865 177527 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948375.1 protein_id gnl|my_center|LOCUS_16910 >Feature sequence009 2708 315 gene locus_tag LOCUS_16920 gene galB 2708 315 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202546.1 protein_id gnl|my_center|LOCUS_16920 3972 2779 gene locus_tag LOCUS_16930 3972 2779 CDS product arabinogalactan endo-1,4-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036451.1 protein_id gnl|my_center|LOCUS_16930 5210 4053 gene locus_tag LOCUS_16940 5210 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 6834 5227 gene locus_tag LOCUS_16950 6834 5227 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789572.1 protein_id gnl|my_center|LOCUS_16950 9812 6840 gene locus_tag LOCUS_16960 9812 6840 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_16960 13970 10065 gene locus_tag LOCUS_16970 13970 10065 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_16970 14275 16884 gene locus_tag LOCUS_16980 14275 16884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 19373 17685 gene locus_tag LOCUS_16990 19373 17685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 21815 19380 gene locus_tag LOCUS_17000 21815 19380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 22034 22414 gene locus_tag LOCUS_17010 22034 22414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 22458 23399 gene locus_tag LOCUS_17020 22458 23399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 23572 24045 gene locus_tag LOCUS_17030 23572 24045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 24119 24397 gene locus_tag LOCUS_17040 24119 24397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 27185 24456 gene locus_tag LOCUS_17050 27185 24456 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073743.1 protein_id gnl|my_center|LOCUS_17050 28656 27262 gene locus_tag LOCUS_17060 28656 27262 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107166.1 protein_id gnl|my_center|LOCUS_17060 31648 28661 gene locus_tag LOCUS_17070 31648 28661 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404908.1 protein_id gnl|my_center|LOCUS_17070 33245 33487 gene locus_tag LOCUS_17080 33245 33487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 33547 34173 gene locus_tag LOCUS_17090 33547 34173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 34271 34104 gene locus_tag LOCUS_17100 34271 34104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 34327 35001 gene locus_tag LOCUS_17110 34327 35001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 35072 36187 gene locus_tag LOCUS_17120 35072 36187 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_17120 36194 38083 gene locus_tag LOCUS_17130 36194 38083 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951079.1 protein_id gnl|my_center|LOCUS_17130 38087 40738 gene locus_tag LOCUS_17140 38087 40738 CDS product type III restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016374.1 protein_id gnl|my_center|LOCUS_17140 40743 41078 gene locus_tag LOCUS_17150 40743 41078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 41540 42055 gene locus_tag LOCUS_17160 41540 42055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 42198 42410 gene locus_tag LOCUS_17170 42198 42410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 42539 42943 gene locus_tag LOCUS_17180 42539 42943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 43703 44170 gene locus_tag LOCUS_17190 43703 44170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 44794 45987 gene locus_tag LOCUS_17200 44794 45987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 46960 47445 gene locus_tag LOCUS_17210 46960 47445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 47811 48302 gene locus_tag LOCUS_17220 47811 48302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 49179 48775 gene locus_tag LOCUS_17230 49179 48775 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_17230 51373 49163 gene locus_tag LOCUS_17240 51373 49163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 51627 52577 gene locus_tag LOCUS_17250 51627 52577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_17250 53443 52715 gene locus_tag LOCUS_17260 53443 52715 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115502769.1 protein_id gnl|my_center|LOCUS_17260 53485 53745 gene locus_tag LOCUS_17270 53485 53745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 53803 54225 gene locus_tag LOCUS_17280 gene umuD 53803 54225 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768414.1 protein_id gnl|my_center|LOCUS_17280 54227 55483 gene locus_tag LOCUS_17290 54227 55483 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962560.1 protein_id gnl|my_center|LOCUS_17290 55841 55584 gene locus_tag LOCUS_17300 55841 55584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 56138 56956 gene locus_tag LOCUS_17310 56138 56956 CDS product RteC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107118.1 protein_id gnl|my_center|LOCUS_17310 57212 57496 gene locus_tag LOCUS_17320 57212 57496 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963685.1 protein_id gnl|my_center|LOCUS_17320 57497 58216 gene locus_tag LOCUS_17330 57497 58216 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964384.1 protein_id gnl|my_center|LOCUS_17330 58200 58862 gene locus_tag LOCUS_17340 58200 58862 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963683.1 protein_id gnl|my_center|LOCUS_17340 60277 58904 gene locus_tag LOCUS_17350 60277 58904 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303131.1 protein_id gnl|my_center|LOCUS_17350 60935 60405 gene locus_tag LOCUS_17360 60935 60405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 61110 60952 gene locus_tag LOCUS_17370 61110 60952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 61239 61526 gene locus_tag LOCUS_17380 61239 61526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 61809 64238 gene locus_tag LOCUS_17390 61809 64238 CDS product TraG family conjugative transposon ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112378231.1 protein_id gnl|my_center|LOCUS_17390 64258 64857 gene locus_tag LOCUS_17400 64258 64857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 64860 65702 gene locus_tag LOCUS_17410 64860 65702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 65713 66330 gene locus_tag LOCUS_17420 65713 66330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 66349 67281 gene locus_tag LOCUS_17430 66349 67281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 67324 68142 gene locus_tag LOCUS_17440 67324 68142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 68150 68515 gene locus_tag LOCUS_17450 68150 68515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 68784 68957 gene locus_tag LOCUS_17460 68784 68957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 70531 68963 gene locus_tag LOCUS_17470 70531 68963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 71570 70539 gene locus_tag LOCUS_17480 71570 70539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 71953 71582 gene locus_tag LOCUS_17490 71953 71582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 72594 72394 gene locus_tag LOCUS_17500 72594 72394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 73073 72603 gene locus_tag LOCUS_17510 73073 72603 CDS product JAB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108556.1 protein_id gnl|my_center|LOCUS_17510 73443 73063 gene locus_tag LOCUS_17520 73443 73063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 73855 73517 gene locus_tag LOCUS_17530 gene ssb 73855 73517 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361980.1 protein_id gnl|my_center|LOCUS_17530 75186 74626 gene locus_tag LOCUS_17540 75186 74626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17540 75762 75199 gene locus_tag LOCUS_17550 75762 75199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17550 77975 75888 gene locus_tag LOCUS_17560 77975 75888 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119288.1 protein_id gnl|my_center|LOCUS_17560 79465 77993 gene locus_tag LOCUS_17570 79465 77993 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767373.1 protein_id gnl|my_center|LOCUS_17570 81011 79581 gene locus_tag LOCUS_17580 81011 79581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 82408 81080 gene locus_tag LOCUS_17590 82408 81080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 83973 82426 gene locus_tag LOCUS_17600 83973 82426 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_17600 87056 83979 gene locus_tag LOCUS_17610 87056 83979 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_17610 91295 87267 gene locus_tag LOCUS_17620 91295 87267 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_17620 92986 91439 gene locus_tag LOCUS_17630 92986 91439 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108775.1 protein_id gnl|my_center|LOCUS_17630 93281 94918 gene locus_tag LOCUS_17640 93281 94918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 94928 96502 gene locus_tag LOCUS_17650 94928 96502 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117744.1 protein_id gnl|my_center|LOCUS_17650 98169 96901 gene locus_tag LOCUS_17660 98169 96901 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921292.1 protein_id gnl|my_center|LOCUS_17660 99503 98349 gene locus_tag LOCUS_17670 99503 98349 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203436.1 protein_id gnl|my_center|LOCUS_17670 101225 99645 gene locus_tag LOCUS_17680 101225 99645 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791107.1 protein_id gnl|my_center|LOCUS_17680 102823 101591 gene locus_tag LOCUS_17690 102823 101591 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_17690 103129 103055 gene locus_tag LOCUS_t00120 103129 103055 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 103731 103462 gene locus_tag LOCUS_17700 103731 103462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 104084 105370 gene locus_tag LOCUS_17710 104084 105370 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963097.1 protein_id gnl|my_center|LOCUS_17710 105442 106530 gene locus_tag LOCUS_17720 105442 106530 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_17720 106542 107456 gene locus_tag LOCUS_17730 106542 107456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 108810 107464 gene locus_tag LOCUS_17740 gene gntU 108810 107464 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704293.1 protein_id gnl|my_center|LOCUS_17740 109302 108820 gene locus_tag LOCUS_17750 109302 108820 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089501.1 protein_id gnl|my_center|LOCUS_17750 110215 109322 gene locus_tag LOCUS_17760 110215 109322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 110388 111104 gene locus_tag LOCUS_17770 110388 111104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 111290 114340 gene locus_tag LOCUS_17780 111290 114340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 114470 114694 gene locus_tag LOCUS_17790 114470 114694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 115398 114757 gene locus_tag LOCUS_17800 115398 114757 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964013.1 protein_id gnl|my_center|LOCUS_17800 115658 116623 gene locus_tag LOCUS_17810 115658 116623 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_17810 116639 117358 gene locus_tag LOCUS_17820 gene gldF 116639 117358 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_17820 117360 119036 gene locus_tag LOCUS_17830 gene gldG 117360 119036 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_17830 119249 120367 gene locus_tag LOCUS_17840 gene dnaN 119249 120367 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963230.1 protein_id gnl|my_center|LOCUS_17840 120939 120502 gene locus_tag LOCUS_17850 120939 120502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 122516 121050 gene locus_tag LOCUS_17860 122516 121050 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513713.1 protein_id gnl|my_center|LOCUS_17860 127032 122524 gene locus_tag LOCUS_17870 gene gltB 127032 122524 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964980.1 protein_id gnl|my_center|LOCUS_17870 127530 128645 gene locus_tag LOCUS_17880 127530 128645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 128664 129002 gene locus_tag LOCUS_17890 128664 129002 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932186.1 protein_id gnl|my_center|LOCUS_17890 129032 130270 gene locus_tag LOCUS_17900 gene amt 129032 130270 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056043.1 protein_id gnl|my_center|LOCUS_17900 130681 130337 gene locus_tag LOCUS_17910 130681 130337 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074087.1 protein_id gnl|my_center|LOCUS_17910 130816 132264 gene locus_tag LOCUS_17920 130816 132264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 133804 132335 gene locus_tag LOCUS_17930 133804 132335 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250770.1 protein_id gnl|my_center|LOCUS_17930 135036 133807 gene locus_tag LOCUS_17940 135036 133807 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_17940 137556 135118 gene locus_tag LOCUS_17950 137556 135118 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963906.1 protein_id gnl|my_center|LOCUS_17950 137846 137586 gene locus_tag LOCUS_17960 137846 137586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 138080 138970 gene locus_tag LOCUS_17970 138080 138970 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963908.1 protein_id gnl|my_center|LOCUS_17970 139762 140019 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 141198 140518 gene locus_tag LOCUS_17980 141198 140518 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963019.1 protein_id gnl|my_center|LOCUS_17980 141952 141302 gene locus_tag LOCUS_17990 141952 141302 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963018.1 protein_id gnl|my_center|LOCUS_17990 142097 142966 gene locus_tag LOCUS_18000 142097 142966 CDS product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 protein_id gnl|my_center|LOCUS_18000 144455 143067 gene locus_tag LOCUS_18010 gene glmM 144455 143067 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_18010 144590 145201 gene locus_tag LOCUS_18020 144590 145201 CDS product acyl carrier protein phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_18020 145206 146942 gene locus_tag LOCUS_18030 gene ggt 145206 146942 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_18030 147126 147719 gene locus_tag LOCUS_18040 147126 147719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 147720 148460 gene locus_tag LOCUS_18050 147720 148460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 148618 149862 gene locus_tag LOCUS_18060 148618 149862 CDS product WG repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence010 267 1664 gene locus_tag LOCUS_18070 267 1664 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_18070 2527 1751 gene locus_tag LOCUS_18080 2527 1751 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771267.1 protein_id gnl|my_center|LOCUS_18080 3266 2685 gene locus_tag LOCUS_18090 3266 2685 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962319.1 protein_id gnl|my_center|LOCUS_18090 3504 4646 gene locus_tag LOCUS_18100 3504 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173416272.1 protein_id gnl|my_center|LOCUS_18100 4894 5262 gene locus_tag LOCUS_18110 4894 5262 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_18110 5262 7397 gene locus_tag LOCUS_18120 5262 7397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 7442 9934 gene locus_tag LOCUS_18130 7442 9934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 10096 11196 gene locus_tag LOCUS_18140 10096 11196 CDS product DUF4407 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 protein_id gnl|my_center|LOCUS_18140 12559 11309 gene locus_tag LOCUS_18150 12559 11309 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712480.1 protein_id gnl|my_center|LOCUS_18150 14834 12561 gene locus_tag LOCUS_18160 14834 12561 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156899988.1 protein_id gnl|my_center|LOCUS_18160 15865 14858 gene locus_tag LOCUS_18170 15865 14858 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385697.1 protein_id gnl|my_center|LOCUS_18170 16756 15893 gene locus_tag LOCUS_18180 16756 15893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18180 17566 16853 gene locus_tag LOCUS_18190 17566 16853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 19269 17692 gene locus_tag LOCUS_18200 19269 17692 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206892.1 protein_id gnl|my_center|LOCUS_18200 20438 19506 gene locus_tag LOCUS_18210 20438 19506 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389819.1 protein_id gnl|my_center|LOCUS_18210 20616 21416 gene locus_tag LOCUS_18220 20616 21416 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194105476.1 protein_id gnl|my_center|LOCUS_18220 22435 21650 gene locus_tag LOCUS_18230 22435 21650 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062386982.1 protein_id gnl|my_center|LOCUS_18230 22856 22539 gene locus_tag LOCUS_18240 22856 22539 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_18240 23938 22937 gene locus_tag LOCUS_18250 23938 22937 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404059.1 protein_id gnl|my_center|LOCUS_18250 25713 23938 gene locus_tag LOCUS_18260 25713 23938 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765433.1 protein_id gnl|my_center|LOCUS_18260 26166 25786 gene locus_tag LOCUS_18270 26166 25786 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_18270 26798 26166 gene locus_tag LOCUS_18280 26798 26166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 27328 26801 gene locus_tag LOCUS_18290 27328 26801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 27938 27312 gene locus_tag LOCUS_18300 27938 27312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 28304 27957 gene locus_tag LOCUS_18310 28304 27957 CDS product DUF4260 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527883.1 protein_id gnl|my_center|LOCUS_18310 29062 28307 gene locus_tag LOCUS_18320 29062 28307 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_18320 30302 29118 gene locus_tag LOCUS_18330 gene hemW 30302 29118 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_18330 30905 30312 gene locus_tag LOCUS_18340 gene ruvC 30905 30312 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962385.1 protein_id gnl|my_center|LOCUS_18340 31015 32076 gene locus_tag LOCUS_18350 31015 32076 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_18350 32558 32079 gene locus_tag LOCUS_18360 32558 32079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 33751 32642 gene locus_tag LOCUS_18370 33751 32642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 34536 33760 gene locus_tag LOCUS_18380 34536 33760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 34711 36330 gene locus_tag LOCUS_18390 34711 36330 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943191.1 protein_id gnl|my_center|LOCUS_18390 37373 36327 gene locus_tag LOCUS_18400 37373 36327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 38424 37468 gene locus_tag LOCUS_18410 gene metF 38424 37468 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404822.1 protein_id gnl|my_center|LOCUS_18410 41327 38592 gene locus_tag LOCUS_18420 41327 38592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18420 42359 41337 gene locus_tag LOCUS_18430 42359 41337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18430 42812 43396 gene locus_tag LOCUS_18440 42812 43396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 43414 44280 gene locus_tag LOCUS_18450 43414 44280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 44273 44653 gene locus_tag LOCUS_18460 44273 44653 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_18460 45705 44650 gene locus_tag LOCUS_18470 45705 44650 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963782.1 protein_id gnl|my_center|LOCUS_18470 46342 45749 gene locus_tag LOCUS_18480 46342 45749 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880784.1 protein_id gnl|my_center|LOCUS_18480 47093 46332 gene locus_tag LOCUS_18490 gene cobA 47093 46332 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496681.1 protein_id gnl|my_center|LOCUS_18490 49179 47086 gene locus_tag LOCUS_18500 49179 47086 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_18500 50524 49280 gene locus_tag LOCUS_18510 50524 49280 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_18510 51528 50629 gene locus_tag LOCUS_18520 gene cysD 51528 50629 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002735002.1 protein_id gnl|my_center|LOCUS_18520 52164 51541 gene locus_tag LOCUS_18530 52164 51541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 52436 52164 gene locus_tag LOCUS_18540 52436 52164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 53003 52590 gene locus_tag LOCUS_18550 53003 52590 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_18550 54199 53033 gene locus_tag LOCUS_18560 54199 53033 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 protein_id gnl|my_center|LOCUS_18560 54880 54398 gene locus_tag LOCUS_18570 54880 54398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 58275 54892 gene locus_tag LOCUS_18580 58275 54892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 59626 58334 gene locus_tag LOCUS_18590 59626 58334 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962432.1 protein_id gnl|my_center|LOCUS_18590 60164 61417 gene locus_tag LOCUS_18600 gene metK 60164 61417 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962442.1 protein_id gnl|my_center|LOCUS_18600 61691 61470 gene locus_tag LOCUS_18610 61691 61470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 61936 62115 gene locus_tag LOCUS_18620 61936 62115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 62189 63115 gene locus_tag LOCUS_18630 62189 63115 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255043.1 protein_id gnl|my_center|LOCUS_18630 63204 65795 gene locus_tag LOCUS_18640 63204 65795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 68567 65862 gene locus_tag LOCUS_18650 68567 65862 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_18650 69437 68604 gene locus_tag LOCUS_18660 69437 68604 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_18660 70322 69501 gene locus_tag LOCUS_18670 70322 69501 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_18670 70667 70344 gene locus_tag LOCUS_18680 70667 70344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 70788 70654 gene locus_tag LOCUS_18690 70788 70654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 70868 72355 gene locus_tag LOCUS_18700 70868 72355 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303152.1 protein_id gnl|my_center|LOCUS_18700 72348 73031 gene locus_tag LOCUS_18710 72348 73031 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678712.1 protein_id gnl|my_center|LOCUS_18710 73139 73909 gene locus_tag LOCUS_18720 73139 73909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 73917 74531 gene locus_tag LOCUS_18730 73917 74531 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_18730 74549 75694 gene locus_tag LOCUS_18740 74549 75694 CDS product arabinogalactan endo-1,4-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036451.1 protein_id gnl|my_center|LOCUS_18740 75863 77686 gene locus_tag LOCUS_18750 75863 77686 CDS product flavohemoglobin expression-modulating QEGLA motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397828.1 protein_id gnl|my_center|LOCUS_18750 77688 78740 gene locus_tag LOCUS_18760 77688 78740 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973597.1 protein_id gnl|my_center|LOCUS_18760 78751 79653 gene locus_tag LOCUS_18770 gene astE 78751 79653 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368485.1 protein_id gnl|my_center|LOCUS_18770 80678 79650 gene locus_tag LOCUS_18780 80678 79650 CDS product DUF2183 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119948.1 protein_id gnl|my_center|LOCUS_18780 83177 80841 gene locus_tag LOCUS_18790 83177 80841 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_18790 83847 83320 gene locus_tag LOCUS_18800 83847 83320 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962510.1 protein_id gnl|my_center|LOCUS_18800 86503 84011 gene locus_tag LOCUS_18810 86503 84011 CDS product DUF5686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962509.1 protein_id gnl|my_center|LOCUS_18810 87609 86632 gene locus_tag LOCUS_18820 87609 86632 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_18820 87880 88626 gene locus_tag LOCUS_18830 87880 88626 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_18830 88694 89662 gene locus_tag LOCUS_18840 88694 89662 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_18840 89747 90361 gene locus_tag LOCUS_18850 89747 90361 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_18850 90367 91779 gene locus_tag LOCUS_18860 90367 91779 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_18860 92156 91785 gene locus_tag LOCUS_18870 92156 91785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 92291 93142 gene locus_tag LOCUS_18880 92291 93142 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962504.1 protein_id gnl|my_center|LOCUS_18880 93161 93574 gene locus_tag LOCUS_18890 93161 93574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 93658 94830 gene locus_tag LOCUS_18900 gene egtB 93658 94830 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921716.1 protein_id gnl|my_center|LOCUS_18900 94837 95811 gene locus_tag LOCUS_18910 gene egtD 94837 95811 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035425.1 protein_id gnl|my_center|LOCUS_18910 96170 95880 gene locus_tag LOCUS_18920 96170 95880 CDS product isoamylase early set domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477072.1 protein_id gnl|my_center|LOCUS_18920 97428 96358 gene locus_tag LOCUS_18930 97428 96358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 97566 97994 gene locus_tag LOCUS_18940 97566 97994 CDS product 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962500.1 protein_id gnl|my_center|LOCUS_18940 98001 98495 gene locus_tag LOCUS_18950 98001 98495 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962499.1 protein_id gnl|my_center|LOCUS_18950 98449 99324 gene locus_tag LOCUS_18960 98449 99324 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799698.1 protein_id gnl|my_center|LOCUS_18960 99421 99921 gene locus_tag LOCUS_18970 99421 99921 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036864.1 protein_id gnl|my_center|LOCUS_18970 100300 99926 gene locus_tag LOCUS_18980 100300 99926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 100388 101269 gene locus_tag LOCUS_18990 gene fabD 100388 101269 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962577.1 protein_id gnl|my_center|LOCUS_18990 101585 101346 gene locus_tag LOCUS_19000 101585 101346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 102054 101851 gene locus_tag LOCUS_19010 102054 101851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 102839 102096 gene locus_tag LOCUS_19020 102839 102096 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207772.1 protein_id gnl|my_center|LOCUS_19020 104106 102847 gene locus_tag LOCUS_19030 104106 102847 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207773.1 protein_id gnl|my_center|LOCUS_19030 104280 105047 gene locus_tag LOCUS_19040 104280 105047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 105416 105183 gene locus_tag LOCUS_19050 105416 105183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 105654 105424 gene locus_tag LOCUS_19060 105654 105424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 105812 106468 gene locus_tag LOCUS_19070 105812 106468 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761471.1 protein_id gnl|my_center|LOCUS_19070 107691 106450 gene locus_tag LOCUS_19080 107691 106450 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 protein_id gnl|my_center|LOCUS_19080 107924 109057 gene locus_tag LOCUS_19090 107924 109057 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_19090 109069 110343 gene locus_tag LOCUS_19100 109069 110343 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_19100 110916 110356 gene locus_tag LOCUS_19110 110916 110356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 111123 113081 gene locus_tag LOCUS_19120 111123 113081 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_19120 115864 113150 gene locus_tag LOCUS_19130 115864 113150 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962569.1 protein_id gnl|my_center|LOCUS_19130 116605 115871 gene locus_tag LOCUS_19140 116605 115871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 117005 117826 gene locus_tag LOCUS_19150 117005 117826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 118624 118085 gene locus_tag LOCUS_19160 118624 118085 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_19160 118805 121432 gene locus_tag LOCUS_19170 gene mutS 118805 121432 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962564.1 protein_id gnl|my_center|LOCUS_19170 121522 121596 gene locus_tag LOCUS_t00130 121522 121596 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 121639 121723 gene locus_tag LOCUS_t00140 121639 121723 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 122277 122858 gene locus_tag LOCUS_19180 122277 122858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 123335 123937 gene locus_tag LOCUS_19190 123335 123937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 124008 126440 gene locus_tag LOCUS_19200 124008 126440 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839988.1 protein_id gnl|my_center|LOCUS_19200 126643 127089 gene locus_tag LOCUS_19210 126643 127089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 127265 127711 gene locus_tag LOCUS_19220 127265 127711 CDS product PA2169 family four-helix-bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113661.1 protein_id gnl|my_center|LOCUS_19220 127933 132315 gene locus_tag LOCUS_19230 gene dnaE 127933 132315 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962512.1 protein_id gnl|my_center|LOCUS_19230 132842 134629 gene locus_tag LOCUS_19240 132842 134629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 134763 136565 gene locus_tag LOCUS_19250 134763 136565 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921313.1 protein_id gnl|my_center|LOCUS_19250 136792 137109 gene locus_tag LOCUS_19260 gene trxA 136792 137109 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962434.1 protein_id gnl|my_center|LOCUS_19260 137385 137930 gene locus_tag LOCUS_19270 gene clpP 137385 137930 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942436.1 protein_id gnl|my_center|LOCUS_19270 138128 139060 gene locus_tag LOCUS_19280 138128 139060 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_19280 139173 139247 gene locus_tag LOCUS_t00150 139173 139247 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 139513 140697 gene locus_tag LOCUS_19290 139513 140697 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_19290 140797 141702 gene locus_tag LOCUS_19300 140797 141702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 141723 142037 gene locus_tag LOCUS_19310 141723 142037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 142195 142527 gene locus_tag LOCUS_19320 142195 142527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 142647 147062 gene locus_tag LOCUS_19330 142647 147062 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_19330 147081 148340 gene locus_tag LOCUS_19340 147081 148340 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_19340 148456 148794 gene locus_tag LOCUS_19350 148456 148794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 148810 149232 gene locus_tag LOCUS_19360 148810 149232 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763608.1 protein_id gnl|my_center|LOCUS_19360 >Feature sequence011 536 807 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 865 1107 gene locus_tag LOCUS_19370 865 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 1138 1578 gene locus_tag LOCUS_19380 1138 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 1587 2192 gene locus_tag LOCUS_19390 1587 2192 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 protein_id gnl|my_center|LOCUS_19390 2213 2692 gene locus_tag LOCUS_19400 2213 2692 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761058.1 protein_id gnl|my_center|LOCUS_19400 2809 3522 gene locus_tag LOCUS_19410 2809 3522 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962551.1 protein_id gnl|my_center|LOCUS_19410 4118 3510 gene locus_tag LOCUS_19420 4118 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962552.1 protein_id gnl|my_center|LOCUS_19420 5572 4118 gene locus_tag LOCUS_19430 gene rpoN 5572 4118 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_19430 6309 5674 gene locus_tag LOCUS_19440 6309 5674 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045135.1 protein_id gnl|my_center|LOCUS_19440 7073 6315 gene locus_tag LOCUS_19450 7073 6315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 7805 7074 gene locus_tag LOCUS_19460 7805 7074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 8590 7928 gene locus_tag LOCUS_19470 8590 