>Feature sequence001 1472 1822 gene locus_tag LOCUS_00010 1472 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2170 2433 gene locus_tag LOCUS_00020 2170 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2673 2888 gene locus_tag LOCUS_00030 2673 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2885 3292 gene locus_tag LOCUS_00040 2885 3292 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669943.1 protein_id gnl|my_center|LOCUS_00040 3560 5392 gene locus_tag LOCUS_00050 gene aspS 3560 5392 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679265.1 protein_id gnl|my_center|LOCUS_00050 7330 5615 gene locus_tag LOCUS_00060 7330 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 12138 8686 gene locus_tag LOCUS_00070 12138 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 12531 12205 gene locus_tag LOCUS_00080 12531 12205 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613391.1 protein_id gnl|my_center|LOCUS_00080 12793 12515 gene locus_tag LOCUS_00090 12793 12515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 14342 13146 gene locus_tag LOCUS_00100 14342 13146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14619 14458 gene locus_tag LOCUS_00110 14619 14458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 14830 16239 gene locus_tag LOCUS_00120 14830 16239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16255 17310 gene locus_tag LOCUS_00130 16255 17310 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680174.1 protein_id gnl|my_center|LOCUS_00130 17307 18089 gene locus_tag LOCUS_00140 17307 18089 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681678.1 protein_id gnl|my_center|LOCUS_00140 18126 19319 gene locus_tag LOCUS_00150 18126 19319 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680173.1 protein_id gnl|my_center|LOCUS_00150 21095 19386 gene locus_tag LOCUS_00160 21095 19386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680819.1 protein_id gnl|my_center|LOCUS_00160 22654 21176 gene locus_tag LOCUS_00170 gene ilvC 22654 21176 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455226.1 protein_id gnl|my_center|LOCUS_00170 23316 24548 gene locus_tag LOCUS_00180 gene metK 23316 24548 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680429.1 protein_id gnl|my_center|LOCUS_00180 24643 25440 gene locus_tag LOCUS_00190 24643 25440 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936128.1 protein_id gnl|my_center|LOCUS_00190 25523 26152 gene locus_tag LOCUS_00200 gene nth 25523 26152 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965134.1 protein_id gnl|my_center|LOCUS_00200 26263 27153 gene locus_tag LOCUS_00210 26263 27153 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680208.1 protein_id gnl|my_center|LOCUS_00210 27160 28254 gene locus_tag LOCUS_00220 27160 28254 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931418.1 protein_id gnl|my_center|LOCUS_00220 28329 28934 gene locus_tag LOCUS_00230 28329 28934 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986274.1 protein_id gnl|my_center|LOCUS_00230 28944 29633 gene locus_tag LOCUS_00240 gene pyrE 28944 29633 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_00240 29630 30523 gene locus_tag LOCUS_00250 29630 30523 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480277.1 protein_id gnl|my_center|LOCUS_00250 29766 29794 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30516 31526 gene locus_tag LOCUS_00260 30516 31526 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903477.1 protein_id gnl|my_center|LOCUS_00260 31519 32298 gene locus_tag LOCUS_00270 31519 32298 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877937.1 protein_id gnl|my_center|LOCUS_00270 33644 32286 gene locus_tag LOCUS_00280 33644 32286 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_00280 34653 33703 gene locus_tag LOCUS_00290 34653 33703 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519085.1 protein_id gnl|my_center|LOCUS_00290 35251 34640 gene locus_tag LOCUS_00300 35251 34640 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965980.1 protein_id gnl|my_center|LOCUS_00300 35461 38154 gene locus_tag LOCUS_00310 35461 38154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 38157 39392 gene locus_tag LOCUS_00320 38157 39392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 39501 40361 gene locus_tag LOCUS_00330 39501 40361 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676763.1 protein_id gnl|my_center|LOCUS_00330 40590 42074 gene locus_tag LOCUS_00340 gene gltA 40590 42074 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681438.1 protein_id gnl|my_center|LOCUS_00340 42315 43187 gene locus_tag LOCUS_00350 42315 43187 CDS product GerMN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675533.1 protein_id gnl|my_center|LOCUS_00350 44188 43184 gene locus_tag LOCUS_00360 44188 43184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 44361 44567 gene locus_tag LOCUS_00370 44361 44567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 45815 44730 gene locus_tag LOCUS_00380 45815 44730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 47628 45817 gene locus_tag LOCUS_00390 47628 45817 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957184.1 protein_id gnl|my_center|LOCUS_00390 48868 47639 gene locus_tag LOCUS_00400 48868 47639 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670666.1 protein_id gnl|my_center|LOCUS_00400 50539 48935 gene locus_tag LOCUS_00410 50539 48935 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680967.1 protein_id gnl|my_center|LOCUS_00410 50986 50582 gene locus_tag LOCUS_00420 50986 50582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 51738 51019 gene locus_tag LOCUS_00430 51738 51019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666686.1 protein_id gnl|my_center|LOCUS_00430 52834 51728 gene locus_tag LOCUS_00440 52834 51728 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956680.1 protein_id gnl|my_center|LOCUS_00440 54343 52850 gene locus_tag LOCUS_00450 54343 52850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 55619 54633 gene locus_tag LOCUS_00460 gene dusB 55619 54633 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680788.1 protein_id gnl|my_center|LOCUS_00460 56397 55621 gene locus_tag LOCUS_00470 56397 55621 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680785.1 protein_id gnl|my_center|LOCUS_00470 56580 57605 gene locus_tag LOCUS_00480 56580 57605 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666722.1 protein_id gnl|my_center|LOCUS_00480 57609 58019 gene locus_tag LOCUS_00490 57609 58019 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680969.1 protein_id gnl|my_center|LOCUS_00490 58019 58579 gene locus_tag LOCUS_00500 58019 58579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 58624 59541 gene locus_tag LOCUS_00510 gene ricT 58624 59541 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680971.1 protein_id gnl|my_center|LOCUS_00510 60182 59592 gene locus_tag LOCUS_00520 60182 59592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 60505 69000 gene locus_tag LOCUS_00530 60505 69000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 68873 68940 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 68963 70579 gene locus_tag LOCUS_00540 68963 70579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 72181 70640 gene locus_tag LOCUS_00550 72181 70640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 73223 72183 gene locus_tag LOCUS_00560 73223 72183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 74300 73251 gene locus_tag LOCUS_00570 74300 73251 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680715.1 protein_id gnl|my_center|LOCUS_00570 74708 75406 gene locus_tag LOCUS_00580 74708 75406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 76115 75546 gene locus_tag LOCUS_00590 gene efp 76115 75546 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897833.1 protein_id gnl|my_center|LOCUS_00590 >Feature sequence002 2507 1227 gene locus_tag LOCUS_00600 2507 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 3928 2696 gene locus_tag LOCUS_00610 3928 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 7181 3930 gene locus_tag LOCUS_00620 7181 3930 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392027.1 protein_id gnl|my_center|LOCUS_00620 7888 7178 gene locus_tag LOCUS_00630 7888 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 9234 7885 gene locus_tag LOCUS_00640 9234 7885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 10546 9311 gene locus_tag LOCUS_00650 10546 9311 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462283.1 protein_id gnl|my_center|LOCUS_00650 10755 11951 gene locus_tag LOCUS_00660 10755 11951 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_00660 12336 12064 gene locus_tag LOCUS_00670 12336 12064 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681514.1 protein_id gnl|my_center|LOCUS_00670 12443 13279 gene locus_tag LOCUS_00680 12443 13279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 13458 14003 gene locus_tag LOCUS_00690 13458 14003 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003041577.1 protein_id gnl|my_center|LOCUS_00690 15267 14020 gene locus_tag LOCUS_00700 15267 14020 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202468.1 protein_id gnl|my_center|LOCUS_00700 14427 14472 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15401 15748 gene locus_tag LOCUS_00710 15401 15748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 17101 15800 gene locus_tag LOCUS_00720 17101 15800 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_00720 17413 17973 gene locus_tag LOCUS_00730 17413 17973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 18122 19276 gene locus_tag LOCUS_00740 18122 19276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 19641 20291 gene locus_tag LOCUS_00750 19641 20291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 20288 21106 gene locus_tag LOCUS_00760 20288 21106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 21110 21733 gene locus_tag LOCUS_00770 21110 21733 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963498.1 protein_id gnl|my_center|LOCUS_00770 23166 21814 gene locus_tag LOCUS_00780 23166 21814 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389377.1 protein_id gnl|my_center|LOCUS_00780 23267 23312 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24705 23383 gene locus_tag LOCUS_00790 24705 23383 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_00790 25033 26148 gene locus_tag LOCUS_00800 25033 26148 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_00800 26538 26212 gene locus_tag LOCUS_00810 26538 26212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 26843 29890 gene locus_tag LOCUS_00820 26843 29890 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808733.1 protein_id gnl|my_center|LOCUS_00820 30375 29920 gene locus_tag LOCUS_00830 30375 29920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 31901 30486 gene locus_tag LOCUS_00840 31901 30486 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_00840 32372 32743 gene locus_tag LOCUS_00850 32372 32743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 33193 32900 gene locus_tag LOCUS_00860 33193 32900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 33382 33984 gene locus_tag LOCUS_00870 33382 33984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 34016 34954 gene locus_tag LOCUS_00880 34016 34954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 35537 34980 gene locus_tag LOCUS_00890 35537 34980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 36810 35539 gene locus_tag LOCUS_00900 36810 35539 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 protein_id gnl|my_center|LOCUS_00900 37536 36979 gene locus_tag LOCUS_00910 37536 36979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 38257 37598 gene locus_tag LOCUS_00920 38257 37598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 39054 38374 gene locus_tag LOCUS_00930 39054 38374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 39449 39072 gene locus_tag LOCUS_00940 39449 39072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 41445 39787 gene locus_tag LOCUS_00950 41445 39787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 42450 41746 gene locus_tag LOCUS_00960 42450 41746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 43508 42660 gene locus_tag LOCUS_00970 43508 42660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 44403 43522 gene locus_tag LOCUS_00980 44403 43522 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087598.1 protein_id gnl|my_center|LOCUS_00980 44919 44404 gene locus_tag LOCUS_00990 44919 44404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 46112 44916 gene locus_tag LOCUS_01000 46112 44916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 47263 46091 gene locus_tag LOCUS_01010 47263 46091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 49233 47266 gene locus_tag LOCUS_01020 49233 47266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 50582 49293 gene locus_tag LOCUS_01030 50582 49293 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_01030 >Feature sequence003 1346 201 gene locus_tag LOCUS_01040 1346 201 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678981.1 protein_id gnl|my_center|LOCUS_01040 1469 2971 gene locus_tag LOCUS_01050 1469 2971 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003289.1 protein_id gnl|my_center|LOCUS_01050 2984 3820 gene locus_tag LOCUS_01060 2984 3820 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679573.1 protein_id gnl|my_center|LOCUS_01060 3802 4542 gene locus_tag LOCUS_01070 3802 4542 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675248.1 protein_id gnl|my_center|LOCUS_01070 4694 4823 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4849 5220 gene locus_tag LOCUS_01080 4849 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 5146 5174 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5195 5548 gene locus_tag LOCUS_01090 5195 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 5737 7236 gene locus_tag LOCUS_01100 5737 7236 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674379.1 protein_id gnl|my_center|LOCUS_01100 8068 7244 gene locus_tag LOCUS_01110 8068 7244 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673320.1 protein_id gnl|my_center|LOCUS_01110 9219 8071 gene locus_tag LOCUS_01120 9219 8071 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939815.1 protein_id gnl|my_center|LOCUS_01120 9692 9402 gene locus_tag LOCUS_01130 9692 9402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 10448 9714 gene locus_tag LOCUS_01140 gene rsmI 10448 9714 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681097.1 protein_id gnl|my_center|LOCUS_01140 10559 11902 gene locus_tag LOCUS_01150 gene purD 10559 11902 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964705.1 protein_id gnl|my_center|LOCUS_01150 14111 12015 gene locus_tag LOCUS_01160 14111 12015 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_01160 16187 14202 gene locus_tag LOCUS_01170 16187 14202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 17281 16214 gene locus_tag LOCUS_01180 17281 16214 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680516.1 protein_id gnl|my_center|LOCUS_01180 17512 18336 gene locus_tag LOCUS_01190 17512 18336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01190 18340 18963 gene locus_tag LOCUS_01200 18340 18963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01200 19672 18965 gene locus_tag LOCUS_01210 19672 18965 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722821.1 protein_id gnl|my_center|LOCUS_01210 20329 19709 gene locus_tag LOCUS_01220 gene hisB 20329 19709 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116767.1 protein_id gnl|my_center|LOCUS_01220 21227 20355 gene locus_tag LOCUS_01230 gene hisG 21227 20355 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545705.1 protein_id gnl|my_center|LOCUS_01230 21453 21938 gene locus_tag LOCUS_01240 21453 21938 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_01240 21970 23142 gene locus_tag LOCUS_01250 21970 23142 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 protein_id gnl|my_center|LOCUS_01250 23144 24502 gene locus_tag LOCUS_01260 23144 24502 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667136.1 protein_id gnl|my_center|LOCUS_01260 25269 24574 gene locus_tag LOCUS_01270 gene rsmG 25269 24574 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957250.1 protein_id gnl|my_center|LOCUS_01270 26224 25271 gene locus_tag LOCUS_01280 26224 25271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 27035 26211 gene locus_tag LOCUS_01290 27035 26211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 27783 27166 gene locus_tag LOCUS_01300 27783 27166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 28689 27928 gene locus_tag LOCUS_01310 28689 27928 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680775.1 protein_id gnl|my_center|LOCUS_01310 28766 30034 gene locus_tag LOCUS_01320 gene pepT 28766 30034 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723986.1 protein_id gnl|my_center|LOCUS_01320 30063 31346 gene locus_tag LOCUS_01330 gene murA 30063 31346 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669886.1 protein_id gnl|my_center|LOCUS_01330 33322 31448 gene locus_tag LOCUS_01340 33322 31448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 34308 33325 gene locus_tag LOCUS_01350 34308 33325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 35212 34361 gene locus_tag LOCUS_01360 35212 34361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 36376 35231 gene locus_tag LOCUS_01370 36376 35231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678869.1 protein_id gnl|my_center|LOCUS_01370 37052 36576 gene locus_tag LOCUS_01380 37052 36576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 37195 38400 gene locus_tag LOCUS_01390 37195 38400 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393776.1 protein_id gnl|my_center|LOCUS_01390 38431 39777 gene locus_tag LOCUS_01400 38431 39777 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673523.1 protein_id gnl|my_center|LOCUS_01400 39664 39732 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43327 39761 gene locus_tag LOCUS_01410 43327 39761 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957290.1 protein_id gnl|my_center|LOCUS_01410 44247 43336 gene locus_tag LOCUS_01420 44247 43336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 44278 44301 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence004 1451 54 gene locus_tag LOCUS_01430 1451 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 2547 1438 gene locus_tag LOCUS_01440 2547 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 5845 2573 gene locus_tag LOCUS_01450 5845 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 8607 5857 gene locus_tag LOCUS_01460 8607 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 5891 5925 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8947 9681 gene locus_tag LOCUS_01470 8947 9681 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_01470 10702 9728 gene locus_tag LOCUS_01480 10702 9728 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681789.1 protein_id gnl|my_center|LOCUS_01480 11450 10695 gene locus_tag LOCUS_01490 11450 10695 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681790.1 protein_id gnl|my_center|LOCUS_01490 11500 12672 gene locus_tag LOCUS_01500 11500 12672 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681116.1 protein_id gnl|my_center|LOCUS_01500 13517 12765 gene locus_tag LOCUS_01510 13517 12765 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793718.1 protein_id gnl|my_center|LOCUS_01510 15005 13530 gene locus_tag LOCUS_01520 15005 13530 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_01520 16264 15002 gene locus_tag LOCUS_01530 16264 15002 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460596.1 protein_id gnl|my_center|LOCUS_01530 16717 16526 gene locus_tag LOCUS_01540 16717 16526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 16839 17894 gene locus_tag LOCUS_01550 16839 17894 CDS product Fic/DOC family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124794669.1 protein_id gnl|my_center|LOCUS_01550 18381 17878 gene locus_tag LOCUS_01560 18381 17878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 19160 18378 gene locus_tag LOCUS_01570 19160 18378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 20074 19313 gene locus_tag LOCUS_01580 gene fabG 20074 19313 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460603.1 protein_id gnl|my_center|LOCUS_01580 20628 20116 gene locus_tag LOCUS_01590 20628 20116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 21063 20641 gene locus_tag LOCUS_01600 21063 20641 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765450.1 protein_id gnl|my_center|LOCUS_01600 21442 21074 gene locus_tag LOCUS_01610 21442 21074 CDS product thioester dehydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074026.1 protein_id gnl|my_center|LOCUS_01610 21817 21569 gene locus_tag LOCUS_01620 21817 21569 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173115.1 protein_id gnl|my_center|LOCUS_01620 22791 21934 gene locus_tag LOCUS_01630 22791 21934 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703715.1 protein_id gnl|my_center|LOCUS_01630 22911 23828 gene locus_tag LOCUS_01640 22911 23828 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681579.1 protein_id gnl|my_center|LOCUS_01640 24215 26902 gene locus_tag LOCUS_01650 gene ppdK 24215 26902 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082976.1 protein_id gnl|my_center|LOCUS_01650 27294 27028 gene locus_tag LOCUS_01660 27294 27028 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517660.1 protein_id gnl|my_center|LOCUS_01660 27523 27296 gene locus_tag LOCUS_01670 27523 27296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 28164 29423 gene locus_tag LOCUS_01680 28164 29423 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679737.1 protein_id gnl|my_center|LOCUS_01680 29482 30267 gene locus_tag LOCUS_01690 29482 30267 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957298.1 protein_id gnl|my_center|LOCUS_01690 31426 30371 gene locus_tag LOCUS_01700 31426 30371 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969779.1 protein_id gnl|my_center|LOCUS_01700 32982 31420 gene locus_tag LOCUS_01710 32982 31420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 34070 33069 gene locus_tag LOCUS_01720 34070 33069 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930836.1 protein_id gnl|my_center|LOCUS_01720 34376 34449 gene locus_tag LOCUS_t00010 34376 34449 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 34509 35534 gene locus_tag LOCUS_01730 34509 35534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 35543 36268 gene locus_tag LOCUS_01740 35543 36268 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_01740 >Feature sequence005 53 1597 gene locus_tag LOCUS_01750 53 1597 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_01750 1794 3530 gene locus_tag LOCUS_01760 gene ettA 1794 3530 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_01760 3599 4249 gene locus_tag LOCUS_01770 3599 4249 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_01770 4301 5689 gene locus_tag LOCUS_01780 4301 5689 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986917.1 protein_id gnl|my_center|LOCUS_01780 5901 5686 gene locus_tag LOCUS_01790 5901 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 6385 5891 gene locus_tag LOCUS_01800 6385 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 7643 6558 gene locus_tag LOCUS_01810 7643 6558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 7802 9946 gene locus_tag LOCUS_01820 7802 9946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 10092 10424 gene locus_tag LOCUS_01830 10092 10424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 10477 11037 gene locus_tag LOCUS_01840 10477 11037 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941709.1 protein_id gnl|my_center|LOCUS_01840 11296 11316 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11359 12138 gene locus_tag LOCUS_01850 gene rlmB 11359 12138 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679077.1 protein_id gnl|my_center|LOCUS_01850 12255 12313 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12607 13803 gene locus_tag LOCUS_01860 12607 13803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 13803 14777 gene locus_tag LOCUS_01870 13803 14777 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947915.1 protein_id gnl|my_center|LOCUS_01870 17050 14867 gene locus_tag LOCUS_01880 17050 14867 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989370.1 protein_id gnl|my_center|LOCUS_01880 17996 17286 gene locus_tag LOCUS_01890 17996 17286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 19842 17998 gene locus_tag LOCUS_01900 19842 17998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 20229 19912 gene locus_tag LOCUS_01910 20229 19912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 20848 20348 gene locus_tag LOCUS_01920 20848 20348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 21686 20862 gene locus_tag LOCUS_01930 21686 20862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 23322 22066 gene locus_tag LOCUS_01940 23322 22066 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774553.1 protein_id gnl|my_center|LOCUS_01940 24496 23582 gene locus_tag LOCUS_01950 24496 23582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 24806 26077 gene locus_tag LOCUS_01960 24806 26077 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_01960 27404 26214 gene locus_tag LOCUS_01970 27404 26214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 28165 27509 gene locus_tag LOCUS_01980 28165 27509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 29335 28277 gene locus_tag LOCUS_01990 29335 28277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 29632 29399 gene locus_tag LOCUS_02000 29632 29399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 29748 30098 gene locus_tag LOCUS_02010 29748 30098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 31099 30116 gene locus_tag LOCUS_02020 31099 30116 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989333.1 protein_id gnl|my_center|LOCUS_02020 31473 31159 gene locus_tag LOCUS_02030 31473 31159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 31805 31605 gene locus_tag LOCUS_02040 31805 31605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 32137 31811 gene locus_tag LOCUS_02050 32137 31811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 >Feature sequence006 <1 806 gene locus_tag LOCUS_02060 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680601.1:helix-turn-helix domain-containing protein 799 2271 gene locus_tag LOCUS_02070 gene rimO 799 2271 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680609.1 protein_id gnl|my_center|LOCUS_02070 2277 4787 gene locus_tag LOCUS_02080 2277 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 6687 4774 gene locus_tag LOCUS_02090 gene malZ 6687 4774 CDS product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257409.1 protein_id gnl|my_center|LOCUS_02090 8201 6756 gene locus_tag LOCUS_02100 8201 6756 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097917.1 protein_id gnl|my_center|LOCUS_02100 9563 8211 gene locus_tag LOCUS_02110 9563 8211 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011319592.1 protein_id gnl|my_center|LOCUS_02110 10747 9743 gene locus_tag LOCUS_02120 gene ldhA 10747 9743 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762236.1 protein_id gnl|my_center|LOCUS_02120 10851 11183 gene locus_tag LOCUS_02130 gene gatC 10851 11183 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665812.1 protein_id gnl|my_center|LOCUS_02130 11211 12737 gene locus_tag LOCUS_02140 gene gatA 11211 12737 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956776.1 protein_id gnl|my_center|LOCUS_02140 12748 14283 gene locus_tag LOCUS_02150 gene gatB 12748 14283 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681743.1 protein_id gnl|my_center|LOCUS_02150 14280 15086 gene locus_tag LOCUS_02160 14280 15086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 15106 15399 gene locus_tag LOCUS_02170 15106 15399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667688.1 protein_id gnl|my_center|LOCUS_02170 15403 15861 gene locus_tag LOCUS_02180 15403 15861 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964318.1 protein_id gnl|my_center|LOCUS_02180 15919 15954 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16147 16563 gene locus_tag LOCUS_02190 16147 16563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 16568 17170 gene locus_tag LOCUS_02200 16568 17170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 18884 17346 gene locus_tag LOCUS_02210 gene rny 18884 17346 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681149.1 protein_id gnl|my_center|LOCUS_02210 19763 19032 gene locus_tag LOCUS_02220 gene lptB 19763 19032 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681841.1 protein_id gnl|my_center|LOCUS_02220 20572 19763 gene locus_tag LOCUS_02230 20572 19763 CDS product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669890.1 protein_id gnl|my_center|LOCUS_02230 21155 20556 gene locus_tag LOCUS_02240 21155 20556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 23286 21304 gene locus_tag LOCUS_02250 gene uvrC 23286 21304 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933467.1 protein_id gnl|my_center|LOCUS_02250 23393 24859 gene locus_tag LOCUS_02260 23393 24859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920589.1 protein_id gnl|my_center|LOCUS_02260 24882 27671 gene locus_tag LOCUS_02270 24882 27671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 27802 28440 gene locus_tag LOCUS_02280 27802 28440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 28468 29208 gene locus_tag LOCUS_02290 28468 29208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 30432 29284 gene locus_tag LOCUS_02300 30432 29284 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129622.1 protein_id gnl|my_center|LOCUS_02300 32034 30451 gene locus_tag LOCUS_02310 gene murJ 32034 30451 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681318.1 protein_id gnl|my_center|LOCUS_02310 >Feature sequence007 1441 92 gene locus_tag LOCUS_02320 1441 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 948 960 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1630 4137 gene locus_tag LOCUS_02330 1630 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 5516 4134 gene locus_tag LOCUS_02340 5516 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 5720 5574 gene locus_tag LOCUS_02350 5720 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 6315 5809 gene locus_tag LOCUS_02360 6315 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02360 5822 5831 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7804 6293 gene locus_tag LOCUS_02370 7804 6293 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679324.1 protein_id gnl|my_center|LOCUS_02370 8893 7817 gene locus_tag LOCUS_02380 8893 7817 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678383.1 protein_id gnl|my_center|LOCUS_02380 9898 8915 gene locus_tag LOCUS_02390 gene fmt 9898 8915 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679327.1 protein_id gnl|my_center|LOCUS_02390 10476 9901 gene locus_tag LOCUS_02400 gene def 10476 9901 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016949.1 protein_id gnl|my_center|LOCUS_02400 10591 10629 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11644 10703 gene locus_tag LOCUS_02410 11644 10703 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546354.1 protein_id gnl|my_center|LOCUS_02410 12013 11648 gene locus_tag LOCUS_02420 12013 11648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02420 13012 12020 gene locus_tag LOCUS_02430 13012 12020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02430 14714 13413 gene locus_tag LOCUS_02440 14714 13413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 17818 14798 gene locus_tag LOCUS_02450 17818 14798 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956687.1 protein_id gnl|my_center|LOCUS_02450 17999 18613 gene locus_tag LOCUS_02460 17999 18613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 18990 18919 gene locus_tag LOCUS_t00020 18990 18919 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 19592 19068 gene locus_tag LOCUS_02470 19592 19068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 21810 19648 gene locus_tag LOCUS_02480 21810 19648 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101886474.1 protein_id gnl|my_center|LOCUS_02480 22714 22163 gene locus_tag LOCUS_02490 22714 22163 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668265.1 protein_id gnl|my_center|LOCUS_02490 22878 24617 gene locus_tag LOCUS_02500 gene argS 22878 24617 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228472.1 protein_id gnl|my_center|LOCUS_02500 25754 24618 gene locus_tag LOCUS_02510 25754 24618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 26022 25747 gene locus_tag LOCUS_02520 gene hupN 26022 25747 CDS product HU-related DNA-binding protein HupN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399274.1 protein_id gnl|my_center|LOCUS_02520 27370 26036 gene locus_tag LOCUS_02530 27370 26036 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033932046.1 protein_id gnl|my_center|LOCUS_02530 28891 27545 gene locus_tag LOCUS_02540 gene gdhA 28891 27545 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_02540 31419 29125 gene locus_tag LOCUS_02550 31419 29125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 >Feature sequence008 1741 206 gene locus_tag LOCUS_02560 1741 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 2838 1750 gene locus_tag LOCUS_02570 2838 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 3896 2853 gene locus_tag LOCUS_02580 3896 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02580 2860 2902 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5446 3917 gene locus_tag LOCUS_02590 5446 3917 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329914.1 protein_id gnl|my_center|LOCUS_02590 