COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..58969 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(442..660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS 884..1078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 1092..1934 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764915.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene murB note possible pseudo, frameshifted CDS 1992..3302 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene murA CDS 3486..3947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 4050..5756 product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107711.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 5758..7203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(7205..7849) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(7854..8474) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765865.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene rsmG CDS complement(8492..8758) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766138.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 8840..10078 product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(10055..11356) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107882.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene tilS CDS complement(11353..13038) product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107667.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(13123..13893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(13890..14531) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396078.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(14681..17233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(17439..17825) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763033.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 18040..18741 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764706.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 18753..19160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 19150..19953 product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 19940..20788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 20920..22233 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764912.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 22316..23392 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788814.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene lysA CDS complement(23411..24304) product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761543.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(24295..25323) product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(25316..25549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 25727..26743 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207085.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 26832..28610 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene sppA CDS 28618..29718 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765467.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene lpxK CDS 29768..30583 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761225.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 30600..31523 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761224.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene thiL note possible pseudo, frameshifted CDS 31866..33209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 33240..33572 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene yajC CDS 33608..34594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 34594..35172 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764748.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene coaE CDS complement(35120..35959) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766194.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(35956..36495) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766193.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(36507..36842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(36854..38101) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene thrC CDS complement(38172..39533) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292596.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(39561..40997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(41007..41393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(41377..43827) product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene thrA CDS complement(43830..45410) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763318.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 45649..46245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 46247..47611 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764082.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene radA CDS complement(47688..48875) product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092658.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene purT CDS complement(48944..49900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 note possible pseudo, frameshifted CDS complement(49891..51357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 note possible pseudo, frameshifted CDS 51590..53701 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 assembly_gap 52321..52339 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 53787..54227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(54202..54978) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791872.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(54975..55724) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 55827..56333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 note possible pseudo, frameshifted assembly_gap 56162..56206 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 56255..56431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 note possible pseudo, frameshifted CDS complement(56428..56673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(56633..57424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 note possible pseudo, frameshifted CDS complement(57345..57791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 note possible pseudo, frameshifted CDS complement(57784..58830) product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555792.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 sequence002 source 1..55219 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 219..224 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 324..1109 product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503931.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(1175..1549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 1787..2128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 2125..3195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 3207..4304 product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760933.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene meaB CDS 4442..5320 product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108933.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(5307..5729) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763033.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 5918..6091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 6168..6545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 6551..7570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 7567..8535 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077130071.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(8614..10569) product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109002.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(10670..11032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 11161..11832 product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965814.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 11844..12683 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254593.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(12693..13676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032528599.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(13676..14464) product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203221.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(14461..15000) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203222.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(15018..15947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(16032..17633) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993641.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene mutL note possible pseudo, frameshifted assembly_gap 17707..17728 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(18327..20192) product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764125.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(20218..21561) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760775.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(21686..22459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(22479..23957) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791859.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene guaB CDS complement(24061..24657) product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107938.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(24668..25192) product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767850.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 tRNA complement(25248..25330) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(25396..26301) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(26313..27362) product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(27446..28288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(28346..28840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107200.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(28996..29313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(29317..30324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(30393..31433) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815431.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(31451..33490) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767220.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene metG CDS complement(33540..34478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963974.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(34478..35194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00950 note possible pseudo, frameshifted CDS complement(35181..35606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 note possible pseudo, frameshifted assembly_gap 35228..35255 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 35866..37179 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793004.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 37225..38148 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786611.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 38156..39361 product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202525.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 39414..42431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 42431..43195 product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794868.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 43535..44944 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766268.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 44978..46132 product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783906.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene fucO CDS 46618..47001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(46991..47989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(48004..48234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(48296..48712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(48828..49232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 note possible pseudo, frameshifted CDS complement(49410..50918) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814235.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(51055..52029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 assembly_gap 51942..51951 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(52040..53353) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461729.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene lpdA CDS complement(53350..53676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01120 note possible pseudo, frameshifted CDS complement(53699..54823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 note possible pseudo, frameshifted sequence003 source 1..44374 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 31..303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 330..509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 586..879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 note possible pseudo, internal stop codon, frameshifted assembly_gap 1033..1104 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1141..2388) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203214.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(2477..3307) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202194.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene pyrF CDS complement(3310..4419) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785133.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene prfA CDS 4616..5977 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene tig CDS 6146..6793 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782306.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene clpP CDS 6859..8112 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791864.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene clpX CDS 8156..9124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 note possible pseudo, frameshifted CDS 9099..10358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 note possible pseudo, frameshifted CDS 10358..11023 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762400.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 11050..11679 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107155.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene udk CDS 11691..12521 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760767.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene lptB CDS complement(12499..13086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(13380..14129) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202815.