7928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 9362 8682 gene locus_tag LOCUS_19480 9362 8682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 10924 9485 gene locus_tag LOCUS_19490 gene asnS 10924 9485 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964340.1 protein_id gnl|my_center|LOCUS_19490 13445 11031 gene locus_tag LOCUS_19500 13445 11031 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_19500 15622 13547 gene locus_tag LOCUS_19510 15622 13547 CDS product DUF5686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962609.1 protein_id gnl|my_center|LOCUS_19510 16356 15793 gene locus_tag LOCUS_19520 gene frr 16356 15793 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962605.1 protein_id gnl|my_center|LOCUS_19520 17173 16466 gene locus_tag LOCUS_19530 gene pyrH 17173 16466 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962604.1 protein_id gnl|my_center|LOCUS_19530 18260 17295 gene locus_tag LOCUS_19540 gene tsf 18260 17295 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325915.1 protein_id gnl|my_center|LOCUS_19540 19152 18358 gene locus_tag LOCUS_19550 gene rpsB 19152 18358 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962623.1 protein_id gnl|my_center|LOCUS_19550 19733 19347 gene locus_tag LOCUS_19560 gene rpsI 19733 19347 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962624.1 protein_id gnl|my_center|LOCUS_19560 20189 19734 gene locus_tag LOCUS_19570 gene rplM 20189 19734 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962625.1 protein_id gnl|my_center|LOCUS_19570 21218 20397 gene locus_tag LOCUS_19580 21218 20397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 21470 24118 gene locus_tag LOCUS_19590 21470 24118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 24528 27593 gene locus_tag LOCUS_19600 24528 27593 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792393.1 protein_id gnl|my_center|LOCUS_19600 27671 29185 gene locus_tag LOCUS_19610 27671 29185 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796344.1 protein_id gnl|my_center|LOCUS_19610 32133 29281 gene locus_tag LOCUS_19620 gene polA 32133 29281 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_19620 32194 32547 gene locus_tag LOCUS_19630 32194 32547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967828.1 protein_id gnl|my_center|LOCUS_19630 32679 34166 gene locus_tag LOCUS_19640 32679 34166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 35512 34220 gene locus_tag LOCUS_19650 gene odhB 35512 34220 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964497.1 protein_id gnl|my_center|LOCUS_19650 38401 35561 gene locus_tag LOCUS_19660 38401 35561 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_19660 38499 39014 gene locus_tag LOCUS_19670 38499 39014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964495.1 protein_id gnl|my_center|LOCUS_19670 39333 38998 gene locus_tag LOCUS_19680 39333 38998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 40310 39336 gene locus_tag LOCUS_19690 40310 39336 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_19690 40472 41077 gene locus_tag LOCUS_19700 40472 41077 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_19700 41077 42456 gene locus_tag LOCUS_19710 41077 42456 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_19710 42475 43650 gene locus_tag LOCUS_19720 42475 43650 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_19720 43652 47140 gene locus_tag LOCUS_19730 43652 47140 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_19730 47306 49027 gene locus_tag LOCUS_19740 47306 49027 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_19740 49031 49744 gene locus_tag LOCUS_19750 49031 49744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 49924 51672 gene locus_tag LOCUS_19760 gene aspS 49924 51672 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962449.1 protein_id gnl|my_center|LOCUS_19760 52982 51810 gene locus_tag LOCUS_19770 52982 51810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202177.1 protein_id gnl|my_center|LOCUS_19770 55802 53022 gene locus_tag LOCUS_19780 55802 53022 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109087.1 protein_id gnl|my_center|LOCUS_19780 55907 56107 gene locus_tag LOCUS_19790 55907 56107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 56064 57398 gene locus_tag LOCUS_19800 56064 57398 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_19800 57459 60158 gene locus_tag LOCUS_19810 57459 60158 CDS product T9SS-dependent M36 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962455.1 protein_id gnl|my_center|LOCUS_19810 61931 60162 gene locus_tag LOCUS_19820 61931 60162 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962453.1 protein_id gnl|my_center|LOCUS_19820 62042 62497 gene locus_tag LOCUS_19830 62042 62497 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962451.1 protein_id gnl|my_center|LOCUS_19830 62509 64413 gene locus_tag LOCUS_19840 62509 64413 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963092.1 protein_id gnl|my_center|LOCUS_19840 64447 65103 gene locus_tag LOCUS_19850 64447 65103 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932717.1 protein_id gnl|my_center|LOCUS_19850 65681 65100 gene locus_tag LOCUS_19860 65681 65100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 66168 65671 gene locus_tag LOCUS_19870 66168 65671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 66439 66948 gene locus_tag LOCUS_19880 66439 66948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 67000 69171 gene locus_tag LOCUS_19890 67000 69171 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814008.1 protein_id gnl|my_center|LOCUS_19890 69657 69292 gene locus_tag LOCUS_19900 69657 69292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 71168 69846 gene locus_tag LOCUS_19910 71168 69846 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_19910 72249 71155 gene locus_tag LOCUS_19920 72249 71155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 72953 72333 gene locus_tag LOCUS_19930 72953 72333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 73805 73482 gene locus_tag LOCUS_19940 73805 73482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 76229 74865 gene locus_tag LOCUS_19950 76229 74865 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_19950 77363 76266 gene locus_tag LOCUS_19960 77363 76266 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108695.1 protein_id gnl|my_center|LOCUS_19960 78276 77413 gene locus_tag LOCUS_19970 78276 77413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 79693 78293 gene locus_tag LOCUS_19980 79693 78293 CDS product DUF4832 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767298.1 protein_id gnl|my_center|LOCUS_19980 81170 79698 gene locus_tag LOCUS_19990 81170 79698 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784504.1 protein_id gnl|my_center|LOCUS_19990 84366 81181 gene locus_tag LOCUS_20000 84366 81181 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202065.1 protein_id gnl|my_center|LOCUS_20000 86555 84717 gene locus_tag LOCUS_20010 86555 84717 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_20010 86871 88007 gene locus_tag LOCUS_20020 86871 88007 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704759.1 protein_id gnl|my_center|LOCUS_20020 88011 88937 gene locus_tag LOCUS_20030 gene pfkB 88011 88937 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963555.1 protein_id gnl|my_center|LOCUS_20030 88924 89892 gene locus_tag LOCUS_20040 88924 89892 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797481.1 protein_id gnl|my_center|LOCUS_20040 89870 90721 gene locus_tag LOCUS_20050 gene fba 89870 90721 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392146.1 protein_id gnl|my_center|LOCUS_20050 90702 91700 gene locus_tag LOCUS_20060 90702 91700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 91846 92604 gene locus_tag LOCUS_20070 gene agaR 91846 92604 CDS product aga operon transcriptional regulator AgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072171.1 protein_id gnl|my_center|LOCUS_20070 94009 92759 gene locus_tag LOCUS_20080 94009 92759 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_20080 94296 94224 gene locus_tag LOCUS_t00160 94296 94224 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 95438 94302 gene locus_tag LOCUS_20090 95438 94302 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_20090 96009 95431 gene locus_tag LOCUS_20100 96009 95431 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_20100 96227 96799 gene locus_tag LOCUS_20110 96227 96799 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962629.1 protein_id gnl|my_center|LOCUS_20110 96850 97065 gene locus_tag LOCUS_20120 96850 97065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 97360 97067 gene locus_tag LOCUS_20130 97360 97067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 98948 97362 gene locus_tag LOCUS_20140 98948 97362 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962632.1 protein_id gnl|my_center|LOCUS_20140 99388 98948 gene locus_tag LOCUS_20150 99388 98948 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 protein_id gnl|my_center|LOCUS_20150 100064 99480 gene locus_tag LOCUS_20160 100064 99480 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_20160 100199 100645 gene locus_tag LOCUS_20170 100199 100645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 100638 101648 gene locus_tag LOCUS_20180 100638 101648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 102645 101638 gene locus_tag LOCUS_20190 102645 101638 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964327.1 protein_id gnl|my_center|LOCUS_20190 102819 105623 gene locus_tag LOCUS_20200 102819 105623 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964328.1 protein_id gnl|my_center|LOCUS_20200 105674 107077 gene locus_tag LOCUS_20210 105674 107077 CDS product DUF5689 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964329.1 protein_id gnl|my_center|LOCUS_20210 107198 107815 gene locus_tag LOCUS_20220 gene def 107198 107815 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116243.1 protein_id gnl|my_center|LOCUS_20220 107893 108423 gene locus_tag LOCUS_20230 107893 108423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 108423 110285 gene locus_tag LOCUS_20240 108423 110285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 110282 110908 gene locus_tag LOCUS_20250 gene nreC 110282 110908 CDS product nitrate respiration regulation response regulator NreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485230.1 protein_id gnl|my_center|LOCUS_20250 111065 112348 gene locus_tag LOCUS_20260 111065 112348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 112482 112784 gene locus_tag LOCUS_20270 112482 112784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 112787 113218 gene locus_tag LOCUS_20280 112787 113218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 114159 113215 gene locus_tag LOCUS_20290 114159 113215 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964327.1 protein_id gnl|my_center|LOCUS_20290 114236 115462 gene locus_tag LOCUS_20300 gene hflX 114236 115462 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964502.1 protein_id gnl|my_center|LOCUS_20300 116476 115529 gene locus_tag LOCUS_20310 116476 115529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 117048 116545 gene locus_tag LOCUS_20320 117048 116545 CDS product DUF2480 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_20320 117400 117071 gene locus_tag LOCUS_20330 117400 117071 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_20330 117629 117405 gene locus_tag LOCUS_20340 117629 117405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 118192 117758 gene locus_tag LOCUS_20350 118192 117758 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_20350 118632 118231 gene locus_tag LOCUS_20360 118632 118231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 119935 118697 gene locus_tag LOCUS_20370 119935 118697 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964478.1 protein_id gnl|my_center|LOCUS_20370 121363 120029 gene locus_tag LOCUS_20380 gene sufD 121363 120029 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_20380 121773 121381 gene locus_tag LOCUS_20390 121773 121381 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_20390 122562 121810 gene locus_tag LOCUS_20400 gene sufC 122562 121810 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_20400 122948 122598 gene locus_tag LOCUS_20410 122948 122598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 123864 122950 gene locus_tag LOCUS_20420 123864 122950 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226863299.1 protein_id gnl|my_center|LOCUS_20420 125314 123869 gene locus_tag LOCUS_20430 gene sufB 125314 123869 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964482.1 protein_id gnl|my_center|LOCUS_20430 125690 125361 gene locus_tag LOCUS_20440 125690 125361 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_20440 127167 125836 gene locus_tag LOCUS_20450 127167 125836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 128351 127167 gene locus_tag LOCUS_20460 128351 127167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 128526 129578 gene locus_tag LOCUS_20470 gene thiL 128526 129578 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964415.1 protein_id gnl|my_center|LOCUS_20470 129822 129580 gene locus_tag LOCUS_20480 129822 129580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 130791 130024 gene locus_tag LOCUS_20490 130791 130024 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099991.1 protein_id gnl|my_center|LOCUS_20490 130827 132119 gene locus_tag LOCUS_20500 gene brnQ 130827 132119 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459557.1 protein_id gnl|my_center|LOCUS_20500 132119 132268 gene locus_tag LOCUS_20510 132119 132268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 132333 132932 gene locus_tag LOCUS_20520 132333 132932 CDS product DUF2652 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950737.1 protein_id gnl|my_center|LOCUS_20520 134408 132942 gene locus_tag LOCUS_20530 134408 132942 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039190.1 protein_id gnl|my_center|LOCUS_20530 135187 136494 gene locus_tag LOCUS_20540 135187 136494 CDS product curlin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071155.1 protein_id gnl|my_center|LOCUS_20540 137057 136557 gene locus_tag LOCUS_20550 gene greA 137057 136557 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545525.1 protein_id gnl|my_center|LOCUS_20550 137769 137209 gene locus_tag LOCUS_20560 137769 137209 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058277.1 protein_id gnl|my_center|LOCUS_20560 137937 137857 gene locus_tag LOCUS_t00170 137937 137857 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 138082 139011 gene locus_tag LOCUS_20570 138082 139011 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_20570 >Feature sequence012 536 96 gene locus_tag LOCUS_20580 536 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 protein_id gnl|my_center|LOCUS_20580 2013 655 gene locus_tag LOCUS_20590 2013 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 3246 2086 gene locus_tag LOCUS_20600 3246 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 5813 3258 gene locus_tag LOCUS_20610 5813 3258 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787151.1 protein_id gnl|my_center|LOCUS_20610 7632 5989 gene locus_tag LOCUS_20620 gene pgi 7632 5989 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962324.1 protein_id gnl|my_center|LOCUS_20620 8848 7634 gene locus_tag LOCUS_20630 8848 7634 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_20630 9856 8903 gene locus_tag LOCUS_20640 9856 8903 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_20640 10632 9856 gene locus_tag LOCUS_20650 10632 9856 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_20650 11944 10784 gene locus_tag LOCUS_20660 gene hppD 11944 10784 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_20660 13282 12122 gene locus_tag LOCUS_20670 13282 12122 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_20670 15622 13361 gene locus_tag LOCUS_20680 15622 13361 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962399.1 protein_id gnl|my_center|LOCUS_20680 17415 15619 gene locus_tag LOCUS_20690 gene uvrC 17415 15619 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962398.1 protein_id gnl|my_center|LOCUS_20690 17541 18002 gene locus_tag LOCUS_20700 17541 18002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 17999 18871 gene locus_tag LOCUS_20710 gene rimK 17999 18871 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261388.1 protein_id gnl|my_center|LOCUS_20710 18875 19867 gene locus_tag LOCUS_20720 18875 19867 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 protein_id gnl|my_center|LOCUS_20720 19857 20420 gene locus_tag LOCUS_20730 19857 20420 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962396.1 protein_id gnl|my_center|LOCUS_20730 20473 21615 gene locus_tag LOCUS_20740 20473 21615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 22231 21605 gene locus_tag LOCUS_20750 22231 21605 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962395.1 protein_id gnl|my_center|LOCUS_20750 22905 22348 gene locus_tag LOCUS_20760 22905 22348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 23428 23045 gene locus_tag LOCUS_20770 23428 23045 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962394.1 protein_id gnl|my_center|LOCUS_20770 26875 23435 gene locus_tag LOCUS_20780 gene ileS 26875 23435 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962393.1 protein_id gnl|my_center|LOCUS_20780 28299 26977 gene locus_tag LOCUS_20790 28299 26977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 30739 28334 gene locus_tag LOCUS_20800 30739 28334 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 protein_id gnl|my_center|LOCUS_20800 31465 30749 gene locus_tag LOCUS_20810 gene recO 31465 30749 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962443.1 protein_id gnl|my_center|LOCUS_20810 33732 31465 gene locus_tag LOCUS_20820 33732 31465 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_20820 35170 33827 gene locus_tag LOCUS_20830 gene gdhA 35170 33827 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_20830 35381 36187 gene locus_tag LOCUS_20840 35381 36187 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962446.1 protein_id gnl|my_center|LOCUS_20840 37370 36201 gene locus_tag LOCUS_20850 37370 36201 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_20850 37449 38207 gene locus_tag LOCUS_20860 37449 38207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 39023 38502 gene locus_tag LOCUS_20870 39023 38502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 39864 39115 gene locus_tag LOCUS_20880 39864 39115 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024697047.1 protein_id gnl|my_center|LOCUS_20880 42373 39956 gene locus_tag LOCUS_20890 42373 39956 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963130.1 protein_id gnl|my_center|LOCUS_20890 43717 42437 gene locus_tag LOCUS_20900 43717 42437 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107523.1 protein_id gnl|my_center|LOCUS_20900 44392 43718 gene locus_tag LOCUS_20910 44392 43718 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107524.1 protein_id gnl|my_center|LOCUS_20910 45255 44779 gene locus_tag LOCUS_20920 45255 44779 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 protein_id gnl|my_center|LOCUS_20920 45479 45784 gene locus_tag LOCUS_20930 45479 45784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 45793 46692 gene locus_tag LOCUS_20940 45793 46692 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 protein_id gnl|my_center|LOCUS_20940 47161 46685 gene locus_tag LOCUS_20950 47161 46685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 47285 48307 gene locus_tag LOCUS_20960 47285 48307 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530707.1 protein_id gnl|my_center|LOCUS_20960 48307 49275 gene locus_tag LOCUS_20970 48307 49275 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_20970 49298 49843 gene locus_tag LOCUS_20980 49298 49843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 49903 51546 gene locus_tag LOCUS_20990 49903 51546 CDS product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096163.1 protein_id gnl|my_center|LOCUS_20990 52533 51604 gene locus_tag LOCUS_21000 52533 51604 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256274.1 protein_id gnl|my_center|LOCUS_21000 53171 52533 gene locus_tag LOCUS_21010 gene lacC 53171 52533 CDS product lactose 3-dehydrogenase subunit gamma LacC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919508.1 protein_id gnl|my_center|LOCUS_21010 54883 53174 gene locus_tag LOCUS_21020 54883 53174 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_21020 55051 56028 gene locus_tag LOCUS_21030 55051 56028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 56071 57264 gene locus_tag LOCUS_21040 56071 57264 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858484.1 protein_id gnl|my_center|LOCUS_21040 57334 58488 gene locus_tag LOCUS_21050 57334 58488 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669535.1 protein_id gnl|my_center|LOCUS_21050 58519 59574 gene locus_tag LOCUS_21060 58519 59574 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973787.1 protein_id gnl|my_center|LOCUS_21060 59581 60318 gene locus_tag LOCUS_21070 59581 60318 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921887.1 protein_id gnl|my_center|LOCUS_21070 60321 61124 gene locus_tag LOCUS_21080 60321 61124 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_21080 61662 61198 gene locus_tag LOCUS_21090 61662 61198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 62789 61695 gene locus_tag LOCUS_21100 62789 61695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 62966 63826 gene locus_tag LOCUS_21110 62966 63826 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_21110 63826 64401 gene locus_tag LOCUS_21120 gene gmk 63826 64401 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962519.1 protein_id gnl|my_center|LOCUS_21120 64404 64991 gene locus_tag LOCUS_21130 gene nadD 64404 64991 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962322.1 protein_id gnl|my_center|LOCUS_21130 65569 64988 gene locus_tag LOCUS_21140 65569 64988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 66232 65738 gene locus_tag LOCUS_21150 gene lysM 66232 65738 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120434.1 protein_id gnl|my_center|LOCUS_21150 67367 66444 gene locus_tag LOCUS_21160 67367 66444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 67654 68643 gene locus_tag LOCUS_21170 67654 68643 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962320.1 protein_id gnl|my_center|LOCUS_21170 69047 68652 gene locus_tag LOCUS_21180 69047 68652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 70281 69265 gene locus_tag LOCUS_21190 gene pheS 70281 69265 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962303.1 protein_id gnl|my_center|LOCUS_21190 70874 70359 gene locus_tag LOCUS_21200 70874 70359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 71425 71069 gene locus_tag LOCUS_21210 71425 71069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_21210 71540 72169 gene locus_tag LOCUS_21220 71540 72169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 73854 72199 gene locus_tag LOCUS_21230 73854 72199 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444186.1 protein_id gnl|my_center|LOCUS_21230 74624 73902 gene locus_tag LOCUS_21240 gene can 74624 73902 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964129.1 protein_id gnl|my_center|LOCUS_21240 74858 74640 gene locus_tag LOCUS_21250 74858 74640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 75811 75002 gene locus_tag LOCUS_21260 75811 75002 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962306.1 protein_id gnl|my_center|LOCUS_21260 77580 75832 gene locus_tag LOCUS_21270 77580 75832 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099968.1 protein_id gnl|my_center|LOCUS_21270 78437 77604 gene locus_tag LOCUS_21280 78437 77604 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803588.1 protein_id gnl|my_center|LOCUS_21280 79521 78472 gene locus_tag LOCUS_21290 79521 78472 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_21290 80604 79600 gene locus_tag LOCUS_21300 80604 79600 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_21300 82312 80594 gene locus_tag LOCUS_21310 82312 80594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962312.1 protein_id gnl|my_center|LOCUS_21310 83153 82287 gene locus_tag LOCUS_21320 83153 82287 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_21320 84239 83235 gene locus_tag LOCUS_21330 84239 83235 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_21330 85287 84448 gene locus_tag LOCUS_21340 85287 84448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 85439 86194 gene locus_tag LOCUS_21350 85439 86194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 86247 86636 gene locus_tag LOCUS_21360 86247 86636 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_21360 86673 87809 gene locus_tag LOCUS_21370 86673 87809 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038509176.1 protein_id gnl|my_center|LOCUS_21370 87809 88540 gene locus_tag LOCUS_21380 87809 88540 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962317.1 protein_id gnl|my_center|LOCUS_21380 89184 88582 gene locus_tag LOCUS_21390 89184 88582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 89505 90635 gene locus_tag LOCUS_21400 89505 90635 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337358.1 protein_id gnl|my_center|LOCUS_21400 90654 91745 gene locus_tag LOCUS_21410 90654 91745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_21410 91839 92495 gene locus_tag LOCUS_21420 91839 92495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 94130 92577 gene locus_tag LOCUS_21430 94130 92577 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_21430 94896 94363 gene locus_tag LOCUS_21440 94896 94363 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964325.1 protein_id gnl|my_center|LOCUS_21440 95040 96098 gene locus_tag LOCUS_21450 95040 96098 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072178.1 protein_id gnl|my_center|LOCUS_21450 96088 96645 gene locus_tag LOCUS_21460 96088 96645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 96689 96907 gene locus_tag LOCUS_21470 96689 96907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21470 97707 97288 gene locus_tag LOCUS_21480 97707 97288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 98230 103797 gene locus_tag LOCUS_21490 98230 103797 CDS product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964323.1 protein_id gnl|my_center|LOCUS_21490 103826 106180 gene locus_tag LOCUS_21500 gene pbpC 103826 106180 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964324.1 protein_id gnl|my_center|LOCUS_21500 106271 106774 gene locus_tag LOCUS_21510 106271 106774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 106781 107917 gene locus_tag LOCUS_21520 106781 107917 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108777.1 protein_id gnl|my_center|LOCUS_21520 107930 111070 gene locus_tag LOCUS_21530 107930 111070 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783792.1 protein_id gnl|my_center|LOCUS_21530 111073 112470 gene locus_tag LOCUS_21540 111073 112470 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767546.1 protein_id gnl|my_center|LOCUS_21540 113041 112541 gene locus_tag LOCUS_21550 113041 112541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 113508 113026 gene locus_tag LOCUS_21560 113508 113026 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784138.1 protein_id gnl|my_center|LOCUS_21560 114160 113495 gene locus_tag LOCUS_21570 114160 113495 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064094285.1 protein_id gnl|my_center|LOCUS_21570 114229 115332 gene locus_tag LOCUS_21580 gene dinB 114229 115332 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974700.1 protein_id gnl|my_center|LOCUS_21580 116827 115391 gene locus_tag LOCUS_21590 gene pyk 116827 115391 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962380.1 protein_id gnl|my_center|LOCUS_21590 117309 116827 gene locus_tag LOCUS_21600 117309 116827 CDS product IPExxxVDY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962379.1 protein_id gnl|my_center|LOCUS_21600 118138 117392 gene locus_tag LOCUS_21610 gene rnc 118138 117392 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962378.1 protein_id gnl|my_center|LOCUS_21610 119398 118145 gene locus_tag LOCUS_21620 gene fabF 119398 118145 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962377.1 protein_id gnl|my_center|LOCUS_21620 >Feature sequence013 122 477 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2762 510 gene locus_tag LOCUS_21630 2762 510 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107267.1 protein_id gnl|my_center|LOCUS_21630 3649 2786 gene locus_tag LOCUS_21640 3649 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 5821 3662 gene locus_tag LOCUS_21650 5821 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 7236 5824 gene locus_tag LOCUS_21660 7236 5824 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286021.1 protein_id gnl|my_center|LOCUS_21660 7360 8058 gene locus_tag LOCUS_21670 7360 8058 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113632.1 protein_id gnl|my_center|LOCUS_21670 9833 8217 gene locus_tag LOCUS_21680 9833 8217 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_21680 12948 9850 gene locus_tag LOCUS_21690 12948 9850 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108253.1 protein_id gnl|my_center|LOCUS_21690 14145 13285 gene locus_tag LOCUS_21700 14145 13285 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975564.1 protein_id gnl|my_center|LOCUS_21700 14940 14164 gene locus_tag LOCUS_21710 14940 14164 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 protein_id gnl|my_center|LOCUS_21710 16266 14947 gene locus_tag LOCUS_21720 16266 14947 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767711.1 protein_id gnl|my_center|LOCUS_21720 17590 16271 gene locus_tag LOCUS_21730 17590 16271 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211917.1 protein_id gnl|my_center|LOCUS_21730 18565 17699 gene locus_tag LOCUS_21740 18565 17699 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_21740 19413 18568 gene locus_tag LOCUS_21750 19413 18568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 19650 21290 gene locus_tag LOCUS_21760 19650 21290 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_21760 21305 22318 gene locus_tag LOCUS_21770 21305 22318 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972587.1 protein_id gnl|my_center|LOCUS_21770 22327 23154 gene locus_tag LOCUS_21780 22327 23154 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922282.1 protein_id gnl|my_center|LOCUS_21780 23158 23955 gene locus_tag LOCUS_21790 23158 23955 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200881.1 protein_id gnl|my_center|LOCUS_21790 24070 25284 gene locus_tag LOCUS_21800 24070 25284 CDS product L-fucose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694544.1 protein_id gnl|my_center|LOCUS_21800 25287 25628 gene locus_tag LOCUS_21810 25287 25628 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039139.1 protein_id gnl|my_center|LOCUS_21810 26233 29424 gene locus_tag LOCUS_21820 26233 29424 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107218.1 protein_id gnl|my_center|LOCUS_21820 29436 31328 gene locus_tag LOCUS_21830 29436 31328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 31375 34410 gene locus_tag LOCUS_21840 31375 34410 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021929855.1 protein_id gnl|my_center|LOCUS_21840 34421 36178 gene locus_tag LOCUS_21850 34421 36178 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764317.1 protein_id gnl|my_center|LOCUS_21850 36202 37242 gene locus_tag LOCUS_21860 36202 37242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 37273 39444 gene locus_tag LOCUS_21870 37273 39444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 39688 40887 gene locus_tag LOCUS_21880 39688 40887 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275490.1 protein_id gnl|my_center|LOCUS_21880 40894 42471 gene locus_tag LOCUS_21890 40894 42471 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890798.1 protein_id gnl|my_center|LOCUS_21890 42547 43812 gene locus_tag LOCUS_21900 42547 43812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 43882 45243 gene locus_tag LOCUS_21910 43882 45243 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_21910 49218 45250 gene locus_tag LOCUS_21920 49218 45250 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_21920 52271 49467 gene locus_tag LOCUS_21930 52271 49467 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226354.1 protein_id gnl|my_center|LOCUS_21930 53475 52309 gene locus_tag LOCUS_21940 gene uxuA 53475 52309 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050396645.1 protein_id gnl|my_center|LOCUS_21940 54218 53478 gene locus_tag LOCUS_21950 54218 53478 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991075.1 protein_id gnl|my_center|LOCUS_21950 