6901 5471 gene locus_tag LOCUS_02600 6901 5471 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671898.1 protein_id gnl|my_center|LOCUS_02600 7071 9422 gene locus_tag LOCUS_02610 7071 9422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 10327 9419 gene locus_tag LOCUS_02620 10327 9419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 11691 10330 gene locus_tag LOCUS_02630 11691 10330 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_02630 12447 11773 gene locus_tag LOCUS_02640 12447 11773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 15717 12454 gene locus_tag LOCUS_02650 15717 12454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 17162 15825 gene locus_tag LOCUS_02660 17162 15825 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582595.1 protein_id gnl|my_center|LOCUS_02660 17257 18681 gene locus_tag LOCUS_02670 17257 18681 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461705.1 protein_id gnl|my_center|LOCUS_02670 19814 18657 gene locus_tag LOCUS_02680 gene earP 19814 18657 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016605.1 protein_id gnl|my_center|LOCUS_02680 20611 19811 gene locus_tag LOCUS_02690 gene folE2 20611 19811 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_02690 21484 20615 gene locus_tag LOCUS_02700 gene folD 21484 20615 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_02700 21625 22221 gene locus_tag LOCUS_02710 21625 22221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 22246 23556 gene locus_tag LOCUS_02720 22246 23556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 23565 23858 gene locus_tag LOCUS_02730 23565 23858 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256312.1 protein_id gnl|my_center|LOCUS_02730 23964 24932 gene locus_tag LOCUS_02740 23964 24932 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_02740 24964 25704 gene locus_tag LOCUS_02750 24964 25704 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_02750 25720 27768 gene locus_tag LOCUS_02760 25720 27768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 27831 28748 gene locus_tag LOCUS_02770 27831 28748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 >Feature sequence009 <1 1300 gene locus_tag LOCUS_02780 <1 1300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105653.1:DEAD/DEAH box helicase family protein 1514 2572 gene locus_tag LOCUS_02790 1514 2572 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140271.1 protein_id gnl|my_center|LOCUS_02790 2569 3081 gene locus_tag LOCUS_02800 2569 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 3123 4094 gene locus_tag LOCUS_02810 3123 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 4106 5422 gene locus_tag LOCUS_02820 4106 5422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 5578 7956 gene locus_tag LOCUS_02830 5578 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02830 7837 7879 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8202 9206 gene locus_tag LOCUS_02840 8202 9206 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109306.1 protein_id gnl|my_center|LOCUS_02840 9241 9702 gene locus_tag LOCUS_02850 9241 9702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02850 9611 10246 gene locus_tag LOCUS_02860 9611 10246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02860 10505 11515 gene locus_tag LOCUS_02870 10505 11515 CDS product adenine-specific methyltransferase EcoRI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196835716.1 protein_id gnl|my_center|LOCUS_02870 11512 12600 gene locus_tag LOCUS_02880 11512 12600 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040498402.1 protein_id gnl|my_center|LOCUS_02880 12602 13474 gene locus_tag LOCUS_02890 12602 13474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 13464 13961 gene locus_tag LOCUS_02900 13464 13961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 13983 14318 gene locus_tag LOCUS_02910 13983 14318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 14348 14881 gene locus_tag LOCUS_02920 14348 14881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359809.1 protein_id gnl|my_center|LOCUS_02920 14389 14409 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14868 15686 gene locus_tag LOCUS_02930 14868 15686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 16043 16537 gene locus_tag LOCUS_02940 16043 16537 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_02940 16622 18673 gene locus_tag LOCUS_02950 16622 18673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 18680 20131 gene locus_tag LOCUS_02960 18680 20131 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174705273.1 protein_id gnl|my_center|LOCUS_02960 20132 20623 gene locus_tag LOCUS_02970 20132 20623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 20726 21367 gene locus_tag LOCUS_02980 20726 21367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 21728 22429 gene locus_tag LOCUS_02990 21728 22429 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760196.1 protein_id gnl|my_center|LOCUS_02990 22475 22798 gene locus_tag LOCUS_03000 22475 22798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 22820 23155 gene locus_tag LOCUS_03010 22820 23155 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944869.1 protein_id gnl|my_center|LOCUS_03010 23240 23806 gene locus_tag LOCUS_03020 23240 23806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 23803 24291 gene locus_tag LOCUS_03030 23803 24291 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853175.1 protein_id gnl|my_center|LOCUS_03030 24617 24342 gene locus_tag LOCUS_03040 24617 24342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 24641 24657 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25085 24816 gene locus_tag LOCUS_03050 25085 24816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 25852 25499 gene locus_tag LOCUS_03060 25852 25499 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956916.1 protein_id gnl|my_center|LOCUS_03060 25960 26577 gene locus_tag LOCUS_03070 25960 26577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 >Feature sequence010 2732 6436 gene locus_tag LOCUS_03080 2732 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 6830 6543 gene locus_tag LOCUS_03090 6830 6543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 7709 6852 gene locus_tag LOCUS_03100 7709 6852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 8113 7748 gene locus_tag LOCUS_03110 8113 7748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 8423 8127 gene locus_tag LOCUS_03120 8423 8127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 8657 8424 gene locus_tag LOCUS_03130 8657 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 8998 8654 gene locus_tag LOCUS_03140 8998 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 9273 8995 gene locus_tag LOCUS_03150 9273 8995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 9971 9276 gene locus_tag LOCUS_03160 9971 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 10431 10240 gene locus_tag LOCUS_03170 10431 10240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 10828 12915 gene locus_tag LOCUS_03180 10828 12915 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948909.1 protein_id gnl|my_center|LOCUS_03180 13180 14217 gene locus_tag LOCUS_03190 13180 14217 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004270929.1 protein_id gnl|my_center|LOCUS_03190 14315 14524 gene locus_tag LOCUS_03200 14315 14524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 14521 14907 gene locus_tag LOCUS_03210 14521 14907 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808288.1 protein_id gnl|my_center|LOCUS_03210 14945 16066 gene locus_tag LOCUS_03220 14945 16066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 16445 17761 gene locus_tag LOCUS_03230 16445 17761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 18633 17758 gene locus_tag LOCUS_03240 18633 17758 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680498.1 protein_id gnl|my_center|LOCUS_03240 18763 19188 gene locus_tag LOCUS_03250 18763 19188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 19455 19300 gene locus_tag LOCUS_03260 19455 19300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 21195 19954 gene locus_tag LOCUS_03270 gene secF 21195 19954 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681892.1 protein_id gnl|my_center|LOCUS_03270 22937 21195 gene locus_tag LOCUS_03280 gene secD 22937 21195 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681894.1 protein_id gnl|my_center|LOCUS_03280 23231 22956 gene locus_tag LOCUS_03290 23231 22956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 23296 23484 gene locus_tag LOCUS_03300 23296 23484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 24641 23637 gene locus_tag LOCUS_03310 24641 23637 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680981.1 protein_id gnl|my_center|LOCUS_03310 24715 25329 gene locus_tag LOCUS_03320 24715 25329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 >Feature sequence011 2066 156 gene locus_tag LOCUS_03330 2066 156 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_03330 3383 2196 gene locus_tag LOCUS_03340 3383 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 3751 4746 gene locus_tag LOCUS_03350 3751 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 5068 5499 gene locus_tag LOCUS_03360 5068 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 6726 5629 gene locus_tag LOCUS_03370 gene asd 6726 5629 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963351.1 protein_id gnl|my_center|LOCUS_03370 7736 6831 gene locus_tag LOCUS_03380 gene dapA 7736 6831 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933288.1 protein_id gnl|my_center|LOCUS_03380 7868 10642 gene locus_tag LOCUS_03390 7868 10642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 10661 11758 gene locus_tag LOCUS_03400 gene aroC 10661 11758 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938193.1 protein_id gnl|my_center|LOCUS_03400 11755 13167 gene locus_tag LOCUS_03410 11755 13167 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682292.1 protein_id gnl|my_center|LOCUS_03410 15417 13159 gene locus_tag LOCUS_03420 15417 13159 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957228.1 protein_id gnl|my_center|LOCUS_03420 16623 15448 gene locus_tag LOCUS_03430 16623 15448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 16678 17175 gene locus_tag LOCUS_03440 gene lepB 16678 17175 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956947.1 protein_id gnl|my_center|LOCUS_03440 17172 19043 gene locus_tag LOCUS_03450 17172 19043 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678847.1 protein_id gnl|my_center|LOCUS_03450 19024 20523 gene locus_tag LOCUS_03460 19024 20523 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678848.1 protein_id gnl|my_center|LOCUS_03460 20725 22059 gene locus_tag LOCUS_03470 20725 22059 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668533.1 protein_id gnl|my_center|LOCUS_03470 22926 22165 gene locus_tag LOCUS_03480 22926 22165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 24504 23023 gene locus_tag LOCUS_03490 24504 23023 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_03490 >Feature sequence012 1719 1342 gene locus_tag LOCUS_03500 1719 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 2231 1773 gene locus_tag LOCUS_03510 gene flgC 2231 1773 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671661.1 protein_id gnl|my_center|LOCUS_03510 2747 2331 gene locus_tag LOCUS_03520 gene flgB 2747 2331 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668460.1 protein_id gnl|my_center|LOCUS_03520 4251 2869 gene locus_tag LOCUS_03530 gene hslU 4251 2869 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677705.1 protein_id gnl|my_center|LOCUS_03530 4800 4261 gene locus_tag LOCUS_03540 gene hslV 4800 4261 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668456.1 protein_id gnl|my_center|LOCUS_03540 5841 4942 gene locus_tag LOCUS_03550 5841 4942 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678705.1 protein_id gnl|my_center|LOCUS_03550 8076 5920 gene locus_tag LOCUS_03560 gene topA 8076 5920 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678704.1 protein_id gnl|my_center|LOCUS_03560 9169 8120 gene locus_tag LOCUS_03570 9169 8120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 9800 9150 gene locus_tag LOCUS_03580 9800 9150 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678696.1 protein_id gnl|my_center|LOCUS_03580 10939 10004 gene locus_tag LOCUS_03590 10939 10004 CDS product site-specific tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044909847.1 protein_id gnl|my_center|LOCUS_03590 12191 10902 gene locus_tag LOCUS_03600 gene ftsZ 12191 10902 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656388.1 protein_id gnl|my_center|LOCUS_03600 13454 12207 gene locus_tag LOCUS_03610 gene ftsA 13454 12207 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678694.1 protein_id gnl|my_center|LOCUS_03610 14398 13550 gene locus_tag LOCUS_03620 14398 13550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 15611 14391 gene locus_tag LOCUS_03630 gene ftsW 15611 14391 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677685.1 protein_id gnl|my_center|LOCUS_03630 17082 15697 gene locus_tag LOCUS_03640 gene murF 17082 15697 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678687.1 protein_id gnl|my_center|LOCUS_03640 17381 17079 gene locus_tag LOCUS_03650 17381 17079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 18382 17381 gene locus_tag LOCUS_03660 gene rsmH 18382 17381 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678681.1 protein_id gnl|my_center|LOCUS_03660 18841 18392 gene locus_tag LOCUS_03670 gene mraZ 18841 18392 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678680.1 protein_id gnl|my_center|LOCUS_03670 18986 19705 gene locus_tag LOCUS_03680 18986 19705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679004.1 protein_id gnl|my_center|LOCUS_03680 20489 19770 gene locus_tag LOCUS_03690 20489 19770 CDS product flagellar filament outer layer protein FlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668795.1 protein_id gnl|my_center|LOCUS_03690 21235 20489 gene locus_tag LOCUS_03700 21235 20489 CDS product flagellar filament outer layer protein FlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668794.1 protein_id gnl|my_center|LOCUS_03700 21555 22421 gene locus_tag LOCUS_03710 gene fba 21555 22421 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_03710 22939 22532 gene locus_tag LOCUS_03720 22939 22532 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964852.1 protein_id gnl|my_center|LOCUS_03720 23017 23142 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24503 23193 gene locus_tag LOCUS_03730 gene hisS 24503 23193 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679075.1 protein_id gnl|my_center|LOCUS_03730 >Feature sequence013 <1 1058 gene locus_tag LOCUS_03740 <1 1058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202294.1:site-specific DNA-methyltransferase 1072 2610 gene locus_tag LOCUS_03750 1072 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 2566 2589 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2634 3371 gene locus_tag LOCUS_03760 2634 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 3415 3485 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5415 3559 gene locus_tag LOCUS_03770 5415 3559 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_03770 5747 7543 gene locus_tag LOCUS_03780 gene pyk 5747 7543 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232648.1 protein_id gnl|my_center|LOCUS_03780 7543 8505 gene locus_tag LOCUS_03790 7543 8505 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_03790 8829 8608 gene locus_tag LOCUS_03800 gene rpmB 8829 8608 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_03800 11557 9029 gene locus_tag LOCUS_03810 11557 9029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 14061 12052 gene locus_tag LOCUS_03820 gene uvrB 14061 12052 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678935.1 protein_id gnl|my_center|LOCUS_03820 15311 14061 gene locus_tag LOCUS_03830 15311 14061 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679693.1 protein_id gnl|my_center|LOCUS_03830 16187 15330 gene locus_tag LOCUS_03840 16187 15330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 16874 16191 gene locus_tag LOCUS_03850 gene radC 16874 16191 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682286.1 protein_id gnl|my_center|LOCUS_03850 16981 17595 gene locus_tag LOCUS_03860 16981 17595 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681594.1 protein_id gnl|my_center|LOCUS_03860 18504 17809 gene locus_tag LOCUS_03870 gene pyrH 18504 17809 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668261.1 protein_id gnl|my_center|LOCUS_03870 20215 18506 gene locus_tag LOCUS_03880 20215 18506 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680944.1 protein_id gnl|my_center|LOCUS_03880 20874 20212 gene locus_tag LOCUS_03890 20874 20212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 21418 20855 gene locus_tag LOCUS_03900 21418 20855 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666766.1 protein_id gnl|my_center|LOCUS_03900 <22698 21456 gene locus_tag LOCUS_03910 <22698 21456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002666765.1:cysteine--tRNA ligase >Feature sequence014 526 560 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 784 1638 gene locus_tag LOCUS_03920 784 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03920 1650 2546 gene locus_tag LOCUS_03930 1650 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03930 2573 3028 gene locus_tag LOCUS_03940 2573 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03940 2997 4484 gene locus_tag LOCUS_03950 2997 4484 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03950 4521 7286 gene locus_tag LOCUS_03960 4521 7286 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678931.1 protein_id gnl|my_center|LOCUS_03960 7335 7940 gene locus_tag LOCUS_03970 7335 7940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669375.1 protein_id gnl|my_center|LOCUS_03970 7947 9884 gene locus_tag LOCUS_03980 7947 9884 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964368.1 protein_id gnl|my_center|LOCUS_03980 9991 10926 gene locus_tag LOCUS_03990 gene rlmJ 9991 10926 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681232.1 protein_id gnl|my_center|LOCUS_03990 11094 12329 gene locus_tag LOCUS_04000 gene tyrS 11094 12329 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032910643.1 protein_id gnl|my_center|LOCUS_04000 12742 12335 gene locus_tag LOCUS_04010 12742 12335 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668053.1 protein_id gnl|my_center|LOCUS_04010 13781 12771 gene locus_tag LOCUS_04020 13781 12771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04020 13803 13864 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15402 13966 gene locus_tag LOCUS_04030 15402 13966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04030 14070 14121 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16615 15605 gene locus_tag LOCUS_04040 16615 15605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 17557 16640 gene locus_tag LOCUS_04050 17557 16640 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679456.1 protein_id gnl|my_center|LOCUS_04050 17795 17559 gene locus_tag LOCUS_04060 17795 17559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 18051 17884 gene locus_tag LOCUS_04070 18051 17884 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670897.1 protein_id gnl|my_center|LOCUS_04070 19479 18316 gene locus_tag LOCUS_04080 19479 18316 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681927.1 protein_id gnl|my_center|LOCUS_04080 20008 19463 gene locus_tag LOCUS_04090 20008 19463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 21553 20336 gene locus_tag LOCUS_04100 21553 20336 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992247.1 protein_id gnl|my_center|LOCUS_04100 21621 21732 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence015 <1 727 gene locus_tag LOCUS_04110 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000368910.1:Fic family protein 3563 933 gene locus_tag LOCUS_04120 3563 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 4292 3606 gene locus_tag LOCUS_04130 4292 3606 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675739.1 protein_id gnl|my_center|LOCUS_04130 5614 4520 gene locus_tag LOCUS_04140 5614 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 6114 5704 gene locus_tag LOCUS_04150 6114 5704 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_04150 6725 6111 gene locus_tag LOCUS_04160 6725 6111 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_04160 8533 6857 gene locus_tag LOCUS_04170 8533 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 11422 8549 gene locus_tag LOCUS_04180 11422 8549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 10838 10867 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12811 11444 gene locus_tag LOCUS_04190 12811 11444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679186.1 protein_id gnl|my_center|LOCUS_04190 17411 12822 gene locus_tag LOCUS_04200 17411 12822 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965697.1 protein_id gnl|my_center|LOCUS_04200 18916 17477 gene locus_tag LOCUS_04210 18916 17477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 20634 18895 gene locus_tag LOCUS_04220 20634 18895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 >Feature sequence016 976 314 gene locus_tag LOCUS_04230 976 314 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384107.1 protein_id gnl|my_center|LOCUS_04230 2374 1067 gene locus_tag LOCUS_04240 2374 1067 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228155.1 protein_id gnl|my_center|LOCUS_04240 5067 2389 gene locus_tag LOCUS_04250 5067 2389 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679812.1 protein_id gnl|my_center|LOCUS_04250 6179 5064 gene locus_tag LOCUS_04260 6179 5064 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328432.1 protein_id gnl|my_center|LOCUS_04260 6711 6157 gene locus_tag LOCUS_04270 6711 6157 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391707.1 protein_id gnl|my_center|LOCUS_04270 8060 6729 gene locus_tag LOCUS_04280 8060 6729 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679814.1 protein_id gnl|my_center|LOCUS_04280 8740 8057 gene locus_tag LOCUS_04290 8740 8057 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668339.1 protein_id gnl|my_center|LOCUS_04290 10040 8733 gene locus_tag LOCUS_04300 10040 8733 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679815.1 protein_id gnl|my_center|LOCUS_04300 11163 10033 gene locus_tag LOCUS_04310 11163 10033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 12049 11168 gene locus_tag LOCUS_04320 gene ftsY 12049 11168 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668333.1 protein_id gnl|my_center|LOCUS_04320 13858 12116 gene locus_tag LOCUS_04330 13858 12116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 14921 13893 gene locus_tag LOCUS_04340 gene prfB 14921 13893 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014540570.1 protein_id gnl|my_center|LOCUS_04340 15076 15116 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16265 15156 gene locus_tag LOCUS_04350 gene rfbB 16265 15156 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679073.1 protein_id gnl|my_center|LOCUS_04350 15924 15959 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16869 16267 gene locus_tag LOCUS_04360 gene rfbC 16869 16267 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_04360 17765 16893 gene locus_tag LOCUS_04370 gene rfbA 17765 16893 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679070.1 protein_id gnl|my_center|LOCUS_04370 18818 17925 gene locus_tag LOCUS_04380 gene rfbD 18818 17925 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964565.1 protein_id gnl|my_center|LOCUS_04380 19007 18933 gene locus_tag LOCUS_t00030 19007 18933 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 19085 19012 gene locus_tag LOCUS_t00040 19085 19012 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence017 1092 79 gene locus_tag LOCUS_04390 1092 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 1847 1101 gene locus_tag LOCUS_04400 1847 1101 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_04400 2121 3827 gene locus_tag LOCUS_04410 2121 3827 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680894.1 protein_id gnl|my_center|LOCUS_04410 3978 5237 gene locus_tag LOCUS_04420 gene fabF 3978 5237 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673329.1 protein_id gnl|my_center|LOCUS_04420 5302 5334 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5340 6560 gene locus_tag LOCUS_04430 5340 6560 CDS product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681770.1 protein_id gnl|my_center|LOCUS_04430 6731 7129 gene locus_tag LOCUS_04440 6731 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04440 7283 9814 gene locus_tag LOCUS_04450 7283 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 9859 10782 gene locus_tag LOCUS_04460 gene pyrB 9859 10782 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_04460 10850 11302 gene locus_tag LOCUS_04470 10850 11302 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_04470 11302 12729 gene locus_tag LOCUS_04480 11302 12729 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880489.1 protein_id gnl|my_center|LOCUS_04480 13605 13120 gene locus_tag LOCUS_04490 13605 13120 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_04490 14277 13624 gene locus_tag LOCUS_04500 14277 13624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 15025 14279 gene locus_tag LOCUS_04510 15025 14279 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679334.1 protein_id gnl|my_center|LOCUS_04510 15605 15048 gene locus_tag LOCUS_04520 15605 15048 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679338.1 protein_id gnl|my_center|LOCUS_04520 15706 17034 gene locus_tag LOCUS_04530 15706 17034 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547031.1 protein_id gnl|my_center|LOCUS_04530 17945 17085 gene locus_tag LOCUS_04540 17945 17085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 18329 18253 gene locus_tag LOCUS_t00050 18329 18253 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 18451 18365 gene locus_tag LOCUS_t00060 18451 18365 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 18485 18507 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18778 19362 gene locus_tag LOCUS_04550 18778 19362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 19380 20006 gene locus_tag LOCUS_04560 19380 20006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021681.1 protein_id gnl|my_center|LOCUS_04560 >Feature sequence018 731 1339 gene locus_tag LOCUS_04570 731 1339 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_04570 1899 1363 gene locus_tag LOCUS_04580 1899 1363 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085816.1 protein_id gnl|my_center|LOCUS_04580 2373 2092 gene locus_tag LOCUS_04590 2373 2092 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681558.1 protein_id gnl|my_center|LOCUS_04590 4584 2509 gene locus_tag LOCUS_04600 4584 2509 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680167.1 protein_id gnl|my_center|LOCUS_04600 6378 4627 gene locus_tag LOCUS_04610 6378 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 6588 8177 gene locus_tag LOCUS_04620 gene cls 6588 8177 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262851.1 protein_id gnl|my_center|LOCUS_04620 9080 8250 gene locus_tag LOCUS_04630 9080 8250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 9197 10108 gene locus_tag LOCUS_04640 gene ilvY 9197 10108 CDS product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704174.1 protein_id gnl|my_center|LOCUS_04640 10153 10911 gene locus_tag LOCUS_04650 10153 10911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681806.1 protein_id gnl|my_center|LOCUS_04650 11046 12077 gene locus_tag LOCUS_04660 11046 12077 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126169.1 protein_id gnl|my_center|LOCUS_04660 12074 12841 gene locus_tag LOCUS_04670 12074 12841 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832763.1 protein_id gnl|my_center|LOCUS_04670 13252 12863 gene locus_tag LOCUS_04680 13252 12863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 13588 13361 gene locus_tag LOCUS_04690 13588 13361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 15390 13627 gene locus_tag LOCUS_04700 15390 13627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682311.1 protein_id gnl|my_center|LOCUS_04700 15470 16858 gene locus_tag LOCUS_04710 15470 16858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 16855 18048 gene locus_tag LOCUS_04720 16855 18048 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680885.1 protein_id gnl|my_center|LOCUS_04720 18109 18152 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19388 18312 gene locus_tag LOCUS_04730 19388 18312 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526112.1 protein_id gnl|my_center|LOCUS_04730 >Feature sequence019 408 429 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1726 1478 gene locus_tag LOCUS_04740 1726 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 2664 1849 gene locus_tag LOCUS_04750 2664 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 3800 3186 gene locus_tag LOCUS_04760 gene pgsA 3800 3186 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667297.1 protein_id gnl|my_center|LOCUS_04760 4729 3902 gene locus_tag LOCUS_04770 4729 3902 CDS product cytidylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956669.1 protein_id gnl|my_center|LOCUS_04770 5603 4908 gene locus_tag LOCUS_04780 5603 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 6601 5600 gene locus_tag LOCUS_04790 6601 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675892.1 protein_id gnl|my_center|LOCUS_04790 6811 7029 gene locus_tag LOCUS_04800 6811 7029 CDS product PC4/YdbC family ssDNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667298.1 protein_id gnl|my_center|LOCUS_04800 8035 7013 gene locus_tag LOCUS_04810 gene holA 8035 7013 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681969.1 protein_id gnl|my_center|LOCUS_04810 8679 8068 gene locus_tag LOCUS_04820 gene lexA 8679 8068 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654116.1 protein_id gnl|my_center|LOCUS_04820 8948 8682 gene locus_tag LOCUS_04830 8948 8682 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668605.1 protein_id gnl|my_center|LOCUS_04830 9967 8978 gene locus_tag LOCUS_04840 gene hprK 9967 8978 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062490.1 protein_id gnl|my_center|LOCUS_04840 10124 10411 gene locus_tag LOCUS_04850 10124 10411 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671537.1 protein_id gnl|my_center|LOCUS_04850 12099 10537 gene locus_tag LOCUS_04860 gene rpoN 12099 10537 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680335.1 protein_id gnl|my_center|LOCUS_04860 12145 13497 gene locus_tag LOCUS_04870 12145 13497 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_04870 15368 13500 gene locus_tag LOCUS_04880 gene recQ 15368 13500 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681287.1 protein_id gnl|my_center|LOCUS_04880 14456 14484 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15446 15528 gene locus_tag LOCUS_t00070 15446 15528 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17280 15688 gene locus_tag LOCUS_04890 17280 15688 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679741.1 protein_id gnl|my_center|LOCUS_04890 18248 17391 gene locus_tag LOCUS_04900 18248 17391 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680625.1 protein_id gnl|my_center|LOCUS_04900 18334 19575 gene locus_tag LOCUS_04910 18334 19575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 19582 19654 gene locus_tag LOCUS_t00080 19582 19654 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence020 733 1029 gene locus_tag LOCUS_04920 733 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 1513 1899 gene locus_tag LOCUS_04930 1513 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 1785 2126 gene locus_tag LOCUS_04940 1785 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 2640 2987 gene locus_tag LOCUS_04950 2640 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 4241 2994 gene locus_tag LOCUS_04960 4241 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 5397 4219 gene locus_tag LOCUS_04970 5397 4219 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948604.1 protein_id gnl|my_center|LOCUS_04970 6355 5405 gene locus_tag LOCUS_04980 6355 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 7741 6374 gene locus_tag LOCUS_04990 7741 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 9980 8013 gene locus_tag LOCUS_05000 9980 8013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 11089 10415 gene locus_tag LOCUS_05010 11089 10415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 11358 12938 gene locus_tag LOCUS_05020 11358 12938 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669793.1 protein_id gnl|my_center|LOCUS_05020 13424 12960 gene locus_tag LOCUS_05030 gene ybaK 13424 12960 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244878.1 protein_id gnl|my_center|LOCUS_05030 13713 14741 gene locus_tag LOCUS_05040 13713 14741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 14888 16309 gene locus_tag LOCUS_05050 14888 16309 CDS product lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679156.1 protein_id gnl|my_center|LOCUS_05050 16340 17758 gene locus_tag LOCUS_05060 16340 17758 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_05060 18395 17844 gene locus_tag LOCUS_05070 18395 17844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 18607 18398 gene locus_tag LOCUS_05080 18607 18398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 19211 18660 gene locus_tag LOCUS_05090 19211 18660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 >Feature sequence021 2064 1036 gene locus_tag LOCUS_05100 2064 1036 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679158.1 protein_id gnl|my_center|LOCUS_05100 