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 14167..14769 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene yihA CDS 14828..14983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 15098..17335 product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787468.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 17319..18158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(18238..19425) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941495.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(19422..22511) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(22523..23596) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803349.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(24183..24782) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295313.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(24775..24963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(25323..26627) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202760.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(26624..26989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 note possible pseudo, frameshifted CDS complement(26979..27683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 note possible pseudo, frameshifted CDS complement(27667..27924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 note possible pseudo, frameshifted CDS 28208..30436 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032850355.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 30449..31123 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(31125..32816) product lipid A phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107999.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(32803..33987) product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695909.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 34199..35152 product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202513.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(35115..35729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(35650..35910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01490 assembly_gap 36096..36112 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 36205..36660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 36657..36923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 37018..38040 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789293.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene pheS CDS 38063..38707 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767855.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene nth CDS 38746..40113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 40155..42551 product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(42554..43429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 note possible pseudo, frameshifted CDS complement(43532..44077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(44191..44373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 sequence004 source 1..39359 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(917..1603) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791123.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 1680..2474 product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791347.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(2478..2849) product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787945.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(2989..4494) product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768282.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(4532..7489) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108255.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 assembly_gap 7301..7319 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7798..8769 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761539.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 8814..9917 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203749.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene ychF CDS complement(10100..11131) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203190.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 11266..12924 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107663.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(12933..16613) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729624.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene metH CDS complement(16781..17821) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203190.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(17829..19937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(20102..21124) product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(21199..21705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(21702..22208) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766431.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(22205..24343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(24374..26665) product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766293.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 26897..28099 product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene ilvA CDS complement(28248..30029) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene rpsA CDS complement(30326..32917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(33015..33617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(33922..35040) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202124.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 note possible pseudo, frameshifted CDS complement(34949..35296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 note possible pseudo, frameshifted CDS complement(35396..36388) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764142.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene tsf CDS complement(36420..36593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 assembly_gap 36642..36804 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(37331..37717) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene rpsI CDS complement(37727..38206) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782434.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene rplM CDS complement(38432..38668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 sequence005 source 1..38492 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 123..731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(722..1714) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785910.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(1916..2788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(2865..4406) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108979.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(4396..5994) product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790465.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(5981..6841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781085.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(6848..7558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781085.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(7623..10007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 10322..10924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 10933..11754 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107719.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(11805..12245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(12318..14909) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764749.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene clpB CDS 15056..15937 product DUF5106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793053.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 15942..16451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 16473..17564 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202407.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene mnmA CDS 17596..18186 product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 18214..19596 product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760003.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 19589..20338 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760001.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 20341..21147 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759991.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene kdsA CDS 21176..22768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(22732..23049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 note possible pseudo, frameshifted CDS complement(23027..23272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 note possible pseudo, frameshifted CDS complement(23285..23905) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene recR CDS 24036..24875 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202230.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene panC assembly_gap 25153..25196 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 25460..25604 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 25645..26007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 note possible pseudo, frameshifted CDS 26045..26509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 note possible pseudo, frameshifted CDS 26540..27421 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767914.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene folD CDS 27432..28277 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 28284..29216 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763724.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 29226..29519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 assembly_gap 29360..29386 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 29479..29757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 assembly_gap 29763..29776 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 29941..30055 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 30646..31182 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478802.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 31167..31688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 31694..32596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 32598..33341 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109289.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(33354..34265) product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene dinD CDS complement(34306..34839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 note possible pseudo, frameshifted CDS complement(34880..36271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 note possible pseudo, frameshifted assembly_gap 34888..34907 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 35596..35608 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(36287..37567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 assembly_gap 37721..37809 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence006 source 1..38069 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(59..1471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(1464..2171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(2173..2766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(3130..3729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 3903..5192 product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916221.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(5266..8007) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(8153..8662) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906361.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 8795..10567 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107752.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 10713..11201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(11202..11678) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762228.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene cdd CDS complement(11675..13309) product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767963.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(13341..13991) product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763832.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(14007..15395) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203550.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene asnS CDS complement(15433..16944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(17156..18499) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791759.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene purB CDS complement(18530..19195) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(19210..21522) product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202810.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 21689..22282 product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802804.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 22279..22848 product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 22851..24155 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(24199..24573) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762436.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(24586..25947) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107706.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 26065..26922 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787611.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 26951..28663 product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765636.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 28735..29679 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768748.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(29848..30699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(30705..31247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 assembly_gap 31257..31376 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 32490..35726 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813489.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 35807..37861 product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791949.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 sequence007 source 1..36957 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(140..502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 note possible pseudo, frameshifted assembly_gap 741..815 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1040..2383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(2429..3181) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene rlmB CDS complement(3193..4854) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107738.