56370 54220 gene locus_tag LOCUS_21960 56370 54220 CDS product alpha-glucuronidase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920652.1 protein_id gnl|my_center|LOCUS_21960 57526 56489 gene locus_tag LOCUS_21970 57526 56489 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_21970 60938 57651 gene locus_tag LOCUS_21980 60938 57651 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_21980 62132 61056 gene locus_tag LOCUS_21990 62132 61056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 62359 62895 gene locus_tag LOCUS_22000 62359 62895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 62908 63453 gene locus_tag LOCUS_22010 62908 63453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962459.1 protein_id gnl|my_center|LOCUS_22010 63470 63997 gene locus_tag LOCUS_22020 63470 63997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 64009 64536 gene locus_tag LOCUS_22030 64009 64536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 66369 64750 gene locus_tag LOCUS_22040 gene pckA 66369 64750 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108802.1 protein_id gnl|my_center|LOCUS_22040 67701 66643 gene locus_tag LOCUS_22050 gene dmlA 67701 66643 CDS product multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978487.1 protein_id gnl|my_center|LOCUS_22050 68596 67703 gene locus_tag LOCUS_22060 68596 67703 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 protein_id gnl|my_center|LOCUS_22060 70072 68603 gene locus_tag LOCUS_22070 70072 68603 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_22070 71024 70074 gene locus_tag LOCUS_22080 71024 70074 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906865.1 protein_id gnl|my_center|LOCUS_22080 74114 71052 gene locus_tag LOCUS_22090 74114 71052 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890684.1 protein_id gnl|my_center|LOCUS_22090 75363 74200 gene locus_tag LOCUS_22100 75363 74200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 75463 75999 gene locus_tag LOCUS_22110 75463 75999 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108735.1 protein_id gnl|my_center|LOCUS_22110 76416 76342 gene locus_tag LOCUS_t00180 76416 76342 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 76573 76965 gene locus_tag LOCUS_22120 76573 76965 CDS product START-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_22120 77019 77858 gene locus_tag LOCUS_22130 77019 77858 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 protein_id gnl|my_center|LOCUS_22130 78423 77863 gene locus_tag LOCUS_22140 78423 77863 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964107.1 protein_id gnl|my_center|LOCUS_22140 78804 78532 gene locus_tag LOCUS_22150 78804 78532 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964108.1 protein_id gnl|my_center|LOCUS_22150 79950 78994 gene locus_tag LOCUS_22160 gene fmt 79950 78994 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964109.1 protein_id gnl|my_center|LOCUS_22160 81851 79947 gene locus_tag LOCUS_22170 81851 79947 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362014.1 protein_id gnl|my_center|LOCUS_22170 82387 81848 gene locus_tag LOCUS_22180 82387 81848 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964111.1 protein_id gnl|my_center|LOCUS_22180 82531 82824 gene locus_tag LOCUS_22190 82531 82824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 83005 83649 gene locus_tag LOCUS_22200 83005 83649 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_22200 83669 84982 gene locus_tag LOCUS_22210 gene murA 83669 84982 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964114.1 protein_id gnl|my_center|LOCUS_22210 85615 85094 gene locus_tag LOCUS_22220 85615 85094 CDS product 5'-3'-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468869.1 protein_id gnl|my_center|LOCUS_22220 85749 86045 gene locus_tag LOCUS_22230 85749 86045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 86026 86712 gene locus_tag LOCUS_22240 86026 86712 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763958.1 protein_id gnl|my_center|LOCUS_22240 86717 87475 gene locus_tag LOCUS_22250 86717 87475 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114678736.1 protein_id gnl|my_center|LOCUS_22250 89094 87790 gene locus_tag LOCUS_22260 89094 87790 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_22260 89848 89150 gene locus_tag LOCUS_22270 89848 89150 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_22270 90366 89854 gene locus_tag LOCUS_22280 90366 89854 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_22280 90659 91498 gene locus_tag LOCUS_22290 90659 91498 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_22290 92558 91578 gene locus_tag LOCUS_22300 92558 91578 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_22300 94304 92577 gene locus_tag LOCUS_22310 94304 92577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 96911 94413 gene locus_tag LOCUS_22320 96911 94413 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383264.1 protein_id gnl|my_center|LOCUS_22320 97896 97003 gene locus_tag LOCUS_22330 97896 97003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 98516 97929 gene locus_tag LOCUS_22340 98516 97929 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963543.1 protein_id gnl|my_center|LOCUS_22340 98850 98542 gene locus_tag LOCUS_22350 98850 98542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 98897 99070 gene locus_tag LOCUS_22360 98897 99070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 99939 99067 gene locus_tag LOCUS_22370 99939 99067 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_22370 100868 100134 gene locus_tag LOCUS_22380 100868 100134 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704223.1 protein_id gnl|my_center|LOCUS_22380 102632 100908 gene locus_tag LOCUS_22390 102632 100908 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962836.1 protein_id gnl|my_center|LOCUS_22390 102969 102625 gene locus_tag LOCUS_22400 102969 102625 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_22400 103556 103059 gene locus_tag LOCUS_22410 103556 103059 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962834.1 protein_id gnl|my_center|LOCUS_22410 103703 104158 gene locus_tag LOCUS_22420 103703 104158 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_22420 104277 105164 gene locus_tag LOCUS_22430 104277 105164 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147838.1 protein_id gnl|my_center|LOCUS_22430 105308 105505 gene locus_tag LOCUS_22440 105308 105505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963849.1 protein_id gnl|my_center|LOCUS_22440 106491 105538 gene locus_tag LOCUS_22450 106491 105538 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_22450 107012 106602 gene locus_tag LOCUS_22460 107012 106602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 >Feature sequence014 300 1439 gene locus_tag LOCUS_22470 gene dnaX 300 1439 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963113.1 protein_id gnl|my_center|LOCUS_22470 1472 2092 gene locus_tag LOCUS_22480 1472 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 2092 2673 gene locus_tag LOCUS_22490 2092 2673 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_22490 3285 2743 gene locus_tag LOCUS_22500 3285 2743 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402867.1 protein_id gnl|my_center|LOCUS_22500 4257 3358 gene locus_tag LOCUS_22510 4257 3358 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_22510 6344 4260 gene locus_tag LOCUS_22520 gene ppk1 6344 4260 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963117.1 protein_id gnl|my_center|LOCUS_22520 6829 6344 gene locus_tag LOCUS_22530 gene sixA 6829 6344 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_22530 7485 6841 gene locus_tag LOCUS_22540 gene pdxH 7485 6841 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963814.1 protein_id gnl|my_center|LOCUS_22540 8520 7606 gene locus_tag LOCUS_22550 8520 7606 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963815.1 protein_id gnl|my_center|LOCUS_22550 8932 8597 gene locus_tag LOCUS_22560 8932 8597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963901.1 protein_id gnl|my_center|LOCUS_22560 9861 8929 gene locus_tag LOCUS_22570 9861 8929 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963902.1 protein_id gnl|my_center|LOCUS_22570 10426 9887 gene locus_tag LOCUS_22580 gene pyrR 10426 9887 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_22580 10686 10537 gene locus_tag LOCUS_22590 10686 10537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 11351 10689 gene locus_tag LOCUS_22600 11351 10689 CDS product DUF4294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963216.1 protein_id gnl|my_center|LOCUS_22600 11494 12579 gene locus_tag LOCUS_22610 11494 12579 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_22610 12777 13853 gene locus_tag LOCUS_22620 12777 13853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 13959 16790 gene locus_tag LOCUS_22630 gene uvrA 13959 16790 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963005.1 protein_id gnl|my_center|LOCUS_22630 16819 17508 gene locus_tag LOCUS_22640 16819 17508 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963001.1 protein_id gnl|my_center|LOCUS_22640 17604 20447 gene locus_tag LOCUS_22650 17604 20447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962879.1 protein_id gnl|my_center|LOCUS_22650 20666 23077 gene locus_tag LOCUS_22660 20666 23077 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_22660 24623 23085 gene locus_tag LOCUS_22670 24623 23085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 25137 24616 gene locus_tag LOCUS_22680 25137 24616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 26032 25193 gene locus_tag LOCUS_22690 26032 25193 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962642.1 protein_id gnl|my_center|LOCUS_22690 27009 26173 gene locus_tag LOCUS_22700 27009 26173 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962641.1 protein_id gnl|my_center|LOCUS_22700 27476 27135 gene locus_tag LOCUS_22710 27476 27135 CDS product DUF2853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963785.1 protein_id gnl|my_center|LOCUS_22710 29266 27551 gene locus_tag LOCUS_22720 gene menD 29266 27551 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963786.1 protein_id gnl|my_center|LOCUS_22720 30476 29373 gene locus_tag LOCUS_22730 30476 29373 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962818.1 protein_id gnl|my_center|LOCUS_22730 30915 30490 gene locus_tag LOCUS_22740 30915 30490 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962819.1 protein_id gnl|my_center|LOCUS_22740 31016 31663 gene locus_tag LOCUS_22750 31016 31663 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_22750 32544 33266 gene locus_tag LOCUS_22760 32544 33266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 34360 33353 gene locus_tag LOCUS_22770 34360 33353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 34537 35040 gene locus_tag LOCUS_22780 34537 35040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 35371 35838 gene locus_tag LOCUS_22790 35371 35838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 35961 39194 gene locus_tag LOCUS_22800 35961 39194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 39175 41115 gene locus_tag LOCUS_22810 39175 41115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 41122 43086 gene locus_tag LOCUS_22820 41122 43086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 43130 44344 gene locus_tag LOCUS_22830 43130 44344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 44386 45612 gene locus_tag LOCUS_22840 44386 45612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 45809 46366 gene locus_tag LOCUS_22850 45809 46366 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_22850 46366 46779 gene locus_tag LOCUS_22860 46366 46779 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_22860 46854 47504 gene locus_tag LOCUS_22870 gene udk 46854 47504 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963257.1 protein_id gnl|my_center|LOCUS_22870 47527 47856 gene locus_tag LOCUS_22880 47527 47856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 47849 49297 gene locus_tag LOCUS_22890 47849 49297 CDS product methylmalonyl-CoA mutase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963259.1 protein_id gnl|my_center|LOCUS_22890 49290 49925 gene locus_tag LOCUS_22900 49290 49925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 49929 52055 gene locus_tag LOCUS_22910 gene scpA 49929 52055 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963261.1 protein_id gnl|my_center|LOCUS_22910 52084 52965 gene locus_tag LOCUS_22920 52084 52965 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097527.1 protein_id gnl|my_center|LOCUS_22920 53141 55936 gene locus_tag LOCUS_22930 53141 55936 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_22930 57174 56008 gene locus_tag LOCUS_22940 57174 56008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 57988 57176 gene locus_tag LOCUS_22950 57988 57176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 58545 59312 gene locus_tag LOCUS_22960 58545 59312 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_22960 59315 60220 gene locus_tag LOCUS_22970 59315 60220 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 protein_id gnl|my_center|LOCUS_22970 60213 60806 gene locus_tag LOCUS_22980 60213 60806 CDS product DUF5683 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963267.1 protein_id gnl|my_center|LOCUS_22980 60809 61504 gene locus_tag LOCUS_22990 gene dapB 60809 61504 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_22990 61605 63179 gene locus_tag LOCUS_23000 gene lepB 61605 63179 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963265.1 protein_id gnl|my_center|LOCUS_23000 63310 63762 gene locus_tag LOCUS_23010 63310 63762 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939839.1 protein_id gnl|my_center|LOCUS_23010 63917 64756 gene locus_tag LOCUS_23020 63917 64756 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_23020 64903 65340 gene locus_tag LOCUS_23030 64903 65340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 65355 65729 gene locus_tag LOCUS_23040 65355 65729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 66533 65790 gene locus_tag LOCUS_23050 66533 65790 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405485.1 protein_id gnl|my_center|LOCUS_23050 67234 66641 gene locus_tag LOCUS_23060 67234 66641 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_23060 67360 69159 gene locus_tag LOCUS_23070 67360 69159 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_23070 69544 71991 gene locus_tag LOCUS_23080 69544 71991 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_23080 72117 72983 gene locus_tag LOCUS_23090 72117 72983 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_23090 73639 73052 gene locus_tag LOCUS_23100 73639 73052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 76011 73654 gene locus_tag LOCUS_23110 76011 73654 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 protein_id gnl|my_center|LOCUS_23110 76484 76164 gene locus_tag LOCUS_23120 76484 76164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 77215 76499 gene locus_tag LOCUS_23130 77215 76499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 78719 77199 gene locus_tag LOCUS_23140 78719 77199 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963094.1 protein_id gnl|my_center|LOCUS_23140 78984 79364 gene locus_tag LOCUS_23150 78984 79364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 80233 79514 gene locus_tag LOCUS_23160 80233 79514 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888106.1 protein_id gnl|my_center|LOCUS_23160 80375 80992 gene locus_tag LOCUS_23170 80375 80992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 80993 81274 gene locus_tag LOCUS_23180 80993 81274 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953389.1 protein_id gnl|my_center|LOCUS_23180 81357 81968 gene locus_tag LOCUS_23190 81357 81968 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963735.1 protein_id gnl|my_center|LOCUS_23190 82219 82950 gene locus_tag LOCUS_23200 82219 82950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 82977 83819 gene locus_tag LOCUS_23210 82977 83819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 84197 83901 gene locus_tag LOCUS_23220 gene yajC 84197 83901 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962700.1 protein_id gnl|my_center|LOCUS_23220 84677 84207 gene locus_tag LOCUS_23230 84677 84207 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 protein_id gnl|my_center|LOCUS_23230 85661 84747 gene locus_tag LOCUS_23240 gene nusB 85661 84747 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962698.1 protein_id gnl|my_center|LOCUS_23240 85959 87716 gene locus_tag LOCUS_23250 85959 87716 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_23250 87784 88155 gene locus_tag LOCUS_23260 87784 88155 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_23260 88314 90830 gene locus_tag LOCUS_23270 88314 90830 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838916.1 protein_id gnl|my_center|LOCUS_23270 90870 91295 gene locus_tag LOCUS_23280 90870 91295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 91613 95476 gene locus_tag LOCUS_23290 91613 95476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 95888 96781 gene locus_tag LOCUS_23300 95888 96781 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921651.1 protein_id gnl|my_center|LOCUS_23300 97057 100305 gene locus_tag LOCUS_23310 97057 100305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 100529 100906 gene locus_tag LOCUS_23320 100529 100906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 100973 101491 gene locus_tag LOCUS_23330 100973 101491 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962661.1 protein_id gnl|my_center|LOCUS_23330 101731 101961 gene locus_tag LOCUS_23340 101731 101961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 101961 102464 gene locus_tag LOCUS_23350 101961 102464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 102623 103774 gene locus_tag LOCUS_23360 102623 103774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 104393 105637 gene locus_tag LOCUS_23370 104393 105637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 <107006 105852 gene locus_tag LOCUS_23380 <107006 105852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963020.1:molecular chaperone DnaK >Feature sequence015 970 557 gene locus_tag LOCUS_23390 970 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 1229 2116 gene locus_tag LOCUS_23400 1229 2116 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119250.1 protein_id gnl|my_center|LOCUS_23400 3469 2135 gene locus_tag LOCUS_23410 3469 2135 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_23410 4671 4201 gene locus_tag LOCUS_23420 4671 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 4945 5607 gene locus_tag LOCUS_23430 4945 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 7225 5648 gene locus_tag LOCUS_23440 7225 5648 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227184.1 protein_id gnl|my_center|LOCUS_23440 8721 7312 gene locus_tag LOCUS_23450 8721 7312 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022878.1 protein_id gnl|my_center|LOCUS_23450 8932 9726 gene locus_tag LOCUS_23460 8932 9726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766739.1 protein_id gnl|my_center|LOCUS_23460 9704 10087 gene locus_tag LOCUS_23470 9704 10087 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817730.1 protein_id gnl|my_center|LOCUS_23470 12435 10831 gene locus_tag LOCUS_23480 12435 10831 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100342827.1 protein_id gnl|my_center|LOCUS_23480 13858 12665 gene locus_tag LOCUS_23490 13858 12665 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703911.1 protein_id gnl|my_center|LOCUS_23490 16276 14054 gene locus_tag LOCUS_23500 16276 14054 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 protein_id gnl|my_center|LOCUS_23500 16843 16412 gene locus_tag LOCUS_23510 16843 16412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 17190 16903 gene locus_tag LOCUS_23520 17190 16903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 19613 17271 gene locus_tag LOCUS_23530 19613 17271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 19892 20050 gene locus_tag LOCUS_23540 19892 20050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 20965 20054 gene locus_tag LOCUS_23550 20965 20054 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403347.1 protein_id gnl|my_center|LOCUS_23550 21787 21002 gene locus_tag LOCUS_23560 21787 21002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 22128 23345 gene locus_tag LOCUS_23570 22128 23345 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969697.1 protein_id gnl|my_center|LOCUS_23570 26637 23347 gene locus_tag LOCUS_23580 26637 23347 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_23580 26792 29539 gene locus_tag LOCUS_23590 26792 29539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_23590 29766 32876 gene locus_tag LOCUS_23600 29766 32876 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769257.1 protein_id gnl|my_center|LOCUS_23600 32895 34316 gene locus_tag LOCUS_23610 32895 34316 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_23610 34336 35700 gene locus_tag LOCUS_23620 34336 35700 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108887.1 protein_id gnl|my_center|LOCUS_23620 35700 37100 gene locus_tag LOCUS_23630 35700 37100 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796641.1 protein_id gnl|my_center|LOCUS_23630 37107 37880 gene locus_tag LOCUS_23640 37107 37880 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108741.1 protein_id gnl|my_center|LOCUS_23640 37908 40184 gene locus_tag LOCUS_23650 gene bglX 37908 40184 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_23650 40196 41101 gene locus_tag LOCUS_23660 40196 41101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 41105 42748 gene locus_tag LOCUS_23670 41105 42748 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158257889.1 protein_id gnl|my_center|LOCUS_23670 42895 43662 gene locus_tag LOCUS_23680 42895 43662 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_23680 44844 43843 gene locus_tag LOCUS_23690 gene mgrA 44844 43843 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640297.1 protein_id gnl|my_center|LOCUS_23690 45039 47417 gene locus_tag LOCUS_23700 45039 47417 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838717.1 protein_id gnl|my_center|LOCUS_23700 48237 47437 gene locus_tag LOCUS_23710 48237 47437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 49186 48353 gene locus_tag LOCUS_23720 49186 48353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 49353 49898 gene locus_tag LOCUS_23730 49353 49898 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962515.1 protein_id gnl|my_center|LOCUS_23730 49911 50435 gene locus_tag LOCUS_23740 gene rimM 49911 50435 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962516.1 protein_id gnl|my_center|LOCUS_23740 50573 51298 gene locus_tag LOCUS_23750 50573 51298 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962517.1 protein_id gnl|my_center|LOCUS_23750 51437 52615 gene locus_tag LOCUS_23760 51437 52615 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_23760 52694 53470 gene locus_tag LOCUS_23770 52694 53470 CDS product DUF3050 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361984.1 protein_id gnl|my_center|LOCUS_23770 53512 54408 gene locus_tag LOCUS_23780 53512 54408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 54431 55192 gene locus_tag LOCUS_23790 54431 55192 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_23790 55536 55216 gene locus_tag LOCUS_23800 55536 55216 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_23800 56572 55664 gene locus_tag LOCUS_23810 56572 55664 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_23810 56939 56691 gene locus_tag LOCUS_23820 56939 56691 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963781.1 protein_id gnl|my_center|LOCUS_23820 58073 56940 gene locus_tag LOCUS_23830 58073 56940 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963780.1 protein_id gnl|my_center|LOCUS_23830 58532 58188 gene locus_tag LOCUS_23840 58532 58188 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_23840 59151 58534 gene locus_tag LOCUS_23850 59151 58534 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962540.1 protein_id gnl|my_center|LOCUS_23850 59832 59158 gene locus_tag LOCUS_23860 gene trmB 59832 59158 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962539.1 protein_id gnl|my_center|LOCUS_23860 62114 61077 gene locus_tag LOCUS_23870 62114 61077 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072879556.1 protein_id gnl|my_center|LOCUS_23870 62846 62163 gene locus_tag LOCUS_23880 62846 62163 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_23880 63008 63985 gene locus_tag LOCUS_23890 63008 63985 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097278.1 protein_id gnl|my_center|LOCUS_23890 64595 64125 gene locus_tag LOCUS_23900 64595 64125 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964461.1 protein_id gnl|my_center|LOCUS_23900 66047 64683 gene locus_tag LOCUS_23910 66047 64683 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_23910 66193 66579 gene locus_tag LOCUS_23920 66193 66579 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 protein_id gnl|my_center|LOCUS_23920 66651 68261 gene locus_tag LOCUS_23930 gene pckA 66651 68261 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108804.1 protein_id gnl|my_center|LOCUS_23930 69091 68336 gene locus_tag LOCUS_23940 69091 68336 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_23940 69768 69103 gene locus_tag LOCUS_23950 69768 69103 CDS product DUF4271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962358.1 protein_id gnl|my_center|LOCUS_23950 69874 70605 gene locus_tag LOCUS_23960 69874 70605 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_23960 70609 71949 gene locus_tag LOCUS_23970 70609 71949 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962341.1 protein_id gnl|my_center|LOCUS_23970 71949 72425 gene locus_tag LOCUS_23980 71949 72425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 73470 72415 gene locus_tag LOCUS_23990 73470 72415 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_23990 73632 74930 gene locus_tag LOCUS_24000 gene tyrS 73632 74930 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962338.1 protein_id gnl|my_center|LOCUS_24000 75827 75069 gene locus_tag LOCUS_24010 75827 75069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 76648 75941 gene locus_tag LOCUS_24020 76648 75941 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_24020 77845 76733 gene locus_tag LOCUS_24030 gene ald 77845 76733 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795308.1 protein_id gnl|my_center|LOCUS_24030 78261 77986 gene locus_tag LOCUS_24040 78261 77986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 82010 78261 gene locus_tag LOCUS_24050 82010 78261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 79438 79694 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 82613 82080 gene locus_tag LOCUS_24060 82613 82080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 82884 83762 gene locus_tag LOCUS_24070 82884 83762 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964449.1 protein_id gnl|my_center|LOCUS_24070 83825 84145 gene locus_tag LOCUS_24080 83825 84145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 84146 84943 gene locus_tag LOCUS_24090 84146 84943 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_24090 84974 85678 gene locus_tag LOCUS_24100 gene truB 84974 85678 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964446.1 protein_id gnl|my_center|LOCUS_24100 85750 86487 gene locus_tag LOCUS_24110 85750 86487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 87103 86465 gene locus_tag LOCUS_24120 87103 86465 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_24120 87197 87775 gene locus_tag LOCUS_24130 87197 87775 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 protein_id gnl|my_center|LOCUS_24130 87772 88326 gene locus_tag LOCUS_24140 87772 88326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 88307 88981 gene locus_tag LOCUS_24150 88307 88981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 89554 88997 gene locus_tag LOCUS_24160 gene aat 89554 88997 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964441.1 protein_id gnl|my_center|LOCUS_24160 90094 89720 gene locus_tag LOCUS_24170 90094 89720 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964440.1 protein_id gnl|my_center|LOCUS_24170 91008 90127 gene locus_tag LOCUS_24180 91008 90127 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_24180 91165 92316 gene locus_tag LOCUS_24190 91165 92316 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_24190 92316 92903 gene locus_tag LOCUS_24200 gene nudK 92316 92903 CDS product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037689.1 protein_id gnl|my_center|LOCUS_24200 92937 93290 gene locus_tag LOCUS_24210 92937 93290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 93672 93283 gene locus_tag LOCUS_24220 93672 93283 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964456.1 protein_id gnl|my_center|LOCUS_24220 94205 93729 gene locus_tag LOCUS_24230 gene greA 94205 93729 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964455.1 protein_id gnl|my_center|LOCUS_24230 94442 94822 gene locus_tag LOCUS_24240 94442 94822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964454.1 protein_id gnl|my_center|LOCUS_24240 97112 94890 gene locus_tag LOCUS_24250 97112 94890 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_24250 97754 97353 gene locus_tag LOCUS_24260 gene arfB 97754 97353 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_24260 99298 97754 gene locus_tag LOCUS_24270 99298 97754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24270 99855 99295 gene locus_tag LOCUS_24280 99855 99295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24280 100448 99816 gene locus_tag LOCUS_24290 gene pnuC 100448 99816 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_24290 101183 100452 gene locus_tag LOCUS_24300 101183 100452 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_24300 101635 101180 gene locus_tag LOCUS_24310 101635 101180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 >Feature sequence016 995 2134 gene locus_tag LOCUS_24320 995 2134 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530336.1 protein_id gnl|my_center|LOCUS_24320 2332 3537 gene locus_tag LOCUS_24330 2332 3537 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073169944.1 protein_id gnl|my_center|LOCUS_24330 3630 4673 gene locus_tag LOCUS_24340 3630 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 4666 5634 gene locus_tag LOCUS_24350 4666 5634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 5631 7235 gene locus_tag LOCUS_24360 5631 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 8177 7464 gene locus_tag LOCUS_24370 gene msrA 8177 7464 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013187310.1 protein_id gnl|my_center|LOCUS_24370 9458 8835 gene locus_tag LOCUS_24380 9458 8835 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459566.1 protein_id gnl|my_center|LOCUS_24380 10196 9465 gene locus_tag LOCUS_24390 10196 9465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 10445 10495 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11429 12796 gene locus_tag LOCUS_24400 gene hemN 11429 12796 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963301.1 protein_id gnl|my_center|LOCUS_24400 13107 13649 gene locus_tag LOCUS_24410 13107 13649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 14654 13947 gene locus_tag LOCUS_24420 14654 13947 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_24420 15103 14657 gene locus_tag LOCUS_24430 15103 14657 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963298.1 protein_id gnl|my_center|LOCUS_24430 15330 15181 gene locus_tag LOCUS_24440 15330 15181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 16759 15338 gene locus_tag LOCUS_24450 gene ccoG 16759 15338 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_24450 17754 16771 gene locus_tag LOCUS_24460 17754 16771 CDS product cbb3-type cytochrome c oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963296.1 protein_id gnl|my_center|LOCUS_24460 17939 17751 gene locus_tag LOCUS_24470 17939 17751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 20146 17942 gene locus_tag LOCUS_24480 gene ccoN 20146 17942 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_24480 20364 20149 gene locus_tag LOCUS_24490 gene ccoS 20364 20149 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963292.1 protein_id gnl|my_center|LOCUS_24490 22856 20424 gene locus_tag LOCUS_24500 22856 20424 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_24500 23055 23672 gene locus_tag LOCUS_24510 23055 23672 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_24510 25524 23674 gene locus_tag LOCUS_24520 25524 23674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 26639 25614 gene locus_tag LOCUS_24530 26639 25614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 