2428 3669 gene locus_tag LOCUS_05110 2428 3669 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673537.1 protein_id gnl|my_center|LOCUS_05110 4130 3666 gene locus_tag LOCUS_05120 4130 3666 CDS product DUF188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679987.1 protein_id gnl|my_center|LOCUS_05120 4432 4127 gene locus_tag LOCUS_05130 4432 4127 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668137.1 protein_id gnl|my_center|LOCUS_05130 4954 4442 gene locus_tag LOCUS_05140 4954 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 5325 4966 gene locus_tag LOCUS_05150 gene rplT 5325 4966 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668132.1 protein_id gnl|my_center|LOCUS_05150 5539 5339 gene locus_tag LOCUS_05160 gene rpmI 5539 5339 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679992.1 protein_id gnl|my_center|LOCUS_05160 6091 5558 gene locus_tag LOCUS_05170 gene infC 6091 5558 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668127.1 protein_id gnl|my_center|LOCUS_05170 6312 7343 gene locus_tag LOCUS_05180 gene pta 6312 7343 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_05180 7634 8278 gene locus_tag LOCUS_05190 7634 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 8295 8960 gene locus_tag LOCUS_05200 8295 8960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 9046 9891 gene locus_tag LOCUS_05210 9046 9891 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545457.1 protein_id gnl|my_center|LOCUS_05210 9986 11053 gene locus_tag LOCUS_05220 gene gap 9986 11053 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_05220 12229 11270 gene locus_tag LOCUS_05230 12229 11270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 12989 12234 gene locus_tag LOCUS_05240 12989 12234 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387194.1 protein_id gnl|my_center|LOCUS_05240 13829 13008 gene locus_tag LOCUS_05250 13829 13008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 16423 13862 gene locus_tag LOCUS_05260 16423 13862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 17263 16535 gene locus_tag LOCUS_05270 17263 16535 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682266.1 protein_id gnl|my_center|LOCUS_05270 18033 17275 gene locus_tag LOCUS_05280 18033 17275 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897805.1 protein_id gnl|my_center|LOCUS_05280 >Feature sequence022 3 76 gene locus_tag LOCUS_t00090 3 76 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3646 260 gene locus_tag LOCUS_05290 3646 260 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948403.1 protein_id gnl|my_center|LOCUS_05290 4746 3754 gene locus_tag LOCUS_05300 4746 3754 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122014502.1 protein_id gnl|my_center|LOCUS_05300 5199 4912 gene locus_tag LOCUS_05310 5199 4912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 5775 5386 gene locus_tag LOCUS_05320 5775 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 6195 5923 gene locus_tag LOCUS_05330 6195 5923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 7420 6176 gene locus_tag LOCUS_05340 7420 6176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 8145 7468 gene locus_tag LOCUS_05350 8145 7468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 9526 8315 gene locus_tag LOCUS_05360 9526 8315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 10794 9691 gene locus_tag LOCUS_05370 10794 9691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 11294 10869 gene locus_tag LOCUS_05380 11294 10869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 12716 11319 gene locus_tag LOCUS_05390 12716 11319 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948261.1 protein_id gnl|my_center|LOCUS_05390 14195 12732 gene locus_tag LOCUS_05400 14195 12732 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_05400 15204 14260 gene locus_tag LOCUS_05410 15204 14260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 17890 15254 gene locus_tag LOCUS_05420 17890 15254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 >Feature sequence023 2567 207 gene locus_tag LOCUS_05430 gene rpsA 2567 207 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679883.1 protein_id gnl|my_center|LOCUS_05430 3407 2655 gene locus_tag LOCUS_05440 3407 2655 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682155.1 protein_id gnl|my_center|LOCUS_05440 3936 3397 gene locus_tag LOCUS_05450 gene scpB 3936 3397 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672067.1 protein_id gnl|my_center|LOCUS_05450 4802 3951 gene locus_tag LOCUS_05460 4802 3951 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670199.1 protein_id gnl|my_center|LOCUS_05460 5379 4813 gene locus_tag LOCUS_05470 5379 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 6513 5380 gene locus_tag LOCUS_05480 gene recA 6513 5380 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682153.1 protein_id gnl|my_center|LOCUS_05480 7267 6635 gene locus_tag LOCUS_05490 7267 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05490 7728 7327 gene locus_tag LOCUS_05500 7728 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 7333 7337 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9222 7729 gene locus_tag LOCUS_05510 9222 7729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 10130 9219 gene locus_tag LOCUS_05520 10130 9219 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667244.1 protein_id gnl|my_center|LOCUS_05520 10822 10193 gene locus_tag LOCUS_05530 gene rpe 10822 10193 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957271.1 protein_id gnl|my_center|LOCUS_05530 11083 12012 gene locus_tag LOCUS_05540 11083 12012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667094.1 protein_id gnl|my_center|LOCUS_05540 12204 14918 gene locus_tag LOCUS_05550 gene greA 12204 14918 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673498.1 protein_id gnl|my_center|LOCUS_05550 15074 15490 gene locus_tag LOCUS_05560 15074 15490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05560 15478 15486 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15561 16013 gene locus_tag LOCUS_05570 15561 16013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05570 16754 16023 gene locus_tag LOCUS_05580 gene deoC 16754 16023 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017446.1 protein_id gnl|my_center|LOCUS_05580 16885 16995 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17274 17555 gene locus_tag LOCUS_05590 17274 17555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 >Feature sequence024 3111 1765 gene locus_tag LOCUS_05600 3111 1765 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233074.1 protein_id gnl|my_center|LOCUS_05600 3292 5091 gene locus_tag LOCUS_05610 3292 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 5102 6211 gene locus_tag LOCUS_05620 5102 6211 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101281.1 protein_id gnl|my_center|LOCUS_05620 6215 7672 gene locus_tag LOCUS_05630 6215 7672 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128519551.1 protein_id gnl|my_center|LOCUS_05630 7675 8574 gene locus_tag LOCUS_05640 7675 8574 CDS product benzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101762936.1 protein_id gnl|my_center|LOCUS_05640 9037 8636 gene locus_tag LOCUS_05650 9037 8636 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876264.1 protein_id gnl|my_center|LOCUS_05650 9303 9046 gene locus_tag LOCUS_05660 9303 9046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 9435 10178 gene locus_tag LOCUS_05670 9435 10178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 10123 10170 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11445 10399 gene locus_tag LOCUS_05680 11445 10399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 12164 13606 gene locus_tag LOCUS_05690 12164 13606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 13744 14901 gene locus_tag LOCUS_05700 13744 14901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 14905 15951 gene locus_tag LOCUS_05710 14905 15951 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_05710 15562 15606 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16483 16058 gene locus_tag LOCUS_05720 16483 16058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05720 17459 16431 gene locus_tag LOCUS_05730 17459 16431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05730 16505 16529 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence025 <1 1120 gene locus_tag LOCUS_05740 <1 1120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460982.1:ATP-binding protein 1416 1967 gene locus_tag LOCUS_05750 1416 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 3547 2255 gene locus_tag LOCUS_05760 3547 2255 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_05760 3777 5015 gene locus_tag LOCUS_05770 3777 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 5033 5569 gene locus_tag LOCUS_05780 5033 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 5701 6201 gene locus_tag LOCUS_05790 5701 6201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 6753 6421 gene locus_tag LOCUS_05800 6753 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 6973 8190 gene locus_tag LOCUS_05810 6973 8190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 8194 8814 gene locus_tag LOCUS_05820 8194 8814 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328106.1 protein_id gnl|my_center|LOCUS_05820 9576 9684 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9875 9921 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10570 10046 gene locus_tag LOCUS_05830 10570 10046 CDS product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072772897.1 protein_id gnl|my_center|LOCUS_05830 11837 10782 gene locus_tag LOCUS_05840 11837 10782 CDS product Fic/DOC family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124794669.1 protein_id gnl|my_center|LOCUS_05840 12390 12043 gene locus_tag LOCUS_05850 12390 12043 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956916.1 protein_id gnl|my_center|LOCUS_05850 12527 12958 gene locus_tag LOCUS_05860 12527 12958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 12960 13706 gene locus_tag LOCUS_05870 12960 13706 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360559.1 protein_id gnl|my_center|LOCUS_05870 13707 15224 gene locus_tag LOCUS_05880 13707 15224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039965.1 protein_id gnl|my_center|LOCUS_05880 15217 15729 gene locus_tag LOCUS_05890 15217 15729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05890 15629 15663 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15880 16446 gene locus_tag LOCUS_05900 15880 16446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05900 15885 15916 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16968 17008 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence026 211 20 gene locus_tag LOCUS_05910 211 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 1275 379 gene locus_tag LOCUS_05920 1275 379 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869154.1 protein_id gnl|my_center|LOCUS_05920 1866 1324 gene locus_tag LOCUS_05930 1866 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 2098 1853 gene locus_tag LOCUS_05940 2098 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 3005 2112 gene locus_tag LOCUS_05950 3005 2112 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_05950 3472 3038 gene locus_tag LOCUS_05960 3472 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 4280 3495 gene locus_tag LOCUS_05970 4280 3495 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943610.1 protein_id gnl|my_center|LOCUS_05970 5293 4283 gene locus_tag LOCUS_05980 5293 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 7250 5439 gene locus_tag LOCUS_05990 gene pepF 7250 5439 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971600.1 protein_id gnl|my_center|LOCUS_05990 8589 7489 gene locus_tag LOCUS_06000 8589 7489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06000 9608 8586 gene locus_tag LOCUS_06010 9608 8586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06010 8624 8663 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9939 12101 gene locus_tag LOCUS_06020 gene nrdD 9939 12101 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 protein_id gnl|my_center|LOCUS_06020 12112 12597 gene locus_tag LOCUS_06030 12112 12597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 14295 12592 gene locus_tag LOCUS_06040 gene sulP 14295 12592 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797091.1 protein_id gnl|my_center|LOCUS_06040 14546 14665 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14930 14727 gene locus_tag LOCUS_06050 14930 14727 CDS product copper ion binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132585.1 protein_id gnl|my_center|LOCUS_06050 <17122 14975 gene locus_tag LOCUS_06060 <17122 14975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680864.1:heavy metal translocating P-type ATPase >Feature sequence027 936 2855 gene locus_tag LOCUS_06070 936 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 2904 3011 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3041 5329 gene locus_tag LOCUS_06080 3041 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 6084 5530 gene locus_tag LOCUS_06090 6084 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 7376 6090 gene locus_tag LOCUS_06100 7376 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 7575 8522 gene locus_tag LOCUS_06110 gene yhdJ 7575 8522 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258939.1 protein_id gnl|my_center|LOCUS_06110 9402 10604 gene locus_tag LOCUS_06120 9402 10604 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682240.1 protein_id gnl|my_center|LOCUS_06120 10604 11197 gene locus_tag LOCUS_06130 10604 11197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 12210 11395 gene locus_tag LOCUS_06140 12210 11395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 12874 12284 gene locus_tag LOCUS_06150 12874 12284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 16638 12961 gene locus_tag LOCUS_06160 16638 12961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06160 13002 13015 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence028 <1 236 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcaggttgacttggaaaattaatcagttataattc 637 302 gene locus_tag LOCUS_06170 gene cas2 637 302 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475522.1 protein_id gnl|my_center|LOCUS_06170 1568 630 gene locus_tag LOCUS_06180 gene cas1 1568 630 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_06180 1887 1570 gene locus_tag LOCUS_06190 1887 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 4930 1910 gene locus_tag LOCUS_06200 4930 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 1972 1986 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5148 5387 gene locus_tag LOCUS_06210 5148 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 5441 5911 gene locus_tag LOCUS_06220 5441 5911 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262715.1 protein_id gnl|my_center|LOCUS_06220 5924 6730 gene locus_tag LOCUS_06230 5924 6730 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_06230 7035 7601 gene locus_tag LOCUS_06240 7035 7601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 7634 7891 gene locus_tag LOCUS_06250 7634 7891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 8123 9067 gene locus_tag LOCUS_06260 8123 9067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 9071 9772 gene locus_tag LOCUS_06270 9071 9772 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 protein_id gnl|my_center|LOCUS_06270 9776 11134 gene locus_tag LOCUS_06280 9776 11134 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948710.1 protein_id gnl|my_center|LOCUS_06280 12338 11148 gene locus_tag LOCUS_06290 12338 11148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 13135 12350 gene locus_tag LOCUS_06300 13135 12350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 13751 14944 gene locus_tag LOCUS_06310 13751 14944 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891654.1 protein_id gnl|my_center|LOCUS_06310 15962 15264 gene locus_tag LOCUS_06320 15962 15264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 >Feature sequence029 488 1645 gene locus_tag LOCUS_06330 488 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 1826 2086 gene locus_tag LOCUS_06340 1826 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 2151 4718 gene locus_tag LOCUS_06350 gene lon 2151 4718 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681876.1 protein_id gnl|my_center|LOCUS_06350 5472 4867 gene locus_tag LOCUS_06360 gene thrH 5472 4867 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_06360 6319 7389 gene locus_tag LOCUS_06370 6319 7389 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680471.1 protein_id gnl|my_center|LOCUS_06370 7539 8564 gene locus_tag LOCUS_06380 gene tsaD 7539 8564 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680472.1 protein_id gnl|my_center|LOCUS_06380 8838 9872 gene locus_tag LOCUS_06390 gene aroF 8838 9872 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_06390 9275 9285 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9918 10814 gene locus_tag LOCUS_06400 9918 10814 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964211.1 protein_id gnl|my_center|LOCUS_06400 11082 11612 gene locus_tag LOCUS_06410 11082 11612 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678446.1 protein_id gnl|my_center|LOCUS_06410 11614 12633 gene locus_tag LOCUS_06420 gene asnA 11614 12633 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108145.1 protein_id gnl|my_center|LOCUS_06420 12630 13634 gene locus_tag LOCUS_06430 12630 13634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 13669 14625 gene locus_tag LOCUS_06440 13669 14625 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902040.1 protein_id gnl|my_center|LOCUS_06440 14880 15506 gene locus_tag LOCUS_06450 14880 15506 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681814.1 protein_id gnl|my_center|LOCUS_06450 >Feature sequence030 1019 1408 gene locus_tag LOCUS_06460 1019 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06460 1323 1346 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1444 1836 gene locus_tag LOCUS_06470 1444 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 1876 2739 gene locus_tag LOCUS_06480 1876 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 6602 2955 gene locus_tag LOCUS_06490 6602 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 7043 7762 gene locus_tag LOCUS_06500 7043 7762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 7964 8998 gene locus_tag LOCUS_06510 gene prfA 7964 8998 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680455.1 protein_id gnl|my_center|LOCUS_06510 9013 9942 gene locus_tag LOCUS_06520 gene prmC 9013 9942 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680454.1 protein_id gnl|my_center|LOCUS_06520 10442 10149 gene locus_tag LOCUS_06530 10442 10149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656352.1 protein_id gnl|my_center|LOCUS_06530 11614 10445 gene locus_tag LOCUS_06540 11614 10445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 13616 11739 gene locus_tag LOCUS_06550 13616 11739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 11754 11769 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14588 13620 gene locus_tag LOCUS_06560 14588 13620 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946763.1 protein_id gnl|my_center|LOCUS_06560 15992 14694 gene locus_tag LOCUS_06570 15992 14694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 >Feature sequence031 2344 434 gene locus_tag LOCUS_06580 2344 434 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049207.1 protein_id gnl|my_center|LOCUS_06580 2889 2362 gene locus_tag LOCUS_06590 2889 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 3637 2936 gene locus_tag LOCUS_06600 3637 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 4053 3634 gene locus_tag LOCUS_06610 4053 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 5471 4083 gene locus_tag LOCUS_06620 gene miaB 5471 4083 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679246.1 protein_id gnl|my_center|LOCUS_06620 5556 5613 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6682 5669 gene locus_tag LOCUS_06630 6682 5669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 7459 6821 gene locus_tag LOCUS_06640 gene phoU 7459 6821 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986850.1 protein_id gnl|my_center|LOCUS_06640 8309 7551 gene locus_tag LOCUS_06650 gene pstB 8309 7551 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_06650 9149 8322 gene locus_tag LOCUS_06660 gene pstA 9149 8322 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427927.1 protein_id gnl|my_center|LOCUS_06660 10092 9247 gene locus_tag LOCUS_06670 gene pstC 10092 9247 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814831.1 protein_id gnl|my_center|LOCUS_06670 10951 10193 gene locus_tag LOCUS_06680 10951 10193 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716331.1 protein_id gnl|my_center|LOCUS_06680 10965 11038 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12124 11510 gene locus_tag LOCUS_06690 12124 11510 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583945.1 protein_id gnl|my_center|LOCUS_06690 12426 13034 gene locus_tag LOCUS_06700 12426 13034 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682263.1 protein_id gnl|my_center|LOCUS_06700 13052 13756 gene locus_tag LOCUS_06710 13052 13756 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680496.1 protein_id gnl|my_center|LOCUS_06710 13747 14523 gene locus_tag LOCUS_06720 13747 14523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 >Feature sequence032 403 1539 gene locus_tag LOCUS_06730 403 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 1463 1499 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1581 2237 gene locus_tag LOCUS_06740 1581 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 2251 2298 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2567 5290 gene locus_tag LOCUS_06750 2567 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 5359 6537 gene locus_tag LOCUS_06760 5359 6537 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709916.1 protein_id gnl|my_center|LOCUS_06760 6646 7464 gene locus_tag LOCUS_06770 6646 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 7433 8761 gene locus_tag LOCUS_06780 7433 8761 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804062.1 protein_id gnl|my_center|LOCUS_06780 7439 7457 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8758 9834 gene locus_tag LOCUS_06790 8758 9834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 10082 11854 gene locus_tag LOCUS_06800 10082 11854 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584022.1 protein_id gnl|my_center|LOCUS_06800 12608 11943 gene locus_tag LOCUS_06810 12608 11943 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_06810 12687 13394 gene locus_tag LOCUS_06820 12687 13394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 13468 15522 gene locus_tag LOCUS_06830 gene fusA 13468 15522 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681223.1 protein_id gnl|my_center|LOCUS_06830 15692 15749 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence033 <1 889 gene locus_tag LOCUS_06840 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202672.1:PDDEXK nuclease domain-containing protein 682 708 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 886 1938 gene locus_tag LOCUS_06850 886 1938 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_06850 1935 3197 gene locus_tag LOCUS_06860 1935 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 3331 3825 gene locus_tag LOCUS_06870 3331 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 4006 4239 gene locus_tag LOCUS_06880 4006 4239 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443825.1 protein_id gnl|my_center|LOCUS_06880 4233 4571 gene locus_tag LOCUS_06890 gene mazF 4233 4571 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240418.1 protein_id gnl|my_center|LOCUS_06890 4637 4864 gene locus_tag LOCUS_06900 4637 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 4864 5139 gene locus_tag LOCUS_06910 4864 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 5152 8247 gene locus_tag LOCUS_06920 5152 8247 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141537.1 protein_id gnl|my_center|LOCUS_06920 8868 8296 gene locus_tag LOCUS_06930 8868 8296 CDS product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140224180.1 protein_id gnl|my_center|LOCUS_06930 8374 8384 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9506 10183 gene locus_tag LOCUS_06940 9506 10183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 10180 11316 gene locus_tag LOCUS_06950 10180 11316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 11272 11305 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11579 14779 gene locus_tag LOCUS_06960 11579 14779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 14599 14640 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14782 15408 gene locus_tag LOCUS_06970 14782 15408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 15686 15468 gene locus_tag LOCUS_06980 15686 15468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435950.1 protein_id gnl|my_center|LOCUS_06980 >Feature sequence034 392 93 gene locus_tag LOCUS_06990 392 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06990 1006 389 gene locus_tag LOCUS_07000 1006 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07000 406 426 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 641 652 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1864 1163 gene locus_tag LOCUS_07010 gene deoD 1864 1163 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681557.1 protein_id gnl|my_center|LOCUS_07010 2488 1907 gene locus_tag LOCUS_07020 2488 1907 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679462.1 protein_id gnl|my_center|LOCUS_07020 3073 2489 gene locus_tag LOCUS_07030 3073 2489 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_07030 3950 3084 gene locus_tag LOCUS_07040 3950 3084 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_07040 5482 3950 gene locus_tag LOCUS_07050 5482 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 6968 5691 gene locus_tag LOCUS_07060 6968 5691 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254464.1 protein_id gnl|my_center|LOCUS_07060 7671 7087 gene locus_tag LOCUS_07070 7671 7087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 7910 7671 gene locus_tag LOCUS_07080 7910 7671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 10070 8010 gene locus_tag LOCUS_07090 10070 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 8359 8365 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10486 10127 gene locus_tag LOCUS_07100 10486 10127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 10688 10479 gene locus_tag LOCUS_07110 10688 10479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 12145 11108 gene locus_tag LOCUS_07120 12145 11108 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013616093.1 protein_id gnl|my_center|LOCUS_07120 12872 12171 gene locus_tag LOCUS_07130 12872 12171 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780363.1 protein_id gnl|my_center|LOCUS_07130 13242 14483 gene locus_tag LOCUS_07140 13242 14483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 14967 14497 gene locus_tag LOCUS_07150 14967 14497 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_07150 <15701 14993 gene locus_tag LOCUS_07160 <15701 14993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000887749.1:cysteine desulfurase >Feature sequence035 <1 1594 gene locus_tag LOCUS_07170 <1 1594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679203.1:chitobiase/beta-hexosaminidase C-terminal domain-containing protein 1599 2189 gene locus_tag LOCUS_07180 1599 2189 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956988.1 protein_id gnl|my_center|LOCUS_07180 2620 2204 gene locus_tag LOCUS_07190 2620 2204 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672091.1 protein_id gnl|my_center|LOCUS_07190 4033 2840 gene locus_tag LOCUS_07200 4033 2840 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680952.1 protein_id gnl|my_center|LOCUS_07200 5167 4049 gene locus_tag LOCUS_07210 5167 4049 CDS product 3-dehydroquinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680953.1 protein_id gnl|my_center|LOCUS_07210 5806 5177 gene locus_tag LOCUS_07220 5806 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680583.1 protein_id gnl|my_center|LOCUS_07220 6437 5808 gene locus_tag LOCUS_07230 gene tmk 6437 5808 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957272.1 protein_id gnl|my_center|LOCUS_07230 6534 10934 gene locus_tag LOCUS_07240 6534 10934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680585.1 protein_id gnl|my_center|LOCUS_07240 11059 12339 gene locus_tag LOCUS_07250 11059 12339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07250 11374 11402 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12247 12291 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12324 13502 gene locus_tag LOCUS_07260 12324 13502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07260 13515 14039 gene locus_tag LOCUS_07270 13515 14039 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667237.1 protein_id gnl|my_center|LOCUS_07270 >Feature sequence036 140 544 gene locus_tag LOCUS_07280 140 544 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_07280 501 650 gene locus_tag LOCUS_07290 501 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 773 2659 gene locus_tag LOCUS_07300 773 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 2875 3231 gene locus_tag LOCUS_07310 2875 3231 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963739.1 protein_id gnl|my_center|LOCUS_07310 3734 3357 gene locus_tag LOCUS_07320 3734 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07320 4007 3786 gene locus_tag LOCUS_07330 4007 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07330 4642 4334 gene locus_tag LOCUS_07340 4642 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07340 5167 4814 gene locus_tag LOCUS_07350 5167 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 5204 6229 gene locus_tag LOCUS_07360 5204 6229 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690326.1 protein_id gnl|my_center|LOCUS_07360 6249 7202 gene locus_tag LOCUS_07370 6249 7202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 8042 7326 gene locus_tag LOCUS_07380 8042 7326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 8563 8141 gene locus_tag LOCUS_07390 8563 8141 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681772.1 protein_id gnl|my_center|LOCUS_07390 8476 8510 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8781 8563 gene locus_tag LOCUS_07400 8781 8563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681774.1 protein_id gnl|my_center|LOCUS_07400 9541 10488 gene locus_tag LOCUS_07410 gene dcm 9541 10488 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222381.1 protein_id gnl|my_center|LOCUS_07410 10485 12143 gene locus_tag LOCUS_07420 10485 12143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 12307 13647 gene locus_tag LOCUS_07430 12307 13647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 13926 14417 gene locus_tag LOCUS_07440 13926 14417 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390171.1 protein_id gnl|my_center|LOCUS_07440 14417 14668 gene locus_tag LOCUS_07450 14417 14668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 14474 14496 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence037 115 1200 gene locus_tag LOCUS_07460 115 1200 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_07460 1190 2128 gene locus_tag LOCUS_07470 1190 2128 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682131.1 protein_id gnl|my_center|LOCUS_07470 2172 5264 gene locus_tag LOCUS_07480 2172 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 3252 3260 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6024 5245 gene locus_tag LOCUS_07490 6024 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07490 6613 5945 gene locus_tag LOCUS_07500 6613 5945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07500 6045 6057 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7957 6665 gene locus_tag LOCUS_07510 7957 6665 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_07510 8368 9273 gene locus_tag LOCUS_07520 gene metF 8368 9273 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_07520 9293 10384 gene locus_tag LOCUS_07530 gene rpsA 9293 10384 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941857.1 protein_id gnl|my_center|LOCUS_07530 10432 11364 gene locus_tag LOCUS_07540 gene pyrF 10432 11364 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965940.1 protein_id gnl|my_center|LOCUS_07540 11479 13257 gene locus_tag LOCUS_07550 11479 13257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 13328 14569 gene locus_tag LOCUS_07560 13328 14569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 <15311 14573 gene locus_tag LOCUS_07570 <15311 14573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680027.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE >Feature sequence038 <1 2559 gene locus_tag LOCUS_07580 <1 2559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224463.1:glycogen debranching protein GlgX 3078 6362 gene locus_tag LOCUS_07590 gene rpoB 3078 6362 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680361.1 protein_id gnl|my_center|LOCUS_07590 6300 6334 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6343 6636 gene locus_tag LOCUS_07600 6343 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07600 6637 6660 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6698 10924 gene locus_tag LOCUS_07610 gene rpoC 6698 10924 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680359.1 protein_id gnl|my_center|LOCUS_07610 11281 12180 gene locus_tag LOCUS_07620 11281 12180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 12278 14587 gene locus_tag LOCUS_07630 12278 14587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 13302 13306 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence039 353 799 gene locus_tag LOCUS_07640 353 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 842 2584 gene locus_tag LOCUS_07650 gene rho 842 2584 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668994.1 protein_id gnl|my_center|LOCUS_07650 2696 2905 gene locus_tag LOCUS_07660 gene rpmE 2696 2905 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_07660 4070 2967 gene locus_tag LOCUS_07670 4070 2967 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679607.1 protein_id gnl|my_center|LOCUS_07670 4175 5395 gene locus_tag LOCUS_07680 4175 5395 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_07680 5412 5933 gene locus_tag LOCUS_07690 5412 5933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07690 5898 5920 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5930 6175 gene locus_tag LOCUS_07700 5930 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07700 6291 7892 gene locus_tag LOCUS_07710 6291 7892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 7942 7970 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8111 9568 gene locus_tag LOCUS_07720 8111 9568 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669145.1 protein_id gnl|my_center|LOCUS_07720 9826 10707 gene locus_tag LOCUS_07730 9826 10707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 10765 11235 gene locus_tag LOCUS_07740 10765 11235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 11174 11213 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12956 12967 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence040 272 322 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 500 1258 gene locus_tag LOCUS_07750 gene tpiA 500 1258 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_07750 1464 1805 gene locus_tag LOCUS_07760 gene secG 1464 1805 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668509.1 protein_id gnl|my_center|LOCUS_07760 1817 2293 gene locus_tag LOCUS_07770 1817 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 2373 2684 gene locus_tag LOCUS_07780 2373 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 2695 3714 gene locus_tag LOCUS_07790 2695 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 3729 5717 gene locus_tag LOCUS_07800 3729 5717 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_07800 5727 6074 gene locus_tag LOCUS_07810 5727 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 6140 6472 gene locus_tag LOCUS_07820 6140 6472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 6504 7133 gene locus_tag LOCUS_07830 6504 7133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 7134 8906 gene locus_tag LOCUS_07840 7134 8906 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250553.1 protein_id gnl|my_center|LOCUS_07840 8906 10285 gene locus_tag LOCUS_07850 8906 10285 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_07850 10285 10908 gene locus_tag LOCUS_07860 10285 10908 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_07860 10919 11422 gene locus_tag LOCUS_07870 10919 11422 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_07870 11433 12215 gene locus_tag LOCUS_07880 11433 12215 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679454.1 protein_id gnl|my_center|LOCUS_07880 12328 13086 gene locus_tag LOCUS_07890 gene map 12328 13086 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670900.1 protein_id gnl|my_center|LOCUS_07890 13305 14795 gene locus_tag LOCUS_07900 13305 14795 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674333.1 protein_id gnl|my_center|LOCUS_07900 >Feature sequence041 <1 1502 gene locus_tag LOCUS_07910 <1 1502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966175.1:CTP synthase 1539 2750 gene locus_tag LOCUS_07920 gene glnA 1539 2750 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024100.1 protein_id gnl|my_center|LOCUS_07920 2763 3332 gene locus_tag LOCUS_07930 2763 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 4843 3434 gene locus_tag LOCUS_07940 gene purF 4843 3434 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964701.1 protein_id gnl|my_center|LOCUS_07940 6359 4854 gene locus_tag LOCUS_07950 6359 4854 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_07950 6965 6456 gene locus_tag LOCUS_07960 6965 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 7892 6969 gene locus_tag LOCUS_07970 7892 6969 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108933.1 protein_id gnl|my_center|LOCUS_07970 8425 7958 gene locus_tag LOCUS_07980 8425 7958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 8552 8827 gene locus_tag LOCUS_07990 8552 8827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 9810 8980 gene locus_tag LOCUS_08000 9810 8980 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_08000 10027 10938 gene locus_tag LOCUS_08010 10027 10938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 10988 11512 gene locus_tag LOCUS_08020 10988 11512 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387373.1 protein_id gnl|my_center|LOCUS_08020 11596 11862 gene locus_tag LOCUS_08030 11596 11862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 11862 12164 gene locus_tag LOCUS_08040 11862 12164 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165613498.1 protein_id gnl|my_center|LOCUS_08040 12708 12214 gene locus_tag LOCUS_08050 12708 12214 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461280.1 protein_id gnl|my_center|LOCUS_08050 14199 12805 gene locus_tag LOCUS_08060 14199 12805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 14363 14432 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence042 1182 778 gene locus_tag LOCUS_08070 1182 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 2165 1257 gene locus_tag LOCUS_08080 2165 1257 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681695.1 protein_id gnl|my_center|LOCUS_08080 2961 2104 gene locus_tag LOCUS_08090 2961 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 2131 2154 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3680 2982 gene locus_tag LOCUS_08100 3680 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 3832 4080 gene locus_tag LOCUS_08110 3832 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 4177 5514 gene locus_tag LOCUS_08120 4177 5514 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_08120 7104 5674 gene locus_tag LOCUS_08130 7104 5674 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417780.1 protein_id gnl|my_center|LOCUS_08130 9196 7115 gene locus_tag LOCUS_08140 gene oadA 9196 7115 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261303.1 protein_id gnl|my_center|LOCUS_08140 9494 9222 gene locus_tag LOCUS_08150 9494 9222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 9926 9762 gene locus_tag LOCUS_08160 9926 9762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 9964 10392 gene locus_tag LOCUS_08170 9964 10392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 11178 10399 gene locus_tag LOCUS_08180 gene dapB 11178 10399 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_08180 12531 11191 gene locus_tag LOCUS_08190 gene lysC 12531 11191 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931789.1 protein_id gnl|my_center|LOCUS_08190 13555 12638 gene locus_tag LOCUS_08200 13555 12638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 14269 13565 gene locus_tag LOCUS_08210 14269 13565 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764403.1 protein_id gnl|my_center|LOCUS_08210 14409 14305 gene locus_tag LOCUS_r00010 14409 14305 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence043 154 211 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 362 1537 gene locus_tag LOCUS_08220 gene mnmA 362 1537 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256566.1 protein_id gnl|my_center|LOCUS_08220 2546 1674 gene locus_tag LOCUS_08230 2546 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679630.1 protein_id gnl|my_center|LOCUS_08230 3620 2559 gene locus_tag LOCUS_08240 3620 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679631.1 protein_id gnl|my_center|LOCUS_08240 3781 4431 gene locus_tag LOCUS_08250 3781 4431 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682388.1 protein_id gnl|my_center|LOCUS_08250 5738 4551 gene locus_tag LOCUS_08260 5738 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679110.1 protein_id gnl|my_center|LOCUS_08260 5934 5980 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6003 6458 gene locus_tag LOCUS_08270 6003 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 6578 8767 gene locus_tag LOCUS_08280 6578 8767 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679721.1 protein_id gnl|my_center|LOCUS_08280 8733 11657 gene locus_tag LOCUS_08290 8733 11657 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679719.1 protein_id gnl|my_center|LOCUS_08290 11647 12969 gene locus_tag LOCUS_08300 11647 12969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957119.1 protein_id gnl|my_center|LOCUS_08300 >Feature sequence044 <1 607 gene locus_tag LOCUS_08310 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005809743.1:formate--tetrahydrofolate ligase 743 781 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1316 885 gene locus_tag LOCUS_08320 1316 885 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879168.1 protein_id gnl|my_center|LOCUS_08320 2701 1388 gene locus_tag LOCUS_08330 2701 1388 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788204.1 protein_id gnl|my_center|LOCUS_08330 3270 2704 gene locus_tag LOCUS_08340 3270 2704 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_08340 5022 3271 gene locus_tag LOCUS_08350 gene iorA 5022 3271 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_08350 5222 5249 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7668 5287 gene locus_tag LOCUS_08360 7668 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 9576 7729 gene locus_tag LOCUS_08370 9576 7729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 8731 8810 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10862 9600 gene locus_tag LOCUS_08380 10862 9600 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667047.1 protein_id gnl|my_center|LOCUS_08380 11559 11182 gene locus_tag LOCUS_08390 11559 11182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 12955 11672 gene locus_tag LOCUS_08400 12955 11672 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674509.1 protein_id gnl|my_center|LOCUS_08400 13907 12948 gene locus_tag LOCUS_08410 13907 12948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 14187 14255 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence045 109 1116 gene locus_tag LOCUS_08420 109 1116 CDS product DUF4007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016393.1 protein_id gnl|my_center|LOCUS_08420 1119 1910 gene locus_tag LOCUS_08430 1119 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08430 1998 5045 gene locus_tag LOCUS_08440 1998 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106895171.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08440 5128 5204 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5396 5439 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5470 6492 gene locus_tag LOCUS_08450 5470 6492 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016395.1 protein_id gnl|my_center|LOCUS_08450 6503 8737 gene locus_tag LOCUS_08460 6503 8737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 8727 8903 gene locus_tag LOCUS_08470 8727 8903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 8894 10894 gene locus_tag LOCUS_08480 8894 10894 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016398.1 protein_id gnl|my_center|LOCUS_08480 10897 11433 gene locus_tag LOCUS_08490 10897 11433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 11443 12492 gene locus_tag LOCUS_08500 gene rpoD 11443 12492 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226225.1 protein_id gnl|my_center|LOCUS_08500 12541 13002 gene locus_tag LOCUS_08510 12541 13002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062537442.1 protein_id gnl|my_center|LOCUS_08510 12999 13769 gene locus_tag LOCUS_08520 12999 13769 CDS product DUF1829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213043995.1 protein_id gnl|my_center|LOCUS_08520 13820 14266 gene locus_tag LOCUS_08530 13820 14266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 >Feature sequence046 2263 743 gene locus_tag LOCUS_08540 gene murD 2263 743 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956725.1 protein_id gnl|my_center|LOCUS_08540 3423 2296 gene locus_tag LOCUS_08550 3423 2296 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680316.1 protein_id gnl|my_center|LOCUS_08550 5183 3444 gene locus_tag LOCUS_08560 5183 3444 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682087.1 protein_id gnl|my_center|LOCUS_08560 5317 5715 gene locus_tag LOCUS_08570 gene queD 5317 5715 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_08570 6473 5703 gene locus_tag LOCUS_08580 6473 5703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 7247 6483 gene locus_tag LOCUS_08590 gene hisF 7247 6483 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937595.1 protein_id gnl|my_center|LOCUS_08590 7876 7241 gene locus_tag LOCUS_08600 gene hisH 7876 7241 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937594.1 protein_id gnl|my_center|LOCUS_08600 7942 8199 gene locus_tag LOCUS_08610 7942 8199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 9866 8181 gene locus_tag LOCUS_08620 9866 8181 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681501.1 protein_id gnl|my_center|LOCUS_08620 11389 10139 gene locus_tag LOCUS_08630 11389 10139 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681866.1 protein_id gnl|my_center|LOCUS_08630 10475 10493 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11553 11948 gene locus_tag LOCUS_08640 11553 11948 CDS product Holliday junction resolvase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680619.1 protein_id gnl|my_center|LOCUS_08640 13615 11918 gene locus_tag LOCUS_08650 13615 11918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 >Feature sequence047 867 890 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2986 974 gene locus_tag LOCUS_08660 2986 974 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682194.1 protein_id gnl|my_center|LOCUS_08660 3218 4510 gene locus_tag LOCUS_08670 3218 4510 CDS product hexokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680422.1 protein_id gnl|my_center|LOCUS_08670 4527 5147 gene locus_tag LOCUS_08680 4527 5147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678886.1 protein_id gnl|my_center|LOCUS_08680 5214 6515 gene locus_tag LOCUS_08690 5214 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 6550 6999 gene locus_tag LOCUS_08700 gene flgD 6550 6999 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666981.1 protein_id gnl|my_center|LOCUS_08700 7057 7230 gene locus_tag LOCUS_08710 7057 7230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08710 7267 8448 gene locus_tag LOCUS_08720 gene flgE 7267 8448 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680830.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08720 10588 8750 gene locus_tag LOCUS_08730 10588 8750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 10988 10608 gene locus_tag LOCUS_08740 10988 10608 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681559.1 protein_id gnl|my_center|LOCUS_08740 11200 10988 gene locus_tag LOCUS_08750 11200 10988 CDS product DUF2281 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672644.1 protein_id gnl|my_center|LOCUS_08750 11634 11293 gene locus_tag LOCUS_08760 11634 11293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 12010 11624 gene locus_tag LOCUS_08770 12010 11624 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805125.1 protein_id gnl|my_center|LOCUS_08770 12920 12003 gene locus_tag LOCUS_08780 12920 12003 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_08780 <14132 12924 gene locus_tag LOCUS_08790 <14132 12924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005176203.1:dTDP-4-amino-4,6-dideoxygalactose transaminase >Feature sequence048 881 528 gene locus_tag LOCUS_08800 881 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 1795 1034 gene locus_tag LOCUS_08810 1795 1034 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294240.1 protein_id gnl|my_center|LOCUS_08810 2562 1810 gene locus_tag LOCUS_08820 2562 1810 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943967.1 protein_id gnl|my_center|LOCUS_08820 3564 2650 gene locus_tag LOCUS_08830 3564 2650 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814503.1 protein_id gnl|my_center|LOCUS_08830 3815 4018 gene locus_tag LOCUS_08840 3815 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 4011 4877 gene locus_tag LOCUS_08850 4011 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 4879 5748 gene locus_tag LOCUS_08860 4879 5748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 7137 5734 gene locus_tag LOCUS_08870 7137 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 7713 7258 gene locus_tag LOCUS_08880 7713 7258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 8804 7986 gene locus_tag LOCUS_08890 8804 7986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 10276 9137 gene locus_tag LOCUS_08900 10276 9137 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104055.1 protein_id gnl|my_center|LOCUS_08900 10592 10278 gene locus_tag LOCUS_08910 10592 10278 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249076.1 protein_id gnl|my_center|LOCUS_08910 12272 10695 gene locus_tag LOCUS_08920 12272 10695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08920 12603 12286 gene locus_tag LOCUS_08930 12603 12286 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869719.1 protein_id gnl|my_center|LOCUS_08930 12743 13894 gene locus_tag LOCUS_08940 12743 13894 CDS product tyramine oxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014462.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence049 <1 1648 gene locus_tag LOCUS_08950 <1 1648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679557.1:insulinase family protein 1778 1996 gene locus_tag LOCUS_08960 1778 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 2065 3213 gene locus_tag LOCUS_08970 2065 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 3853 5919 gene locus_tag LOCUS_08980 gene clpB 3853 5919 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680241.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08980 3872 3936 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7176 6040 gene locus_tag LOCUS_08990 7176 6040 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566189.1 protein_id gnl|my_center|LOCUS_08990 7634 8041 gene locus_tag LOCUS_09000 7634 8041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 8476 8072 gene locus_tag LOCUS_09010 8476 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 8728 9321 gene locus_tag LOCUS_09020 8728 9321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 9338 10048 gene locus_tag LOCUS_09030 9338 10048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 10045 10623 gene locus_tag LOCUS_09040 10045 10623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 11291 10992 gene locus_tag LOCUS_09050 11291 10992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09050 12166 11288 gene locus_tag LOCUS_09060 12166 11288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09060 13175 12153 gene locus_tag LOCUS_09070 gene dcm 13175 12153 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964364.1 protein_id gnl|my_center|LOCUS_09070 >Feature sequence050 1604 306 gene locus_tag LOCUS_09080 1604 306 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_09080 2866 1601 gene locus_tag LOCUS_09090 2866 1601 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681281.1 protein_id gnl|my_center|LOCUS_09090 3898 2879 gene locus_tag LOCUS_09100 3898 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 7911 3940 gene locus_tag LOCUS_09110 7911 3940 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_09110 9184 8039 gene locus_tag LOCUS_09120 9184 8039 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_09120 9572 9321 gene locus_tag LOCUS_09130 9572 9321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 11001 9835 gene locus_tag LOCUS_09140 11001 9835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957140.1 protein_id gnl|my_center|LOCUS_09140 11817 11023 gene locus_tag LOCUS_09150 11817 11023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 12419 11964 gene locus_tag LOCUS_09160 gene rnhA 12419 11964 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003511799.1 protein_id gnl|my_center|LOCUS_09160 13121 12432 gene locus_tag LOCUS_09170 13121 12432 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453781.1 protein_id gnl|my_center|LOCUS_09170 >Feature sequence051 1067 138 gene locus_tag LOCUS_09180 1067 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 2021 1185 gene locus_tag LOCUS_09190 2021 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 3747 2053 gene locus_tag LOCUS_09200 3747 2053 CDS product DUF5312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680846.1 protein_id gnl|my_center|LOCUS_09200 3957 5219 gene locus_tag LOCUS_09210 3957 5219 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679691.1 protein_id gnl|my_center|LOCUS_09210 7171 5192 gene locus_tag LOCUS_09220 7171 5192 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667902.1 protein_id gnl|my_center|LOCUS_09220 7543 8178 gene locus_tag LOCUS_09230 7543 8178 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861240.1 protein_id gnl|my_center|LOCUS_09230 9229 8243 gene locus_tag LOCUS_09240 gene add 9229 8243 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548323.1 protein_id gnl|my_center|LOCUS_09240 9575 9255 gene locus_tag LOCUS_09250 9575 9255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09250 10413 9511 gene locus_tag LOCUS_09260 10413 9511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 9553 9566 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11464 10667 gene locus_tag LOCUS_09270 11464 10667 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682279.1 protein_id gnl|my_center|LOCUS_09270 12196 11639 gene locus_tag LOCUS_09280 12196 11639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 13147 12230 gene locus_tag LOCUS_09290 13147 12230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 13423 13348 gene locus_tag LOCUS_t00100 13423 13348 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence052 1298 648 gene locus_tag LOCUS_09300 1298 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 2814 1300 gene locus_tag LOCUS_09310 2814 1300 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_09310 3329 2850 gene locus_tag LOCUS_09320 3329 2850 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948445.1 protein_id gnl|my_center|LOCUS_09320 4114 3389 gene locus_tag LOCUS_09330 4114 3389 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_09330 4669 4151 gene locus_tag LOCUS_09340 gene lspA 4669 4151 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680623.1 protein_id gnl|my_center|LOCUS_09340 5671 4904 gene locus_tag LOCUS_09350 5671 4904 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680051.1 protein_id gnl|my_center|LOCUS_09350 6771 5728 gene locus_tag LOCUS_09360 6771 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 7703 6894 gene locus_tag LOCUS_09370 7703 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 7815 7823 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8614 7961 gene locus_tag LOCUS_09380 8614 7961 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263190.1 protein_id gnl|my_center|LOCUS_09380 9474 8632 gene locus_tag LOCUS_09390 9474 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 9601 11592 gene locus_tag LOCUS_09400 9601 11592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 12856 11654 gene locus_tag LOCUS_09410 12856 11654 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256229.1 protein_id gnl|my_center|LOCUS_09410 13484 12846 gene locus_tag LOCUS_09420 13484 12846 CDS product ApaLI family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012859081.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence053 186 195 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 704 784 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 929 964 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1191 1264 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1402 2829 gene locus_tag LOCUS_09430 1402 2829 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_09430 3018 5606 gene locus_tag LOCUS_09440 3018 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 5616 6635 gene locus_tag LOCUS_09450 5616 6635 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920607.1 protein_id gnl|my_center|LOCUS_09450 7505 6708 gene locus_tag LOCUS_09460 7505 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 7546 7582 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7811 10741 gene locus_tag LOCUS_09470 7811 10741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 >Feature sequence054 <1 3158 gene locus_tag LOCUS_09480 <1 3158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002678792.1:transcription-repair coupling factor 3326 4984 gene locus_tag LOCUS_09490 3326 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 4994 5542 gene locus_tag LOCUS_09500 gene rsmD 4994 5542 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669684.1 protein_id gnl|my_center|LOCUS_09500 5597 5941 gene locus_tag LOCUS_09510 5597 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668283.1 protein_id gnl|my_center|LOCUS_09510 6051 7247 gene locus_tag LOCUS_09520 6051 7247 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679870.1 protein_id gnl|my_center|LOCUS_09520 7254 8381 gene locus_tag LOCUS_09530 gene rlmN 7254 8381 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679871.1 protein_id gnl|my_center|LOCUS_09530 8278 8288 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8360 8569 gene locus_tag LOCUS_09540 8360 8569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 8573 9517 gene locus_tag LOCUS_09550 8573 9517 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966228.1 protein_id gnl|my_center|LOCUS_09550 9606 10889 gene locus_tag LOCUS_09560 9606 10889 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942548.1 protein_id gnl|my_center|LOCUS_09560 10924 11457 gene locus_tag LOCUS_09570 10924 11457 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942547.1 protein_id gnl|my_center|LOCUS_09570 12059 11589 gene locus_tag LOCUS_09580 12059 11589 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682399.1 protein_id gnl|my_center|LOCUS_09580 12099 12120 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13055 12186 gene locus_tag LOCUS_09590 13055 12186 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682397.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence055 1459 674 gene locus_tag LOCUS_09600 1459 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 1720 1514 gene locus_tag LOCUS_09610 1720 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 2244 1873 gene locus_tag LOCUS_09620 2244 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 4324 2813 gene locus_tag LOCUS_09630 4324 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09630 4674 4381 gene locus_tag LOCUS_09640 4674 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09640 5377 4733 gene locus_tag LOCUS_09650 5377 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 6620 5364 gene locus_tag LOCUS_09660 6620 5364 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_09660 9495 6751 gene locus_tag LOCUS_09670 9495 6751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09670 10756 9563 gene locus_tag LOCUS_09680 10756 9563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09680 9566 9583 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11741 10743 gene locus_tag LOCUS_09690 11741 10743 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109063.1 protein_id gnl|my_center|LOCUS_09690 13135 11768 gene locus_tag LOCUS_09700 13135 11768 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767538.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence056 <1 858 gene locus_tag LOCUS_09710 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963590.1:L-lactate dehydrogenase 991 2409 gene locus_tag LOCUS_09720 gene fumC 991 2409 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456610.1 protein_id gnl|my_center|LOCUS_09720 1677 1727 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2568 3359 gene locus_tag LOCUS_09730 2568 3359 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_09730 3352 3747 gene locus_tag LOCUS_09740 3352 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 3760 5808 gene locus_tag LOCUS_09750 3760 5808 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939674.1 protein_id gnl|my_center|LOCUS_09750 4872 4902 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5836 6237 gene locus_tag LOCUS_09760 5836 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 6199 6215 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6296 7282 gene locus_tag LOCUS_09770 6296 7282 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392333.1 protein_id gnl|my_center|LOCUS_09770 7282 8319 gene locus_tag LOCUS_09780 7282 8319 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_09780 8319 9149 gene locus_tag LOCUS_09790 8319 9149 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392335.1 protein_id gnl|my_center|LOCUS_09790 9443 10129 gene locus_tag LOCUS_09800 9443 10129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 10150 11793 gene locus_tag LOCUS_09810 10150 11793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 11947 12195 gene locus_tag LOCUS_09820 11947 12195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 <13226 12198 gene locus_tag LOCUS_09830 <13226 12198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_039851544.1:glycosyltransferase family 1 protein >Feature sequence057 <1 619 gene locus_tag LOCUS_09840 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002667114.1:FapA family protein 622 951 gene locus_tag LOCUS_09850 622 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 956 1669 gene locus_tag LOCUS_09860 956 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 1666 2727 gene locus_tag LOCUS_09870 1666 2727 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668712.1 protein_id gnl|my_center|LOCUS_09870 2899 3519 gene locus_tag LOCUS_09880 2899 3519 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678965.1 protein_id gnl|my_center|LOCUS_09880 3976 4032 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4104 4991 gene locus_tag LOCUS_09890 4104 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09890 5016 5873 gene locus_tag LOCUS_09900 5016 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09900 5873 7213 gene locus_tag LOCUS_09910 5873 7213 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669361.1 protein_id gnl|my_center|LOCUS_09910 6376 6422 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7232 7861 gene locus_tag LOCUS_09920 7232 7861 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679385.1 protein_id gnl|my_center|LOCUS_09920 7858 9783 gene locus_tag LOCUS_09930 7858 9783 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003276.1 protein_id gnl|my_center|LOCUS_09930 9801 10223 gene locus_tag LOCUS_09940 9801 10223 CDS product ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669353.1 protein_id gnl|my_center|LOCUS_09940 10496 12559 gene locus_tag LOCUS_09950 10496 12559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 >Feature sequence058 207 1583 gene locus_tag LOCUS_09960 207 1583 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680439.1 protein_id gnl|my_center|LOCUS_09960 1858 3441 gene locus_tag LOCUS_09970 1858 3441 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680556.1 protein_id gnl|my_center|LOCUS_09970 3574 4197 gene locus_tag LOCUS_09980 3574 4197 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429111.1 protein_id gnl|my_center|LOCUS_09980 4333 4246 gene locus_tag LOCUS_t00110 4333 4246 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4517 5335 gene locus_tag LOCUS_09990 4517 5335 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679808.1 protein_id gnl|my_center|LOCUS_09990 5818 5315 gene locus_tag LOCUS_10000 5818 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 6056 5862 gene locus_tag LOCUS_10010 6056 5862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 6421 6053 gene locus_tag LOCUS_10020 6421 6053 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675753.1 protein_id gnl|my_center|LOCUS_10020 6722 6459 gene locus_tag LOCUS_10030 6722 6459 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545507.1 protein_id gnl|my_center|LOCUS_10030 7822 6719 gene locus_tag LOCUS_10040 7822 6719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 8305 7835 gene locus_tag LOCUS_10050 gene rplS 8305 7835 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670222.1 protein_id gnl|my_center|LOCUS_10050 9122 8358 gene locus_tag LOCUS_10060 gene trmD 9122 8358 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670221.1 protein_id gnl|my_center|LOCUS_10060 9707 9126 gene locus_tag LOCUS_10070 gene rimM 9707 9126 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002664616.1 protein_id gnl|my_center|LOCUS_10070 9949 9716 gene locus_tag LOCUS_10080 9949 9716 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670215.1 protein_id gnl|my_center|LOCUS_10080 10216 9965 gene locus_tag LOCUS_10090 gene rpsP 10216 9965 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670213.1 protein_id gnl|my_center|LOCUS_10090 11127 10363 gene locus_tag LOCUS_10100 11127 10363 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016658.1 protein_id gnl|my_center|LOCUS_10100 11817 11137 gene locus_tag LOCUS_10110 11817 11137 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002940990.1 protein_id gnl|my_center|LOCUS_10110 12694 11888 gene locus_tag LOCUS_10120 12694 11888 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811433.