26802 27167 gene locus_tag LOCUS_24540 26802 27167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 27305 27736 gene locus_tag LOCUS_24550 27305 27736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 27743 28144 gene locus_tag LOCUS_24560 27743 28144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 28229 29035 gene locus_tag LOCUS_24570 28229 29035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962739.1 protein_id gnl|my_center|LOCUS_24570 29214 30224 gene locus_tag LOCUS_24580 29214 30224 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_24580 30235 31218 gene locus_tag LOCUS_24590 30235 31218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962741.1 protein_id gnl|my_center|LOCUS_24590 31815 34841 gene locus_tag LOCUS_24600 31815 34841 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098195218.1 protein_id gnl|my_center|LOCUS_24600 34861 36669 gene locus_tag LOCUS_24610 34861 36669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 36739 37857 gene locus_tag LOCUS_24620 36739 37857 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794948.1 protein_id gnl|my_center|LOCUS_24620 37847 39634 gene locus_tag LOCUS_24630 37847 39634 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117506598.1 protein_id gnl|my_center|LOCUS_24630 42062 39693 gene locus_tag LOCUS_24640 42062 39693 CDS product DUF2309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404785.1 protein_id gnl|my_center|LOCUS_24640 43546 42065 gene locus_tag LOCUS_24650 43546 42065 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404786.1 protein_id gnl|my_center|LOCUS_24650 44073 43768 gene locus_tag LOCUS_24660 44073 43768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 44176 45102 gene locus_tag LOCUS_24670 gene pycR 44176 45102 CDS product LysR family transcriptional regulator PycR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121355.1 protein_id gnl|my_center|LOCUS_24670 45399 47267 gene locus_tag LOCUS_24680 45399 47267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 47277 48116 gene locus_tag LOCUS_24690 47277 48116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 48191 49039 gene locus_tag LOCUS_24700 48191 49039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 50419 49076 gene locus_tag LOCUS_24710 50419 49076 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_24710 51755 50409 gene locus_tag LOCUS_24720 51755 50409 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794226.1 protein_id gnl|my_center|LOCUS_24720 51961 53214 gene locus_tag LOCUS_24730 51961 53214 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 protein_id gnl|my_center|LOCUS_24730 53272 53976 gene locus_tag LOCUS_24740 53272 53976 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_24740 54009 56456 gene locus_tag LOCUS_24750 54009 56456 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_24750 56522 58879 gene locus_tag LOCUS_24760 56522 58879 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_24760 58907 61378 gene locus_tag LOCUS_24770 58907 61378 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_24770 61403 63802 gene locus_tag LOCUS_24780 61403 63802 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_24780 63855 66266 gene locus_tag LOCUS_24790 63855 66266 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_24790 66330 68774 gene locus_tag LOCUS_24800 66330 68774 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_24800 68860 71256 gene locus_tag LOCUS_24810 68860 71256 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_24810 71318 71995 gene locus_tag LOCUS_24820 71318 71995 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794222.1 protein_id gnl|my_center|LOCUS_24820 72079 73503 gene locus_tag LOCUS_24830 72079 73503 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107656.1 protein_id gnl|my_center|LOCUS_24830 73748 73972 gene locus_tag LOCUS_24840 73748 73972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 74058 74552 gene locus_tag LOCUS_24850 74058 74552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 74892 76010 gene locus_tag LOCUS_24860 74892 76010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 76120 77301 gene locus_tag LOCUS_24870 76120 77301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 77358 79022 gene locus_tag LOCUS_24880 77358 79022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 79106 80173 gene locus_tag LOCUS_24890 79106 80173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 80490 80915 gene locus_tag LOCUS_24900 80490 80915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 81893 81327 gene locus_tag LOCUS_24910 81893 81327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 82528 81956 gene locus_tag LOCUS_24920 82528 81956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 83537 82956 gene locus_tag LOCUS_24930 83537 82956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 83747 83577 gene locus_tag LOCUS_24940 83747 83577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 84129 84302 gene locus_tag LOCUS_24950 84129 84302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 84629 86314 gene locus_tag LOCUS_24960 84629 86314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 86327 86992 gene locus_tag LOCUS_24970 86327 86992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 87799 86993 gene locus_tag LOCUS_24980 87799 86993 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903695.1 protein_id gnl|my_center|LOCUS_24980 89108 92734 gene locus_tag LOCUS_24990 89108 92734 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163515044.1 protein_id gnl|my_center|LOCUS_24990 92900 93838 gene locus_tag LOCUS_25000 92900 93838 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958087.1 protein_id gnl|my_center|LOCUS_25000 93933 94808 gene locus_tag LOCUS_25010 93933 94808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 95005 95772 gene locus_tag LOCUS_25020 95005 95772 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103613.1 protein_id gnl|my_center|LOCUS_25020 95769 96221 gene locus_tag LOCUS_25030 95769 96221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 96233 96724 gene locus_tag LOCUS_25040 96233 96724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 96857 97858 gene locus_tag LOCUS_25050 96857 97858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 97894 99126 gene locus_tag LOCUS_25060 97894 99126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 99905 100208 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence017 627 187 gene locus_tag LOCUS_25070 627 187 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119942.1 protein_id gnl|my_center|LOCUS_25070 566 757 gene locus_tag LOCUS_25080 566 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 911 1888 gene locus_tag LOCUS_25090 gene sbnA 911 1888 CDS product 2,3-diaminopropionate biosynthesis protein SbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145344089.1 protein_id gnl|my_center|LOCUS_25090 1885 3630 gene locus_tag LOCUS_25100 1885 3630 CDS product FAD/NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420131.1 protein_id gnl|my_center|LOCUS_25100 3693 5120 gene locus_tag LOCUS_25110 3693 5120 CDS product Y4yA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921741.1 protein_id gnl|my_center|LOCUS_25110 5130 5402 gene locus_tag LOCUS_25120 5130 5402 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125345.1 protein_id gnl|my_center|LOCUS_25120 5399 5965 gene locus_tag LOCUS_25130 5399 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 5978 6385 gene locus_tag LOCUS_25140 5978 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 6538 8673 gene locus_tag LOCUS_25150 gene katE 6538 8673 CDS product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266295.1 protein_id gnl|my_center|LOCUS_25150 9595 8747 gene locus_tag LOCUS_25160 9595 8747 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432004.1 protein_id gnl|my_center|LOCUS_25160 9759 9625 gene locus_tag LOCUS_25170 9759 9625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 10113 9841 gene locus_tag LOCUS_25180 10113 9841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 10329 10517 gene locus_tag LOCUS_25190 10329 10517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 10495 11649 gene locus_tag LOCUS_25200 10495 11649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 11646 12014 gene locus_tag LOCUS_25210 11646 12014 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_25210 13339 12332 gene locus_tag LOCUS_25220 13339 12332 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107967.1 protein_id gnl|my_center|LOCUS_25220 13554 14948 gene locus_tag LOCUS_25230 13554 14948 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256441.1 protein_id gnl|my_center|LOCUS_25230 15040 18351 gene locus_tag LOCUS_25240 15040 18351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 23166 18577 gene locus_tag LOCUS_25250 23166 18577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 25973 23166 gene locus_tag LOCUS_25260 25973 23166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 29077 26357 gene locus_tag LOCUS_25270 29077 26357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108819.1 protein_id gnl|my_center|LOCUS_25270 30247 29435 gene locus_tag LOCUS_25280 30247 29435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 30429 33467 gene locus_tag LOCUS_25290 30429 33467 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963084.1 protein_id gnl|my_center|LOCUS_25290 33464 34690 gene locus_tag LOCUS_25300 33464 34690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963085.1 protein_id gnl|my_center|LOCUS_25300 34687 36198 gene locus_tag LOCUS_25310 34687 36198 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963086.1 protein_id gnl|my_center|LOCUS_25310 37401 36199 gene locus_tag LOCUS_25320 37401 36199 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963087.1 protein_id gnl|my_center|LOCUS_25320 38777 37521 gene locus_tag LOCUS_25330 38777 37521 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963088.1 protein_id gnl|my_center|LOCUS_25330 39317 41338 gene locus_tag LOCUS_25340 39317 41338 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963167.1 protein_id gnl|my_center|LOCUS_25340 42063 41344 gene locus_tag LOCUS_25350 42063 41344 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 protein_id gnl|my_center|LOCUS_25350 42416 42099 gene locus_tag LOCUS_25360 42416 42099 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963165.1 protein_id gnl|my_center|LOCUS_25360 43453 42419 gene locus_tag LOCUS_25370 43453 42419 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963164.1 protein_id gnl|my_center|LOCUS_25370 44585 43455 gene locus_tag LOCUS_25380 44585 43455 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963163.1 protein_id gnl|my_center|LOCUS_25380 46565 44589 gene locus_tag LOCUS_25390 46565 44589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 47100 46558 gene locus_tag LOCUS_25400 47100 46558 CDS product heme NO-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490721.1 protein_id gnl|my_center|LOCUS_25400 47501 47100 gene locus_tag LOCUS_25410 47501 47100 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 protein_id gnl|my_center|LOCUS_25410 50437 47708 gene locus_tag LOCUS_25420 50437 47708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 50805 51242 gene locus_tag LOCUS_25430 50805 51242 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263864.1 protein_id gnl|my_center|LOCUS_25430 51391 52164 gene locus_tag LOCUS_25440 51391 52164 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_25440 53463 52255 gene locus_tag LOCUS_25450 53463 52255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 54466 53585 gene locus_tag LOCUS_25460 54466 53585 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207473.1 protein_id gnl|my_center|LOCUS_25460 54727 55116 gene locus_tag LOCUS_25470 54727 55116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 55326 56153 gene locus_tag LOCUS_25480 55326 56153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 56436 56155 gene locus_tag LOCUS_25490 56436 56155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 56774 60352 gene locus_tag LOCUS_25500 56774 60352 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163515044.1 protein_id gnl|my_center|LOCUS_25500 60642 62093 gene locus_tag LOCUS_25510 60642 62093 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_25510 62181 63605 gene locus_tag LOCUS_25520 62181 63605 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_25520 65210 63702 gene locus_tag LOCUS_25530 65210 63702 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840507.1 protein_id gnl|my_center|LOCUS_25530 68168 65376 gene locus_tag LOCUS_25540 68168 65376 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109142.1 protein_id gnl|my_center|LOCUS_25540 69512 68232 gene locus_tag LOCUS_25550 69512 68232 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109136.1 protein_id gnl|my_center|LOCUS_25550 70631 69585 gene locus_tag LOCUS_25560 70631 69585 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658101.1 protein_id gnl|my_center|LOCUS_25560 70738 72867 gene locus_tag LOCUS_25570 70738 72867 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973081.1 protein_id gnl|my_center|LOCUS_25570 72937 74217 gene locus_tag LOCUS_25580 gene rhaI 72937 74217 CDS product L-rhamnose catabolism isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533596.1 protein_id gnl|my_center|LOCUS_25580 74236 75609 gene locus_tag LOCUS_25590 74236 75609 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968718.1 protein_id gnl|my_center|LOCUS_25590 75606 76763 gene locus_tag LOCUS_25600 75606 76763 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220815.1 protein_id gnl|my_center|LOCUS_25600 76767 78188 gene locus_tag LOCUS_25610 76767 78188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921337.1 protein_id gnl|my_center|LOCUS_25610 78440 79051 gene locus_tag LOCUS_25620 78440 79051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 79096 79656 gene locus_tag LOCUS_25630 79096 79656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 79756 79941 gene locus_tag LOCUS_25640 79756 79941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 80433 81038 gene locus_tag LOCUS_25650 80433 81038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246043.1 protein_id gnl|my_center|LOCUS_25650 81120 81740 gene locus_tag LOCUS_25660 81120 81740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 81905 82786 gene locus_tag LOCUS_25670 81905 82786 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121934.1 protein_id gnl|my_center|LOCUS_25670 82969 83376 gene locus_tag LOCUS_25680 82969 83376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 83650 84099 gene locus_tag LOCUS_25690 83650 84099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 84292 85200 gene locus_tag LOCUS_25700 84292 85200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 85208 85648 gene locus_tag LOCUS_25710 85208 85648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 85641 86903 gene locus_tag LOCUS_25720 85641 86903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 86990 87511 gene locus_tag LOCUS_25730 86990 87511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 88568 87885 gene locus_tag LOCUS_25740 88568 87885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 88909 89272 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence018 3067 44 gene locus_tag LOCUS_25750 3067 44 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583743.1 protein_id gnl|my_center|LOCUS_25750 4295 3075 gene locus_tag LOCUS_25760 gene dinB 4295 3075 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937382.1 protein_id gnl|my_center|LOCUS_25760 5240 4386 gene locus_tag LOCUS_25770 5240 4386 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118012.1 protein_id gnl|my_center|LOCUS_25770 5398 5544 gene locus_tag LOCUS_25780 5398 5544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 7094 5586 gene locus_tag LOCUS_25790 7094 5586 CDS product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963862.1 protein_id gnl|my_center|LOCUS_25790 7303 7230 gene locus_tag LOCUS_t00190 7303 7230 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 7448 8179 gene locus_tag LOCUS_25800 7448 8179 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964522.1 protein_id gnl|my_center|LOCUS_25800 8179 9435 gene locus_tag LOCUS_25810 8179 9435 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_25810 9470 10843 gene locus_tag LOCUS_25820 9470 10843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 10844 11434 gene locus_tag LOCUS_25830 gene lptC 10844 11434 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964520.1 protein_id gnl|my_center|LOCUS_25830 11434 11628 gene locus_tag LOCUS_25840 11434 11628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 11631 12917 gene locus_tag LOCUS_25850 11631 12917 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_25850 13077 15197 gene locus_tag LOCUS_25860 13077 15197 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964518.1 protein_id gnl|my_center|LOCUS_25860 16165 15251 gene locus_tag LOCUS_25870 16165 15251 CDS product GYDIA family GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_25870 17256 16168 gene locus_tag LOCUS_25880 17256 16168 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258998.1 protein_id gnl|my_center|LOCUS_25880 18578 17253 gene locus_tag LOCUS_25890 18578 17253 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964430.1 protein_id gnl|my_center|LOCUS_25890 18921 21092 gene locus_tag LOCUS_25900 18921 21092 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_25900 21102 22631 gene locus_tag LOCUS_25910 21102 22631 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964426.1 protein_id gnl|my_center|LOCUS_25910 22772 23076 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23089 24750 gene locus_tag LOCUS_25920 23089 24750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 24874 25344 gene locus_tag LOCUS_25930 24874 25344 CDS product thioredoxin fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 protein_id gnl|my_center|LOCUS_25930 27376 25352 gene locus_tag LOCUS_25940 27376 25352 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964423.1 protein_id gnl|my_center|LOCUS_25940 28062 27466 gene locus_tag LOCUS_25950 28062 27466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 29291 28176 gene locus_tag LOCUS_25960 gene lpxB 29291 28176 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_25960 30110 29328 gene locus_tag LOCUS_25970 gene surE 30110 29328 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964421.1 protein_id gnl|my_center|LOCUS_25970 30242 32383 gene locus_tag LOCUS_25980 30242 32383 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_25980 32596 33561 gene locus_tag LOCUS_25990 32596 33561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 33563 34369 gene locus_tag LOCUS_26000 33563 34369 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964510.1 protein_id gnl|my_center|LOCUS_26000 35661 34399 gene locus_tag LOCUS_26010 gene rodA 35661 34399 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_26010 37571 35661 gene locus_tag LOCUS_26020 gene mrdA 37571 35661 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964508.1 protein_id gnl|my_center|LOCUS_26020 38074 37568 gene locus_tag LOCUS_26030 38074 37568 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964507.1 protein_id gnl|my_center|LOCUS_26030 38888 38064 gene locus_tag LOCUS_26040 gene mreC 38888 38064 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099559.1 protein_id gnl|my_center|LOCUS_26040 39931 38903 gene locus_tag LOCUS_26050 39931 38903 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_26050 41531 40005 gene locus_tag LOCUS_26060 gene purH 41531 40005 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964504.1 protein_id gnl|my_center|LOCUS_26060 41668 42921 gene locus_tag LOCUS_26070 41668 42921 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_26070 43394 42924 gene locus_tag LOCUS_26080 43394 42924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 43902 43444 gene locus_tag LOCUS_26090 43902 43444 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964137.1 protein_id gnl|my_center|LOCUS_26090 43920 44483 gene locus_tag LOCUS_26100 gene xrtF 43920 44483 CDS product exosortase family protein XrtF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964136.1 protein_id gnl|my_center|LOCUS_26100 44952 45488 gene locus_tag LOCUS_26110 44952 45488 CDS product DUF3347 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073122886.1 protein_id gnl|my_center|LOCUS_26110 47238 45598 gene locus_tag LOCUS_26120 gene groL 47238 45598 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964087.1 protein_id gnl|my_center|LOCUS_26120 47580 47305 gene locus_tag LOCUS_26130 47580 47305 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964086.1 protein_id gnl|my_center|LOCUS_26130 48070 47726 gene locus_tag LOCUS_26140 48070 47726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 49034 48123 gene locus_tag LOCUS_26150 49034 48123 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964084.1 protein_id gnl|my_center|LOCUS_26150 49555 49040 gene locus_tag LOCUS_26160 49555 49040 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964083.1 protein_id gnl|my_center|LOCUS_26160 50849 49596 gene locus_tag LOCUS_26170 50849 49596 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 protein_id gnl|my_center|LOCUS_26170 52304 50859 gene locus_tag LOCUS_26180 gene miaB 52304 50859 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964081.1 protein_id gnl|my_center|LOCUS_26180 52464 52652 gene locus_tag LOCUS_26190 52464 52652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 52634 55156 gene locus_tag LOCUS_26200 gene topA 52634 55156 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964077.1 protein_id gnl|my_center|LOCUS_26200 55160 56326 gene locus_tag LOCUS_26210 55160 56326 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_26210 56433 57806 gene locus_tag LOCUS_26220 gene gldK 56433 57806 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_26220 57873 58523 gene locus_tag LOCUS_26230 gene gldL 57873 58523 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_26230 58567 60099 gene locus_tag LOCUS_26240 gene gldM 58567 60099 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_26240 60153 61001 gene locus_tag LOCUS_26250 gene gldN 60153 61001 CDS product gliding motility protein GldN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_26250 61090 62145 gene locus_tag LOCUS_26260 61090 62145 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_26260 62605 62132 gene locus_tag LOCUS_26270 62605 62132 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 protein_id gnl|my_center|LOCUS_26270 62644 64551 gene locus_tag LOCUS_26280 62644 64551 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 protein_id gnl|my_center|LOCUS_26280 64627 65760 gene locus_tag LOCUS_26290 64627 65760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 65766 68966 gene locus_tag LOCUS_26300 65766 68966 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_26300 68956 70341 gene locus_tag LOCUS_26310 68956 70341 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764018.1 protein_id gnl|my_center|LOCUS_26310 70342 70524 gene locus_tag LOCUS_26320 70342 70524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 70599 70955 gene locus_tag LOCUS_26330 70599 70955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 71123 71377 gene locus_tag LOCUS_26340 71123 71377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 72942 71374 gene locus_tag LOCUS_26350 72942 71374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 73070 73143 gene locus_tag LOCUS_t00200 73070 73143 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 73410 73829 gene locus_tag LOCUS_26360 73410 73829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 73972 77757 gene locus_tag LOCUS_26370 73972 77757 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_26370 77754 79052 gene locus_tag LOCUS_26380 77754 79052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 79055 79618 gene locus_tag LOCUS_26390 79055 79618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 79701 80024 gene locus_tag LOCUS_26400 79701 80024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 80099 82417 gene locus_tag LOCUS_26410 80099 82417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 >Feature sequence019 657 1511 gene locus_tag LOCUS_26420 657 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016190.1 protein_id gnl|my_center|LOCUS_26420 1508 1822 gene locus_tag LOCUS_26430 1508 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 1987 3012 gene locus_tag LOCUS_26440 1987 3012 CDS product retron St85 family RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016192.1 protein_id gnl|my_center|LOCUS_26440 3202 3714 gene locus_tag LOCUS_26450 3202 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 3774 4358 gene locus_tag LOCUS_26460 3774 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 5211 5762 gene locus_tag LOCUS_26470 5211 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 5883 7037 gene locus_tag LOCUS_26480 5883 7037 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108461.1 protein_id gnl|my_center|LOCUS_26480 8789 7143 gene locus_tag LOCUS_26490 8789 7143 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769526.1 protein_id gnl|my_center|LOCUS_26490 11769 8800 gene locus_tag LOCUS_26500 11769 8800 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791675.1 protein_id gnl|my_center|LOCUS_26500 12038 14458 gene locus_tag LOCUS_26510 gene galB 12038 14458 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202546.1 protein_id gnl|my_center|LOCUS_26510 16333 14453 gene locus_tag LOCUS_26520 16333 14453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 16473 16937 gene locus_tag LOCUS_26530 16473 16937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 17536 17144 gene locus_tag LOCUS_26540 17536 17144 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 protein_id gnl|my_center|LOCUS_26540 17562 18140 gene locus_tag LOCUS_26550 17562 18140 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_26550 18289 18137 gene locus_tag LOCUS_26560 18289 18137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 20676 18793 gene locus_tag LOCUS_26570 20676 18793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 21037 20678 gene locus_tag LOCUS_26580 21037 20678 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 protein_id gnl|my_center|LOCUS_26580 21297 22079 gene locus_tag LOCUS_26590 gene cdaA 21297 22079 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762592.1 protein_id gnl|my_center|LOCUS_26590 22085 22933 gene locus_tag LOCUS_26600 22085 22933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 24704 22935 gene locus_tag LOCUS_26610 24704 22935 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_26610 25458 24694 gene locus_tag LOCUS_26620 gene truA 25458 24694 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963544.1 protein_id gnl|my_center|LOCUS_26620 25531 26025 gene locus_tag LOCUS_26630 25531 26025 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962868.1 protein_id gnl|my_center|LOCUS_26630 26602 26192 gene locus_tag LOCUS_26640 26602 26192 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962875.1 protein_id gnl|my_center|LOCUS_26640 26809 28581 gene locus_tag LOCUS_26650 gene rho 26809 28581 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962876.1 protein_id gnl|my_center|LOCUS_26650 28973 28725 gene locus_tag LOCUS_26660 gene rpsT 28973 28725 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783989.1 protein_id gnl|my_center|LOCUS_26660 29067 28995 gene locus_tag LOCUS_t00210 29067 28995 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 29182 29110 gene locus_tag LOCUS_t00220 29182 29110 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 29183 29430 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29499 29426 gene locus_tag LOCUS_t00230 29499 29426 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 31047 29575 gene locus_tag LOCUS_26670 gene proS 31047 29575 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963521.1 protein_id gnl|my_center|LOCUS_26670 31278 32402 gene locus_tag LOCUS_26680 31278 32402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 32425 33921 gene locus_tag LOCUS_26690 32425 33921 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963523.1 protein_id gnl|my_center|LOCUS_26690 34080 34766 gene locus_tag LOCUS_26700 gene folE 34080 34766 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962758.1 protein_id gnl|my_center|LOCUS_26700 34807 36297 gene locus_tag LOCUS_26710 gene cysS 34807 36297 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962759.1 protein_id gnl|my_center|LOCUS_26710 36625 37569 gene locus_tag LOCUS_26720 gene lgt 36625 37569 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962761.1 protein_id gnl|my_center|LOCUS_26720 37574 38053 gene locus_tag LOCUS_26730 37574 38053 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975603.1 protein_id gnl|my_center|LOCUS_26730 38091 39008 gene locus_tag LOCUS_26740 gene glsB 38091 39008 CDS product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026017793.1 protein_id gnl|my_center|LOCUS_26740 42097 39083 gene locus_tag LOCUS_26750 gene secDF 42097 39083 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962693.1 protein_id gnl|my_center|LOCUS_26750 42635 45190 gene locus_tag LOCUS_26760 42635 45190 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769973.1 protein_id gnl|my_center|LOCUS_26760 46189 45263 gene locus_tag LOCUS_26770 46189 45263 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962692.1 protein_id gnl|my_center|LOCUS_26770 47412 46411 gene locus_tag LOCUS_26780 47412 46411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 49491 47551 gene locus_tag LOCUS_26790 gene gyrB 49491 47551 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962691.1 protein_id gnl|my_center|LOCUS_26790 51505 49820 gene locus_tag LOCUS_26800 gene asnB 51505 49820 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706472.1 protein_id gnl|my_center|LOCUS_26800 51751 52293 gene locus_tag LOCUS_26810 51751 52293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 53016 52384 gene locus_tag LOCUS_26820 53016 52384 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964290.1 protein_id gnl|my_center|LOCUS_26820 53171 54694 gene locus_tag LOCUS_26830 53171 54694 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 protein_id gnl|my_center|LOCUS_26830 54709 55254 gene locus_tag LOCUS_26840 54709 55254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 55281 55646 gene locus_tag LOCUS_26850 55281 55646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 55784 55987 gene locus_tag LOCUS_26860 55784 55987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 56036 56875 gene locus_tag LOCUS_26870 56036 56875 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963353.1 protein_id gnl|my_center|LOCUS_26870 56886 57686 gene locus_tag LOCUS_26880 gene rluF 56886 57686 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963354.1 protein_id gnl|my_center|LOCUS_26880 57779 58024 gene locus_tag LOCUS_26890 57779 58024 CDS product Rho termination factor N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727907.1 protein_id gnl|my_center|LOCUS_26890 58046 58465 gene locus_tag LOCUS_26900 58046 58465 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114206.1 protein_id gnl|my_center|LOCUS_26900 58462 59523 gene locus_tag LOCUS_26910 58462 59523 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202490.1 protein_id gnl|my_center|LOCUS_26910 59498 59977 gene locus_tag LOCUS_26920 59498 59977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 60036 60779 gene locus_tag LOCUS_26930 60036 60779 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 protein_id gnl|my_center|LOCUS_26930 61725 60838 gene locus_tag LOCUS_26940 61725 60838 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963593.1 protein_id gnl|my_center|LOCUS_26940 63131 61803 gene locus_tag LOCUS_26950 gene ffh 63131 61803 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963594.1 protein_id gnl|my_center|LOCUS_26950 65069 63294 gene locus_tag LOCUS_26960 gene argS 65069 63294 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963616.1 protein_id gnl|my_center|LOCUS_26960 65217 65648 gene locus_tag LOCUS_26970 65217 65648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 65840 65649 gene locus_tag LOCUS_26980 65840 65649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 65949 67385 gene locus_tag LOCUS_26990 65949 67385 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 protein_id gnl|my_center|LOCUS_26990 67408 68910 gene locus_tag LOCUS_27000 gene opuD 67408 68910 CDS product glycine betaine transporter OpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229220.1 protein_id gnl|my_center|LOCUS_27000 69839 68907 gene locus_tag LOCUS_27010 69839 68907 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_27010 70776 69862 gene locus_tag LOCUS_27020 70776 69862 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963439.1 protein_id gnl|my_center|LOCUS_27020 72152 70866 gene locus_tag