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence059 <1 1056 gene locus_tag LOCUS_10130 <1 1056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009888533.1:formate--tetrahydrofolate ligase 2257 1175 gene locus_tag LOCUS_10140 2257 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 3596 2511 gene locus_tag LOCUS_10150 3596 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 4546 3821 gene locus_tag LOCUS_10160 4546 3821 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232924.1 protein_id gnl|my_center|LOCUS_10160 5946 4609 gene locus_tag LOCUS_10170 5946 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 6879 5950 gene locus_tag LOCUS_10180 6879 5950 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676765.1 protein_id gnl|my_center|LOCUS_10180 7258 6869 gene locus_tag LOCUS_10190 7258 6869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672736.1 protein_id gnl|my_center|LOCUS_10190 7501 9033 gene locus_tag LOCUS_10200 7501 9033 CDS product DUF5312 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680918.1 protein_id gnl|my_center|LOCUS_10200 11019 9043 gene locus_tag LOCUS_10210 11019 9043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 11021 11082 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12056 11148 gene locus_tag LOCUS_10220 12056 11148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 12103 12759 gene locus_tag LOCUS_10230 gene pth 12103 12759 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672368.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence060 559 2484 gene locus_tag LOCUS_10240 559 2484 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957030.1 protein_id gnl|my_center|LOCUS_10240 3966 2611 gene locus_tag LOCUS_10250 3966 2611 CDS product small ribosomal subunit Rsm22 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680936.1 protein_id gnl|my_center|LOCUS_10250 4324 4007 gene locus_tag LOCUS_10260 4324 4007 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680938.1 protein_id gnl|my_center|LOCUS_10260 5859 4324 gene locus_tag LOCUS_10270 gene der 5859 4324 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680939.1 protein_id gnl|my_center|LOCUS_10270 7691 5970 gene locus_tag LOCUS_10280 gene ptsP 7691 5970 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431795.1 protein_id gnl|my_center|LOCUS_10280 7884 7812 gene locus_tag LOCUS_t00120 7884 7812 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9800 7968 gene locus_tag LOCUS_10290 gene glmS 9800 7968 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931824.1 protein_id gnl|my_center|LOCUS_10290 12811 10391 gene locus_tag LOCUS_10300 12811 10391 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682327.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence061 <1 838 gene locus_tag LOCUS_10310 <1 838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_044977758.1:SUMF1/EgtB/PvdO family nonheme iron enzyme 1565 888 gene locus_tag LOCUS_10320 1565 888 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680480.1 protein_id gnl|my_center|LOCUS_10320 2721 1573 gene locus_tag LOCUS_10330 gene hisC 2721 1573 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208421.1 protein_id gnl|my_center|LOCUS_10330 2864 4765 gene locus_tag LOCUS_10340 2864 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681756.1 protein_id gnl|my_center|LOCUS_10340 4924 5370 gene locus_tag LOCUS_10350 gene ssb 4924 5370 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879973.1 protein_id gnl|my_center|LOCUS_10350 7683 5380 gene locus_tag LOCUS_10360 7683 5380 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680923.1 protein_id gnl|my_center|LOCUS_10360 8745 7717 gene locus_tag LOCUS_10370 8745 7717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 9285 9390 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10131 9877 gene locus_tag LOCUS_10380 10131 9877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 10359 10153 gene locus_tag LOCUS_10390 10359 10153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 10313 10738 gene locus_tag LOCUS_10400 10313 10738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 11364 10735 gene locus_tag LOCUS_10410 11364 10735 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680767.1 protein_id gnl|my_center|LOCUS_10410 <12779 11361 gene locus_tag LOCUS_10420 <12779 11361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682402.1:tetratricopeptide repeat protein >Feature sequence062 14 223 gene locus_tag LOCUS_10430 14 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 255 417 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1522 572 gene locus_tag LOCUS_10440 1522 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 2682 1702 gene locus_tag LOCUS_10450 2682 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 3292 2828 gene locus_tag LOCUS_10460 3292 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 3446 4153 gene locus_tag LOCUS_10470 3446 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 4184 4531 gene locus_tag LOCUS_10480 4184 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 4546 5376 gene locus_tag LOCUS_10490 4546 5376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 5446 6471 gene locus_tag LOCUS_10500 5446 6471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 7170 6478 gene locus_tag LOCUS_10510 7170 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 7413 7213 gene locus_tag LOCUS_10520 7413 7213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 7343 8410 gene locus_tag LOCUS_10530 7343 8410 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121735.1 protein_id gnl|my_center|LOCUS_10530 8423 9748 gene locus_tag LOCUS_10540 8423 9748 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121734.1 protein_id gnl|my_center|LOCUS_10540 10778 9741 gene locus_tag LOCUS_10550 10778 9741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 11247 11291 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11323 11721 gene locus_tag LOCUS_10560 11323 11721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 11732 12445 gene locus_tag LOCUS_10570 11732 12445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 12404 12439 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence063 <1 2496 gene locus_tag LOCUS_10580 <1 2496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889758.1:membrane protein 166 225 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2613 4040 gene locus_tag LOCUS_10590 2613 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 5221 4037 gene locus_tag LOCUS_10600 gene ispD 5221 4037 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546162.1 protein_id gnl|my_center|LOCUS_10600 5897 5211 gene locus_tag LOCUS_10610 5897 5211 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680200.1 protein_id gnl|my_center|LOCUS_10610 6082 8184 gene locus_tag LOCUS_10620 6082 8184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 9722 8274 gene locus_tag LOCUS_10630 9722 8274 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679249.1 protein_id gnl|my_center|LOCUS_10630 9892 10101 gene locus_tag LOCUS_10640 9892 10101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 10104 12194 gene locus_tag LOCUS_10650 10104 12194 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681568.1 protein_id gnl|my_center|LOCUS_10650 12207 12524 gene locus_tag LOCUS_10660 12207 12524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 >Feature sequence064 187 1575 gene locus_tag LOCUS_10670 187 1575 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678992.1 protein_id gnl|my_center|LOCUS_10670 1583 3517 gene locus_tag LOCUS_10680 1583 3517 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678989.1 protein_id gnl|my_center|LOCUS_10680 3532 4506 gene locus_tag LOCUS_10690 gene galE 3532 4506 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931718.1 protein_id gnl|my_center|LOCUS_10690 4521 5774 gene locus_tag LOCUS_10700 4521 5774 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680921.1 protein_id gnl|my_center|LOCUS_10700 4596 4640 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5810 5854 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6948 5878 gene locus_tag LOCUS_10710 6948 5878 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680111.1 protein_id gnl|my_center|LOCUS_10710 8054 6957 gene locus_tag LOCUS_10720 8054 6957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 8571 8008 gene locus_tag LOCUS_10730 8571 8008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 8083 8099 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8661 10010 gene locus_tag LOCUS_10740 gene aroA 8661 10010 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679391.1 protein_id gnl|my_center|LOCUS_10740 10201 11241 gene locus_tag LOCUS_10750 10201 11241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 12269 11247 gene locus_tag LOCUS_10760 12269 11247 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680574.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence065 333 2630 gene locus_tag LOCUS_10770 gene pflB 333 2630 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289265.1 protein_id gnl|my_center|LOCUS_10770 4358 2778 gene locus_tag LOCUS_10780 gene gltX 4358 2778 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681104.1 protein_id gnl|my_center|LOCUS_10780 4581 5387 gene locus_tag LOCUS_10790 4581 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 5472 6218 gene locus_tag LOCUS_10800 gene pflA 5472 6218 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289264.1 protein_id gnl|my_center|LOCUS_10800 7895 6243 gene locus_tag LOCUS_10810 7895 6243 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326733.1 protein_id gnl|my_center|LOCUS_10810 9069 7900 gene locus_tag LOCUS_10820 9069 7900 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861434.1 protein_id gnl|my_center|LOCUS_10820 9989 9108 gene locus_tag LOCUS_10830 gene argB 9989 9108 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459300.1 protein_id gnl|my_center|LOCUS_10830 9759 9791 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11330 10116 gene locus_tag LOCUS_10840 gene argJ 11330 10116 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_10840 10133 10157 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence066 <1 1175 gene locus_tag LOCUS_10850 <1 1175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681815.1:molecular chaperone DnaK 1366 2508 gene locus_tag LOCUS_10860 gene dnaJ 1366 2508 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002686888.1 protein_id gnl|my_center|LOCUS_10860 2740 4131 gene locus_tag LOCUS_10870 2740 4131 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672386.1 protein_id gnl|my_center|LOCUS_10870 4133 6412 gene locus_tag LOCUS_10880 4133 6412 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681817.1 protein_id gnl|my_center|LOCUS_10880 6519 6845 gene locus_tag LOCUS_10890 6519 6845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 6853 7644 gene locus_tag LOCUS_10900 6853 7644 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407737.1 protein_id gnl|my_center|LOCUS_10900 10312 7760 gene locus_tag LOCUS_10910 gene leuS 10312 7760 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680258.1 protein_id gnl|my_center|LOCUS_10910 11782 10331 gene locus_tag LOCUS_10920 11782 10331 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681057.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence067 2058 676 gene locus_tag LOCUS_10930 2058 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 2551 2060 gene locus_tag LOCUS_10940 2551 2060 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678972.1 protein_id gnl|my_center|LOCUS_10940 2291 2301 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2623 3468 gene locus_tag LOCUS_10950 2623 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 3461 3823 gene locus_tag LOCUS_10960 3461 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 3820 4725 gene locus_tag LOCUS_10970 3820 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679695.1 protein_id gnl|my_center|LOCUS_10970 4227 4293 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5816 4722 gene locus_tag LOCUS_10980 gene pcnB 5816 4722 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669419.1 protein_id gnl|my_center|LOCUS_10980 6782 5832 gene locus_tag LOCUS_10990 6782 5832 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679981.1 protein_id gnl|my_center|LOCUS_10990 6830 8038 gene locus_tag LOCUS_11000 gene rlmD 6830 8038 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_11000 8050 9888 gene locus_tag LOCUS_11010 8050 9888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 9758 9779 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9930 11507 gene locus_tag LOCUS_11020 9930 11507 CDS product P83/100 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680732.1 protein_id gnl|my_center|LOCUS_11020 >Feature sequence068 <1 2438 gene locus_tag LOCUS_11030 <1 2438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209237.1:bifunctional aspartate kinase/homoserine dehydrogenase I 2519 3010 gene locus_tag LOCUS_11040 gene ilvN 2519 3010 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 protein_id gnl|my_center|LOCUS_11040 3609 3028 gene locus_tag LOCUS_11050 3609 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 3656 4876 gene locus_tag LOCUS_11060 3656 4876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 4837 4849 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4888 5514 gene locus_tag LOCUS_11070 4888 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 6068 5511 gene locus_tag LOCUS_11080 6068 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678723.1 protein_id gnl|my_center|LOCUS_11080 6751 6068 gene locus_tag LOCUS_11090 6751 6068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 6806 7627 gene locus_tag LOCUS_11100 gene murI 6806 7627 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679098.1 protein_id gnl|my_center|LOCUS_11100 7652 8581 gene locus_tag LOCUS_11110 7652 8581 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11110 9222 8998 gene locus_tag LOCUS_11120 9222 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 9312 10535 gene locus_tag LOCUS_11130 9312 10535 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940837.1 protein_id gnl|my_center|LOCUS_11130 >Feature sequence069 233 1999 gene locus_tag LOCUS_11140 233 1999 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682136.1 protein_id gnl|my_center|LOCUS_11140 2284 4062 gene locus_tag LOCUS_11150 2284 4062 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679748.1 protein_id gnl|my_center|LOCUS_11150 4085 4666 gene locus_tag LOCUS_11160 4085 4666 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669823.1 protein_id gnl|my_center|LOCUS_11160 5516 4677 gene locus_tag LOCUS_11170 5516 4677 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678797.1 protein_id gnl|my_center|LOCUS_11170 6229 5603 gene locus_tag LOCUS_11180 6229 5603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11180 6845 6300 gene locus_tag LOCUS_11190 6845 6300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11190 6325 6349 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7661 6858 gene locus_tag LOCUS_11200 7661 6858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668611.1 protein_id gnl|my_center|LOCUS_11200 9355 7661 gene locus_tag LOCUS_11210 gene recN 9355 7661 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678799.1 protein_id gnl|my_center|LOCUS_11210 9978 9331 gene locus_tag LOCUS_11220 9978 9331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11220 9360 9370 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9989 10036 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11369 10251 gene locus_tag LOCUS_11230 11369 10251 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679269.1 protein_id gnl|my_center|LOCUS_11230 >Feature sequence070 553 831 gene locus_tag LOCUS_11240 553 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 831 1118 gene locus_tag LOCUS_11250 831 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 1115 1306 gene locus_tag LOCUS_11260 1115 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1494 1778 gene locus_tag LOCUS_11270 1494 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 2104 2571 gene locus_tag LOCUS_11280 2104 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2835 3041 gene locus_tag LOCUS_11290 2835 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 3384 4076 gene locus_tag LOCUS_11300 3384 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 4156 4605 gene locus_tag LOCUS_11310 4156 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 4699 5445 gene locus_tag LOCUS_11320 4699 5445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 5546 5926 gene locus_tag LOCUS_11330 5546 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 6728 7075 gene locus_tag LOCUS_11340 6728 7075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 7268 7654 gene locus_tag LOCUS_11350 7268 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 7691 8053 gene locus_tag LOCUS_11360 7691 8053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 8343 8383 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9500 8694 gene locus_tag LOCUS_11370 9500 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 10659 9991 gene locus_tag LOCUS_11380 10659 9991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 >Feature sequence071 <1 1370 gene locus_tag LOCUS_11390 <1 1370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679921.1:GldG family protein 1367 2320 gene locus_tag LOCUS_11400 1367 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 1381 1435 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2979 3016 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3092 4342 gene locus_tag LOCUS_11410 3092 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 4088 4106 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4354 5037 gene locus_tag LOCUS_11420 4354 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 4990 5031 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5069 5569 gene locus_tag LOCUS_11430 5069 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 5563 6000 gene locus_tag LOCUS_11440 5563 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 6071 6826 gene locus_tag LOCUS_11450 6071 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 6877 6922 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7044 8348 gene locus_tag LOCUS_11460 7044 8348 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671452.1 protein_id gnl|my_center|LOCUS_11460 9954 8536 gene locus_tag LOCUS_11470 gene thrC 9954 8536 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680037.1 protein_id gnl|my_center|LOCUS_11470 11070 10042 gene locus_tag LOCUS_11480 11070 10042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence072 1448 441 gene locus_tag LOCUS_11490 1448 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 3242 1461 gene locus_tag LOCUS_11500 3242 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 4388 3297 gene locus_tag LOCUS_11510 4388 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 4504 4812 gene locus_tag LOCUS_11520 4504 4812 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667543.1 protein_id gnl|my_center|LOCUS_11520 5896 4832 gene locus_tag LOCUS_11530 5896 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 6684 5893 gene locus_tag LOCUS_11540 6684 5893 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367330.1 protein_id gnl|my_center|LOCUS_11540 6510 6547 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7724 6681 gene locus_tag LOCUS_11550 7724 6681 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627760.1 protein_id gnl|my_center|LOCUS_11550 8232 7687 gene locus_tag LOCUS_11560 8232 7687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 9207 8320 gene locus_tag LOCUS_11570 9207 8320 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680667.1 protein_id gnl|my_center|LOCUS_11570 9352 9609 gene locus_tag LOCUS_11580 9352 9609 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_11580 9709 9838 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence073 1022 303 gene locus_tag LOCUS_11590 1022 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 2569 1067 gene locus_tag LOCUS_11600 2569 1067 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681013.1 protein_id gnl|my_center|LOCUS_11600 3607 2585 gene locus_tag LOCUS_11610 3607 2585 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681007.1 protein_id gnl|my_center|LOCUS_11610 4070 6898 gene locus_tag LOCUS_11620 gene polA 4070 6898 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679321.1 protein_id gnl|my_center|LOCUS_11620 6895 7443 gene locus_tag LOCUS_11630 gene coaE 6895 7443 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438041.1 protein_id gnl|my_center|LOCUS_11630 7530 8411 gene locus_tag LOCUS_11640 7530 8411 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679323.1 protein_id gnl|my_center|LOCUS_11640 8547 9920 gene locus_tag LOCUS_11650 8547 9920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 9982 10785 gene locus_tag LOCUS_11660 9982 10785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11660 >Feature sequence074 969 2804 gene locus_tag LOCUS_11670 969 2804 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680776.1 protein_id gnl|my_center|LOCUS_11670 2798 4912 gene locus_tag LOCUS_11680 2798 4912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681085.1 protein_id gnl|my_center|LOCUS_11680 5424 4966 gene locus_tag LOCUS_11690 5424 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11690 5753 5307 gene locus_tag LOCUS_11700 5753 5307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11700 5323 5332 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6094 5717 gene locus_tag LOCUS_11710 6094 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11710 5758 5776 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6357 6890 gene locus_tag LOCUS_11720 6357 6890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666906.1 protein_id gnl|my_center|LOCUS_11720 6900 8162 gene locus_tag LOCUS_11730 6900 8162 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583659.1 protein_id gnl|my_center|LOCUS_11730 9218 8133 gene locus_tag LOCUS_11740 9218 8133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 10806 9220 gene locus_tag LOCUS_11750 gene modF 10806 9220 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097518.1 protein_id gnl|my_center|LOCUS_11750 9520 9551 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence075 5158 2084 gene locus_tag LOCUS_11760 5158 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 5787 5206 gene locus_tag LOCUS_11770 5787 5206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 5666 5714 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6746 5784 gene locus_tag LOCUS_11780 6746 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 7377 6781 gene locus_tag LOCUS_11790 7377 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 8423 7380 gene locus_tag LOCUS_11800 8423 7380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 9073 8498 gene locus_tag LOCUS_11810 9073 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 9450 9070 gene locus_tag LOCUS_11820 9450 9070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 9108 9122 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9698 10207 gene locus_tag LOCUS_11830 9698 10207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 >Feature sequence076 177 1208 gene locus_tag LOCUS_11840 177 1208 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_11840 1241 2440 gene locus_tag LOCUS_11850 1241 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 3714 2437 gene locus_tag LOCUS_11860 3714 2437 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_11860 3756 3974 gene locus_tag LOCUS_11870 3756 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11870 4004 5056 gene locus_tag LOCUS_11880 4004 5056 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_11880 5183 5455 gene locus_tag LOCUS_11890 5183 5455 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 protein_id gnl|my_center|LOCUS_11890 5533 5751 gene locus_tag LOCUS_11900 5533 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11900 6346 6182 gene locus_tag LOCUS_11910 6346 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 6577 6356 gene locus_tag LOCUS_11920 6577 6356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 6841 6671 gene locus_tag LOCUS_11930 6841 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 7991 6822 gene locus_tag LOCUS_11940 7991 6822 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104822.1 protein_id gnl|my_center|LOCUS_11940 9223 8135 gene locus_tag LOCUS_11950 9223 8135 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948401.1 protein_id gnl|my_center|LOCUS_11950 9526 10473 gene locus_tag LOCUS_11960 gene argC 9526 10473 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197909.1 protein_id gnl|my_center|LOCUS_11960 >Feature sequence077 1439 666 gene locus_tag LOCUS_11970 1439 666 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680465.1 protein_id gnl|my_center|LOCUS_11970 1521 3263 gene locus_tag LOCUS_11980 1521 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668497.1 protein_id gnl|my_center|LOCUS_11980 3273 4409 gene locus_tag LOCUS_11990 3273 4409 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438374.1 protein_id gnl|my_center|LOCUS_11990 5556 4378 gene locus_tag LOCUS_12000 gene thiI 5556 4378 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680552.1 protein_id gnl|my_center|LOCUS_12000 6508 5594 gene locus_tag LOCUS_12010 6508 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 6732 9947 gene locus_tag LOCUS_12020 gene ileS 6732 9947 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680710.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence078 282 76 gene locus_tag LOCUS_12030 282 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 773 279 gene locus_tag LOCUS_12040 773 279 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803082.1 protein_id gnl|my_center|LOCUS_12040 985 770 gene locus_tag LOCUS_12050 985 770 CDS product DUF3791 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433743.1 protein_id gnl|my_center|LOCUS_12050 1538 1149 gene locus_tag LOCUS_12060 1538 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 2028 1738 gene locus_tag LOCUS_12070 2028 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 3437 2241 gene locus_tag LOCUS_12080 3437 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 3626 4177 gene locus_tag LOCUS_12090 3626 4177 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678895.1 protein_id gnl|my_center|LOCUS_12090 4346 5749 gene locus_tag LOCUS_12100 gene tilS 4346 5749 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678896.1 protein_id gnl|my_center|LOCUS_12100 5764 7866 gene locus_tag LOCUS_12110 5764 7866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 7856 9481 gene locus_tag LOCUS_12120 7856 9481 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678901.1 protein_id gnl|my_center|LOCUS_12120 9927 9960 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence079 <1 590 gene locus_tag LOCUS_12130 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002669995.1:50S ribosomal protein L3 602 1240 gene locus_tag LOCUS_12140 gene rplD 602 1240 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669996.1 protein_id gnl|my_center|LOCUS_12140 1240 1524 gene locus_tag LOCUS_12150 1240 1524 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672216.1 protein_id gnl|my_center|LOCUS_12150 1553 2377 gene locus_tag LOCUS_12160 gene rplB 1553 2377 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669998.1 protein_id gnl|my_center|LOCUS_12160 2395 2679 gene locus_tag LOCUS_12170 gene rpsS 2395 2679 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669999.1 protein_id gnl|my_center|LOCUS_12170 2692 3048 gene locus_tag LOCUS_12180 gene rplV 2692 3048 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670000.1 protein_id gnl|my_center|LOCUS_12180 3050 3799 gene locus_tag LOCUS_12190 gene rpsC 3050 3799 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670002.1 protein_id gnl|my_center|LOCUS_12190 3803 4222 gene locus_tag LOCUS_12200 gene rplP 3803 4222 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670003.1 protein_id gnl|my_center|LOCUS_12200 4234 4446 gene locus_tag LOCUS_12210 gene rpmC 4234 4446 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670007.1 protein_id gnl|my_center|LOCUS_12210 4457 4732 gene locus_tag LOCUS_12220 gene rpsQ 4457 4732 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670009.1 protein_id gnl|my_center|LOCUS_12220 4751 5119 gene locus_tag LOCUS_12230 gene rplN 4751 5119 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670011.1 protein_id gnl|my_center|LOCUS_12230 5126 5449 gene locus_tag LOCUS_12240 gene rplX 5126 5449 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670017.1 protein_id gnl|my_center|LOCUS_12240 5449 6000 gene locus_tag LOCUS_12250 gene rplE 5449 6000 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670018.1 protein_id gnl|my_center|LOCUS_12250 6013 6198 gene locus_tag LOCUS_12260 6013 6198 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557082.1 protein_id gnl|my_center|LOCUS_12260 6216 6614 gene locus_tag LOCUS_12270 gene rpsH 6216 6614 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670022.1 protein_id gnl|my_center|LOCUS_12270 6627 7166 gene locus_tag LOCUS_12280 gene rplF 6627 7166 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670023.1 protein_id gnl|my_center|LOCUS_12280 7178 7540 gene locus_tag LOCUS_12290 gene rplR 7178 7540 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670026.1 protein_id gnl|my_center|LOCUS_12290 7549 8061 gene locus_tag LOCUS_12300 gene rpsE 7549 8061 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670027.1 protein_id gnl|my_center|LOCUS_12300 8064 8255 gene locus_tag LOCUS_12310 gene rpmD 8064 8255 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129921.1 protein_id gnl|my_center|LOCUS_12310 8255 8731 gene locus_tag LOCUS_12320 gene rplO 8255 8731 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682039.1 protein_id gnl|my_center|LOCUS_12320 8748 10082 gene locus_tag LOCUS_12330 gene secY 8748 10082 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670031.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence080 2503 1382 gene locus_tag LOCUS_12340 2503 1382 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583291.1 protein_id gnl|my_center|LOCUS_12340 3855 2515 gene locus_tag LOCUS_12350 3855 2515 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739314.1 protein_id gnl|my_center|LOCUS_12350 4491 3859 gene locus_tag LOCUS_12360 gene gmhA 4491 3859 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351733.1 protein_id gnl|my_center|LOCUS_12360 4860 4510 gene locus_tag LOCUS_12370 4860 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12370 5527 4853 gene locus_tag LOCUS_12380 5527 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12380 4864 4902 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6620 5559 gene locus_tag LOCUS_12390 6620 5559 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582745.1 protein_id gnl|my_center|LOCUS_12390 6701 8440 gene locus_tag LOCUS_12400 6701 8440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence081 1960 80 gene locus_tag LOCUS_12410 gene guaA 1960 80 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234667.1 protein_id gnl|my_center|LOCUS_12410 2818 2222 gene locus_tag LOCUS_12420 2818 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 2790 2990 gene locus_tag LOCUS_12430 2790 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 2997 3434 gene locus_tag LOCUS_12440 2997 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 4190 3534 gene locus_tag LOCUS_12450 4190 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12450 4995 4183 gene locus_tag LOCUS_12460 4995 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12460 4198 4219 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5227 6465 gene locus_tag LOCUS_12470 5227 6465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12470 5978 6029 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6398 7036 gene locus_tag LOCUS_12480 6398 7036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12480 6402 6449 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7284 8972 gene locus_tag LOCUS_12490 gene leuA 7284 8972 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933761.1 protein_id gnl|my_center|LOCUS_12490 8976 10058 gene locus_tag LOCUS_12500 8976 10058 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613385.1 protein_id gnl|my_center|LOCUS_12500 >Feature sequence082 <1 1371 gene locus_tag LOCUS_12510 <1 1371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682106.1:DUF4954 family protein 1427 4279 gene locus_tag LOCUS_12520 gene uvrA 1427 4279 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956862.1 protein_id gnl|my_center|LOCUS_12520 4286 7621 gene locus_tag LOCUS_12530 4286 7621 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682325.1 protein_id gnl|my_center|LOCUS_12530 7680 8603 gene locus_tag LOCUS_12540 7680 8603 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678733.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence083 914 927 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 943 2406 gene locus_tag LOCUS_12550 943 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 2481 7862 gene locus_tag LOCUS_12560 2481 7862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 8422 7955 gene locus_tag LOCUS_12570 8422 7955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 8795 8415 gene locus_tag LOCUS_12580 8795 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 9004 8792 gene locus_tag LOCUS_12590 9004 8792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 9494 9156 gene locus_tag LOCUS_12600 9494 9156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence084 377 395 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 476 1216 gene locus_tag LOCUS_12610 476 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12610 1252 2838 gene locus_tag LOCUS_12620 1252 2838 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680053.1 protein_id gnl|my_center|LOCUS_12620 2835 3869 gene locus_tag LOCUS_12630 2835 3869 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679426.1 protein_id gnl|my_center|LOCUS_12630 3866 4333 gene locus_tag LOCUS_12640 3866 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 4432 5511 gene locus_tag LOCUS_12650 4432 5511 CDS product flagellar filament outer layer protein FlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670927.1 protein_id gnl|my_center|LOCUS_12650 5603 6871 gene locus_tag LOCUS_12660 5603 6871 CDS product RelA/SpoT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679418.1 protein_id gnl|my_center|LOCUS_12660 7009 7082 gene locus_tag LOCUS_t00130 7009 7082 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7152 9296 gene locus_tag LOCUS_12670 7152 9296 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679730.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence085 454 2283 gene locus_tag LOCUS_12680 454 2283 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880932.1 protein_id gnl|my_center|LOCUS_12680 2292 3398 gene locus_tag LOCUS_12690 2292 3398 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880275.1 protein_id gnl|my_center|LOCUS_12690 3405 5372 gene locus_tag LOCUS_12700 3405 5372 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385805.1 protein_id gnl|my_center|LOCUS_12700 5675 7237 gene locus_tag LOCUS_12710 gene malQ 5675 7237 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680318.1 protein_id gnl|my_center|LOCUS_12710 7403 8329 gene locus_tag LOCUS_12720 7403 8329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 8631 9281 gene locus_tag LOCUS_12730 8631 9281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 >Feature sequence086 <1 977 gene locus_tag LOCUS_12740 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458936.1:ATP-binding protein 2352 1006 gene locus_tag LOCUS_12750 2352 1006 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_12750 3521 2790 gene locus_tag LOCUS_12760 3521 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 3667 3518 gene locus_tag LOCUS_12770 3667 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 4002 3817 gene locus_tag LOCUS_12780 4002 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 4492 3995 gene locus_tag LOCUS_12790 4492 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 6166 4604 gene locus_tag LOCUS_12800 6166 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 7467 6157 gene locus_tag LOCUS_12810 gene carA 7467 6157 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005020950.1 protein_id gnl|my_center|LOCUS_12810 7944 7480 gene locus_tag LOCUS_12820 7944 7480 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760630.1 protein_id gnl|my_center|LOCUS_12820 >Feature sequence087 745 38 gene locus_tag LOCUS_12830 745 38 CDS product tRNA 2-thiocytidine biosynthesis TtcA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666040.1 protein_id gnl|my_center|LOCUS_12830 1323 742 gene locus_tag LOCUS_12840 1323 742 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263803.1 protein_id gnl|my_center|LOCUS_12840 2372 1347 gene locus_tag LOCUS_12850 2372 1347 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_12850 2668 3639 gene locus_tag LOCUS_12860 gene hflK 2668 3639 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_12860 3643 4629 gene locus_tag LOCUS_12870 gene hflC 3643 4629 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_12870 4635 6230 gene locus_tag LOCUS_12880 4635 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 6353 7843 gene locus_tag LOCUS_12890 6353 7843 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_12890 8417 7959 gene locus_tag LOCUS_12900 8417 7959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 8676 9731 gene locus_tag LOCUS_12910 8676 9731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence088 <1 556 gene locus_tag LOCUS_12920 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002671073.1:uracil phosphoribosyltransferase 560 1048 gene locus_tag LOCUS_12930 560 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12930 984 1027 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2552 1215 gene locus_tag LOCUS_12940 2552 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 3009 2557 gene locus_tag LOCUS_12950 3009 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 3044 3244 gene locus_tag LOCUS_12960 3044 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 4109 3141 gene locus_tag LOCUS_12970 4109 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12970 3147 3163 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5592 4117 gene locus_tag LOCUS_12980 5592 4117 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679115.1 protein_id gnl|my_center|LOCUS_12980 8062 5672 gene locus_tag LOCUS_12990 8062 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679117.1 protein_id gnl|my_center|LOCUS_12990 8187 8744 gene locus_tag LOCUS_13000 8187 8744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 8725 9282 gene locus_tag LOCUS_13010 8725 9282 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679118.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence089 109 212 gene locus_tag LOCUS_r00020 109 212 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1975 245 gene locus_tag LOCUS_13020 gene ade 1975 245 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964205.1 protein_id gnl|my_center|LOCUS_13020 2217 1996 gene locus_tag LOCUS_13030 2217 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 2510 3280 gene locus_tag LOCUS_13040 2510 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 3346 3963 gene locus_tag LOCUS_13050 3346 3963 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_13050 4079 5026 gene locus_tag LOCUS_13060 4079 5026 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_13060 5093 6124 gene locus_tag LOCUS_13070 5093 6124 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549276.1 protein_id gnl|my_center|LOCUS_13070 6148 6933 gene locus_tag LOCUS_13080 6148 6933 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289388.1 protein_id gnl|my_center|LOCUS_13080 7158 7460 gene locus_tag LOCUS_13090 7158 7460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 7483 8160 gene locus_tag LOCUS_13100 7483 8160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 8594 8211 gene locus_tag LOCUS_13110 8594 8211 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_13110 9383 8715 gene locus_tag LOCUS_13120 9383 8715 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence090 162 968 gene locus_tag LOCUS_13130 gene fliR 162 968 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673318.1 protein_id gnl|my_center|LOCUS_13130 968 2062 gene locus_tag LOCUS_13140 gene flhB 968 2062 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680909.1 protein_id gnl|my_center|LOCUS_13140 2819 2911 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2915 3061 gene locus_tag LOCUS_13150 2915 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 3122 4285 gene locus_tag LOCUS_13160 3122 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13160 4287 5561 gene locus_tag LOCUS_13170 4287 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 5680 5710 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5748 6488 gene locus_tag LOCUS_13180 5748 6488 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680723.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13180 6581 7345 gene locus_tag LOCUS_13190 6581 7345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 7362 8189 gene locus_tag LOCUS_13200 gene whiG 7362 8189 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667112.1 protein_id gnl|my_center|LOCUS_13200 >Feature sequence091 886 3681 gene locus_tag LOCUS_13210 886 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 4324 3632 gene locus_tag LOCUS_13220 4324 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 4473 4399 gene locus_tag LOCUS_t00140 4473 4399 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 7714 4544 gene locus_tag LOCUS_13230 7714 4544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 8884 7805 gene locus_tag LOCUS_13240 8884 7805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 8183 8202 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9429 8983 gene locus_tag LOCUS_13250 9429 8983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence092 46 129 gene locus_tag LOCUS_t00150 46 129 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 264 1211 gene locus_tag LOCUS_13260 264 1211 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669065.1 protein_id gnl|my_center|LOCUS_13260 1208 1402 gene locus_tag LOCUS_13270 1208 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 1399 2448 gene locus_tag LOCUS_13280 gene mltG 1399 2448 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671179.1 protein_id gnl|my_center|LOCUS_13280 2452 4239 gene locus_tag LOCUS_13290 gene dnaG 2452 4239 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678905.1 protein_id gnl|my_center|LOCUS_13290 4265 6046 gene locus_tag LOCUS_13300 gene rpoD 4265 6046 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678907.1 protein_id gnl|my_center|LOCUS_13300 6127 7032 gene locus_tag LOCUS_13310 6127 7032 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671470.1 protein_id gnl|my_center|LOCUS_13310 7523 8395 gene locus_tag LOCUS_13320 7523 8395 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678909.1 protein_id gnl|my_center|LOCUS_13320 9034 9071 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence093 1335 691 gene locus_tag LOCUS_13330 1335 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 2608 1394 gene locus_tag LOCUS_13340 gene fliN 2608 1394 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680828.1 protein_id gnl|my_center|LOCUS_13340 3639 2605 gene locus_tag LOCUS_13350 gene fliM 3639 2605 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666990.1 protein_id gnl|my_center|LOCUS_13350 4212 3667 gene locus_tag LOCUS_13360 4212 3667 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666989.1 protein_id gnl|my_center|LOCUS_13360 5052 4324 gene locus_tag LOCUS_13370 gene motB 5052 4324 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666988.1 protein_id gnl|my_center|LOCUS_13370 5851 5069 gene locus_tag LOCUS_13380 5851 5069 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666986.1 protein_id gnl|my_center|LOCUS_13380 6103 5852 gene locus_tag LOCUS_13390 6103 5852 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680829.1 protein_id gnl|my_center|LOCUS_13390 7460 6288 gene locus_tag LOCUS_13400 gene hemW 7460 6288 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964591.1 protein_id gnl|my_center|LOCUS_13400 8161 7463 gene locus_tag LOCUS_13410 gene lepB 8161 7463 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668934.1 protein_id gnl|my_center|LOCUS_13410 8228 8692 gene locus_tag LOCUS_13420 gene smpB 8228 8692 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668932.1 protein_id gnl|my_center|LOCUS_13420 9063 9079 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence094 146 200 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1881 400 gene locus_tag LOCUS_13430 1881 400 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062419932.1 protein_id gnl|my_center|LOCUS_13430 1992 2933 gene locus_tag LOCUS_13440 1992 2933 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258521.1 protein_id gnl|my_center|LOCUS_13440 2991 5510 gene locus_tag LOCUS_13450 2991 5510 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_13450 5512 6021 gene locus_tag LOCUS_13460 5512 6021 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679252.1 protein_id gnl|my_center|LOCUS_13460 6056 8317 gene locus_tag LOCUS_13470 6056 8317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 8330 9187 gene locus_tag LOCUS_13480 gene uppP 8330 9187 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681055.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence095 <1 608 gene locus_tag LOCUS_13490 <1 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002668952.1:flagellin 951 1799 gene locus_tag LOCUS_13500 951 1799 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668950.1 protein_id gnl|my_center|LOCUS_13500 1892 2272 gene locus_tag LOCUS_13510 1892 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 2303 4375 gene locus_tag LOCUS_13520 gene fliD 2303 4375 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679139.1 protein_id gnl|my_center|LOCUS_13520 2957 2986 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4434 5024 gene locus_tag LOCUS_13530 4434 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 5047 6123 gene locus_tag LOCUS_13540 5047 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 6232 6495 gene locus_tag LOCUS_13550 6232 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 6492 6923 gene locus_tag LOCUS_13560 gene tsaE 6492 6923 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679136.1 protein_id gnl|my_center|LOCUS_13560 6928 7611 gene locus_tag LOCUS_13570 gene tsaB 6928 7611 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966124.1 protein_id gnl|my_center|LOCUS_13570 7828 7592 gene locus_tag LOCUS_13580 7828 7592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 8270 7830 gene locus_tag LOCUS_13590 8270 7830 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674247.1 protein_id gnl|my_center|LOCUS_13590 <9120 8314 gene locus_tag LOCUS_13600 <9120 8314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680271.1:flagellar hook-associated protein 3 >Feature sequence096 325 834 gene locus_tag LOCUS_13610 325 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13610 741 1328 gene locus_tag LOCUS_13620 741 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13620 753 789 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2089 1463 gene locus_tag LOCUS_13630 2089 1463 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032881713.1 protein_id gnl|my_center|LOCUS_13630 2514 2122 gene locus_tag LOCUS_13640 gene rpsI 2514 2122 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682117.1 protein_id gnl|my_center|LOCUS_13640 2959 2528 gene locus_tag LOCUS_13650 gene rplM 2959 2528 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682116.1 protein_id gnl|my_center|LOCUS_13650 3345 3100 gene locus_tag LOCUS_13660 3345 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 3788 4531 gene locus_tag LOCUS_13670 3788 4531 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065707.1 protein_id gnl|my_center|LOCUS_13670 4722 4775 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5138 6328 gene locus_tag LOCUS_13680 5138 6328 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081574.1 protein_id gnl|my_center|LOCUS_13680 6329 7258 gene locus_tag LOCUS_13690 6329 7258 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015835.1 protein_id gnl|my_center|LOCUS_13690 7255 8139 gene locus_tag LOCUS_13700 7255 8139 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627435.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence097 1257 103 gene locus_tag LOCUS_13710 1257 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1863 1267 gene locus_tag LOCUS_13720 1863 1267 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669797.1 protein_id gnl|my_center|LOCUS_13720 1987 2003 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2112 3200 gene locus_tag LOCUS_13730 2112 3200 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920597.1 protein_id gnl|my_center|LOCUS_13730 3193 3708 gene locus_tag LOCUS_13740 3193 3708 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671188.1 protein_id gnl|my_center|LOCUS_13740 3755 4147 gene locus_tag LOCUS_13750 3755 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 5366 4164 gene locus_tag LOCUS_13760 5366 4164 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677016.1 protein_id gnl|my_center|LOCUS_13760 6233 5418 gene locus_tag LOCUS_13770 6233 5418 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669892.1 protein_id gnl|my_center|LOCUS_13770 6653 8668 gene locus_tag LOCUS_13780 6653 8668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 >Feature sequence098 239 1198 gene locus_tag LOCUS_13790 gene rsgA 239 1198 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679106.1 protein_id gnl|my_center|LOCUS_13790 1199 3766 gene locus_tag LOCUS_13800 1199 3766 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679109.1 protein_id gnl|my_center|LOCUS_13800 2590 2630 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3582 3611 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3914 4384 gene locus_tag LOCUS_13810 3914 4384 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762699.1 protein_id gnl|my_center|LOCUS_13810 6475 4394 gene locus_tag LOCUS_13820 6475 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 <8723 6480 gene locus_tag LOCUS_13830 <8723 6480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193485432.1:damage-control phosphatase ARMT1 family protein >Feature sequence099 1382 3880 gene locus_tag LOCUS_13840 1382 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 3877 4491 gene locus_tag LOCUS_13850 3877 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 4531 4869 gene locus_tag LOCUS_13860 4531 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 4919 5662 gene locus_tag LOCUS_13870 4919 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 6080 6112 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6363 7730 gene locus_tag LOCUS_13880 6363 7730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 7677 7716 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence100 3072 64 gene locus_tag LOCUS_13890 3072 64 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680942.1 protein_id gnl|my_center|LOCUS_13890 3194 3808 gene locus_tag LOCUS_13900 3194 3808 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062281989.1 protein_id gnl|my_center|LOCUS_13900 5600 3810 gene locus_tag LOCUS_13910 5600 3810 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682243.1 protein_id gnl|my_center|LOCUS_13910 3933 3943 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6098 7354 gene locus_tag LOCUS_13920 gene lysA 6098 7354 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020771.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence101 2954 1287 gene locus_tag LOCUS_13930 2954 1287 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_13930 2607 2646 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3214 3005 gene locus_tag LOCUS_13940 3214 3005 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359683.1 protein_id gnl|my_center|LOCUS_13940 3796 3227 gene locus_tag LOCUS_13950 3796 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 3902 4004 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5742 4177 gene locus_tag LOCUS_13960 gene putP 5742 4177 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263649.1 protein_id gnl|my_center|LOCUS_13960 6981 5911 gene locus_tag LOCUS_13970 6981 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 7167 8384 gene locus_tag LOCUS_13980 7167 8384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 >Feature sequence102 1567 680 gene locus_tag LOCUS_13990 1567 680 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679668.1 protein_id gnl|my_center|LOCUS_13990 1966 1709 gene locus_tag LOCUS_14000 1966 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1993 2136 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2967 2164 gene locus_tag LOCUS_14010 2967 2164 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681821.1 protein_id gnl|my_center|LOCUS_14010 4394 2988 gene locus_tag LOCUS_14020 4394 2988 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_14020 4630 4406 gene locus_tag LOCUS_14030 4630 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 5466 4627 gene locus_tag LOCUS_14040 5466 4627 CDS product DUF5718 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061002828.1 protein_id gnl|my_center|LOCUS_14040 5523 6878 gene locus_tag LOCUS_14050 5523 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 8191 6917 gene locus_tag LOCUS_14060 8191 6917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 >Feature sequence103 782 135 gene locus_tag LOCUS_14070 782 135 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890811.1 protein_id gnl|my_center|LOCUS_14070 1031 1489 gene locus_tag LOCUS_14080 gene rimP 1031 1489 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670663.1 protein_id gnl|my_center|LOCUS_14080 1515 2963 gene locus_tag LOCUS_14090 gene nusA 1515 2963 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682413.1 protein_id gnl|my_center|LOCUS_14090 2972 3412 gene locus_tag LOCUS_14100 2972 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 3324 4301 gene locus_tag LOCUS_14110 3324 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14110 3413 3425 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4273 5979 gene locus_tag LOCUS_14120 4273 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 6130 6519 gene locus_tag LOCUS_14130 gene rbfA 6130 6519 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670660.1 protein_id gnl|my_center|LOCUS_14130 6545 7573 gene locus_tag LOCUS_14140 gene truB 6545 7573 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682411.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence104 151 195 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 359 1276 gene locus_tag LOCUS_14150 359 1276 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_14150 1865 2323 gene locus_tag LOCUS_14160 1865 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 2320 2487 gene locus_tag LOCUS_14170 2320 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 2484 3395 gene locus_tag LOCUS_14180 2484 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_14180 5350 3665 gene locus_tag LOCUS_14190 5350 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 5966 5439 gene locus_tag LOCUS_14200 5966 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14200 5499 5526 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6007 6098 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6483 6812 gene locus_tag LOCUS_14210 6483 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 6809 7120 gene locus_tag LOCUS_14220 6809 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence105 291 1733 gene locus_tag LOCUS_14230 291 1733 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440276.1 protein_id gnl|my_center|LOCUS_14230 4341 1843 gene locus_tag LOCUS_14240 4341 1843 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680347.1 protein_id gnl|my_center|LOCUS_14240 6618 4504 gene locus_tag LOCUS_14250 gene glgX 6618 4504 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680950.1 protein_id gnl|my_center|LOCUS_14250 7619 6663 gene locus_tag LOCUS_14260 gene era 7619 6663 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679589.1 protein_id gnl|my_center|LOCUS_14260 6953 7019 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7914 8004 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence106 267 317 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 379 2385 gene locus_tag LOCUS_14270 379 2385 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679969.1 protein_id gnl|my_center|LOCUS_14270 492 499 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2470 2877 gene locus_tag LOCUS_14280 2470 2877 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679984.1 protein_id gnl|my_center|LOCUS_14280 4140 2896 gene locus_tag LOCUS_14290 4140 2896 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681086.1 protein_id gnl|my_center|LOCUS_14290 4390 4458 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4530 6161 gene locus_tag LOCUS_14300 4530 6161 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669793.1 protein_id gnl|my_center|LOCUS_14300 6233 6910 gene locus_tag LOCUS_14310 6233 6910 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_14310 7017 8267 gene locus_tag LOCUS_14320 7017 8267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 >Feature sequence107 2367 55 gene locus_tag LOCUS_14330 2367 55 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106540.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14330 3322 2354 gene locus_tag LOCUS_14340 3322 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14340 2435 2471 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4689 3430 gene locus_tag LOCUS_14350 4689 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 6783 4810 gene locus_tag LOCUS_14360 6783 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 6788 6900 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7457 7684 gene locus_tag LOCUS_14370 7457 7684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 7681 7836 gene locus_tag LOCUS_14380 7681 7836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 8083 7814 gene locus_tag LOCUS_14390 8083 7814 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963800.1 protein_id gnl|my_center|LOCUS_14390 >Feature sequence108 572 1756 gene locus_tag LOCUS_14400 572 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 1678 1696 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1840 2712 gene locus_tag LOCUS_14410 1840 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14410 4682 2715 gene locus_tag LOCUS_14420 gene mutL 4682 2715 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020571.1 protein_id gnl|my_center|LOCUS_14420 4954 4679 gene locus_tag LOCUS_14430 gene xseB 4954 4679 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674672.1 protein_id gnl|my_center|LOCUS_14430 6183 4969 gene locus_tag LOCUS_14440 gene xseA 6183 4969 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682333.1 protein_id gnl|my_center|LOCUS_14440 6240 7820 gene locus_tag LOCUS_14450 6240 7820 CDS product spiro-SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679625.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence109 227 988 gene locus_tag LOCUS_14460 227 988 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546810.1 protein_id gnl|my_center|LOCUS_14460 985 1377 gene locus_tag LOCUS_14470 985 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 1380 1417 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1479 2507 gene locus_tag LOCUS_14480 1479 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 2510 2851 gene locus_tag LOCUS_14490 2510 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 2848 2997 gene locus_tag LOCUS_14500 2848 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 2994 3185 gene locus_tag LOCUS_14510 2994 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 3330 3485 gene locus_tag LOCUS_14520 3330 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 3460 3726 gene locus_tag LOCUS_14530 3460 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 3730 4527 gene locus_tag LOCUS_14540 3730 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 4539 4979 gene locus_tag LOCUS_14550 4539 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 4965 4974 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5005 5229 gene locus_tag LOCUS_14560 5005 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 5259 5296 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5360 5821 gene locus_tag LOCUS_14570 5360 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 6387 6884 gene locus_tag LOCUS_14580 6387 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 >Feature sequence110 654 301 gene locus_tag LOCUS_14590 654 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 1301 690 gene locus_tag LOCUS_14600 1301 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 705 736 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1696 1505 gene locus_tag LOCUS_14610 1696 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 1833 1630 gene locus_tag LOCUS_14620 1833 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 2761 2153 gene locus_tag LOCUS_14630 2761 2153 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026924.1 protein_id gnl|my_center|LOCUS_14630 4144 2813 gene locus_tag LOCUS_14640 4144 2813 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993582.1 protein_id gnl|my_center|LOCUS_14640 4391 4732 gene locus_tag LOCUS_14650 4391 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 4736 6601 gene locus_tag LOCUS_14660 4736 6601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 6658 6990 gene locus_tag LOCUS_14670 6658 6990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 7036 7062 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence111 492 1472 gene locus_tag LOCUS_14680 492 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670623.1 protein_id gnl|my_center|LOCUS_14680 1474 1926 gene locus_tag LOCUS_14690 1474 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1926 2306 gene locus_tag LOCUS_14700 1926 2306 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667147.1 protein_id gnl|my_center|LOCUS_14700 2360 2439 gene locus_tag LOCUS_t00160 2360 2439 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2735 3679 gene locus_tag LOCUS_14710 2735 3679 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109323.1 protein_id gnl|my_center|LOCUS_14710 4140 3664 gene locus_tag LOCUS_14720 4140 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 4438 4037 gene locus_tag LOCUS_14730 4438 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 4097 4135 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5418 4426 gene locus_tag LOCUS_14740 5418 4426 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682393.1 protein_id gnl|my_center|LOCUS_14740 6053 5454 gene locus_tag LOCUS_14750 6053 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682391.1 protein_id gnl|my_center|LOCUS_14750 6751 6050 gene locus_tag LOCUS_14760 6751 6050 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_14760 7626 6748 gene locus_tag LOCUS_14770 gene rsmA 7626 6748 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682389.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence112 398 1579 gene locus_tag LOCUS_14780 398 1579 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673293.1 protein_id gnl|my_center|LOCUS_14780 1639 2136 gene locus_tag LOCUS_14790 1639 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680920.1 protein_id gnl|my_center|LOCUS_14790 2140 2598 gene locus_tag LOCUS_14800 2140 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 3794 2649 gene locus_tag LOCUS_14810 3794 2649 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681112.1 protein_id gnl|my_center|LOCUS_14810 4382 3810 gene locus_tag LOCUS_14820 4382 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 4545 4617 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4896 6215 gene locus_tag LOCUS_14830 4896 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 6212 6802 gene locus_tag LOCUS_14840 6212 6802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 7592 6783 gene locus_tag LOCUS_14850 7592 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 >Feature sequence113 315 590 gene locus_tag LOCUS_14860 315 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 587 2236 gene locus_tag LOCUS_14870 587 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 2250 2870 gene locus_tag LOCUS_14880 2250 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 2921 4222 gene locus_tag LOCUS_14890 gene serS 2921 4222 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680220.1 protein_id gnl|my_center|LOCUS_14890 3024 3045 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5238 4294 gene locus_tag LOCUS_14900 5238 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 5866 5279 gene locus_tag LOCUS_14910 5866 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 7067 6042 gene locus_tag LOCUS_14920 7067 6042 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence114 1124 435 gene locus_tag LOCUS_14930 1124 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1332 1081 gene locus_tag LOCUS_14940 1332 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1088 1107 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1692 2330 gene locus_tag LOCUS_14950 1692 2330 CDS product master DNA invertase Mpi family serine-type recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680425.1 protein_id gnl|my_center|LOCUS_14950 2512 5898 gene locus_tag LOCUS_14960 gene hsdR 2512 5898 CDS product type I restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122926.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence115 822 385 gene locus_tag LOCUS_14970 822 385 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972158.1 protein_id gnl|my_center|LOCUS_14970 1355 1029 gene locus_tag LOCUS_14980 1355 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1896 1420 gene locus_tag LOCUS_14990 1896 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 2449 2715 gene locus_tag LOCUS_15000 2449 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 2768 4156 gene locus_tag LOCUS_15010 2768 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 4156 4299 gene locus_tag LOCUS_15020 4156 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 4303 4827 gene locus_tag LOCUS_15030 4303 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 5279 4821 gene locus_tag LOCUS_15040 5279 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 5872 5279 gene locus_tag LOCUS_15050 5872 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 6046 6357 gene locus_tag LOCUS_15060 6046 6357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 6361 6687 gene locus_tag LOCUS_15070 6361 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 7050 7101 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence116 2139 586 gene locus_tag LOCUS_15080 2139 586 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679741.1 protein_id gnl|my_center|LOCUS_15080 3505 2192 gene locus_tag LOCUS_15090 3505 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 5295 3553 gene locus_tag LOCUS_15100 5295 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 6356 5535 gene locus_tag LOCUS_15110 6356 5535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 7336 6359 gene locus_tag LOCUS_15120 7336 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence117 431 159 gene locus_tag LOCUS_15130 431 159 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670325.1 protein_id gnl|my_center|LOCUS_15130 836 1678 gene locus_tag LOCUS_15140 836 1678 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670326.1 protein_id gnl|my_center|LOCUS_15140 3854 1668 gene locus_tag LOCUS_15150 gene recG 3854 1668 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680562.1 protein_id gnl|my_center|LOCUS_15150 4461 3856 gene locus_tag LOCUS_15160 4461 3856 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666956.1 protein_id gnl|my_center|LOCUS_15160 6585 4486 gene locus_tag LOCUS_15170 6585 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15170 >Feature sequence118 204 245 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1042 428 gene locus_tag LOCUS_15180 1042 428 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679200.1 protein_id gnl|my_center|LOCUS_15180 4097 1227 gene locus_tag LOCUS_15190 4097 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 4883 4113 gene locus_tag LOCUS_15200 4883 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 5042 5070 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6039 5215 gene locus_tag LOCUS_15210 6039 5215 CDS product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056925.1 protein_id gnl|my_center|LOCUS_15210 6987 6232 gene locus_tag LOCUS_15220 6987 6232 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005008.