LOCUS_27030 72152 70866 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963440.1 protein_id gnl|my_center|LOCUS_27030 74016 72727 gene locus_tag LOCUS_27040 gene eno 74016 72727 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963441.1 protein_id gnl|my_center|LOCUS_27040 75340 74228 gene locus_tag LOCUS_27050 gene carA 75340 74228 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963443.1 protein_id gnl|my_center|LOCUS_27050 75937 75446 gene locus_tag LOCUS_27060 gene rplQ 75937 75446 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963444.1 protein_id gnl|my_center|LOCUS_27060 76994 76002 gene locus_tag LOCUS_27070 76994 76002 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963445.1 protein_id gnl|my_center|LOCUS_27070 77626 77021 gene locus_tag LOCUS_27080 gene rpsD 77626 77021 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963446.1 protein_id gnl|my_center|LOCUS_27080 78134 77712 gene locus_tag LOCUS_27090 gene rpsK 78134 77712 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963447.1 protein_id gnl|my_center|LOCUS_27090 >Feature sequence020 200 128 gene locus_tag LOCUS_t00240 200 128 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 434 361 gene locus_tag LOCUS_t00250 434 361 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 564 481 gene locus_tag LOCUS_t00260 564 481 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 733 659 gene locus_tag LOCUS_t00270 733 659 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1280 831 gene locus_tag LOCUS_27100 1280 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 2145 1249 gene locus_tag LOCUS_27110 2145 1249 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963321.1 protein_id gnl|my_center|LOCUS_27110 2520 2326 gene locus_tag LOCUS_27120 gene rpsU 2520 2326 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963322.1 protein_id gnl|my_center|LOCUS_27120 3778 2609 gene locus_tag LOCUS_27130 3778 2609 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963323.1 protein_id gnl|my_center|LOCUS_27130 4822 3941 gene locus_tag LOCUS_27140 4822 3941 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963324.1 protein_id gnl|my_center|LOCUS_27140 6911 4836 gene locus_tag LOCUS_27150 6911 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 8251 7244 gene locus_tag LOCUS_27160 8251 7244 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_27160 9827 8526 gene locus_tag LOCUS_27170 9827 8526 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_27170 9944 10426 gene locus_tag LOCUS_27180 9944 10426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 11416 10436 gene locus_tag LOCUS_27190 11416 10436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 12210 11551 gene locus_tag LOCUS_27200 12210 11551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 13686 12430 gene locus_tag LOCUS_27210 13686 12430 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 protein_id gnl|my_center|LOCUS_27210 13667 14926 gene locus_tag LOCUS_27220 13667 14926 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100706.1 protein_id gnl|my_center|LOCUS_27220 15052 15417 gene locus_tag LOCUS_27230 15052 15417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 15433 16719 gene locus_tag LOCUS_27240 15433 16719 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_27240 16845 18395 gene locus_tag LOCUS_27250 16845 18395 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920401.1 protein_id gnl|my_center|LOCUS_27250 18472 19125 gene locus_tag LOCUS_27260 18472 19125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 20117 19128 gene locus_tag LOCUS_27270 20117 19128 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228982.1 protein_id gnl|my_center|LOCUS_27270 20617 20120 gene locus_tag LOCUS_27280 20617 20120 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964287.1 protein_id gnl|my_center|LOCUS_27280 20654 21382 gene locus_tag LOCUS_27290 20654 21382 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964288.1 protein_id gnl|my_center|LOCUS_27290 21492 22280 gene locus_tag LOCUS_27300 21492 22280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 23235 22351 gene locus_tag LOCUS_27310 23235 22351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964516.1 protein_id gnl|my_center|LOCUS_27310 23527 23691 gene locus_tag LOCUS_27320 23527 23691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 24386 23688 gene locus_tag LOCUS_27330 24386 23688 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962235.1 protein_id gnl|my_center|LOCUS_27330 24539 24703 gene locus_tag LOCUS_27340 24539 24703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 25888 24773 gene locus_tag LOCUS_27350 25888 24773 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964539.1 protein_id gnl|my_center|LOCUS_27350 27769 26078 gene locus_tag LOCUS_27360 gene ettA 27769 26078 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963874.1 protein_id gnl|my_center|LOCUS_27360 28101 28892 gene locus_tag LOCUS_27370 gene paoA 28101 28892 CDS product aldehyde dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275317.1 protein_id gnl|my_center|LOCUS_27370 28908 29897 gene locus_tag LOCUS_27380 28908 29897 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105102.1 protein_id gnl|my_center|LOCUS_27380 29908 32079 gene locus_tag LOCUS_27390 29908 32079 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061665.1 protein_id gnl|my_center|LOCUS_27390 32626 32156 gene locus_tag LOCUS_27400 32626 32156 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480196.1 protein_id gnl|my_center|LOCUS_27400 32805 32626 gene locus_tag LOCUS_27410 32805 32626 CDS product CAL67264 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963197.1 protein_id gnl|my_center|LOCUS_27410 33230 34858 gene locus_tag LOCUS_27420 33230 34858 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_27420 34959 35381 gene locus_tag LOCUS_27430 34959 35381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 35389 36489 gene locus_tag LOCUS_27440 35389 36489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 36656 37840 gene locus_tag LOCUS_27450 gene araJ 36656 37840 CDS product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108639.1 protein_id gnl|my_center|LOCUS_27450 39126 37837 gene locus_tag LOCUS_27460 39126 37837 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_27460 39676 39227 gene locus_tag LOCUS_27470 39676 39227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 41537 39708 gene locus_tag LOCUS_27480 41537 39708 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_27480 42709 41633 gene locus_tag LOCUS_27490 42709 41633 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_27490 43679 42726 gene locus_tag LOCUS_27500 43679 42726 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963714.1 protein_id gnl|my_center|LOCUS_27500 44717 43683 gene locus_tag LOCUS_27510 44717 43683 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962662.1 protein_id gnl|my_center|LOCUS_27510 45409 44729 gene locus_tag LOCUS_27520 45409 44729 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287133.1 protein_id gnl|my_center|LOCUS_27520 46392 45490 gene locus_tag LOCUS_27530 gene menA 46392 45490 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962643.1 protein_id gnl|my_center|LOCUS_27530 46534 48198 gene locus_tag LOCUS_27540 46534 48198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 48278 50026 gene locus_tag LOCUS_27550 gene malL 48278 50026 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_27550 50115 50651 gene locus_tag LOCUS_27560 50115 50651 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403648.1 protein_id gnl|my_center|LOCUS_27560 50662 51186 gene locus_tag LOCUS_27570 50662 51186 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123297.1 protein_id gnl|my_center|LOCUS_27570 51371 52528 gene locus_tag LOCUS_27580 51371 52528 CDS product DUF4998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108514.1 protein_id gnl|my_center|LOCUS_27580 52854 53450 gene locus_tag LOCUS_27590 52854 53450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 54430 53498 gene locus_tag LOCUS_27600 54430 53498 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963872.1 protein_id gnl|my_center|LOCUS_27600 55645 54440 gene locus_tag LOCUS_27610 gene mnmA 55645 54440 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963885.1 protein_id gnl|my_center|LOCUS_27610 55855 57699 gene locus_tag LOCUS_27620 55855 57699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 59644 57782 gene locus_tag LOCUS_27630 gene yidC 59644 57782 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964004.1 protein_id gnl|my_center|LOCUS_27630 61459 59831 gene locus_tag LOCUS_27640 61459 59831 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964003.1 protein_id gnl|my_center|LOCUS_27640 61810 61562 gene locus_tag LOCUS_27650 61810 61562 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964002.1 protein_id gnl|my_center|LOCUS_27650 62380 61814 gene locus_tag LOCUS_27660 62380 61814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 63766 62384 gene locus_tag LOCUS_27670 63766 62384 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_27670 63875 64429 gene locus_tag LOCUS_27680 63875 64429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 64465 65064 gene locus_tag LOCUS_27690 64465 65064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569938.1 protein_id gnl|my_center|LOCUS_27690 66669 65134 gene locus_tag LOCUS_27700 66669 65134 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_27700 67711 67115 gene locus_tag LOCUS_27710 67711 67115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 69109 67742 gene locus_tag LOCUS_27720 69109 67742 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_27720 70437 69568 gene locus_tag LOCUS_27730 70437 69568 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962727.1 protein_id gnl|my_center|LOCUS_27730 71612 70449 gene locus_tag LOCUS_27740 71612 70449 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_27740 72466 71615 gene locus_tag LOCUS_27750 72466 71615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 73427 72495 gene locus_tag LOCUS_27760 73427 72495 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141614.1 protein_id gnl|my_center|LOCUS_27760 74723 73434 gene locus_tag LOCUS_27770 74723 73434 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_27770 75679 74723 gene locus_tag LOCUS_27780 75679 74723 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_27780 >Feature sequence021 1293 262 gene locus_tag LOCUS_27790 1293 262 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_27790 3084 1357 gene locus_tag LOCUS_27800 3084 1357 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640593.1 protein_id gnl|my_center|LOCUS_27800 5220 3133 gene locus_tag LOCUS_27810 5220 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 8156 5469 gene locus_tag LOCUS_27820 gene galB 8156 5469 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039185.1 protein_id gnl|my_center|LOCUS_27820 10951 8273 gene locus_tag LOCUS_27830 10951 8273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 12106 10970 gene locus_tag LOCUS_27840 12106 10970 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336377.1 protein_id gnl|my_center|LOCUS_27840 13213 12110 gene locus_tag LOCUS_27850 13213 12110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 15846 13210 gene locus_tag LOCUS_27860 15846 13210 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108580.1 protein_id gnl|my_center|LOCUS_27860 18289 15848 gene locus_tag LOCUS_27870 18289 15848 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303191.1 protein_id gnl|my_center|LOCUS_27870 19677 18304 gene locus_tag LOCUS_27880 19677 18304 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890799.1 protein_id gnl|my_center|LOCUS_27880 21604 19670 gene locus_tag LOCUS_27890 21604 19670 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767043.1 protein_id gnl|my_center|LOCUS_27890 21934 26064 gene locus_tag LOCUS_27900 21934 26064 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_27900 27146 26067 gene locus_tag LOCUS_27910 27146 26067 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583995.1 protein_id gnl|my_center|LOCUS_27910 28616 27165 gene locus_tag LOCUS_27920 28616 27165 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089742.1 protein_id gnl|my_center|LOCUS_27920 32018 28710 gene locus_tag LOCUS_27930 32018 28710 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_27930 33639 32155 gene locus_tag LOCUS_27940 33639 32155 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_27940 36641 33654 gene locus_tag LOCUS_27950 36641 33654 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_27950 37186 39024 gene locus_tag LOCUS_27960 37186 39024 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_27960 41001 39055 gene locus_tag LOCUS_27970 41001 39055 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_27970 41122 43356 gene locus_tag LOCUS_27980 41122 43356 CDS product alpha-glucuronidase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275545.1 protein_id gnl|my_center|LOCUS_27980 43358 44098 gene locus_tag LOCUS_27990 gene kduD 43358 44098 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963683.1 protein_id gnl|my_center|LOCUS_27990 44099 45265 gene locus_tag LOCUS_28000 gene uxuA 44099 45265 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050396645.1 protein_id gnl|my_center|LOCUS_28000 45292 48099 gene locus_tag LOCUS_28010 45292 48099 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226354.1 protein_id gnl|my_center|LOCUS_28010 48259 52314 gene locus_tag LOCUS_28020 48259 52314 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_28020 53756 52386 gene locus_tag LOCUS_28030 53756 52386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 54815 53847 gene locus_tag LOCUS_28040 54815 53847 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 protein_id gnl|my_center|LOCUS_28040 56190 54874 gene locus_tag LOCUS_28050 56190 54874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 57692 56244 gene locus_tag LOCUS_28060 57692 56244 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890798.1 protein_id gnl|my_center|LOCUS_28060 58963 57824 gene locus_tag LOCUS_28070 58963 57824 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275490.1 protein_id gnl|my_center|LOCUS_28070 60460 58979 gene locus_tag LOCUS_28080 60460 58979 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039190.1 protein_id gnl|my_center|LOCUS_28080 62816 60645 gene locus_tag LOCUS_28090 62816 60645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 63912 62854 gene locus_tag LOCUS_28100 63912 62854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 65655 63913 gene locus_tag LOCUS_28110 65655 63913 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764317.1 protein_id gnl|my_center|LOCUS_28110 68705 65679 gene locus_tag LOCUS_28120 68705 65679 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021929855.1 protein_id gnl|my_center|LOCUS_28120 70608 68755 gene locus_tag LOCUS_28130 70608 68755 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107216.1 protein_id gnl|my_center|LOCUS_28130 73853 70659 gene locus_tag LOCUS_28140 73853 70659 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107218.1 protein_id gnl|my_center|LOCUS_28140 >Feature sequence022 405 1490 gene locus_tag LOCUS_28150 405 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 1684 2109 gene locus_tag LOCUS_28160 1684 2109 CDS product DMP19 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038648.1 protein_id gnl|my_center|LOCUS_28160 2633 2337 gene locus_tag LOCUS_28170 2633 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 2860 3204 gene locus_tag LOCUS_28180 2860 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 4805 3309 gene locus_tag LOCUS_28190 4805 3309 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_28190 5167 6618 gene locus_tag LOCUS_28200 5167 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 6754 8019 gene locus_tag LOCUS_28210 6754 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 8012 9727 gene locus_tag LOCUS_28220 8012 9727 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116957511.1 protein_id gnl|my_center|LOCUS_28220 10648 9794 gene locus_tag LOCUS_28230 10648 9794 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382227.1 protein_id gnl|my_center|LOCUS_28230 11373 10645 gene locus_tag LOCUS_28240 gene pxpB 11373 10645 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869461.1 protein_id gnl|my_center|LOCUS_28240 12116 11370 gene locus_tag LOCUS_28250 12116 11370 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868110.1 protein_id gnl|my_center|LOCUS_28250 13336 12113 gene locus_tag LOCUS_28260 13336 12113 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_28260 14454 13336 gene locus_tag LOCUS_28270 14454 13336 CDS product DUF2891 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922099.1 protein_id gnl|my_center|LOCUS_28270 14573 15316 gene locus_tag LOCUS_28280 14573 15316 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224502.1 protein_id gnl|my_center|LOCUS_28280 15381 16199 gene locus_tag LOCUS_28290 15381 16199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 19159 16289 gene locus_tag LOCUS_28300 19159 16289 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_28300 20802 19315 gene locus_tag LOCUS_28310 20802 19315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 22048 20921 gene locus_tag LOCUS_28320 22048 20921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 22954 22238 gene locus_tag LOCUS_28330 22954 22238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 23781 23161 gene locus_tag LOCUS_28340 23781 23161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764517.1 protein_id gnl|my_center|LOCUS_28340 25411 23873 gene locus_tag LOCUS_28350 25411 23873 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963722.1 protein_id gnl|my_center|LOCUS_28350 25569 26060 gene locus_tag LOCUS_28360 25569 26060 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_28360 27796 26057 gene locus_tag LOCUS_28370 27796 26057 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083709.1 protein_id gnl|my_center|LOCUS_28370 27959 28765 gene locus_tag LOCUS_28380 27959 28765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 30656 28776 gene locus_tag LOCUS_28390 30656 28776 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072207.1 protein_id gnl|my_center|LOCUS_28390 32514 30661 gene locus_tag LOCUS_28400 32514 30661 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839780.1 protein_id gnl|my_center|LOCUS_28400 33689 32658 gene locus_tag LOCUS_28410 33689 32658 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_28410 33890 36808 gene locus_tag LOCUS_28420 33890 36808 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_28420 36798 38423 gene locus_tag LOCUS_28430 36798 38423 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789572.1 protein_id gnl|my_center|LOCUS_28430 38444 39511 gene locus_tag LOCUS_28440 38444 39511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 39517 40956 gene locus_tag LOCUS_28450 39517 40956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 41015 43801 gene locus_tag LOCUS_28460 41015 43801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 45579 44227 gene locus_tag LOCUS_28470 gene clcA 45579 44227 CDS product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463563.1 protein_id gnl|my_center|LOCUS_28470 46942 46199 gene locus_tag LOCUS_28480 46942 46199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 48927 47101 gene locus_tag LOCUS_28490 48927 47101 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 protein_id gnl|my_center|LOCUS_28490 50776 48929 gene locus_tag LOCUS_28500 50776 48929 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_28500 52805 50793 gene locus_tag LOCUS_28510 52805 50793 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_28510 54114 52798 gene locus_tag LOCUS_28520 gene tilS 54114 52798 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963738.1 protein_id gnl|my_center|LOCUS_28520 54268 55983 gene locus_tag LOCUS_28530 gene sulP 54268 55983 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 protein_id gnl|my_center|LOCUS_28530 57046 56129 gene locus_tag LOCUS_28540 57046 56129 CDS product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_28540 57197 58087 gene locus_tag LOCUS_28550 57197 58087 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531641.1 protein_id gnl|my_center|LOCUS_28550 58263 61307 gene locus_tag LOCUS_28560 58263 61307 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_28560 61311 62795 gene locus_tag LOCUS_28570 61311 62795 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766147.1 protein_id gnl|my_center|LOCUS_28570 63844 62792 gene locus_tag LOCUS_28580 gene bioF 63844 62792 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118943.1 protein_id gnl|my_center|LOCUS_28580 64851 63841 gene locus_tag LOCUS_28590 64851 63841 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922169.1 protein_id gnl|my_center|LOCUS_28590 64984 66324 gene locus_tag LOCUS_28600 64984 66324 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896784.1 protein_id gnl|my_center|LOCUS_28600 66961 68343 gene locus_tag LOCUS_28610 66961 68343 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_28610 68353 69390 gene locus_tag LOCUS_28620 gene cydB 68353 69390 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_28620 70107 69709 gene locus_tag LOCUS_28630 70107 69709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 70465 71061 gene locus_tag LOCUS_28640 70465 71061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 71139 71711 gene locus_tag LOCUS_28650 71139 71711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 >Feature sequence023 906 1709 gene locus_tag LOCUS_28660 906 1709 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261101.1 protein_id gnl|my_center|LOCUS_28660 1821 2525 gene locus_tag LOCUS_28670 1821 2525 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045801381.1 protein_id gnl|my_center|LOCUS_28670 2634 3068 gene locus_tag LOCUS_28680 2634 3068 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369485.1 protein_id gnl|my_center|LOCUS_28680 3592 3065 gene locus_tag LOCUS_28690 3592 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 4905 3895 gene locus_tag LOCUS_28700 4905 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_28700 5041 6327 gene locus_tag LOCUS_28710 5041 6327 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083225.1 protein_id gnl|my_center|LOCUS_28710 6419 8008 gene locus_tag LOCUS_28720 6419 8008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 8056 8274 gene locus_tag LOCUS_28730 8056 8274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 9489 8491 gene locus_tag LOCUS_28740 9489 8491 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405131.1 protein_id gnl|my_center|LOCUS_28740 10358 9531 gene locus_tag LOCUS_28750 10358 9531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 10571 11041 gene locus_tag LOCUS_28760 10571 11041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 11041 11730 gene locus_tag LOCUS_28770 11041 11730 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_28770 11727 13202 gene locus_tag LOCUS_28780 11727 13202 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_28780 13288 14748 gene locus_tag LOCUS_28790 13288 14748 CDS product DUF2029 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838851.1 protein_id gnl|my_center|LOCUS_28790 14819 16267 gene locus_tag LOCUS_28800 14819 16267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 16264 17187 gene locus_tag LOCUS_28810 16264 17187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 18824 17184 gene locus_tag LOCUS_28820 18824 17184 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661302.1 protein_id gnl|my_center|LOCUS_28820 19450 18821 gene locus_tag LOCUS_28830 19450 18821 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802698.1 protein_id gnl|my_center|LOCUS_28830 20162 19443 gene locus_tag LOCUS_28840 20162 19443 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789838.1 protein_id gnl|my_center|LOCUS_28840 21290 20310 gene locus_tag LOCUS_28850 21290 20310 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963819.1 protein_id gnl|my_center|LOCUS_28850 22218 21274 gene locus_tag LOCUS_28860 gene speB 22218 21274 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_28860 23605 22205 gene locus_tag LOCUS_28870 23605 22205 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963818.1 protein_id gnl|my_center|LOCUS_28870 24601 23747 gene locus_tag LOCUS_28880 24601 23747 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962486.1 protein_id gnl|my_center|LOCUS_28880 25605 24694 gene locus_tag LOCUS_28890 25605 24694 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962485.1 protein_id gnl|my_center|LOCUS_28890 26599 25661 gene locus_tag LOCUS_28900 26599 25661 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_28900 27710 26628 gene locus_tag LOCUS_28910 gene mvaD 27710 26628 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_28910 29553 28282 gene locus_tag LOCUS_28920 29553 28282 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_28920 30038 33124 gene locus_tag LOCUS_28930 30038 33124 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_28930 33111 34766 gene locus_tag LOCUS_28940 33111 34766 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_28940 35023 38226 gene locus_tag LOCUS_28950 35023 38226 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_28950 38219 41569 gene locus_tag LOCUS_28960 38219 41569 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_28960 41589 44801 gene locus_tag LOCUS_28970 41589 44801 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_28970 44844 46196 gene locus_tag LOCUS_28980 44844 46196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 46251 47165 gene locus_tag LOCUS_28990 46251 47165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 47611 47162 gene locus_tag LOCUS_29000 47611 47162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 49019 47664 gene locus_tag LOCUS_29010 49019 47664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 49924 49016 gene locus_tag LOCUS_29020 49924 49016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 50674 50054 gene locus_tag LOCUS_29030 50674 50054 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932168.1 protein_id gnl|my_center|LOCUS_29030 53112 50806 gene locus_tag LOCUS_29040 53112 50806 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 protein_id gnl|my_center|LOCUS_29040 53773 53114 gene locus_tag LOCUS_29050 gene pgmB 53773 53114 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288121.1 protein_id gnl|my_center|LOCUS_29050 54818 53775 gene locus_tag LOCUS_29060 54818 53775 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_29060 54954 56510 gene locus_tag LOCUS_29070 54954 56510 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026811032.1 protein_id gnl|my_center|LOCUS_29070 56536 57873 gene locus_tag LOCUS_29080 56536 57873 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_29080 57925 58818 gene locus_tag LOCUS_29090 57925 58818 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_29090 60308 58878 gene locus_tag LOCUS_29100 60308 58878 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_29100 60473 62245 gene locus_tag LOCUS_29110 60473 62245 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785879.1 protein_id gnl|my_center|LOCUS_29110 62257 62943 gene locus_tag LOCUS_29120 62257 62943 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760381.1 protein_id gnl|my_center|LOCUS_29120 63025 64071 gene locus_tag LOCUS_29130 63025 64071 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024772.1 protein_id gnl|my_center|LOCUS_29130 64215 65093 gene locus_tag LOCUS_29140 gene yghX 64215 65093 CDS product YghX family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005010978.1 protein_id gnl|my_center|LOCUS_29140 66014 65247 gene locus_tag LOCUS_29150 66014 65247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 66517 65978 gene locus_tag LOCUS_29160 66517 65978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 66632 67951 gene locus_tag LOCUS_29170 66632 67951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 67964 68509 gene locus_tag LOCUS_29180 67964 68509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 68520 68975 gene locus_tag LOCUS_29190 68520 68975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 70472 69219 gene locus_tag LOCUS_29200 70472 69219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 >Feature sequence024 859 77 gene locus_tag LOCUS_29210 859 77 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403240.1 protein_id gnl|my_center|LOCUS_29210 1852 917 gene locus_tag LOCUS_29220 1852 917 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_29220 2002 2079 gene locus_tag LOCUS_t00280 2002 2079 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3598 2306 gene locus_tag LOCUS_29230 3598 2306 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963518.1 protein_id gnl|my_center|LOCUS_29230 5359 3665 gene locus_tag LOCUS_29240 gene gldJ 5359 3665 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_29240 5562 9416 gene locus_tag LOCUS_29250 gene porU 5562 9416 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_29250 9455 10627 gene locus_tag LOCUS_29260 gene porV 9455 10627 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_29260 10631 11116 gene locus_tag LOCUS_29270 gene cdd 10631 11116 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_29270 11278 12279 gene locus_tag LOCUS_29280 gene pdhA 11278 12279 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963513.1 protein_id gnl|my_center|LOCUS_29280 12283 13983 gene locus_tag LOCUS_29290 12283 13983 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963512.1 protein_id gnl|my_center|LOCUS_29290 14052 15110 gene locus_tag LOCUS_29300 14052 15110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 15103 15786 gene locus_tag LOCUS_29310 15103 15786 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963511.1 protein_id gnl|my_center|LOCUS_29310 15786 16382 gene locus_tag LOCUS_29320 15786 16382 CDS product SprT-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_29320 16387 17481 gene locus_tag LOCUS_29330 16387 17481 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963509.1 protein_id gnl|my_center|LOCUS_29330 17490 18935 gene locus_tag LOCUS_29340 17490 18935 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783735.1 protein_id gnl|my_center|LOCUS_29340 19699 18929 gene locus_tag LOCUS_29350 19699 18929 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_29350 20436 19699 gene locus_tag LOCUS_29360 20436 19699 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_29360 20549 22189 gene locus_tag LOCUS_29370 20549 22189 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_29370 23029 22181 gene locus_tag LOCUS_29380 23029 22181 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963505.1 protein_id gnl|my_center|LOCUS_29380 23547 23026 gene locus_tag LOCUS_29390 23547 23026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 23701 24252 gene locus_tag LOCUS_29400 gene sigX 23701 24252 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230521.1 protein_id gnl|my_center|LOCUS_29400 24256 24510 gene locus_tag LOCUS_29410 24256 24510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 24837 24475 gene locus_tag LOCUS_29420 24837 24475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 25481 28264 gene locus_tag LOCUS_29430 gene gcvP 25481 28264 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963500.1 protein_id gnl|my_center|LOCUS_29430 28758 28315 gene locus_tag LOCUS_29440 28758 28315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 29135 28755 gene locus_tag LOCUS_29450 29135 28755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 29488 29147 gene locus_tag LOCUS_29460 29488 29147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 30050 29547 gene locus_tag LOCUS_29470 30050 29547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 30131 31357 gene locus_tag LOCUS_29480 30131 31357 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962902.1 protein_id gnl|my_center|LOCUS_29480 31904 31389 gene locus_tag LOCUS_29490 31904 31389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 34026 31972 gene locus_tag LOCUS_29500 34026 31972 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 protein_id gnl|my_center|LOCUS_29500 34699 34220 gene locus_tag LOCUS_29510 gene purE 34699 34220 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963493.1 protein_id gnl|my_center|LOCUS_29510 35862 34705 gene locus_tag LOCUS_29520 35862 34705 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963492.1 protein_id gnl|my_center|LOCUS_29520 36054 37160 gene locus_tag LOCUS_29530 36054 37160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 37222 38235 gene locus_tag LOCUS_29540 gene obgE 37222 38235 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963487.1 protein_id gnl|my_center|LOCUS_29540 38321 38821 gene locus_tag LOCUS_29550 38321 38821 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964059.1 protein_id gnl|my_center|LOCUS_29550 38900 39853 gene locus_tag LOCUS_29560 38900 