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence119 164 3 gene locus_tag LOCUS_15230 164 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 118 2001 gene locus_tag LOCUS_15240 118 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 2113 3777 gene locus_tag LOCUS_15250 gene gpmI 2113 3777 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_15250 4700 3897 gene locus_tag LOCUS_15260 4700 3897 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039647756.1 protein_id gnl|my_center|LOCUS_15260 5627 4701 gene locus_tag LOCUS_15270 5627 4701 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940886.1 protein_id gnl|my_center|LOCUS_15270 6868 5879 gene locus_tag LOCUS_15280 6868 5879 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940885.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence120 220 270 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 502 2280 gene locus_tag LOCUS_15290 502 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 4364 2355 gene locus_tag LOCUS_15300 4364 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 4345 4506 gene locus_tag LOCUS_15310 4345 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 4528 4686 gene locus_tag LOCUS_15320 4528 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 4883 4929 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5042 5350 gene locus_tag LOCUS_15330 5042 5350 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence121 270 294 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2543 522 gene locus_tag LOCUS_15340 2543 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 2676 3449 gene locus_tag LOCUS_15350 2676 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15350 3400 3429 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3439 3855 gene locus_tag LOCUS_15360 3439 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15360 3890 3922 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3932 4546 gene locus_tag LOCUS_15370 3932 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 4580 5305 gene locus_tag LOCUS_15380 gene trmB 4580 5305 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956879.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence122 81 665 gene locus_tag LOCUS_15390 81 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 685 1473 gene locus_tag LOCUS_15400 685 1473 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232924.1 protein_id gnl|my_center|LOCUS_15400 1719 2327 gene locus_tag LOCUS_15410 1719 2327 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476292.1 protein_id gnl|my_center|LOCUS_15410 2417 2444 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2930 2963 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3897 3211 gene locus_tag LOCUS_15420 3897 3211 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358908.1 protein_id gnl|my_center|LOCUS_15420 4076 5620 gene locus_tag LOCUS_15430 4076 5620 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199604.1 protein_id gnl|my_center|LOCUS_15430 5621 6673 gene locus_tag LOCUS_15440 5621 6673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 >Feature sequence123 711 181 gene locus_tag LOCUS_15450 711 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 2773 881 gene locus_tag LOCUS_15460 2773 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 2225 2252 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2903 3208 gene locus_tag LOCUS_15470 2903 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 4767 3502 gene locus_tag LOCUS_15480 4767 3502 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393768.1 protein_id gnl|my_center|LOCUS_15480 6072 5029 gene locus_tag LOCUS_15490 6072 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence124 <1 1121 gene locus_tag LOCUS_15500 <1 1121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682400.1:threonine--tRNA ligase 3630 1303 gene locus_tag LOCUS_15510 3630 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 3917 3648 gene locus_tag LOCUS_15520 3917 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 4269 3919 gene locus_tag LOCUS_15530 4269 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 5078 4266 gene locus_tag LOCUS_15540 5078 4266 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669703.1 protein_id gnl|my_center|LOCUS_15540 5711 5133 gene locus_tag LOCUS_15550 5711 5133 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670118.1 protein_id gnl|my_center|LOCUS_15550 6348 5725 gene locus_tag LOCUS_15560 6348 5725 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670120.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence125 958 77 gene locus_tag LOCUS_15570 958 77 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679999.1 protein_id gnl|my_center|LOCUS_15570 2179 992 gene locus_tag LOCUS_15580 2179 992 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678712.1 protein_id gnl|my_center|LOCUS_15580 2241 2375 gene locus_tag LOCUS_15590 2241 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 2452 2853 gene locus_tag LOCUS_15600 2452 2853 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680077.1 protein_id gnl|my_center|LOCUS_15600 3686 2850 gene locus_tag LOCUS_15610 3686 2850 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_15610 4919 3780 gene locus_tag LOCUS_15620 4919 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 5118 5191 gene locus_tag LOCUS_t00170 5118 5191 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5251 6012 gene locus_tag LOCUS_15630 5251 6012 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860778.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence126 1577 4258 gene locus_tag LOCUS_15640 1577 4258 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957294.1 protein_id gnl|my_center|LOCUS_15640 4516 5310 gene locus_tag LOCUS_15650 4516 5310 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887209.1 protein_id gnl|my_center|LOCUS_15650 5404 6063 gene locus_tag LOCUS_15660 5404 6063 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966882.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence127 <1 936 gene locus_tag LOCUS_15670 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_207280515.1:YidE/YbjL duplication 1399 1067 gene locus_tag LOCUS_15680 1399 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 3176 1422 gene locus_tag LOCUS_15690 3176 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 6134 3189 gene locus_tag LOCUS_15700 6134 3189 CDS product CHASE2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682238.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence128 410 934 gene locus_tag LOCUS_15710 410 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 1127 1185 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1425 2426 gene locus_tag LOCUS_15720 1425 2426 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678753.1 protein_id gnl|my_center|LOCUS_15720 2428 4077 gene locus_tag LOCUS_15730 2428 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 4026 5432 gene locus_tag LOCUS_15740 4026 5432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 5597 5619 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5646 6218 gene locus_tag LOCUS_15750 5646 6218 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678761.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence129 408 1043 gene locus_tag LOCUS_15760 408 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 2028 1024 gene locus_tag LOCUS_15770 2028 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 4206 2068 gene locus_tag LOCUS_15780 gene recJ 4206 2068 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680035.1 protein_id gnl|my_center|LOCUS_15780 5579 4221 gene locus_tag LOCUS_15790 5579 4221 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680036.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence130 1575 547 gene locus_tag LOCUS_15800 1575 547 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797307.1 protein_id gnl|my_center|LOCUS_15800 2493 1603 gene locus_tag LOCUS_15810 2493 1603 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_15810 5363 2745 gene locus_tag LOCUS_15820 5363 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 <6105 5409 gene locus_tag LOCUS_15830 <6105 5409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082389.1:type I pullulanase >Feature sequence131 616 671 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1178 1214 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1365 1396 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2762 1491 gene locus_tag LOCUS_15840 2762 1491 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679428.1 protein_id gnl|my_center|LOCUS_15840 3164 3457 gene locus_tag LOCUS_15850 3164 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 3359 3379 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3381 3770 gene locus_tag LOCUS_15860 3381 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 3855 4274 gene locus_tag LOCUS_15870 3855 4274 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963907.1 protein_id gnl|my_center|LOCUS_15870 4293 5039 gene locus_tag LOCUS_15880 4293 5039 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878518.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence132 1786 17 gene locus_tag LOCUS_15890 1786 17 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890790.1 protein_id gnl|my_center|LOCUS_15890 2109 2300 gene locus_tag LOCUS_15900 2109 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 3615 2344 gene locus_tag LOCUS_15910 3615 2344 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202285.1 protein_id gnl|my_center|LOCUS_15910 3988 3599 gene locus_tag LOCUS_15920 3988 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 <5918 4153 gene locus_tag LOCUS_15930 <5918 4153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461428.1:InlB B-repeat-containing protein >Feature sequence133 90 956 gene locus_tag LOCUS_15940 gene ispE 90 956 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678892.1 protein_id gnl|my_center|LOCUS_15940 1000 1278 gene locus_tag LOCUS_15950 gene spoVG 1000 1278 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_15950 1299 1373 gene locus_tag LOCUS_t00180 1299 1373 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2399 1584 gene locus_tag LOCUS_15960 2399 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 3173 2472 gene locus_tag LOCUS_15970 3173 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 4002 3421 gene locus_tag LOCUS_15980 4002 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 4531 4558 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5654 4983 gene locus_tag LOCUS_15990 5654 4983 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948424.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence134 <1 674 gene locus_tag LOCUS_16000 <1 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011017115.1:ATP-binding protein 1156 692 gene locus_tag LOCUS_16010 1156 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1758 1171 gene locus_tag LOCUS_16020 1758 1171 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948175.1 protein_id gnl|my_center|LOCUS_16020 2236 3276 gene locus_tag LOCUS_16030 2236 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 3286 3858 gene locus_tag LOCUS_16040 3286 3858 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_16040 4192 3860 gene locus_tag LOCUS_16050 4192 3860 CDS product DUF3781 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861913.1 protein_id gnl|my_center|LOCUS_16050 5000 4200 gene locus_tag LOCUS_16060 5000 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922289.1 protein_id gnl|my_center|LOCUS_16060 5521 5000 gene locus_tag LOCUS_16070 5521 5000 CDS product DUF6434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247875.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence135 1314 2393 gene locus_tag LOCUS_16080 gene trpS 1314 2393 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804845.1 protein_id gnl|my_center|LOCUS_16080 2462 3025 gene locus_tag LOCUS_16090 2462 3025 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_16090 4530 3124 gene locus_tag LOCUS_16100 4530 3124 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_16100 4907 4530 gene locus_tag LOCUS_16110 4907 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 4957 5733 gene locus_tag LOCUS_16120 4957 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence136 158 1021 gene locus_tag LOCUS_16130 158 1021 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546408.1 protein_id gnl|my_center|LOCUS_16130 1534 1103 gene locus_tag LOCUS_16140 1534 1103 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966530.1 protein_id gnl|my_center|LOCUS_16140 2034 1660 gene locus_tag LOCUS_16150 2034 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 2287 2036 gene locus_tag LOCUS_16160 2287 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 2866 2411 gene locus_tag LOCUS_16170 2866 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 3171 2875 gene locus_tag LOCUS_16180 3171 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 3410 3159 gene locus_tag LOCUS_16190 3410 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 3734 3519 gene locus_tag LOCUS_16200 3734 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 4927 3731 gene locus_tag LOCUS_16210 4927 3731 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759897.1 protein_id gnl|my_center|LOCUS_16210 5637 4999 gene locus_tag LOCUS_16220 5637 4999 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461761.1 protein_id gnl|my_center|LOCUS_16220 5281 5311 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence137 794 105 gene locus_tag LOCUS_16230 794 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 1195 932 gene locus_tag LOCUS_16240 1195 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 1964 1224 gene locus_tag LOCUS_16250 1964 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 2737 2030 gene locus_tag LOCUS_16260 2737 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 3195 2734 gene locus_tag LOCUS_16270 3195 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 3418 4164 gene locus_tag LOCUS_16280 3418 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 >Feature sequence138 653 75 gene locus_tag LOCUS_16290 653 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16290 1951 650 gene locus_tag LOCUS_16300 1951 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16300 655 701 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1972 2190 gene locus_tag LOCUS_16310 1972 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670390.1 protein_id gnl|my_center|LOCUS_16310 3203 2250 gene locus_tag LOCUS_16320 gene miaA 3203 2250 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679096.1 protein_id gnl|my_center|LOCUS_16320 4534 3299 gene locus_tag LOCUS_16330 4534 3299 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_16330 3330 3357 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4683 5531 gene locus_tag LOCUS_16340 4683 5531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence139 102 2540 gene locus_tag LOCUS_16350 102 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 2749 3852 gene locus_tag LOCUS_16360 2749 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 3861 4922 gene locus_tag LOCUS_16370 3861 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 5217 4927 gene locus_tag LOCUS_16380 5217 4927 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057517.1 protein_id gnl|my_center|LOCUS_16380 5512 5219 gene locus_tag LOCUS_16390 5512 5219 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693946.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence140 <1 501 gene locus_tag LOCUS_16400 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680076.1:1-acyl-sn-glycerol-3-phosphate acyltransferase 1902 523 gene locus_tag LOCUS_16410 gene radA 1902 523 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680482.1 protein_id gnl|my_center|LOCUS_16410 3019 2150 gene locus_tag LOCUS_16420 3019 2150 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_16420 3291 3364 gene locus_tag LOCUS_t00190 3291 3364 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3401 3577 gene locus_tag LOCUS_16430 gene rpmG 3401 3577 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667594.1 protein_id gnl|my_center|LOCUS_16430 3621 3695 gene locus_tag LOCUS_t00200 3621 3695 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 3879 4061 gene locus_tag LOCUS_16440 gene secE 3879 4061 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667596.1 protein_id gnl|my_center|LOCUS_16440 4074 4631 gene locus_tag LOCUS_16450 gene nusG 4074 4631 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667597.1 protein_id gnl|my_center|LOCUS_16450 4774 5205 gene locus_tag LOCUS_16460 gene rplK 4774 5205 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667599.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence141 459 10 gene locus_tag LOCUS_16470 459 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 624 645 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 835 2313 gene locus_tag LOCUS_16480 835 2313 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681937.1 protein_id gnl|my_center|LOCUS_16480 2324 3556 gene locus_tag LOCUS_16490 2324 3556 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681964.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence142 106 849 gene locus_tag LOCUS_16500 106 849 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668967.1 protein_id gnl|my_center|LOCUS_16500 1010 1552 gene locus_tag LOCUS_16510 gene ruvC 1010 1552 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679556.1 protein_id gnl|my_center|LOCUS_16510 1625 2224 gene locus_tag LOCUS_16520 gene ruvA 1625 2224 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679554.1 protein_id gnl|my_center|LOCUS_16520 2225 3265 gene locus_tag LOCUS_16530 gene ruvB 2225 3265 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679608.1 protein_id gnl|my_center|LOCUS_16530 3262 4341 gene locus_tag LOCUS_16540 gene queA 3262 4341 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957235.1 protein_id gnl|my_center|LOCUS_16540 5163 4357 gene locus_tag LOCUS_16550 5163 4357 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681967.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence143 1106 1259 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2380 1616 gene locus_tag LOCUS_16560 2380 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 2787 2533 gene locus_tag LOCUS_16570 2787 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 3351 2791 gene locus_tag LOCUS_16580 3351 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 4396 3341 gene locus_tag LOCUS_16590 4396 3341 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682041.1 protein_id gnl|my_center|LOCUS_16590 5002 4409 gene locus_tag LOCUS_16600 gene rpsD 5002 4409 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903916.1 protein_id gnl|my_center|LOCUS_16600 5396 5016 gene locus_tag LOCUS_16610 gene rpsK 5396 5016 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670039.1 protein_id gnl|my_center|LOCUS_16610 5532 5383 gene locus_tag LOCUS_16620 5532 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence144 504 1031 gene locus_tag LOCUS_16630 504 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 1255 1354 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1720 2934 gene locus_tag LOCUS_16640 1720 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 4626 3172 gene locus_tag LOCUS_16650 4626 3172 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence145 1499 621 gene locus_tag LOCUS_16660 1499 621 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667742.1 protein_id gnl|my_center|LOCUS_16660 2217 1510 gene locus_tag LOCUS_16670 gene uppS 2217 1510 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675801.1 protein_id gnl|my_center|LOCUS_16670 2753 2217 gene locus_tag LOCUS_16680 gene frr 2753 2217 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675802.1 protein_id gnl|my_center|LOCUS_16680 3749 2916 gene locus_tag LOCUS_16690 gene tsf 3749 2916 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674264.1 protein_id gnl|my_center|LOCUS_16690 4642 3773 gene locus_tag LOCUS_16700 gene rpsB 4642 3773 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680262.1 protein_id gnl|my_center|LOCUS_16700 5350 4760 gene locus_tag LOCUS_16710 5350 4760 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680263.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence146 543 989 gene locus_tag LOCUS_16720 gene dut 543 989 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882709.1 protein_id gnl|my_center|LOCUS_16720 1085 1657 gene locus_tag LOCUS_16730 1085 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16730 1747 2250 gene locus_tag LOCUS_16740 1747 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 2247 3326 gene locus_tag LOCUS_16750 2247 3326 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682352.1 protein_id gnl|my_center|LOCUS_16750 3493 4626 gene locus_tag LOCUS_16760 gene tgt 3493 4626 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681512.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence147 39 668 gene locus_tag LOCUS_16770 39 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 635 661 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 739 924 gene locus_tag LOCUS_16780 739 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 1281 1880 gene locus_tag LOCUS_16790 1281 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 1908 2495 gene locus_tag LOCUS_16800 1908 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 2513 2977 gene locus_tag LOCUS_16810 2513 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 3108 4196 gene locus_tag LOCUS_16820 3108 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 4311 5021 gene locus_tag LOCUS_16830 gene trbF 4311 5021 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090989.1 protein_id gnl|my_center|LOCUS_16830 >Feature sequence148 1693 392 gene locus_tag LOCUS_16840 gene tig 1693 392 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679366.1 protein_id gnl|my_center|LOCUS_16840 1904 1832 gene locus_tag LOCUS_t00210 1904 1832 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2192 2113 gene locus_tag LOCUS_t00220 2192 2113 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2273 2201 gene locus_tag LOCUS_t00230 2273 2201 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2418 2499 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2673 2743 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2850 3266 gene locus_tag LOCUS_16850 2850 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 3293 5164 gene locus_tag LOCUS_16860 gene flgK 3293 5164 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957216.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence149 <1 1954 gene locus_tag LOCUS_16870 <1 1954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680941.1:UvrD-helicase domain-containing protein 2658 1951 gene locus_tag LOCUS_16880 2658 1951 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388547.1 protein_id gnl|my_center|LOCUS_16880 3668 2655 gene locus_tag LOCUS_16890 3668 2655 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817222.1 protein_id gnl|my_center|LOCUS_16890 4515 3670 gene locus_tag LOCUS_16900 4515 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 5037 4603 gene locus_tag LOCUS_16910 5037 4603 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668975.1 protein_id gnl|my_center|LOCUS_16910 >Feature sequence150 252 1622 gene locus_tag LOCUS_16920 252 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 2392 1619 gene locus_tag LOCUS_16930 2392 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 2453 3103 gene locus_tag LOCUS_16940 2453 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16940 3191 3748 gene locus_tag LOCUS_16950 3191 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 >Feature sequence151 1876 638 gene locus_tag LOCUS_16960 1876 638 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679701.1 protein_id gnl|my_center|LOCUS_16960 2322 1861 gene locus_tag LOCUS_16970 2322 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 3122 2271 gene locus_tag LOCUS_16980 3122 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 2277 2307 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3604 3122 gene locus_tag LOCUS_16990 3604 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 4789 3632 gene locus_tag LOCUS_17000 gene murG 4789 3632 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957113.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence152 4588 14 gene locus_tag LOCUS_17010 gene gltB 4588 14 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence153 1564 125 gene locus_tag LOCUS_17020 1564 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17020 459 488 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2172 1903 gene locus_tag LOCUS_17030 gene rpsO 2172 1903 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671840.1 protein_id gnl|my_center|LOCUS_17030 2873 2301 gene locus_tag LOCUS_17040 2873 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 2891 2924 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3004 4665 gene locus_tag LOCUS_17050 3004 4665 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674349.1 protein_id gnl|my_center|LOCUS_17050 >Feature sequence154 426 64 gene locus_tag LOCUS_17060 426 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 838 428 gene locus_tag LOCUS_17070 838 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17070 1717 866 gene locus_tag LOCUS_17080 1717 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17080 1886 2007 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2128 2937 gene locus_tag LOCUS_17090 gene flgF 2128 2937 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671871.1 protein_id gnl|my_center|LOCUS_17090 2202 2232 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2950 3744 gene locus_tag LOCUS_17100 gene flgG 2950 3744 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670463.1 protein_id gnl|my_center|LOCUS_17100 3768 4265 gene locus_tag LOCUS_17110 3768 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 >Feature sequence155 164 1846 gene locus_tag LOCUS_17120 164 1846 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138361510.1 protein_id gnl|my_center|LOCUS_17120 3392 1881 gene locus_tag LOCUS_17130 3392 1881 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423106.1 protein_id gnl|my_center|LOCUS_17130 4467 3466 gene locus_tag LOCUS_17140 4467 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 4505 4579 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence156 3416 1797 gene locus_tag LOCUS_17150 3416 1797 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682403.1 protein_id gnl|my_center|LOCUS_17150 4104 3430 gene locus_tag LOCUS_17160 4104 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 4800 4261 gene locus_tag LOCUS_17170 4800 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 >Feature sequence157 1 561 gene locus_tag LOCUS_17180 1 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 586 1005 gene locus_tag LOCUS_17190 586 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 1112 2947 gene locus_tag LOCUS_17200 1112 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 3041 3160 gene locus_tag LOCUS_17210 3041 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 >Feature sequence158 832 458 gene locus_tag LOCUS_17220 832 458 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679605.1 protein_id gnl|my_center|LOCUS_17220 1905 829 gene locus_tag LOCUS_17230 1905 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 2698 1883 gene locus_tag LOCUS_17240 gene cdaA 2698 1883 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669723.1 protein_id gnl|my_center|LOCUS_17240 3616 2759 gene locus_tag LOCUS_17250 3616 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 2786 2839 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <4789 3618 gene locus_tag LOCUS_17260 <4789 3618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957098.1:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence159 <1 667 gene locus_tag LOCUS_17270 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001361291.1:Bax inhibitor-1/YccA family protein 1339 710 gene locus_tag LOCUS_17280 1339 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 2651 1359 gene locus_tag LOCUS_17290 2651 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 3735 2671 gene locus_tag LOCUS_17300 3735 2671 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121735.1 protein_id gnl|my_center|LOCUS_17300 3841 3897 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3925 4257 gene locus_tag LOCUS_17310 3925 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 4375 4404 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence160 101 700 gene locus_tag LOCUS_17320 101 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 729 2207 gene locus_tag LOCUS_17330 729 2207 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678947.1 protein_id gnl|my_center|LOCUS_17330 2342 3520 gene locus_tag LOCUS_17340 gene ugd 2342 3520 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706040.1 protein_id gnl|my_center|LOCUS_17340 3570 4685 gene locus_tag LOCUS_17350 3570 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence161 206 685 gene locus_tag LOCUS_17360 206 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 678 1187 gene locus_tag LOCUS_17370 678 1187 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966286.1 protein_id gnl|my_center|LOCUS_17370 2442 1267 gene locus_tag LOCUS_17380 2442 1267 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 protein_id gnl|my_center|LOCUS_17380 3603 2452 gene locus_tag LOCUS_17390 3603 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 >Feature sequence162 674 201 gene locus_tag LOCUS_17400 674 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 1248 664 gene locus_tag LOCUS_17410 1248 664 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680233.1 protein_id gnl|my_center|LOCUS_17410 1598 1251 gene locus_tag LOCUS_17420 1598 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680234.1 protein_id gnl|my_center|LOCUS_17420 2244 1765 gene locus_tag LOCUS_17430 2244 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 3366 2254 gene locus_tag LOCUS_17440 gene hflX 3366 2254 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873770.1 protein_id gnl|my_center|LOCUS_17440 3478 3405 gene locus_tag LOCUS_t00240 3478 3405 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3616 3635 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence163 <1 961 gene locus_tag LOCUS_17450 <1 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775575.1:IS110 family transposase 482 577 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1766 1548 gene locus_tag LOCUS_17460 1766 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 2745 2089 gene locus_tag LOCUS_17470 2745 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 3005 2757 gene locus_tag LOCUS_17480 3005 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 3852 2992 gene locus_tag LOCUS_17490 3852 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 4530 3853 gene locus_tag LOCUS_17500 4530 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 >Feature sequence164 27 284 gene locus_tag LOCUS_17510 27 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 750 397 gene locus_tag LOCUS_17520 gene rsfS 750 397 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679464.1 protein_id gnl|my_center|LOCUS_17520 1992 784 gene locus_tag LOCUS_17530 1992 784 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669467.1 protein_id gnl|my_center|LOCUS_17530 2012 2031 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2688 2098 gene locus_tag LOCUS_17540 2688 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17540 3349 2678 gene locus_tag LOCUS_17550 gene nadD 3349 2678 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841927.1 protein_id gnl|my_center|LOCUS_17550 4461 3346 gene locus_tag LOCUS_17560 gene obgE 4461 3346 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679468.1 protein_id gnl|my_center|LOCUS_17560 >Feature sequence165 626 2380 gene locus_tag LOCUS_17570 626 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 2596 3579 gene locus_tag LOCUS_17580 2596 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17580 3517 3560 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence166 2928 1042 gene locus_tag LOCUS_17590 gene mrdA 2928 1042 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671463.1 protein_id gnl|my_center|LOCUS_17590 3434 2928 gene locus_tag LOCUS_17600 3434 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 4303 3437 gene locus_tag LOCUS_17610 gene mreC 4303 3437 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668697.