39853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 40021 41373 gene locus_tag LOCUS_29570 40021 41373 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_29570 41819 41376 gene locus_tag LOCUS_29580 41819 41376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 41926 42624 gene locus_tag LOCUS_29590 gene radC 41926 42624 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_29590 42675 43979 gene locus_tag LOCUS_29600 42675 43979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 43972 44664 gene locus_tag LOCUS_29610 43972 44664 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 protein_id gnl|my_center|LOCUS_29610 44734 45612 gene locus_tag LOCUS_29620 44734 45612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 46977 45700 gene locus_tag LOCUS_29630 46977 45700 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_29630 47420 47845 gene locus_tag LOCUS_29640 47420 47845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 48576 47842 gene locus_tag LOCUS_29650 gene rlmB 48576 47842 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963477.1 protein_id gnl|my_center|LOCUS_29650 49615 48662 gene locus_tag LOCUS_29660 49615 48662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 50469 49633 gene locus_tag LOCUS_29670 50469 49633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 52014 50497 gene locus_tag LOCUS_29680 52014 50497 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963330.1 protein_id gnl|my_center|LOCUS_29680 55134 52027 gene locus_tag LOCUS_29690 55134 52027 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963331.1 protein_id gnl|my_center|LOCUS_29690 57029 55383 gene locus_tag LOCUS_29700 57029 55383 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963474.1 protein_id gnl|my_center|LOCUS_29700 57247 57621 gene locus_tag LOCUS_29710 gene rpsL 57247 57621 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963473.1 protein_id gnl|my_center|LOCUS_29710 57698 58174 gene locus_tag LOCUS_29720 gene rpsG 57698 58174 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963472.1 protein_id gnl|my_center|LOCUS_29720 58346 58654 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence025 854 450 gene locus_tag LOCUS_29730 854 450 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964001.1 protein_id gnl|my_center|LOCUS_29730 2801 858 gene locus_tag LOCUS_29740 2801 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 4451 2919 gene locus_tag LOCUS_29750 gene guaA 4451 2919 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963998.1 protein_id gnl|my_center|LOCUS_29750 4890 5624 gene locus_tag LOCUS_29760 4890 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 6586 5690 gene locus_tag LOCUS_29770 6586 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 8970 6706 gene locus_tag LOCUS_29780 8970 6706 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_29780 10225 9218 gene locus_tag LOCUS_29790 10225 9218 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_29790 11621 10176 gene locus_tag LOCUS_29800 11621 10176 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963305.1 protein_id gnl|my_center|LOCUS_29800 12450 11584 gene locus_tag LOCUS_29810 12450 11584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 12746 13192 gene locus_tag LOCUS_29820 12746 13192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 13195 13428 gene locus_tag LOCUS_29830 13195 13428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963364.1 protein_id gnl|my_center|LOCUS_29830 13601 14128 gene locus_tag LOCUS_29840 13601 14128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 15731 14259 gene locus_tag LOCUS_29850 gene guaB 15731 14259 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963927.1 protein_id gnl|my_center|LOCUS_29850 15928 17148 gene locus_tag LOCUS_29860 15928 17148 CDS product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 protein_id gnl|my_center|LOCUS_29860 17196 18320 gene locus_tag LOCUS_29870 17196 18320 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963605.1 protein_id gnl|my_center|LOCUS_29870 18320 19669 gene locus_tag LOCUS_29880 18320 19669 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_29880 19647 22106 gene locus_tag LOCUS_29890 19647 22106 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_29890 23068 22202 gene locus_tag LOCUS_29900 23068 22202 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_29900 25158 23209 gene locus_tag LOCUS_29910 25158 23209 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012792659.1 protein_id gnl|my_center|LOCUS_29910 26244 25228 gene locus_tag LOCUS_29920 26244 25228 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963929.1 protein_id gnl|my_center|LOCUS_29920 29239 26360 gene locus_tag LOCUS_29930 29239 26360 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890684.1 protein_id gnl|my_center|LOCUS_29930 29380 30627 gene locus_tag LOCUS_29940 gene pepT 29380 30627 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964023.1 protein_id gnl|my_center|LOCUS_29940 30774 31364 gene locus_tag LOCUS_29950 30774 31364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 31472 31948 gene locus_tag LOCUS_29960 31472 31948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 33310 32030 gene locus_tag LOCUS_29970 gene rocD 33310 32030 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_29970 33576 34943 gene locus_tag LOCUS_29980 gene rlmD 33576 34943 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962893.1 protein_id gnl|my_center|LOCUS_29980 34943 35437 gene locus_tag LOCUS_29990 34943 35437 CDS product DUF6452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962892.1 protein_id gnl|my_center|LOCUS_29990 35445 36146 gene locus_tag LOCUS_30000 35445 36146 CDS product DUF6048 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962891.1 protein_id gnl|my_center|LOCUS_30000 36159 37067 gene locus_tag LOCUS_30010 36159 37067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 37102 37908 gene locus_tag LOCUS_30020 37102 37908 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_30020 37921 39153 gene locus_tag LOCUS_30030 37921 39153 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_30030 39235 41451 gene locus_tag LOCUS_30040 39235 41451 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_30040 41452 41964 gene locus_tag LOCUS_30050 41452 41964 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_30050 41965 43236 gene locus_tag LOCUS_30060 41965 43236 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964006.1 protein_id gnl|my_center|LOCUS_30060 43368 44417 gene locus_tag LOCUS_30070 43368 44417 CDS product putative zinc-binding peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967100.1 protein_id gnl|my_center|LOCUS_30070 44469 45044 gene locus_tag LOCUS_30080 44469 45044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 45071 46963 gene locus_tag LOCUS_30090 45071 46963 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963882.1 protein_id gnl|my_center|LOCUS_30090 46953 48143 gene locus_tag LOCUS_30100 46953 48143 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_30100 48260 49669 gene locus_tag LOCUS_30110 48260 49669 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963880.1 protein_id gnl|my_center|LOCUS_30110 49765 50745 gene locus_tag LOCUS_30120 49765 50745 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057642364.1 protein_id gnl|my_center|LOCUS_30120 50735 51751 gene locus_tag LOCUS_30130 50735 51751 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071604.1 protein_id gnl|my_center|LOCUS_30130 51798 52559 gene locus_tag LOCUS_30140 51798 52559 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963879.1 protein_id gnl|my_center|LOCUS_30140 52825 55020 gene locus_tag LOCUS_30150 52825 55020 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963876.1 protein_id gnl|my_center|LOCUS_30150 55033 55659 gene locus_tag LOCUS_30160 55033 55659 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260949.1 protein_id gnl|my_center|LOCUS_30160 56748 55705 gene locus_tag LOCUS_30170 56748 55705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 57460 56924 gene locus_tag LOCUS_30180 57460 56924 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962996.1 protein_id gnl|my_center|LOCUS_30180 58212 57457 gene locus_tag LOCUS_30190 gene kdsB 58212 57457 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963128.1 protein_id gnl|my_center|LOCUS_30190 58788 58219 gene locus_tag LOCUS_30200 58788 58219 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_30200 60225 58792 gene locus_tag LOCUS_30210 60225 58792 CDS product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_30210 >Feature sequence026 <1 1494 gene locus_tag LOCUS_30220 <1 1494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104887.1:ligase-associated DNA damage response DEXH box helicase 1559 2011 gene locus_tag LOCUS_30230 1559 2011 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948145.1 protein_id gnl|my_center|LOCUS_30230 2101 2757 gene locus_tag LOCUS_30240 gene pdeM 2101 2757 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764871.1 protein_id gnl|my_center|LOCUS_30240 2802 3605 gene locus_tag LOCUS_30250 2802 3605 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888398.1 protein_id gnl|my_center|LOCUS_30250 3688 5127 gene locus_tag LOCUS_30260 3688 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 6479 5124 gene locus_tag LOCUS_30270 6479 5124 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163428.1 protein_id gnl|my_center|LOCUS_30270 7299 6517 gene locus_tag LOCUS_30280 7299 6517 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088129.1 protein_id gnl|my_center|LOCUS_30280 7454 10828 gene locus_tag LOCUS_30290 gene mfd 7454 10828 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962369.1 protein_id gnl|my_center|LOCUS_30290 11230 10874 gene locus_tag LOCUS_30300 11230 10874 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361979.1 protein_id gnl|my_center|LOCUS_30300 12156 11239 gene locus_tag LOCUS_30310 12156 11239 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179062.1 protein_id gnl|my_center|LOCUS_30310 12389 14470 gene locus_tag LOCUS_30320 gene metG 12389 14470 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962236.1 protein_id gnl|my_center|LOCUS_30320 14604 16739 gene locus_tag LOCUS_30330 14604 16739 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964572.1 protein_id gnl|my_center|LOCUS_30330 16732 17634 gene locus_tag LOCUS_30340 16732 17634 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404794.1 protein_id gnl|my_center|LOCUS_30340 17766 18305 gene locus_tag LOCUS_30350 17766 18305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 18443 18703 gene locus_tag LOCUS_30360 18443 18703 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262767.1 protein_id gnl|my_center|LOCUS_30360 18724 20496 gene locus_tag LOCUS_30370 18724 20496 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188216241.1 protein_id gnl|my_center|LOCUS_30370 20520 20903 gene locus_tag LOCUS_30380 20520 20903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 21034 22944 gene locus_tag LOCUS_30390 gene acs 21034 22944 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_30390 23304 24167 gene locus_tag LOCUS_30400 23304 24167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 24571 24239 gene locus_tag LOCUS_30410 gene ssb 24571 24239 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361980.1 protein_id gnl|my_center|LOCUS_30410 25135 25299 gene locus_tag LOCUS_30420 25135 25299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 26285 25296 gene locus_tag LOCUS_30430 26285 25296 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102407668.1 protein_id gnl|my_center|LOCUS_30430 27183 26278 gene locus_tag LOCUS_30440 27183 26278 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_30440 27456 28841 gene locus_tag LOCUS_30450 27456 28841 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860163.1 protein_id gnl|my_center|LOCUS_30450 28900 29427 gene locus_tag LOCUS_30460 gene bstA 28900 29427 CDS product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999077.1 protein_id gnl|my_center|LOCUS_30460 29461 29808 gene locus_tag LOCUS_30470 29461 29808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_30470 29903 30379 gene locus_tag LOCUS_30480 29903 30379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 30384 31163 gene locus_tag LOCUS_30490 30384 31163 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963758.1 protein_id gnl|my_center|LOCUS_30490 32191 31160 gene locus_tag LOCUS_30500 32191 31160 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763402.1 protein_id gnl|my_center|LOCUS_30500 33551 32172 gene locus_tag LOCUS_30510 33551 32172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 36268 33551 gene locus_tag LOCUS_30520 36268 33551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 37050 36556 gene locus_tag LOCUS_30530 37050 36556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 37157 39463 gene locus_tag LOCUS_30540 37157 39463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 39495 40295 gene locus_tag LOCUS_30550 39495 40295 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962265.1 protein_id gnl|my_center|LOCUS_30550 41801 40476 gene locus_tag LOCUS_30560 41801 40476 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764912.1 protein_id gnl|my_center|LOCUS_30560 41902 42543 gene locus_tag LOCUS_30570 41902 42543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 44762 42696 gene locus_tag LOCUS_30580 44762 42696 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962266.1 protein_id gnl|my_center|LOCUS_30580 45290 44790 gene locus_tag LOCUS_30590 45290 44790 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962259.1 protein_id gnl|my_center|LOCUS_30590 45891 45301 gene locus_tag LOCUS_30600 45891 45301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 46417 45974 gene locus_tag LOCUS_30610 46417 45974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 47166 46600 gene locus_tag LOCUS_30620 47166 46600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 47434 47727 gene locus_tag LOCUS_30630 47434 47727 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_30630 48167 47808 gene locus_tag LOCUS_30640 48167 47808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962526.1 protein_id gnl|my_center|LOCUS_30640 48436 50688 gene locus_tag LOCUS_30650 48436 50688 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766433.1 protein_id gnl|my_center|LOCUS_30650 53441 50916 gene locus_tag LOCUS_30660 53441 50916 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962626.1 protein_id gnl|my_center|LOCUS_30660 54577 53591 gene locus_tag LOCUS_30670 54577 53591 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_30670 55667 54987 gene locus_tag LOCUS_30680 55667 54987 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151672826.1 protein_id gnl|my_center|LOCUS_30680 56449 55664 gene locus_tag LOCUS_30690 56449 55664 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962233.1 protein_id gnl|my_center|LOCUS_30690 56529 56951 gene locus_tag LOCUS_30700 56529 56951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 57639 56953 gene locus_tag LOCUS_30710 57639 56953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 57848 57651 gene locus_tag LOCUS_30720 57848 57651 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023878.1 protein_id gnl|my_center|LOCUS_30720 58335 57946 gene locus_tag LOCUS_30730 58335 57946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 58911 58438 gene locus_tag LOCUS_30740 58911 58438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 59077 60054 gene locus_tag LOCUS_30750 59077 60054 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098061990.1 protein_id gnl|my_center|LOCUS_30750 >Feature sequence027 <1 2626 gene locus_tag LOCUS_30760 <1 2626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615851.1:Ig-like domain-containing protein 2683 3612 gene locus_tag LOCUS_30770 2683 3612 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_30770 3624 5555 gene locus_tag LOCUS_30780 3624 5555 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_30780 5658 6176 gene locus_tag LOCUS_30790 gene idi 5658 6176 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_30790 6173 6586 gene locus_tag LOCUS_30800 6173 6586 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963898.1 protein_id gnl|my_center|LOCUS_30800 6611 7579 gene locus_tag LOCUS_30810 6611 7579 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963896.1 protein_id gnl|my_center|LOCUS_30810 7645 7911 gene locus_tag LOCUS_30820 7645 7911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963895.1 protein_id gnl|my_center|LOCUS_30820 8746 7985 gene locus_tag LOCUS_30830 8746 7985 CDS product DUF4369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963060.1 protein_id gnl|my_center|LOCUS_30830 9776 8847 gene locus_tag LOCUS_30840 9776 8847 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682158.1 protein_id gnl|my_center|LOCUS_30840 10279 9776 gene locus_tag LOCUS_30850 10279 9776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 10603 11352 gene locus_tag LOCUS_30860 10603 11352 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062784820.1 protein_id gnl|my_center|LOCUS_30860 12243 11380 gene locus_tag LOCUS_30870 12243 11380 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790194.1 protein_id gnl|my_center|LOCUS_30870 13424 12546 gene locus_tag LOCUS_30880 13424 12546 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194105476.1 protein_id gnl|my_center|LOCUS_30880 13627 14211 gene locus_tag LOCUS_30890 13627 14211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 14623 14261 gene locus_tag LOCUS_30900 14623 14261 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963140.1 protein_id gnl|my_center|LOCUS_30900 15059 14655 gene locus_tag LOCUS_30910 15059 14655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 15887 15171 gene locus_tag LOCUS_30920 15887 15171 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021949.1 protein_id gnl|my_center|LOCUS_30920 16536 15931 gene locus_tag LOCUS_30930 16536 15931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 16741 18024 gene locus_tag LOCUS_30940 16741 18024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 18008 18766 gene locus_tag LOCUS_30950 18008 18766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 19401 18793 gene locus_tag LOCUS_30960 gene pncA 19401 18793 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444893.1 protein_id gnl|my_center|LOCUS_30960 19942 19415 gene locus_tag LOCUS_30970 19942 19415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 21345 19945 gene locus_tag LOCUS_30980 21345 19945 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957965.1 protein_id gnl|my_center|LOCUS_30980 23413 21524 gene locus_tag LOCUS_30990 gene htpG 23413 21524 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963627.1 protein_id gnl|my_center|LOCUS_30990 23617 24303 gene locus_tag LOCUS_31000 23617 24303 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963624.1 protein_id gnl|my_center|LOCUS_31000 24309 25616 gene locus_tag LOCUS_31010 24309 25616 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 protein_id gnl|my_center|LOCUS_31010 26609 25752 gene locus_tag LOCUS_31020 gene sppA 26609 25752 CDS product fructose-phosphate phosphohydrolase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263015.1 protein_id gnl|my_center|LOCUS_31020 27093 26617 gene locus_tag LOCUS_31030 27093 26617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 27469 27161 gene locus_tag LOCUS_31040 27469 27161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 31043 27681 gene locus_tag LOCUS_31050 gene secA 31043 27681 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962742.1 protein_id gnl|my_center|LOCUS_31050 31505 31284 gene locus_tag LOCUS_31060 31505 31284 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962743.1 protein_id gnl|my_center|LOCUS_31060 32227 31652 gene locus_tag LOCUS_31070 32227 31652 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_31070 32429 32244 gene locus_tag LOCUS_31080 32429 32244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 33503 32469 gene locus_tag LOCUS_31090 33503 32469 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010255239.1 protein_id gnl|my_center|LOCUS_31090 34143 33490 gene locus_tag LOCUS_31100 34143 33490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 34359 35339 gene locus_tag LOCUS_31110 34359 35339 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962814.1 protein_id gnl|my_center|LOCUS_31110 35389 35904 gene locus_tag LOCUS_31120 35389 35904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 35909 36361 gene locus_tag LOCUS_31130 gene coaD 35909 36361 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962815.1 protein_id gnl|my_center|LOCUS_31130 36365 37171 gene locus_tag LOCUS_31140 36365 37171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 37198 37977 gene locus_tag LOCUS_31150 37198 37977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 40098 38017 gene locus_tag LOCUS_31160 40098 38017 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771258.1 protein_id gnl|my_center|LOCUS_31160 41370 40099 gene locus_tag LOCUS_31170 41370 40099 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142597.1 protein_id gnl|my_center|LOCUS_31170 41662 42180 gene locus_tag LOCUS_31180 41662 42180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 42184 42930 gene locus_tag LOCUS_31190 42184 42930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 43164 43030 gene locus_tag LOCUS_31200 43164 43030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 44048 43284 gene locus_tag LOCUS_31210 gene trpA 44048 43284 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962671.1 protein_id gnl|my_center|LOCUS_31210 45451 44267 gene locus_tag LOCUS_31220 gene trpB 45451 44267 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962672.1 protein_id gnl|my_center|LOCUS_31220 46216 45536 gene locus_tag LOCUS_31230 46216 45536 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962673.1 protein_id gnl|my_center|LOCUS_31230 47164 46382 gene locus_tag LOCUS_31240 gene trpC 47164 46382 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962674.1 protein_id gnl|my_center|LOCUS_31240 48223 47201 gene locus_tag LOCUS_31250 gene trpD 48223 47201 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962675.1 protein_id gnl|my_center|LOCUS_31250 48909 48331 gene locus_tag LOCUS_31260 48909 48331 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_31260 50348 48951 gene locus_tag LOCUS_31270 50348 48951 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_31270 51157 50591 gene locus_tag LOCUS_31280 51157 50591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 51837 51205 gene locus_tag LOCUS_31290 51837 51205 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962679.1 protein_id gnl|my_center|LOCUS_31290 52288 51830 gene locus_tag LOCUS_31300 52288 51830 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_31300 52516 53037 gene locus_tag LOCUS_31310 52516 53037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 53050 53670 gene locus_tag LOCUS_31320 53050 53670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 53734 54054 gene locus_tag LOCUS_31330 53734 54054 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962681.1 protein_id gnl|my_center|LOCUS_31330 55091 56536 gene locus_tag LOCUS_31340 55091 56536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 >Feature sequence028 2939 1551 gene locus_tag LOCUS_31350 2939 1551 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202206.1 protein_id gnl|my_center|LOCUS_31350 3051 3950 gene locus_tag LOCUS_31360 3051 3950 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801276.1 protein_id gnl|my_center|LOCUS_31360 4297 7311 gene locus_tag LOCUS_31370 4297 7311 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_31370 7328 8914 gene locus_tag LOCUS_31380 7328 8914 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108889.1 protein_id gnl|my_center|LOCUS_31380 9060 12566 gene locus_tag LOCUS_31390 9060 12566 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_31390 14933 13602 gene locus_tag LOCUS_31400 14933 13602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 16721 14940 gene locus_tag LOCUS_31410 16721 14940 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_31410 17192 18220 gene locus_tag LOCUS_31420 17192 18220 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_31420 18566 21466 gene locus_tag LOCUS_31430 18566 21466 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108253.1 protein_id gnl|my_center|LOCUS_31430 21477 23120 gene locus_tag LOCUS_31440 21477 23120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 23217 26036 gene locus_tag LOCUS_31450 23217 26036 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108855.1 protein_id gnl|my_center|LOCUS_31450 26043 26783 gene locus_tag LOCUS_31460 26043 26783 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991075.1 protein_id gnl|my_center|LOCUS_31460 26796 27968 gene locus_tag LOCUS_31470 gene uxuA 26796 27968 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050396645.1 protein_id gnl|my_center|LOCUS_31470 28558 28974 gene locus_tag LOCUS_31480 28558 28974 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 protein_id gnl|my_center|LOCUS_31480 28974 29540 gene locus_tag LOCUS_31490 28974 29540 CDS product heme NO-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490721.1 protein_id gnl|my_center|LOCUS_31490 29512 31869 gene locus_tag LOCUS_31500 29512 31869 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963162.1 protein_id gnl|my_center|LOCUS_31500 31874 33007 gene locus_tag LOCUS_31510 31874 33007 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963163.1 protein_id gnl|my_center|LOCUS_31510 33008 34060 gene locus_tag LOCUS_31520 33008 34060 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963164.1 protein_id gnl|my_center|LOCUS_31520 34062 34379 gene locus_tag LOCUS_31530 34062 34379 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963165.1 protein_id gnl|my_center|LOCUS_31530 34389 35108 gene locus_tag LOCUS_31540 34389 35108 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 protein_id gnl|my_center|LOCUS_31540 35239 37644 gene locus_tag LOCUS_31550 35239 37644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 38431 37718 gene locus_tag LOCUS_31560 38431 37718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 40546 38492 gene locus_tag LOCUS_31570 40546 38492 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963167.1 protein_id gnl|my_center|LOCUS_31570 40861 41154 gene locus_tag LOCUS_31580 40861 41154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 41180 42427 gene locus_tag LOCUS_31590 41180 42427 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963088.1 protein_id gnl|my_center|LOCUS_31590 42535 43746 gene locus_tag LOCUS_31600 42535 43746 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963087.1 protein_id gnl|my_center|LOCUS_31600 45397 43874 gene locus_tag LOCUS_31610 45397 43874 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963086.1 protein_id gnl|my_center|LOCUS_31610 46602 45394 gene locus_tag LOCUS_31620 46602 45394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963085.1 protein_id gnl|my_center|LOCUS_31620 49013 46599 gene locus_tag LOCUS_31630 49013 46599 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963084.1 protein_id gnl|my_center|LOCUS_31630 49276 49491 gene locus_tag LOCUS_31640 49276 49491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 49890 50702 gene locus_tag LOCUS_31650 49890 50702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 51428 50724 gene locus_tag LOCUS_31660 51428 50724 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_31660 52464 51433 gene locus_tag LOCUS_31670 52464 51433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 52683 55055 gene locus_tag LOCUS_31680 52683 55055 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_31680 55066 55842 gene locus_tag LOCUS_31690 55066 55842 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706790.1 protein_id gnl|my_center|LOCUS_31690 >Feature sequence029 273 1367 gene locus_tag LOCUS_31700 gene ychF 273 1367 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962805.1 protein_id gnl|my_center|LOCUS_31700 1548 2240 gene locus_tag LOCUS_31710 1548 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 2693 2286 gene locus_tag LOCUS_31720 2693 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963100.1 protein_id gnl|my_center|LOCUS_31720 2912 4264 gene locus_tag LOCUS_31730 2912 4264 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253941.1 protein_id gnl|my_center|LOCUS_31730 4483 4956 gene locus_tag LOCUS_31740 4483 4956 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114745.1 protein_id gnl|my_center|LOCUS_31740 6078 5092 gene locus_tag LOCUS_31750 6078 5092 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252564.1 protein_id gnl|my_center|LOCUS_31750 6540 8222 gene locus_tag LOCUS_31760 gene ilvD 6540 8222 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962618.1 protein_id gnl|my_center|LOCUS_31760 8230 9963 gene locus_tag LOCUS_31770 gene ilvB 8230 9963 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962617.1 protein_id gnl|my_center|LOCUS_31770 9966 10493 gene locus_tag LOCUS_31780 gene ilvN 9966 10493 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_31780 10543 12042 gene locus_tag LOCUS_31790 gene ilvC 10543 12042 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455226.1 protein_id gnl|my_center|LOCUS_31790 12122 13387 gene locus_tag LOCUS_31800 gene ilvA 12122 13387 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962614.1 protein_id gnl|my_center|LOCUS_31800 13413 15008 gene locus_tag LOCUS_31810 13413 15008 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941484.1 protein_id gnl|my_center|LOCUS_31810 15445 15747 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15842 16378 gene locus_tag LOCUS_31820 15842 16378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 16425 17612 gene locus_tag LOCUS_31830 16425 17612 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_31830 17609 18586 gene locus_tag LOCUS_31840 gene argC 17609 18586 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762696.1 protein_id gnl|my_center|LOCUS_31840 18710 19510 gene locus_tag LOCUS_31850 gene proC 18710 19510 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962247.1 protein_id gnl|my_center|LOCUS_31850 19510 20643 gene locus_tag LOCUS_31860 19510 20643 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762695.1 protein_id gnl|my_center|LOCUS_31860 20851 21801 gene locus_tag LOCUS_31870 20851 21801 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202024.1 protein_id gnl|my_center|LOCUS_31870 21811 22587 gene locus_tag LOCUS_31880 gene argB 21811 22587 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783875.1 protein_id gnl|my_center|LOCUS_31880 22587 23651 gene locus_tag LOCUS_31890 22587 23651 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767146.1 protein_id gnl|my_center|LOCUS_31890 23818 25116 gene locus_tag LOCUS_31900 gene argH 23818 25116 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784384.1 protein_id gnl|my_center|LOCUS_31900 25335 25718 gene locus_tag LOCUS_31910 25335 25718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 25887 26951 gene locus_tag LOCUS_31920 25887 26951 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_31920 26974 30177 gene locus_tag LOCUS_31930 26974 30177 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_31930 30167 31612 gene locus_tag LOCUS_31940 30167 31612 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_31940 31870 32631 gene locus_tag LOCUS_31950 31870 32631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 33949 32768 gene locus_tag LOCUS_31960 gene leuB 33949 32768 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789841.1 protein_id gnl|my_center|LOCUS_31960 34575 33991 gene locus_tag LOCUS_31970 gene leuD 34575 33991 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_31970 35961 34576 gene locus_tag LOCUS_31980 gene leuC 35961 34576 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072959918.1 protein_id gnl|my_center|LOCUS_31980 37228 36056 gene locus_tag LOCUS_31990 37228 36056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 37356 38918 gene locus_tag LOCUS_32000 37356 38918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761961.1 protein_id gnl|my_center|LOCUS_32000 39137 39967 gene locus_tag LOCUS_32010 39137 39967 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_32010 41368 40037 gene locus_tag LOCUS_32020 41368 40037 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202181.1 protein_id gnl|my_center|LOCUS_32020 42130 41441 gene locus_tag LOCUS_32030 42130 41441 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963043.1 protein_id gnl|my_center|LOCUS_32030 43043 42225 gene locus_tag LOCUS_32040 gene panB 43043 42225 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963041.1 protein_id gnl|my_center|LOCUS_32040 43113 43562 gene locus_tag LOCUS_32050 43113 43562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 43648 47034 gene locus_tag LOCUS_32060 43648 47034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 48464 47031 gene locus_tag LOCUS_32070 48464 47031 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 protein_id gnl|my_center|LOCUS_32070 48580 48951 gene locus_tag LOCUS_32080 gene umuD 48580 48951 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124912.1 protein_id gnl|my_center|LOCUS_32080 48948 50225 gene locus_tag LOCUS_32090 48948 50225 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962560.1 protein_id gnl|my_center|LOCUS_32090 51463 50459 gene locus_tag LOCUS_32100 51463 50459 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421550.1 protein_id gnl|my_center|LOCUS_32100 52167 51565 gene locus_tag LOCUS_32110 52167 51565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 52716 52255 gene locus_tag LOCUS_32120 52716 52255 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794261.1 protein_id gnl|my_center|LOCUS_32120 52896 54110 gene locus_tag LOCUS_32130 52896 54110 CDS product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259114.1 protein_id gnl|my_center|LOCUS_32130 54512 54249 gene locus_tag LOCUS_32140 54512 54249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 >Feature sequence030 1220 1696 gene locus_tag LOCUS_32150 1220 1696 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788621.1 protein_id gnl|my_center|LOCUS_32150 1830 3227 gene locus_tag LOCUS_32160 1830 3227 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963427.1 protein_id gnl|my_center|LOCUS_32160 3256 4368 gene locus_tag LOCUS_32170 gene gmd 3256 4368 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167740.1 protein_id gnl|my_center|LOCUS_32170 4473 5591 gene locus_tag LOCUS_32180 4473 5591 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763415.1 protein_id gnl|my_center|LOCUS_32180 6155 7513 gene locus_tag LOCUS_32190 6155 7513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 7524 8702 gene locus_tag LOCUS_32200 7524 8702 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141777.1 protein_id gnl|my_center|LOCUS_32200 8779 9570 gene locus_tag LOCUS_32210 8779 9570 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546270.1 protein_id gnl|my_center|LOCUS_32210 9576 10616 gene locus_tag LOCUS_32220 9576 10616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 11668 11399 gene locus_tag LOCUS_32230 11668 11399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 12257 12412 gene locus_tag LOCUS_32240 12257 12412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 12529 13695 gene locus_tag LOCUS_32250 12529 13695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 13959 15134 gene locus_tag LOCUS_32260 13959 15134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 15202 16317 gene locus_tag LOCUS_32270 15202 16317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 16314 17492 gene locus_tag LOCUS_32280 16314 17492 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974187.1 protein_id gnl|my_center|LOCUS_32280 17503 18057 gene locus_tag LOCUS_32290 gene wcaF 17503 18057 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153560.1 protein_id gnl|my_center|LOCUS_32290 18078 18893 gene locus_tag LOCUS_32300 18078 18893 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111408924.1 protein_id gnl|my_center|LOCUS_32300 18894 19835 gene locus_tag LOCUS_32310 18894 19835 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787404.1 protein_id gnl|my_center|LOCUS_32310 20002 20763 gene locus_tag LOCUS_32320 20002 20763 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331386.1 protein_id gnl|my_center|LOCUS_32320 20796 22142 gene locus_tag LOCUS_32330 20796 22142 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 protein_id gnl|my_center|LOCUS_32330 22185 22979 gene locus_tag LOCUS_32340 22185 22979 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_32340 22983 25352 gene locus_tag LOCUS_32350 22983 25352 CDS product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963407.1 protein_id gnl|my_center|LOCUS_32350 27901 27593 gene locus_tag LOCUS_32360 27901 27593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 29744 28575 gene locus_tag LOCUS_32370 29744 28575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 32275 29846 gene locus_tag LOCUS_32380 32275 29846 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108625.1 protein_id gnl|my_center|LOCUS_32380 34260 32371 gene locus_tag LOCUS_32390 34260 32371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 37466 34272 gene locus_tag LOCUS_32400 37466 34272 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_32400 37695 40436 gene locus_tag LOCUS_32410 37695 40436 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_32410 40456 41580 gene locus_tag LOCUS_32420 40456 41580 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759848.1 protein_id gnl|my_center|LOCUS_32420 41995 42915 gene locus_tag LOCUS_32430 41995 42915 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615678.1 protein_id gnl|my_center|LOCUS_32430 43153 44088 gene locus_tag LOCUS_32440 43153 44088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 47159 44265 gene locus_tag LOCUS_32450 47159 44265 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109137.1 protein_id gnl|my_center|LOCUS_32450 48958 47156 gene locus_tag LOCUS_32460 gene rhgW 48958 47156 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886436.1 protein_id gnl|my_center|LOCUS_32460 51572 49047 gene locus_tag LOCUS_32470 51572 49047 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767247.1 protein_id gnl|my_center|LOCUS_32470 53063 51573 gene locus_tag LOCUS_32480 53063 51573 CDS product glycosyl hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303183.1 protein_id gnl|my_center|LOCUS_32480 >Feature sequence031 2395 455 gene locus_tag LOCUS_32490 2395 455 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963329.1 protein_id gnl|my_center|LOCUS_32490 4068 2557 gene locus_tag LOCUS_32500 4068 2557 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768282.1 protein_id gnl|my_center|LOCUS_32500 7285 4079 gene locus_tag LOCUS_32510 7285 4079 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107780.1 protein_id gnl|my_center|LOCUS_32510 7525 8160 gene locus_tag LOCUS_32520 7525 8160 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_32520 8298 10751 gene locus_tag LOCUS_32530 8298 10751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 10925 11650 gene locus_tag LOCUS_32540 10925 11650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 12350 11625 gene locus_tag LOCUS_32550 gene lipB 12350 11625 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963333.1 protein_id gnl|my_center|LOCUS_32550 12670 14385 gene locus_tag LOCUS_32560 gene lysS 12670 14385 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963334.1 protein_id gnl|my_center|LOCUS_32560 14692 14438 gene locus_tag LOCUS_32570 14692 14438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 14816 15307 gene locus_tag LOCUS_32580 14816 15307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 16669 15377 gene locus_tag LOCUS_32590 gene hemL 16669 15377 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963336.1 protein_id gnl|my_center|LOCUS_32590 17502 16669 gene locus_tag LOCUS_32600 17502 16669 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963337.1 protein_id gnl|my_center|LOCUS_32600 18448 17504 gene locus_tag LOCUS_32610 18448 17504 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_32610 18779 20476 gene locus_tag LOCUS_32620 18779 20476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 20798 20478 gene locus_tag LOCUS_32630 20798 20478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964062.1 protein_id gnl|my_center|LOCUS_32630 21085 21627 gene locus_tag LOCUS_32640 21085 21627 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964059.1 protein_id gnl|my_center|LOCUS_32640 22427 21675 gene locus_tag LOCUS_32650 22427 21675 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_32650 22544 24304 gene locus_tag LOCUS_32660 22544 24304 CDS product aromatic amino acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964058.1 protein_id gnl|my_center|LOCUS_32660 24708 24307 gene locus_tag LOCUS_32670 24708 24307 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_32670 26491 24695 gene locus_tag LOCUS_32680 26491 24695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 27080 26499 gene locus_tag LOCUS_32690 27080 26499 CDS product DUF4230 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964057.1 protein_id gnl|my_center|LOCUS_32690 27862 27212 gene locus_tag LOCUS_32700 27862 27212 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244073.1 protein_id gnl|my_center|LOCUS_32700 28612 27887 gene locus_tag LOCUS_32710 28612 27887 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_32710 30497 28713 gene locus_tag LOCUS_32720 30497 28713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 30840 30580 gene locus_tag LOCUS_32730 30840 30580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 31203 30853 gene locus_tag LOCUS_32740 31203 30853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 31950 31213 gene locus_tag LOCUS_32750 31950 31213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 33461 32391 gene locus_tag LOCUS_32760 33461 32391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 34224 33709 gene locus_tag LOCUS_32770 34224 33709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 35243 34296 gene locus_tag LOCUS_32780 35243 34296 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964056.1 protein_id gnl|my_center|LOCUS_32780 38158 35546 gene locus_tag LOCUS_32790 gene alaS 38158 35546 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964045.1 protein_id gnl|my_center|LOCUS_32790 38371 39348 gene locus_tag LOCUS_32800 38371 39348 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_32800 39348 39677 gene locus_tag LOCUS_32810 39348 39677 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_32810 39691 40308 gene locus_tag LOCUS_32820 39691 40308 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964048.1 protein_id gnl|my_center|LOCUS_32820 40308 40748 gene locus_tag LOCUS_32830 40308 40748 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_32830 40886 41554 gene locus_tag LOCUS_32840 40886 41554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 41604 41960 gene locus_tag LOCUS_32850 41604 41960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 42131 42592 gene locus_tag LOCUS_32860 42131 42592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 43106 42639 gene locus_tag LOCUS_32870 gene yiaA 43106 42639 CDS product inner membrane protein YiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208936.1 protein_id gnl|my_center|LOCUS_32870 43255 44715 gene locus_tag LOCUS_32880 43255 44715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 47491 44690 gene locus_tag LOCUS_32890 47491 44690 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_32890 50658 47857 gene locus_tag LOCUS_32900 50658 47857 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_32900 51172 50780 gene locus_tag LOCUS_32910 51172 50780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 51206 51515 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence032 <1 1471 gene locus_tag LOCUS_32920 <1 1471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963779.1:ribonuclease E/G 1632 2111 gene locus_tag LOCUS_32930 1632 2111 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_32930 2974 2108 gene locus_tag LOCUS_32940 2974 2108 CDS product cupin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521521.1 protein_id gnl|my_center|LOCUS_32940 4072 2993 gene locus_tag LOCUS_32950 gene bioB 4072 2993 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962410.1 protein_id gnl|my_center|LOCUS_32950 5422 4178 gene locus_tag LOCUS_32960 5422 4178 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964416.1 protein_id gnl|my_center|LOCUS_32960 5588 6031 gene locus_tag LOCUS_32970 5588 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 7145 6024 gene locus_tag LOCUS_32980 7145 6024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 8478 7213 gene locus_tag LOCUS_32990 gene bioA 8478 7213 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964417.1 protein_id gnl|my_center|LOCUS_32990 9134 8508 gene locus_tag LOCUS_33000 gene bioD 9134 8508 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964418.1 protein_id gnl|my_center|LOCUS_33000 9543 9127 gene locus_tag LOCUS_33010 9543 9127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 10906 9677 gene locus_tag LOCUS_33020 10906 9677 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962298.1 protein_id gnl|my_center|LOCUS_33020 11128 11643 gene locus_tag LOCUS_33030 11128 11643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 11646 11879 gene locus_tag LOCUS_33040 11646 11879 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974619.1 protein_id gnl|my_center|LOCUS_33040 11935 13707 gene locus_tag LOCUS_33050 11935 13707 CDS product M61 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920396.1 protein_id gnl|my_center|LOCUS_33050 14269 13739 gene locus_tag LOCUS_33060 14269 13739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 14619 14341 gene locus_tag LOCUS_33070 14619 14341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 16222 14714 gene locus_tag LOCUS_33080 gene atpD 16222 14714 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962293.1 protein_id gnl|my_center|LOCUS_33080 18287 16437 gene locus_tag LOCUS_33090 gene glmS 18287 16437 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962290.1 protein_id gnl|my_center|LOCUS_33090 19889 18294 gene locus_tag LOCUS_33100 19889 18294 CDS product DUF4270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962289.1 protein_id gnl|my_center|LOCUS_33100 20638 19901 gene locus_tag LOCUS_33110 20638 19901 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_33110 20818 21666 gene locus_tag LOCUS_33120 gene panC 20818 21666 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962287.1 protein_id gnl|my_center|LOCUS_33120 21685 22035 gene locus_tag LOCUS_33130 21685 22035 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962286.1 protein_id gnl|my_center|LOCUS_33130 22053 23021 gene locus_tag LOCUS_33140 22053 23021 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962285.1 protein_id gnl|my_center|LOCUS_33140 23096 24232 gene locus_tag LOCUS_33150 23096 24232 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962284.1 protein_id gnl|my_center|LOCUS_33150 24232 25593 gene locus_tag LOCUS_33160 gene radA 24232 25593 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962283.1 protein_id gnl|my_center|LOCUS_33160 26419 25673 gene locus_tag LOCUS_33170 26419 25673 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_33170 28445 26442 gene locus_tag LOCUS_33180 28445 26442 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 protein_id gnl|my_center|LOCUS_33180 29105 28449 gene locus_tag LOCUS_33190 29105 28449 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_33190 29743 29354 gene locus_tag LOCUS_33200 29743 29354 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788775.1 protein_id gnl|my_center|LOCUS_33200 32601 29758 gene locus_tag LOCUS_33210 32601 29758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 >Feature sequence033 <1 2967 gene locus_tag LOCUS_33220 <1 2967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_185958394.1:TonB-dependent receptor 3051 4373 gene locus_tag LOCUS_33230 3051 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 4438 6948 gene locus_tag LOCUS_33240 4438 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 7292 7008 gene locus_tag LOCUS_33250 7292 7008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 8392 7370 gene locus_tag LOCUS_33260 8392 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 8863 8525 gene locus_tag LOCUS_33270 8863 8525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 9854 8949 gene locus_tag LOCUS_33280 9854 8949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 10234 9860 gene locus_tag LOCUS_33290 10234 9860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 10458 12872 gene locus_tag LOCUS_33300 10458 12872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 12972 13802 gene locus_tag LOCUS_33310 12972 13802 CDS product RteC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963653.1 protein_id gnl|my_center|LOCUS_33310 14085 14354 gene locus_tag LOCUS_33320 14085 14354 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963652.1 protein_id gnl|my_center|LOCUS_33320 14363 15019 gene locus_tag LOCUS_33330 14363 15019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 15003 15659 gene locus_tag LOCUS_33340 15003 15659 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963683.1 protein_id gnl|my_center|LOCUS_33340 16303 15683 gene locus_tag LOCUS_33350 16303 15683 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065597847.1 protein_id gnl|my_center|LOCUS_33350 16412 17296 gene locus_tag LOCUS_33360 16412 17296 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423226.1 protein_id gnl|my_center|LOCUS_33360 17475 17969 gene locus_tag LOCUS_33370 17475 17969 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886701.1 protein_id gnl|my_center|LOCUS_33370 17974 18198 gene locus_tag LOCUS_33380 17974 18198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 19218 18259 gene locus_tag LOCUS_33390 19218 18259 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082266.1 protein_id gnl|my_center|LOCUS_33390 19746 19384 gene locus_tag LOCUS_33400 19746 19384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 20749 20138 gene locus_tag LOCUS_33410 20749 20138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 21340 20756 gene locus_tag LOCUS_33420 21340 20756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 22966 21368 gene locus_tag LOCUS_33430 22966 21368 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943191.1 protein_id gnl|my_center|LOCUS_33430 23615 23160 gene locus_tag LOCUS_33440 23615 23160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 23857 23690 gene locus_tag LOCUS_33450 23857 23690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 <25809 23989 gene locus_tag LOCUS_33460 <25809 23989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963130.1:TonB-dependent receptor >Feature sequence034 <1 573 gene locus_tag LOCUS_33470 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962325.1:50S ribosomal protein L25/general stress protein Ctc 951 1571 gene locus_tag LOCUS_33480 gene pth 951 1571 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100438.1 protein_id gnl|my_center|LOCUS_33480 1573 2508 gene locus_tag LOCUS_33490 1573 2508 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962409.1 protein_id gnl|my_center|LOCUS_33490 2501 3850 gene locus_tag LOCUS_33500 2501 3850 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_33500 4531 3962 gene locus_tag LOCUS_33510 4531 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 5508 4612 gene locus_tag LOCUS_33520 5508 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 6129 5533 gene locus_tag LOCUS_33530 6129 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 7435 6119 gene locus_tag LOCUS_33540 7435 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090662474.1 protein_id gnl|my_center|LOCUS_33540 7886 9157 gene locus_tag LOCUS_33550 gene serS 7886 9157 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_33550 9298 11079 gene locus_tag LOCUS_33560 9298 11079 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962252.1 protein_id gnl|my_center|LOCUS_33560 11099 11425 gene locus_tag LOCUS_33570 11099 11425 CDS product DUF4286 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_33570 11474 12328 gene locus_tag LOCUS_33580 gene rsmA 11474 12328 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962249.1 protein_id gnl|my_center|LOCUS_33580 12488 13837 gene locus_tag LOCUS_33590 gene mgtE 12488 13837 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962248.1 protein_id gnl|my_center|LOCUS_33590 13908 14315 gene locus_tag LOCUS_33600 13908 14315 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207371.1 protein_id gnl|my_center|LOCUS_33600 14324 15262 gene locus_tag LOCUS_33610 14324 15262 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_33610 15343 15948 gene locus_tag LOCUS_33620 15343 15948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 16012 16329 gene locus_tag LOCUS_33630 16012 16329 CDS product NINE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056973.1 protein_id gnl|my_center|LOCUS_33630 16389 16880 gene locus_tag LOCUS_33640 16389 16880 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990112.1 protein_id gnl|my_center|LOCUS_33640 18699 16867 gene locus_tag LOCUS_33650 18699 16867 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962244.1 protein_id gnl|my_center|LOCUS_33650 20058 18805 gene locus_tag LOCUS_33660 20058 18805 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962473.1 protein_id gnl|my_center|LOCUS_33660 20550 20062 gene locus_tag LOCUS_33670 20550 20062 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100451.1 protein_id gnl|my_center|LOCUS_33670 21178 20753 gene locus_tag LOCUS_33680 21178 20753 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962635.1 protein_id gnl|my_center|LOCUS_33680 21654 22595 gene locus_tag LOCUS_33690 21654 22595 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337473.1 protein_id gnl|my_center|LOCUS_33690 22625 24259 gene locus_tag LOCUS_33700 22625 24259 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337472.1 protein_id gnl|my_center|LOCUS_33700 >Feature sequence035 390 650 gene locus_tag LOCUS_33710 390 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 3530 711 gene locus_tag LOCUS_33720 3530 711 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889761.1 protein_id gnl|my_center|LOCUS_33720 4833 3517 gene locus_tag LOCUS_33730 4833 3517 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107166.1 protein_id gnl|my_center|LOCUS_33730 7857 4918 gene locus_tag LOCUS_33740 7857 4918 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_33740 8980 9330 gene locus_tag LOCUS_33750 8980 9330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 9560 9327 gene locus_tag LOCUS_33760 9560 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 10029 9571 gene locus_tag LOCUS_33770 10029 9571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 10314 10922 gene locus_tag LOCUS_33780 10314 10922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 11246 11875 gene locus_tag LOCUS_33790 11246 11875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 12332 12955 gene locus_tag LOCUS_33800 12332 12955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 13134 13337 gene locus_tag LOCUS_33810 13134 13337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 13529 14311 gene locus_tag LOCUS_33820 13529 14311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 14493 15329 gene locus_tag LOCUS_33830 14493 15329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 15521 16402 gene locus_tag LOCUS_33840 15521 16402 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259391.1 protein_id gnl|my_center|LOCUS_33840 16406 17227 gene locus_tag LOCUS_33850 16406 17227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259390.1 protein_id gnl|my_center|LOCUS_33850 17317 18060 gene locus_tag LOCUS_33860 17317 18060 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966202.1 protein_id gnl|my_center|LOCUS_33860 19101 18241 gene locus_tag LOCUS_33870 19101 18241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 19928 19110 gene locus_tag LOCUS_33880 19928 19110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 20505 21365 gene locus_tag LOCUS_33890 20505 21365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 21594 21979 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22078 22380 gene locus_tag LOCUS_33900 22078 22380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 22733 22524 gene locus_tag LOCUS_33910 22733 22524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 22965 22723 gene locus_tag LOCUS_33920 22965 22723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 24125 23367 gene locus_tag LOCUS_33930 24125 23367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963660.1 protein_id gnl|my_center|LOCUS_33930 >Feature sequence036 1215 94 gene locus_tag LOCUS_33940 gene dnaJ 1215 94 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962830.1 protein_id gnl|my_center|LOCUS_33940 1827 1261 gene locus_tag LOCUS_33950 1827 1261 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962831.1 protein_id gnl|my_center|LOCUS_33950 1992 2663 gene locus_tag LOCUS_33960 1992 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 3616 2714 gene locus_tag LOCUS_33970 3616 2714 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_33970 3753 5375 gene locus_tag LOCUS_33980 gene lnt 3753 5375 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933164.1 protein_id gnl|my_center|LOCUS_33980 6741 5353 gene locus_tag LOCUS_33990 6741 5353 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963376.1 protein_id gnl|my_center|LOCUS_33990 7801 6776 gene locus_tag LOCUS_34000 7801 6776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 9119 7749 gene locus_tag LOCUS_34010 9119 7749 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963377.1 protein_id gnl|my_center|LOCUS_34010 10173 9103 gene locus_tag LOCUS_34020 10173 9103 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963378.1 protein_id gnl|my_center|LOCUS_34020 11287 10175 gene locus_tag LOCUS_34030 11287 10175 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963379.1 protein_id gnl|my_center|LOCUS_34030 12276 11284 gene locus_tag LOCUS_34040 12276 11284 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963382.1 protein_id gnl|my_center|LOCUS_34040 13814 12273 gene locus_tag LOCUS_34050 13814 12273 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963383.1 protein_id gnl|my_center|LOCUS_34050 14950 13811 gene locus_tag LOCUS_34060 14950 13811 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963384.1 protein_id gnl|my_center|LOCUS_34060 16041 14950 gene locus_tag LOCUS_34070 16041 14950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 17444 16038 gene locus_tag LOCUS_34080 17444 16038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963386.1 protein_id gnl|my_center|LOCUS_34080 17979 17689 gene locus_tag LOCUS_34090 17979 17689 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832208.1 protein_id gnl|my_center|LOCUS_34090 19320 18196 gene locus_tag LOCUS_34100 gene neuC 19320 18196 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963387.1 protein_id gnl|my_center|LOCUS_34100 20357 19317 gene locus_tag LOCUS_34110 20357 19317 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963388.1 protein_id gnl|my_center|LOCUS_34110 21033 20374 gene locus_tag LOCUS_34120 21033 20374 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963389.1 protein_id gnl|my_center|LOCUS_34120 21974 21030 gene locus_tag LOCUS_34130 21974 21030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 >Feature sequence037 1209 541 gene locus_tag LOCUS_34140 1209 541 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062803978.1 protein_id gnl|my_center|LOCUS_34140 1456 1782 gene locus_tag LOCUS_34150 1456 1782 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300972.1 protein_id gnl|my_center|LOCUS_34150 3057 2329 gene locus_tag LOCUS_34160 3057 2329 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_34160 6082 3047 gene locus_tag LOCUS_34170 6082 3047 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041594898.1 protein_id gnl|my_center|LOCUS_34170 7899 6079 gene locus_tag LOCUS_34180 7899 6079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 9355 7901 gene locus_tag LOCUS_34190 9355 7901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 9896 9423 gene locus_tag LOCUS_34200 9896 9423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 11125 9896 gene locus_tag LOCUS_34210 11125 9896 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484770.1 protein_id gnl|my_center|LOCUS_34210 13527 11116 gene locus_tag LOCUS_34220 13527 11116 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681381.1 protein_id gnl|my_center|LOCUS_34220 13851 13531 gene locus_tag LOCUS_34230 13851 13531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 14313 13867 gene locus_tag LOCUS_34240 14313 13867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 16192 14324 gene locus_tag LOCUS_34250 16192 14324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 17081 16179 gene locus_tag LOCUS_34260 17081 16179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 18346 17078 gene locus_tag LOCUS_34270 18346 17078 CDS product DUF4407 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 protein_id gnl|my_center|LOCUS_34270 18845 18348 gene locus_tag LOCUS_34280 18845 18348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 >Feature sequence038 1143 118 gene locus_tag LOCUS_34290 1143 118 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_34290 2263 1127 gene locus_tag LOCUS_34300 2263 1127 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964380.1 protein_id gnl|my_center|LOCUS_34300 3076 2294 gene locus_tag LOCUS_34310 3076 2294 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964379.1 protein_id gnl|my_center|LOCUS_34310 3183 3626 gene locus_tag LOCUS_34320 3183 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 4960 3950 gene locus_tag LOCUS_34330 4960 3950 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038037.1 protein_id gnl|my_center|LOCUS_34330 5093 6307 gene locus_tag LOCUS_34340 5093 6307 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_34340 6385 7872 gene locus_tag LOCUS_34350 6385 7872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 7955 8251 gene locus_tag LOCUS_34360 7955 8251 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962464.1 protein_id gnl|my_center|LOCUS_34360 8903 8244 gene locus_tag LOCUS_34370 8903 8244 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_34370 12183 8896 gene locus_tag LOCUS_34380 12183 8896 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962469.1 protein_id gnl|my_center|LOCUS_34380 12505 12578 gene locus_tag LOCUS_t00290 12505 12578 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 12961 12641 gene locus_tag LOCUS_34390 12961 12641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 13904 13053 gene locus_tag LOCUS_34400 13904 13053 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_34400 14054 14518 gene locus_tag LOCUS_34410 gene rimP 14054 14518 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962637.1 protein_id gnl|my_center|LOCUS_34410 14528 15757 gene locus_tag LOCUS_34420 gene nusA 14528 15757 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962638.1 protein_id gnl|my_center|LOCUS_34420 17963 18274 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18549 18855 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence039 413 1111 gene locus_tag LOCUS_34430 413 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 1316 1837 gene locus_tag LOCUS_34440 1316 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 2467 1907 gene locus_tag LOCUS_34450 2467 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 4408 2534 gene locus_tag LOCUS_34460 4408 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 6322 5162 gene locus_tag LOCUS_34470 6322 5162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 7744 8796 gene locus_tag LOCUS_34480 7744 8796 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942641.1 protein_id gnl|my_center|LOCUS_34480 9752 8883 gene locus_tag LOCUS_34490 9752 8883 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267661.1 protein_id gnl|my_center|LOCUS_34490 10718 10392 gene locus_tag LOCUS_34500 10718 10392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 10885 12507 gene locus_tag LOCUS_34510 10885 12507 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403855.1 protein_id gnl|my_center|LOCUS_34510 12511 15798 gene locus_tag LOCUS_34520 12511 15798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 15804 17012 gene locus_tag LOCUS_34530 15804 17012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 >Feature sequence040 1826 480 gene locus_tag LOCUS_34540 1826 480 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 protein_id gnl|my_center|LOCUS_34540 2862 1918 gene locus_tag LOCUS_34550 2862 1918 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787404.1 protein_id gnl|my_center|LOCUS_34550 3965 2865 gene locus_tag LOCUS_34560 3965 2865 CDS product DUF1972 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028306.1 protein_id gnl|my_center|LOCUS_34560 4871 3969 gene locus_tag LOCUS_34570 gene rfbD 4871 3969 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_34570 5899 4931 gene locus_tag LOCUS_34580 5899 4931 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202146.1 protein_id gnl|my_center|LOCUS_34580 6800 5910 gene locus_tag LOCUS_34590 6800 5910 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905208.1 protein_id gnl|my_center|LOCUS_34590 8317 6866 gene locus_tag LOCUS_34600 8317 6866 CDS product NDP-hexose 2,3-dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202145.1 protein_id gnl|my_center|LOCUS_34600 9036 8341 gene locus_tag LOCUS_34610 9036 