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence167 840 1210 gene locus_tag LOCUS_tm00010 840 1210 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1862 1326 gene locus_tag LOCUS_17620 1862 1326 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670683.1 protein_id gnl|my_center|LOCUS_17620 2353 1994 gene locus_tag LOCUS_17630 2353 1994 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670686.1 protein_id gnl|my_center|LOCUS_17630 2145 2165 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4029 2365 gene locus_tag LOCUS_17640 4029 2365 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682419.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence168 1537 203 gene locus_tag LOCUS_17650 1537 203 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_17650 2601 1648 gene locus_tag LOCUS_17660 2601 1648 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_17660 2831 2992 gene locus_tag LOCUS_17670 2831 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 3619 3104 gene locus_tag LOCUS_17680 3619 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 <4453 3652 gene locus_tag LOCUS_17690 <4453 3652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681695.1:formylglycine-generating enzyme family protein 4277 4305 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence169 <1 733 gene locus_tag LOCUS_17700 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682130.1:lipoprotein 743 1306 gene locus_tag LOCUS_17710 743 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 1331 1837 gene locus_tag LOCUS_17720 1331 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 1837 2244 gene locus_tag LOCUS_17730 1837 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 2241 2603 gene locus_tag LOCUS_17740 2241 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 2594 3685 gene locus_tag LOCUS_17750 2594 3685 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682269.1 protein_id gnl|my_center|LOCUS_17750 <4428 3678 gene locus_tag LOCUS_17760 <4428 3678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583581.1:type III pantothenate kinase >Feature sequence170 847 365 gene locus_tag LOCUS_17770 847 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 2157 982 gene locus_tag LOCUS_17780 2157 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence171 2600 282 gene locus_tag LOCUS_17790 gene feoB 2600 282 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861233.1 protein_id gnl|my_center|LOCUS_17790 2821 2600 gene locus_tag LOCUS_17800 2821 2600 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_17800 3074 2865 gene locus_tag LOCUS_17810 3074 2865 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_17810 3489 4247 gene locus_tag LOCUS_17820 3489 4247 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679885.1 protein_id gnl|my_center|LOCUS_17820 >Feature sequence172 704 770 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4177 3038 gene locus_tag LOCUS_17830 4177 3038 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986366.1 protein_id gnl|my_center|LOCUS_17830 >Feature sequence173 575 1483 gene locus_tag LOCUS_17840 gene metA 575 1483 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462040.1 protein_id gnl|my_center|LOCUS_17840 2436 1468 gene locus_tag LOCUS_17850 2436 1468 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680508.1 protein_id gnl|my_center|LOCUS_17850 2804 2421 gene locus_tag LOCUS_17860 2804 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 3375 2944 gene locus_tag LOCUS_17870 gene fabZ 3375 2944 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670104.1 protein_id gnl|my_center|LOCUS_17870 <4314 3419 gene locus_tag LOCUS_17880 <4314 3419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002673329.1:beta-ketoacyl-ACP synthase II >Feature sequence174 251 261 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1598 1008 gene locus_tag LOCUS_17890 1598 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 2692 1655 gene locus_tag LOCUS_17900 2692 1655 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680474.1 protein_id gnl|my_center|LOCUS_17900 3101 2697 gene locus_tag LOCUS_17910 3101 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 3193 3639 gene locus_tag LOCUS_17920 3193 3639 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666808.1 protein_id gnl|my_center|LOCUS_17920 3722 4282 gene locus_tag LOCUS_17930 3722 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 >Feature sequence175 516 1202 gene locus_tag LOCUS_17940 516 1202 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680214.1 protein_id gnl|my_center|LOCUS_17940 1199 3277 gene locus_tag LOCUS_17950 1199 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680210.1 protein_id gnl|my_center|LOCUS_17950 3354 3393 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3538 3585 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4253 3603 gene locus_tag LOCUS_17960 4253 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence176 218 60 gene locus_tag LOCUS_17970 218 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 460 1110 gene locus_tag LOCUS_17980 460 1110 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892118.1 protein_id gnl|my_center|LOCUS_17980 1139 2581 gene locus_tag LOCUS_17990 gene trkA 1139 2581 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676352.1 protein_id gnl|my_center|LOCUS_17990 2583 3164 gene locus_tag LOCUS_18000 2583 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18000 3307 3353 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3365 4078 gene locus_tag LOCUS_18010 3365 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18010 >Feature sequence177 1623 214 gene locus_tag LOCUS_18020 gene fliI 1623 214 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678707.1 protein_id gnl|my_center|LOCUS_18020 2575 1643 gene locus_tag LOCUS_18030 gene fliH 2575 1643 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668471.1 protein_id gnl|my_center|LOCUS_18030 3704 2604 gene locus_tag LOCUS_18040 gene fliG 3704 2604 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668469.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence178 195 2015 gene locus_tag LOCUS_18050 195 2015 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254292.1 protein_id gnl|my_center|LOCUS_18050 3598 2135 gene locus_tag LOCUS_18060 3598 2135 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680143.1 protein_id gnl|my_center|LOCUS_18060 <4193 3595 gene locus_tag LOCUS_18070 <4193 3595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680147.1:alpha/beta hydrolase fold domain-containing protein >Feature sequence179 <1 789 gene locus_tag LOCUS_18080 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013967724.1:prolipoprotein diacylglyceryl transferase 828 960 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3027 1048 gene locus_tag LOCUS_18090 gene tkt 3027 1048 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678841.1 protein_id gnl|my_center|LOCUS_18090 3526 3068 gene locus_tag LOCUS_18100 3526 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 >Feature sequence180 <1 2262 gene locus_tag LOCUS_18110 <1 2262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002671244.1:chemotaxis protein CheA 2281 2847 gene locus_tag LOCUS_18120 2281 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18120 2744 2769 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2792 3751 gene locus_tag LOCUS_18130 2792 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18130 >Feature sequence181 <1 939 gene locus_tag LOCUS_18140 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682356.1:elongation factor G 1025 1702 gene locus_tag LOCUS_18150 1025 1702 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670541.1 protein_id gnl|my_center|LOCUS_18150 1763 1790 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2639 1827 gene locus_tag LOCUS_18160 2639 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 2706 3707 gene locus_tag LOCUS_18170 2706 3707 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682256.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence182 1272 487 gene locus_tag LOCUS_18180 1272 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 1630 1379 gene locus_tag LOCUS_18190 1630 1379 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_18190 1769 1924 gene locus_tag LOCUS_18200 1769 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 2122 2670 gene locus_tag LOCUS_18210 2122 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 3263 2703 gene locus_tag LOCUS_18220 3263 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 <4092 3362 gene locus_tag LOCUS_18230 <4092 3362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000153535.1:two-component system response regulator VraR >Feature sequence183 1066 239 gene locus_tag LOCUS_18240 1066 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 1579 1112 gene locus_tag LOCUS_18250 1579 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 1662 3446 gene locus_tag LOCUS_18260 gene lnt 1662 3446 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680216.1 protein_id gnl|my_center|LOCUS_18260 3518 3982 gene locus_tag LOCUS_18270 gene nrdR 3518 3982 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678882.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence184 125 712 gene locus_tag LOCUS_18280 125 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 911 693 gene locus_tag LOCUS_18290 gene infA 911 693 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668257.1 protein_id gnl|my_center|LOCUS_18290 1082 1438 gene locus_tag LOCUS_18300 1082 1438 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679887.1 protein_id gnl|my_center|LOCUS_18300 2346 1483 gene locus_tag LOCUS_18310 2346 1483 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_18310 3662 2355 gene locus_tag LOCUS_18320 3662 2355 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667421.1 protein_id gnl|my_center|LOCUS_18320 3846 3917 gene locus_tag LOCUS_t00250 3846 3917 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence185 2232 1231 gene locus_tag LOCUS_18330 2232 1231 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258797.1 protein_id gnl|my_center|LOCUS_18330 3479 2244 gene locus_tag LOCUS_18340 3479 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence186 875 132 gene locus_tag LOCUS_18350 gene fabG 875 132 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681771.1 protein_id gnl|my_center|LOCUS_18350 1862 906 gene locus_tag LOCUS_18360 1862 906 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681776.1 protein_id gnl|my_center|LOCUS_18360 3396 2119 gene locus_tag LOCUS_18370 3396 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 3992 3495 gene locus_tag LOCUS_18380 3992 3495 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434028.1 protein_id gnl|my_center|LOCUS_18380 >Feature sequence187 58 972 gene locus_tag LOCUS_18390 gene trxB 58 972 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416869.1 protein_id gnl|my_center|LOCUS_18390 1016 2740 gene locus_tag LOCUS_18400 1016 2740 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680883.1 protein_id gnl|my_center|LOCUS_18400 3340 2756 gene locus_tag LOCUS_18410 3340 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 3545 3607 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence188 1037 1054 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1566 1102 gene locus_tag LOCUS_18420 1566 1102 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_18420 1718 2122 gene locus_tag LOCUS_18430 1718 2122 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_18430 2298 3260 gene locus_tag LOCUS_18440 2298 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18440 3185 3218 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3239 3922 gene locus_tag LOCUS_18450 3239 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18450 >Feature sequence189 49 1293 gene locus_tag LOCUS_18460 49 1293 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679056.1 protein_id gnl|my_center|LOCUS_18460 1294 3123 gene locus_tag LOCUS_18470 1294 3123 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203684.1 protein_id gnl|my_center|LOCUS_18470 3148 3525 gene locus_tag LOCUS_18480 3148 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 3450 3482 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3533 3829 gene locus_tag LOCUS_18490 3533 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 >Feature sequence190 280 1440 gene locus_tag LOCUS_18500 280 1440 CDS product EpsG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107949.1 protein_id gnl|my_center|LOCUS_18500 1445 2263 gene locus_tag LOCUS_18510 1445 2263 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811992.1 protein_id gnl|my_center|LOCUS_18510 2263 3123 gene locus_tag LOCUS_18520 2263 3123 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087598.1 protein_id gnl|my_center|LOCUS_18520 3413 3153 gene locus_tag LOCUS_18530 3413 3153 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_18530 3577 3410 gene locus_tag LOCUS_18540 3577 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 3643 3651 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence191 23 190 gene locus_tag LOCUS_18550 23 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 1054 251 gene locus_tag LOCUS_18560 1054 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 1129 1314 gene locus_tag LOCUS_18570 1129 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 2580 1489 gene locus_tag LOCUS_18580 2580 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 2812 2528 gene locus_tag LOCUS_18590 2812 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 3625 2948 gene locus_tag LOCUS_18600 3625 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 3546 3570 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence192 148 432 gene locus_tag LOCUS_18610 gene rpsF 148 432 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669351.1 protein_id gnl|my_center|LOCUS_18610 453 944 gene locus_tag LOCUS_18620 gene ssb 453 944 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669349.1 protein_id gnl|my_center|LOCUS_18620 960 1286 gene locus_tag LOCUS_18630 gene rpsR 960 1286 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669347.1 protein_id gnl|my_center|LOCUS_18630 1373 1900 gene locus_tag LOCUS_18640 1373 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 2116 3450 gene locus_tag LOCUS_18650 gene dnaB 2116 3450 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669313.1 protein_id gnl|my_center|LOCUS_18650 3538 3610 gene locus_tag LOCUS_t00260 3538 3610 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence193 2407 1391 gene locus_tag LOCUS_18660 2407 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 3336 2407 gene locus_tag LOCUS_18670 3336 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668143.1 protein_id gnl|my_center|LOCUS_18670 3352 3432 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence194 29 655 gene locus_tag LOCUS_18680 29 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 681 2075 gene locus_tag LOCUS_18690 681 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 2402 3544 gene locus_tag LOCUS_18700 2402 3544 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence195 <1 1056 gene locus_tag LOCUS_18710 <1 1056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002670719.1:chaperonin GroEL 1188 2762 gene locus_tag LOCUS_18720 1188 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence196 1457 333 gene locus_tag LOCUS_18730 gene sufD 1457 333 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966564.1 protein_id gnl|my_center|LOCUS_18730 2889 1459 gene locus_tag LOCUS_18740 gene sufB 2889 1459 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_18740 <3613 2891 gene locus_tag LOCUS_18750 <3613 2891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966562.1:Fe-S cluster assembly ATPase SufC >Feature sequence197 2466 3125 gene locus_tag LOCUS_18760 2466 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681839.1 protein_id gnl|my_center|LOCUS_18760 >Feature sequence198 740 120 gene locus_tag LOCUS_18770 740 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 1554 757 gene locus_tag LOCUS_18780 1554 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 1689 1708 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1839 3491 gene locus_tag LOCUS_18790 1839 3491 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262518.1 protein_id gnl|my_center|LOCUS_18790 >Feature sequence199 >Feature sequence200 208 251 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 276 647 gene locus_tag LOCUS_18800 276 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18800 865 2496 gene locus_tag LOCUS_18810 865 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 2759 2848 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence201 3283 431 gene locus_tag LOCUS_18820 3283 431 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680747.1 protein_id gnl|my_center|LOCUS_18820 >Feature sequence202 118 1266 gene locus_tag LOCUS_18830 118 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 2777 1467 gene locus_tag LOCUS_18840 2777 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680475.1 protein_id gnl|my_center|LOCUS_18840 <3524 2904 gene locus_tag LOCUS_18850 <3524 2904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880823.1:adenylosuccinate synthase >Feature sequence203 96 1619 gene locus_tag LOCUS_18860 96 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681908.1 protein_id gnl|my_center|LOCUS_18860 1562 1577 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1732 1865 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3051 1939 gene locus_tag LOCUS_18870 3051 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668541.1 protein_id gnl|my_center|LOCUS_18870 >Feature sequence204 <1 1043 gene locus_tag LOCUS_18880 <1 1043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201786535.1:type IA DNA topoisomerase 1276 1518 gene locus_tag LOCUS_18890 1276 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 1410 1432 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1502 2074 gene locus_tag LOCUS_18900 1502 2074 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087381.1 protein_id gnl|my_center|LOCUS_18900 1800 1852 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2117 2596 gene locus_tag LOCUS_18910 2117 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 >Feature sequence205 1150 464 gene locus_tag LOCUS_18920 1150 464 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680333.1 protein_id gnl|my_center|LOCUS_18920 2009 1251 gene locus_tag LOCUS_18930 2009 1251 CDS product DbpA RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680577.1 protein_id gnl|my_center|LOCUS_18930 2933 2034 gene locus_tag LOCUS_18940 2933 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 <3490 2937 gene locus_tag LOCUS_18950 <3490 2937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002667667.1:ATP-dependent Clp protease proteolytic subunit >Feature sequence206 42 443 gene locus_tag LOCUS_18960 42 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971528.1 protein_id gnl|my_center|LOCUS_18960 1363 491 gene locus_tag LOCUS_18970 1363 491 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669381.1 protein_id gnl|my_center|LOCUS_18970 1902 1360 gene locus_tag LOCUS_18980 1902 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 2227 3117 gene locus_tag LOCUS_18990 2227 3117 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670454.1 protein_id gnl|my_center|LOCUS_18990 2981 3006 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence207 469 1350 gene locus_tag LOCUS_19000 469 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 1183 1205 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1380 2564 gene locus_tag LOCUS_19010 1380 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 >Feature sequence208 413 2425 gene locus_tag LOCUS_19020 gene ftsH 413 2425 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666001.1 protein_id gnl|my_center|LOCUS_19020 2494 3150 gene locus_tag LOCUS_19030 2494 3150 CDS product outer-membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673641.1 protein_id gnl|my_center|LOCUS_19030 >Feature sequence209 808 467 gene locus_tag LOCUS_19040 808 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 1095 1382 gene locus_tag LOCUS_19050 1095 1382 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679319.1 protein_id gnl|my_center|LOCUS_19050 1360 1653 gene locus_tag LOCUS_19060 1360 1653 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679318.1 protein_id gnl|my_center|LOCUS_19060 1723 2382 gene locus_tag LOCUS_19070 1723 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 >Feature sequence210 1 885 gene locus_tag LOCUS_19080 gene ugpC 1 885 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_19080 1067 1085 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3133 1235 gene locus_tag LOCUS_19090 3133 1235 CDS product ribonuclease catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678953.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence211 339 1691 gene locus_tag LOCUS_19100 339 1691 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670692.1 protein_id gnl|my_center|LOCUS_19100 1701 2453 gene locus_tag LOCUS_19110 1701 2453 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670690.1 protein_id gnl|my_center|LOCUS_19110 2466 2975 gene locus_tag LOCUS_19120 2466 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 3031 3204 gene locus_tag LOCUS_19130 3031 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 >Feature sequence212 3 332 gene locus_tag LOCUS_19140 3 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 444 1262 gene locus_tag LOCUS_19150 444 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 1363 1632 gene locus_tag LOCUS_19160 1363 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 1619 2629 gene locus_tag LOCUS_19170 1619 2629 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945539.1 protein_id gnl|my_center|LOCUS_19170 2576 2614 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence213 2357 249 gene locus_tag LOCUS_19180 2357 249 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681580.1 protein_id gnl|my_center|LOCUS_19180 >Feature sequence214 822 343 gene locus_tag LOCUS_19190 822 343 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903575.1 protein_id gnl|my_center|LOCUS_19190 1341 892 gene locus_tag LOCUS_19200 1341 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 1598 1855 gene locus_tag LOCUS_19210 1598 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 1877 2407 gene locus_tag LOCUS_19220 1877 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 3204 2530 gene locus_tag LOCUS_19230 3204 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 >Feature sequence215 <1 2193 gene locus_tag LOCUS_19240 <1 2193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_044971495.1:putative glycoside hydrolase 2080 2123 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2162 2551 gene locus_tag LOCUS_19250 2162 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19250 >Feature sequence216 415 666 gene locus_tag LOCUS_19260 415 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963633.1 protein_id gnl|my_center|LOCUS_19260 687 1445 gene locus_tag LOCUS_19270 687 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 1518 2831 gene locus_tag LOCUS_19280 1518 2831 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777343.1 protein_id gnl|my_center|LOCUS_19280 >Feature sequence217 598 1041 gene locus_tag LOCUS_19290 gene tnpA 598 1041 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_19290 <3249 1508 gene locus_tag LOCUS_19300 <3249 1508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009039964.1:Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain 3027 3040 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence218 650 444 gene locus_tag LOCUS_19310 650 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 1152 673 gene locus_tag LOCUS_19320 1152 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 688 734 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1422 2414 gene locus_tag LOCUS_19330 1422 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 2534 2559 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence219 1092 1256 gene locus_tag LOCUS_19340 1092 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 1341 2306 gene locus_tag LOCUS_19350 1341 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 2324 2352 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence220 140 2950 gene locus_tag LOCUS_19360 gene secA 140 2950 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679596.1 protein_id gnl|my_center|LOCUS_19360 1690 1703 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence221 <1 658 gene locus_tag LOCUS_19370 <1 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002678974.1:SLBB domain-containing protein 713 1780 gene locus_tag LOCUS_19380 713 1780 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678975.1 protein_id gnl|my_center|LOCUS_19380 1858 2337 gene locus_tag LOCUS_19390 1858 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 2334 2954 gene locus_tag LOCUS_19400 2334 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 >Feature sequence222 26 1063 gene locus_tag LOCUS_19410 26 1063 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064796.1 protein_id gnl|my_center|LOCUS_19410 1068 1490 gene locus_tag LOCUS_19420 1068 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 1539 2570 gene locus_tag LOCUS_19430 1539 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 2972 2541 gene locus_tag LOCUS_19440 2972 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 >Feature sequence223 336 518 gene locus_tag LOCUS_19450 336 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 545 1381 gene locus_tag LOCUS_19460 545 1381 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_19460 1378 2058 gene locus_tag LOCUS_19470 1378 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 2514 2539 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence224 633 1847 gene locus_tag LOCUS_19480 633 1847 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938142.1 protein_id gnl|my_center|LOCUS_19480 >Feature sequence225 <1 1121 gene locus_tag LOCUS_19490 <1 1121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682257.1:ATP-binding cassette domain-containing protein 1111 2151 gene locus_tag LOCUS_19500 1111 2151 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682259.1 protein_id gnl|my_center|LOCUS_19500 2159 2986 gene locus_tag LOCUS_19510 2159 2986 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956847.1 protein_id gnl|my_center|LOCUS_19510 >Feature sequence226 <1 727 gene locus_tag LOCUS_19520 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000389102.1:O-methyltransferase 1088 813 gene locus_tag LOCUS_19530 1088 813 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359333.1 protein_id gnl|my_center|LOCUS_19530 2207 1176 gene locus_tag LOCUS_19540 2207 1176 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_19540 2335 3069 gene locus_tag LOCUS_19550 2335 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence227 183 635 gene locus_tag LOCUS_19560 183 635 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691751.1 protein_id gnl|my_center|LOCUS_19560 1148 645 gene locus_tag LOCUS_19570 1148 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 2773 1367 gene locus_tag LOCUS_19580 2773 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence228 25 1068 gene locus_tag LOCUS_19590 gene serC 25 1068 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_19590 1115 2293 gene locus_tag LOCUS_19600 1115 2293 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490251.1 protein_id gnl|my_center|LOCUS_19600 3018 2314 gene locus_tag LOCUS_19610 3018 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 >Feature sequence229 2031 1414 gene locus_tag LOCUS_19620 2031 1414 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430090.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence230 734 21 gene locus_tag LOCUS_19630 734 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 1111 731 gene locus_tag LOCUS_19640 1111 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 2099 1191 gene locus_tag LOCUS_19650 2099 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 2862 2134 gene locus_tag LOCUS_19660 2862 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 >Feature sequence231 145 2841 gene locus_tag LOCUS_19670 145 2841 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679058.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence232 2897 933 gene locus_tag LOCUS_19680 2897 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 >Feature sequence233 541 966 gene locus_tag LOCUS_19690 gene ndk 541 966 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_19690 981 2036 gene locus_tag LOCUS_19700 981 2036 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679888.1 protein_id gnl|my_center|LOCUS_19700 >Feature sequence234 1461 85 gene locus_tag LOCUS_19710 1461 85 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022042.1 protein_id gnl|my_center|LOCUS_19710 2802 1597 gene locus_tag LOCUS_19720 2802 1597 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062984.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence235 <1 963 gene locus_tag LOCUS_19730 <1 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679355.1:alanine--tRNA ligase 1069 2148 gene locus_tag LOCUS_19740 1069 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 2169 2684 gene locus_tag LOCUS_19750 gene nusB 2169 2684 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679351.1 protein_id gnl|my_center|LOCUS_19750 >Feature sequence236 2276 2349 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence237 459 665 gene locus_tag LOCUS_19760 459 665 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666823.1 protein_id gnl|my_center|LOCUS_19760 666 1649 gene locus_tag LOCUS_19770 gene miaA 666 1649 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680912.1 protein_id gnl|my_center|LOCUS_19770 >Feature sequence238 <1 1390 gene locus_tag LOCUS_19780 <1 1390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680463.1:primosomal protein N' 2211 1420 gene locus_tag LOCUS_19790 gene truA 2211 1420 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667863.1 protein_id gnl|my_center|LOCUS_19790 >Feature sequence239 <1 865 gene locus_tag LOCUS_19800 <1 865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680521.1:lysine--tRNA ligase 934 958 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1447 962 gene locus_tag LOCUS_19810 1447 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 1526 1590 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2546 1629 gene locus_tag LOCUS_19820 2546 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 >Feature sequence240 32 280 gene locus_tag LOCUS_19830 32 280 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357396.1 protein_id gnl|my_center|LOCUS_19830 2106 283 gene locus_tag LOCUS_19840 2106 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 >Feature sequence241 1440 85 gene locus_tag LOCUS_19850 1440 85 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922363.1 protein_id gnl|my_center|LOCUS_19850 2124 1537 gene locus_tag LOCUS_19860 2124 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 >Feature sequence242 88 585 gene locus_tag LOCUS_19870 gene purE 88 585 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357851.1 protein_id gnl|my_center|LOCUS_19870 786 1883 gene locus_tag LOCUS_19880 gene purM 786 1883 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099415.1 protein_id gnl|my_center|LOCUS_19880 1886 2524 gene locus_tag LOCUS_19890 gene purN 1886 2524 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047940.1 protein_id gnl|my_center|LOCUS_19890 >Feature sequence243 648 181 gene locus_tag LOCUS_19900 648 181 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967909.1 protein_id gnl|my_center|LOCUS_19900 237 249 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 786 882 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1236 2141 gene locus_tag LOCUS_19910 1236 2141 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116510.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence244 133 1629 gene locus_tag LOCUS_19920 133 1629 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128519551.1 protein_id gnl|my_center|LOCUS_19920 1698 1853 gene locus_tag LOCUS_19930 1698 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 1846 2421 gene locus_tag LOCUS_19940 1846 2421 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203468.1 protein_id gnl|my_center|LOCUS_19940 >Feature sequence245 <1 910 gene locus_tag LOCUS_19950 <1 910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679058.1:YidC/Oxa1 family membrane protein insertase note possible pseudo, frameshifted 952 2448 gene locus_tag LOCUS_19960 952 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19960 >Feature sequence246 487 80 gene locus_tag LOCUS_19970 487 80 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_19970 726 484 gene locus_tag LOCUS_19980 726 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 1596 895 gene locus_tag LOCUS_19990 1596 895 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_19990 2498 2064 gene locus_tag LOCUS_20000 2498 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 >Feature sequence247 <1 599 gene locus_tag LOCUS_20010 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010906177.1:aldo/keto reductase 630 744 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 838 1314 gene locus_tag LOCUS_20020 838 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 1340 1963 gene locus_tag LOCUS_20030 1340 1963 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902979.1 protein_id gnl|my_center|LOCUS_20030 2064 2522 gene locus_tag LOCUS_20040 2064 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 >Feature sequence248 333 2261 gene locus_tag LOCUS_20050 333 2261 CDS product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680031.1 protein_id gnl|my_center|LOCUS_20050 >Feature sequence249 <1 1623 gene locus_tag LOCUS_20060 <1 1623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_044971578.1:ATP-dependent RNA helicase <2505 1624 gene locus_tag LOCUS_20070 <2505 1624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048121910.1:HEAT repeat domain-containing protein