8341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 10280 9048 gene locus_tag LOCUS_34620 10280 9048 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140466.1 protein_id gnl|my_center|LOCUS_34620 11401 10283 gene locus_tag LOCUS_34630 11401 10283 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021207.1 protein_id gnl|my_center|LOCUS_34630 12531 11398 gene locus_tag LOCUS_34640 12531 11398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 13055 12531 gene locus_tag LOCUS_34650 13055 12531 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103394993.1 protein_id gnl|my_center|LOCUS_34650 13582 13049 gene locus_tag LOCUS_34660 13582 13049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 13545 13748 gene locus_tag LOCUS_34670 13545 13748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 15598 14294 gene locus_tag LOCUS_34680 15598 14294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 16167 15598 gene locus_tag LOCUS_34690 gene rfbC 16167 15598 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023680.1 protein_id gnl|my_center|LOCUS_34690 17048 16170 gene locus_tag LOCUS_34700 gene rfbA 17048 16170 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202141.1 protein_id gnl|my_center|LOCUS_34700 >Feature sequence041 2311 3906 gene locus_tag LOCUS_34710 2311 3906 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963308.1 protein_id gnl|my_center|LOCUS_34710 4449 4099 gene locus_tag LOCUS_34720 4449 4099 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_34720 8779 4478 gene locus_tag LOCUS_34730 gene rpoC 8779 4478 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963311.1 protein_id gnl|my_center|LOCUS_34730 9074 8865 gene locus_tag LOCUS_34740 9074 8865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 12994 9029 gene locus_tag LOCUS_34750 gene rpoB 12994 9029 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963312.1 protein_id gnl|my_center|LOCUS_34750 9084 9383 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13558 13184 gene locus_tag LOCUS_34760 gene rplL 13558 13184 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558082.1 protein_id gnl|my_center|LOCUS_34760 14136 13615 gene locus_tag LOCUS_34770 gene rplJ 14136 13615 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963314.1 protein_id gnl|my_center|LOCUS_34770 14845 14147 gene locus_tag LOCUS_34780 gene rplA 14845 14147 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963315.1 protein_id gnl|my_center|LOCUS_34780 >Feature sequence042 535 1515 gene locus_tag LOCUS_34790 535 1515 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963393.1 protein_id gnl|my_center|LOCUS_34790 1603 2442 gene locus_tag LOCUS_34800 1603 2442 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963393.1 protein_id gnl|my_center|LOCUS_34800 2477 3613 gene locus_tag LOCUS_34810 2477 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 3618 4598 gene locus_tag LOCUS_34820 3618 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 4645 5457 gene locus_tag LOCUS_34830 4645 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 5447 6418 gene locus_tag LOCUS_34840 5447 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 6420 7373 gene locus_tag LOCUS_34850 6420 7373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 7355 8608 gene locus_tag LOCUS_34860 7355 8608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 8595 9521 gene locus_tag LOCUS_34870 8595 9521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 9655 10461 gene locus_tag LOCUS_34880 9655 10461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 10458 11117 gene locus_tag LOCUS_34890 10458 11117 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963389.1 protein_id gnl|my_center|LOCUS_34890 11587 12630 gene locus_tag LOCUS_34900 11587 12630 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963388.1 protein_id gnl|my_center|LOCUS_34900 >Feature sequence043 <1 551 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tcactaaaattagtattctgaaagcaattcacaac 760 1569 gene locus_tag LOCUS_34910 760 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 2485 1571 gene locus_tag LOCUS_34920 2485 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 3747 2485 gene locus_tag LOCUS_34930 3747 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 4097 3750 gene locus_tag LOCUS_34940 4097 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 4448 4146 gene locus_tag LOCUS_34950 4448 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 4738 4451 gene locus_tag LOCUS_34960 4738 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 4974 4738 gene locus_tag LOCUS_34970 4974 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 5718 5518 gene locus_tag LOCUS_34980 5718 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 6087 5914 gene locus_tag LOCUS_34990 6087 5914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 6855 6190 gene locus_tag LOCUS_35000 6855 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 8813 6870 gene locus_tag LOCUS_35010 8813 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 9059 8883 gene locus_tag LOCUS_35020 9059 8883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 9438 10232 gene locus_tag LOCUS_35030 9438 10232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 11007 10492 gene locus_tag LOCUS_35040 11007 10492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 >Feature sequence044 477 1361 gene locus_tag LOCUS_35050 477 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 1435 1719 gene locus_tag LOCUS_35060 1435 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 1732 2292 gene locus_tag LOCUS_35070 1732 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 2511 3191 gene locus_tag LOCUS_35080 2511 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 3195 3818 gene locus_tag LOCUS_35090 3195 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 3880 4695 gene locus_tag LOCUS_35100 3880 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 4756 5022 gene locus_tag LOCUS_35110 4756 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 5045 5197 gene locus_tag LOCUS_35120 5045 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 5312 6880 gene locus_tag LOCUS_35130 5312 6880 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084146450.1 protein_id gnl|my_center|LOCUS_35130 7007 7918 gene locus_tag LOCUS_35140 7007 7918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 8038 9984 gene locus_tag LOCUS_35150 gene thrS 8038 9984 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963051.1 protein_id gnl|my_center|LOCUS_35150 10091 10558 gene locus_tag LOCUS_35160 gene infC 10091 10558 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695168.1 protein_id gnl|my_center|LOCUS_35160 >Feature sequence045 1115 261 gene locus_tag LOCUS_35170 1115 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 2054 1125 gene locus_tag LOCUS_35180 2054 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 2686 2072 gene locus_tag LOCUS_35190 gene traK 2686 2072 CDS product conjugative transposon protein TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199146.1 protein_id gnl|my_center|LOCUS_35190 3540 2698 gene locus_tag LOCUS_35200 3540 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 3959 3543 gene locus_tag LOCUS_35210 3959 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 3987 4405 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6842 4446 gene locus_tag LOCUS_35220 6842 4446 CDS product TraG family conjugative transposon ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112378231.1 protein_id gnl|my_center|LOCUS_35220 7522 7157 gene locus_tag LOCUS_35230 7522 7157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 7639 8193 gene locus_tag LOCUS_35240 7639 8193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 8350 9024 gene locus_tag LOCUS_35250 8350 9024 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107524.1 protein_id gnl|my_center|LOCUS_35250 9026 10303 gene locus_tag LOCUS_35260 9026 10303 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107523.1 protein_id gnl|my_center|LOCUS_35260 >Feature sequence046 20 1834 gene locus_tag LOCUS_35270 20 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 1878 4643 gene locus_tag LOCUS_35280 1878 4643 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202204.1 protein_id gnl|my_center|LOCUS_35280 4705 7047 gene locus_tag LOCUS_35290 4705 7047 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109056.1 protein_id gnl|my_center|LOCUS_35290 9862 7145 gene locus_tag LOCUS_35300 9862 7145 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109137.1 protein_id gnl|my_center|LOCUS_35300 >Feature sequence047 609 313 gene locus_tag LOCUS_35310 609 313 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_35310 735 1820 gene locus_tag LOCUS_35320 gene mutY 735 1820 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_35320 1913 2377 gene locus_tag LOCUS_35330 gene ssb 1913 2377 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963776.1 protein_id gnl|my_center|LOCUS_35330 2422 3750 gene locus_tag LOCUS_35340 2422 3750 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_35340 3743 4330 gene locus_tag LOCUS_35350 gene gldD 3743 4330 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_35350 4404 5300 gene locus_tag LOCUS_35360 4404 5300 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_35360 7402 5333 gene locus_tag LOCUS_35370 7402 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 8774 7455 gene locus_tag LOCUS_35380 8774 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 8986 9453 gene locus_tag LOCUS_35390 8986 9453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 >Feature sequence048 1015 335 gene locus_tag LOCUS_35400 1015 335 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161829.1 protein_id gnl|my_center|LOCUS_35400 2004 1114 gene locus_tag LOCUS_35410 2004 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 3597 2161 gene locus_tag LOCUS_35420 3597 2161 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813969.1 protein_id gnl|my_center|LOCUS_35420 6809 3663 gene locus_tag LOCUS_35430 6809 3663 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947887.1 protein_id gnl|my_center|LOCUS_35430 8145 6940 gene locus_tag LOCUS_35440 8145 6940 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947886.1 protein_id gnl|my_center|LOCUS_35440 8616 8263 gene locus_tag LOCUS_35450 8616 8263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 <10024 8874 gene locus_tag LOCUS_35460 <10024 8874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051907092.1:type IV secretion system DNA-binding domain-containing protein >Feature sequence049 4412 3969 gene locus_tag LOCUS_35470 4412 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 6781 4889 gene locus_tag LOCUS_35480 6781 4889 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_35480 7769 6792 gene locus_tag LOCUS_35490 7769 6792 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_35490 <9615 7780 gene locus_tag LOCUS_35500 <9615 7780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_072992487.1:ice-binding family protein >Feature sequence050 1126 26 gene locus_tag LOCUS_35510 1126 26 CDS product L-dopachrome tautomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210042844.1 protein_id gnl|my_center|LOCUS_35510 2082 1138 gene locus_tag LOCUS_35520 2082 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 3208 2099 gene locus_tag LOCUS_35530 3208 2099 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139327943.1 protein_id gnl|my_center|LOCUS_35530 4615 3221 gene locus_tag LOCUS_35540 4615 3221 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298165.1 protein_id gnl|my_center|LOCUS_35540 5489 4617 gene locus_tag LOCUS_35550 5489 4617 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113964.1 protein_id gnl|my_center|LOCUS_35550 6582 5512 gene locus_tag LOCUS_35560 6582 5512 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768800.1 protein_id gnl|my_center|LOCUS_35560 8000 6756 gene locus_tag LOCUS_35570 8000 6756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 >Feature sequence051 576 3740 gene locus_tag LOCUS_35580 576 3740 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765284.1 protein_id gnl|my_center|LOCUS_35580 3754 5724 gene locus_tag LOCUS_35590 3754 5724 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108516.1 protein_id gnl|my_center|LOCUS_35590 5737 6945 gene locus_tag LOCUS_35600 5737 6945 CDS product DUF4959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108515.1 protein_id gnl|my_center|LOCUS_35600 >Feature sequence052 411 596 gene locus_tag LOCUS_35610 411 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 821 1000 gene locus_tag LOCUS_35620 821 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 1418 2260 gene locus_tag LOCUS_35630 1418 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 3671 2415 gene locus_tag LOCUS_35640 3671 2415 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962560.1 protein_id gnl|my_center|LOCUS_35640 4092 3673 gene locus_tag LOCUS_35650 gene umuD 4092 3673 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768414.1 protein_id gnl|my_center|LOCUS_35650 4403 4140 gene locus_tag LOCUS_35660 4403 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 4444 5187 gene locus_tag LOCUS_35670 4444 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 5522 5262 gene locus_tag LOCUS_35680 5522 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 6464 5748 gene locus_tag LOCUS_35690 6464 5748 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_35690 >Feature sequence053 2949 541 gene locus_tag LOCUS_35700 2949 541 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082478.1 protein_id gnl|my_center|LOCUS_35700 3033 3740 gene locus_tag LOCUS_35710 3033 3740 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226433.1 protein_id gnl|my_center|LOCUS_35710 4471 3737 gene locus_tag LOCUS_35720 4471 3737 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021349.1 protein_id gnl|my_center|LOCUS_35720 <6902 4539 gene locus_tag LOCUS_35730 <6902 4539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034349876.1:excinuclease ABC subunit UvrA >Feature sequence054 156 1397 gene locus_tag LOCUS_35740 156 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 1565 1413 gene locus_tag LOCUS_35750 1565 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 1510 2016 gene locus_tag LOCUS_35760 1510 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 2056 2778 gene locus_tag LOCUS_35770 2056 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 2781 3188 gene locus_tag LOCUS_35780 2781 3188 CDS product curli assembly protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073481.1 protein_id gnl|my_center|LOCUS_35780 3198 4616 gene locus_tag LOCUS_35790 3198 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 4606 6120 gene locus_tag LOCUS_35800 4606 6120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 >Feature sequence055 3394 212 gene locus_tag LOCUS_35810 3394 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 5685 3511 gene locus_tag LOCUS_35820 5685 3511 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_35820 6146 5736 gene locus_tag LOCUS_35830 6146 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 >Feature sequence056 1472 852 gene locus_tag LOCUS_35840 gene bioD 1472 852 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964418.1 protein_id gnl|my_center|LOCUS_35840 1881 1465 gene locus_tag LOCUS_35850 1881 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 3095 1920 gene locus_tag LOCUS_35860 3095 1920 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962298.1 protein_id gnl|my_center|LOCUS_35860 3311 3826 gene locus_tag LOCUS_35870 3311 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 3917 4345 gene locus_tag LOCUS_35880 3917 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 4348 4554 gene locus_tag LOCUS_35890 4348 4554 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774957.1 protein_id gnl|my_center|LOCUS_35890 >Feature sequence057 957 181 gene locus_tag LOCUS_35900 957 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 1517 954 gene locus_tag LOCUS_35910 1517 954 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168199.1 protein_id gnl|my_center|LOCUS_35910 1643 2155 gene locus_tag LOCUS_35920 1643 2155 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918302.1 protein_id gnl|my_center|LOCUS_35920 2300 3403 gene locus_tag LOCUS_35930 2300 3403 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108777.1 protein_id gnl|my_center|LOCUS_35930 >Feature sequence058 3273 859 gene locus_tag LOCUS_35940 3273 859 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_35940 4068 3364 gene locus_tag LOCUS_35950 4068 3364 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_35950 5329 4124 gene locus_tag LOCUS_35960 5329 4124 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202492.1 protein_id gnl|my_center|LOCUS_35960 >Feature sequence059 <1 940 gene locus_tag LOCUS_35970 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272562.1:arsenosugar biosynthesis radical SAM protein ArsS 986 1666 gene locus_tag LOCUS_35980 986 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 1761 4952 gene locus_tag LOCUS_35990 1761 4952 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_35990 >Feature sequence060 1794 307 gene locus_tag LOCUS_36000 1794 307 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_36000 4840 1805 gene locus_tag LOCUS_36010 4840 1805 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_36010 >Feature sequence061 <1 769 gene locus_tag LOCUS_36020 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482643.1:ACR3 family arsenite efflux transporter 1922 792 gene locus_tag LOCUS_36030 1922 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 3035 1959 gene locus_tag LOCUS_36040 3035 1959 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958153.1 protein_id gnl|my_center|LOCUS_36040 3716 3129 gene locus_tag LOCUS_36050 3716 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 4428 3874 gene locus_tag LOCUS_36060 4428 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 >Feature sequence062 1917 184 gene locus_tag LOCUS_36070 1917 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 2688 2059 gene locus_tag LOCUS_36080 2688 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 4184 3084 gene locus_tag LOCUS_36090 4184 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 >Feature sequence063 <1 637 gene locus_tag LOCUS_36100 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962192.1:DNA polymerase III subunit delta' 1260 685 gene locus_tag LOCUS_36110 1260 685 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962186.1 protein_id gnl|my_center|LOCUS_36110 2318 1464 gene locus_tag LOCUS_36120 2318 1464 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_36120 4250 2373 gene locus_tag LOCUS_36130 gene mnmG 4250 2373 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962184.1 protein_id gnl|my_center|LOCUS_36130 4742 4329 gene locus_tag LOCUS_36140 gene ybeY 4742 4329 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962183.1 protein_id gnl|my_center|LOCUS_36140 >Feature sequence064 <1 2023 gene locus_tag LOCUS_36150 <1 2023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036017.1:SGNH/GDSL hydrolase family protein 2413 2033 gene locus_tag LOCUS_36160 2413 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 <4784 2435 gene locus_tag LOCUS_36170 <4784 2435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140284.1:TonB-dependent receptor >Feature sequence065 1918 530 gene locus_tag LOCUS_36180 1918 530 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796345.1 protein_id gnl|my_center|LOCUS_36180 <4740 1923 gene locus_tag LOCUS_36190 <4740 1923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202099.1:TonB-dependent receptor >Feature sequence066 370 1974 gene locus_tag LOCUS_36200 370 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 2232 4232 gene locus_tag LOCUS_36210 2232 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 >Feature sequence067 2793 292 gene locus_tag LOCUS_36220 2793 292 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767247.1 protein_id gnl|my_center|LOCUS_36220 3232 2795 gene locus_tag LOCUS_36230 3232 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 3239 3627 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence068 <1 1000 gene locus_tag LOCUS_36240 <1 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963430.1:tyrosine-protein kinase domain-containing protein 1004 1867 gene locus_tag LOCUS_36250 1004 1867 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963402.1 protein_id gnl|my_center|LOCUS_36250 2273 3550 gene locus_tag LOCUS_36260 2273 3550 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963401.1 protein_id gnl|my_center|LOCUS_36260 3540 4283 gene locus_tag LOCUS_36270 3540 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 >Feature sequence069 84 2456 gene locus_tag LOCUS_36280 84 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 >Feature sequence070 436 978 gene locus_tag LOCUS_36290 gene rplF 436 978 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963455.1 protein_id gnl|my_center|LOCUS_36290 990 1343 gene locus_tag LOCUS_36300 gene rplR 990 1343 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963454.1 protein_id gnl|my_center|LOCUS_36300 1350 1874 gene locus_tag LOCUS_36310 gene rpsE 1350 1874 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963453.1 protein_id gnl|my_center|LOCUS_36310 1885 2064 gene locus_tag LOCUS_36320 gene rpmD 1885 2064 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963452.1 protein_id gnl|my_center|LOCUS_36320 2076 2528 gene locus_tag LOCUS_36330 gene rplO 2076 2528 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963451.1 protein_id gnl|my_center|LOCUS_36330 2539 3876 gene locus_tag LOCUS_36340 gene secY 2539 3876 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963450.1 protein_id gnl|my_center|LOCUS_36340 3876 4091 gene locus_tag LOCUS_36350 gene infA 3876 4091 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963449.1 protein_id gnl|my_center|LOCUS_36350 >Feature sequence071 1007 597 gene locus_tag LOCUS_36360 gene rplV 1007 597 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963465.1 protein_id gnl|my_center|LOCUS_36360 1294 1016 gene locus_tag LOCUS_36370 gene rpsS 1294 1016 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007136562.1 protein_id gnl|my_center|LOCUS_36370 2125 1301 gene locus_tag LOCUS_36380 gene rplB 2125 1301 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963466.1 protein_id gnl|my_center|LOCUS_36380 2425 2135 gene locus_tag LOCUS_36390 gene rplW 2425 2135 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963467.1 protein_id gnl|my_center|LOCUS_36390 3059 2430 gene locus_tag LOCUS_36400 gene rplD 3059 2430 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963468.1 protein_id gnl|my_center|LOCUS_36400 3670 3059 gene locus_tag LOCUS_36410 gene rplC 3670 3059 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963469.1 protein_id gnl|my_center|LOCUS_36410 4131 3826 gene locus_tag LOCUS_36420 gene rpsJ 4131 3826 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963470.1 protein_id gnl|my_center|LOCUS_36420 >Feature sequence072 3763 1352 gene locus_tag LOCUS_36430 3763 1352 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582505.1 protein_id gnl|my_center|LOCUS_36430 >Feature sequence073 2452 2150 gene locus_tag LOCUS_36440 2452 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 <3855 2505 gene locus_tag LOCUS_36450 <3855 2505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405167.1:alkaline phosphatase >Feature sequence074 1278 406 gene locus_tag LOCUS_36460 1278 406 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207883.1 protein_id gnl|my_center|LOCUS_36460 1398 3209 gene locus_tag LOCUS_36470 1398 3209 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080425.1 protein_id gnl|my_center|LOCUS_36470 >Feature sequence075 218 565 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1543 755 gene locus_tag LOCUS_36480 1543 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 1923 2230 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3188 3439 gene locus_tag LOCUS_36490 3188 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 >Feature sequence076 615 148 gene locus_tag LOCUS_36500 615 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 827 2146 gene locus_tag LOCUS_36510 827 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 >Feature sequence077 337 2223 gene locus_tag LOCUS_36520 337 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 <3551 2300 gene locus_tag LOCUS_36530 <3551 2300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_117506598.1:alkaline phosphatase >Feature sequence078 1147 770 gene locus_tag LOCUS_36540 1147 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 1507 1160 gene locus_tag LOCUS_36550 1507 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 2118 1612 gene locus_tag LOCUS_36560 2118 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 2295 3521 gene locus_tag LOCUS_36570 2295 3521 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962902.1 protein_id gnl|my_center|LOCUS_36570 >Feature sequence079 97 486 gene locus_tag LOCUS_36580 97 486 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963968.1 protein_id gnl|my_center|LOCUS_36580 1405 476 gene locus_tag LOCUS_36590 1405 476 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963967.1 protein_id gnl|my_center|LOCUS_36590 2243 1392 gene locus_tag LOCUS_36600 2243 1392 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963966.1 protein_id gnl|my_center|LOCUS_36600 2907 2296 gene locus_tag LOCUS_36610 2907 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 <3512 2913 gene locus_tag LOCUS_36620 <3512 2913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962683.1:ATP-binding cassette domain-containing protein >Feature sequence080 985 1362 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1441 2625 gene locus_tag LOCUS_36630 gene trpB 1441 2625 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962672.1 protein_id gnl|my_center|LOCUS_36630 >Feature sequence081 3069 853 gene locus_tag LOCUS_36640 3069 853 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109056.1 protein_id gnl|my_center|LOCUS_36640 >Feature sequence082 84 848 gene locus_tag LOCUS_36650 84 848 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_36650 914 1747 gene locus_tag LOCUS_36660 914 1747 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_36660 2769 3117 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence083 1125 157 gene locus_tag LOCUS_36670 gene arsM 1125 157 CDS product arsenosugar biosynthesis arsenite methyltransferase ArsM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143344.1 protein_id gnl|my_center|LOCUS_36670 2067 1186 gene locus_tag LOCUS_36680 2067 1186 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_36680 <3209 1995 gene locus_tag LOCUS_36690 <3209 1995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015943755.1:sodium:solute symporter >Feature sequence084 450 929 gene locus_tag LOCUS_36700 gene purE 450 929 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963493.1 protein_id gnl|my_center|LOCUS_36700 >Feature sequence085 102 1067 gene locus_tag LOCUS_36710 102 1067 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919320.1 protein_id gnl|my_center|LOCUS_36710 1197 1072 gene locus_tag LOCUS_36720 1197 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 1292 1780 gene locus_tag LOCUS_36730 1292 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 2250 1777 gene locus_tag LOCUS_36740 gene rlmH 2250 1777 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963965.1 protein_id gnl|my_center|LOCUS_36740 >Feature sequence086 897 574 gene locus_tag LOCUS_36750 897 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 1356 910 gene locus_tag LOCUS_36760 1356 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 2896 1367 gene locus_tag LOCUS_36770 2896 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 >Feature sequence087 1011 109 gene locus_tag LOCUS_36780 1011 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 1419 1036 gene locus_tag LOCUS_36790 1419 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 1877 2758 gene locus_tag LOCUS_36800 1877 2758 CDS product RteC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963653.1 protein_id gnl|my_center|LOCUS_36800 >Feature sequence088 1774 2065 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence089 119 1999 gene locus_tag LOCUS_36810 119 1999 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012792659.1 protein_id gnl|my_center|LOCUS_36810 2186 3052 gene locus_tag LOCUS_36820 2186 3052 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_36820 >Feature sequence090 535 2412 gene locus_tag LOCUS_36830 535 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 >Feature sequence091 1054 2250 gene locus_tag LOCUS_36840 1054 2250 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963970.1 protein_id gnl|my_center|LOCUS_36840 >Feature sequence092 50 1105 gene locus_tag LOCUS_36850 50 1105 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_36850 2755 1109 gene locus_tag LOCUS_36860 2755 1109 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759455.1 protein_id gnl|my_center|LOCUS_36860 >Feature sequence093 <2782 847 gene locus_tag LOCUS_36870 <2782 847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963824.1:endopeptidase La >Feature sequence094 1854 547 gene locus_tag LOCUS_36880 gene ilvA 1854 547 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962614.1 protein_id gnl|my_center|LOCUS_36880 <2725 1891 gene locus_tag LOCUS_36890 <2725 1891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005455226.1:ketol-acid reductoisomerase >Feature sequence095 2175 625 gene locus_tag LOCUS_36900 2175 625 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_36900 <2714 2189 gene locus_tag LOCUS_36910 <2714 2189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108629.1:TonB-dependent receptor >Feature sequence096 1002 148 gene locus_tag LOCUS_36920 1002 148 CDS product Lpg0189 family type II secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946607.1 protein_id gnl|my_center|LOCUS_36920 2305 1547 gene locus_tag LOCUS_36930 2305 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36930 2634 2371 gene locus_tag LOCUS_36940 2634 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36940 >Feature sequence097 2142 922 gene locus_tag LOCUS_36950 gene hflX 2142 922 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964502.1 protein_id gnl|my_center|LOCUS_36950 >Feature sequence098 168 590 gene locus_tag LOCUS_36960 gene rplP 168 590 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963463.1 protein_id gnl|my_center|LOCUS_36960 602 793 gene locus_tag LOCUS_36970 gene rpmC 602 793 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963462.1 protein_id gnl|my_center|LOCUS_36970 793 1062 gene locus_tag LOCUS_36980 gene rpsQ 793 1062 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963461.1 protein_id gnl|my_center|LOCUS_36980 1065 1433 gene locus_tag LOCUS_36990 gene rplN 1065 1433 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963460.1 protein_id gnl|my_center|LOCUS_36990 1445 1756 gene locus_tag LOCUS_37000 gene rplX 1445 1756 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963459.1 protein_id gnl|my_center|LOCUS_37000 1759 2310 gene locus_tag LOCUS_37010 gene rplE 1759 2310 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963458.1 protein_id gnl|my_center|LOCUS_37010 2313 2582 gene locus_tag LOCUS_37020 gene rpsN 2313 2582 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_37020 >Feature sequence099 <1 1388 gene locus_tag LOCUS_37030 <1 1388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767657.1:DUF1080 domain-containing protein >Feature sequence100 594 211 gene locus_tag LOCUS_37040 594 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 1167 628 gene locus_tag LOCUS_37050 gene rsmD 1167 628 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963133.1 protein_id gnl|my_center|LOCUS_37050 1968 1171 gene locus_tag LOCUS_37060 1968 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 >Feature sequence101 268 1140 gene locus_tag LOCUS_37070 268 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 1469 1927 gene locus_tag LOCUS_37080 1469 1927 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965852.1 protein_id gnl|my_center|LOCUS_37080 <2620 1924 gene locus_tag LOCUS_37090 <2620 1924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005091036.1:transglutaminase family protein >Feature sequence102 >Feature sequence103 <1 750 gene locus_tag LOCUS_37100 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962366.1:adenosylhomocysteinase 1676 798 gene locus_tag LOCUS_37110 1676 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 1760 2062 gene locus_tag LOCUS_37120 1760 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 2454 2191 gene locus_tag LOCUS_37130 gene rpmA 2454 2191 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964306.1 protein_id gnl|my_center|LOCUS_37130 >Feature sequence104 800 2440 gene locus_tag LOCUS_37140 800 2440 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093328686.1 protein_id gnl|my_center|LOCUS_37140