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene recN CDS complement(4860..5711) product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015543.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(5762..6469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 note possible pseudo, frameshifted CDS complement(6385..6915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 note possible pseudo, frameshifted assembly_gap 6520..6526 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6908..7690) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(7706..8830) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762412.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene dnaN assembly_gap 8961..9001 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9197..11464 product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107585.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 11533..13584 product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108964.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 13691..14152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02660 note possible pseudo, frameshifted assembly_gap 14385..14468 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 14628..14667 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 14833..14857 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 15253..15582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(15569..15757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 assembly_gap 15794..15838 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15854..16393) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790634.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(16377..17000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(17076..17267) product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766883.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 17378..17824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 17799..18764 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108113.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 18761..19534 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478755.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(19539..20843) product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763481.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene nqrF CDS complement(20848..21465) product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763480.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene nqrE CDS complement(21485..22111) product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(22117..22818) product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(22815..24029) product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763477.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(24055..25389) product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787198.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 25734..26093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02810 note possible pseudo, frameshifted assembly_gap 25970..25990 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 26132..26521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 note possible pseudo, frameshifted CDS 26561..27277 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763544.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 27284..28012 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765212.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 28055..28909 product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792001.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(29055..30575) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841405.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(30677..32302) product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784160.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(32411..35680) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201969.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 35893..36312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 note possible pseudo, frameshifted sequence008 source 1..34819 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 548..642 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 897..2384 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930448.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 2475..3755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(4280..5281) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032663510.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 5373..6239 product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064377.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 6236..6658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 6766..7017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 7104..7310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 note possible pseudo, frameshifted CDS complement(7376..8278) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 8516..9919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 9925..10965 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705392.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 11185..13395 product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201924.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(13471..16674) product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799108.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene carB CDS 17132..19801 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 20006..20572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(20648..21553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(22136..24235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 24365..25684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 25665..26360 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787526.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 26510..27412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(27485..28732) product DUF4934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767326.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(28889..31078) product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765057.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(31185..32423) product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788259.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(32423..33196) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202959.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene dapF note possible pseudo, frameshifted assembly_gap 33842..33952 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(34116..34616) product 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762345.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 assembly_gap 34631..34651 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence009 source 1..34718 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(102..1004) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761920.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene xerD CDS complement(1014..1523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(1507..4077) product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108484.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(4095..5582) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291350.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene cysS CDS complement(5597..5911) product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(5912..6583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(6583..7269) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762585.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 tRNA 7650..7725 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 7917..8969 product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(8990..9454) product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993802.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 9545..10162 product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 10164..11093 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203664.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(11066..11614) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(11623..11799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 note possible pseudo, frameshifted CDS complement(11796..12878) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785334.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene serS note possible pseudo, frameshifted CDS complement(12892..13341) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763705.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(13461..14327) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(14397..15410) product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108506.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(15410..17263) product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108505.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(17386..18750) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766200.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(18737..19507) product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(19510..21201) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791194.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(21210..24188) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797422.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(24316..25692) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790898.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(25689..26684) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759775.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(26716..28479) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802230.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene lysS CDS complement(28589..29788) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203338.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene pncB CDS complement(29776..30333) product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015162.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(30327..30974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(30964..33198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(33354..34109) product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783491.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 misc_feature complement(34179..>34718) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761732.1:fumarate reductase/succinate dehydrogenase flavoprotein subunit locus_tag LOCUS_03440 sequence010 source 1..32529 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 265..329 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3108..5039) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815393.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(5050..5673) product HmuY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793333.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(5666..6502) product calycin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793335.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 6746..7699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 7757..8062 product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107149.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 8055..8408 product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766714.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(8518..8955) product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760391.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(8991..9434) product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760391.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(9498..10088) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(10109..11806) product aspartate-alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107422.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene aspT CDS complement(11879..12385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 12487..12810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(12803..14503) product aspartate-alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107422.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene aspT CDS complement(14551..15150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 15386..16462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 16616..17476 product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779810.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 17816..18820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 19043..21904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(21905..23953) product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764525.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 24055..24732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(24798..25700) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786279.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(25775..28771) product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108299.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(28779..30284) product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259102.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 30454..31911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067457.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 misc_feature complement(31916..>32529) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787518.1:iron ABC transporter permease locus_tag LOCUS_03690 sequence011 source 1..32392 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(170..412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 note possible pseudo, frameshifted CDS complement(737..1174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 note possible pseudo, frameshifted CDS complement(1257..2366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(2402..2773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(2851..4236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 note possible pseudo, frameshifted assembly_gap 2861..2937 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3385..3423 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4283..4567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(4449..5123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(5212..7059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 note possible pseudo, frameshifted CDS complement(7221..7877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 note possible pseudo, frameshifted CDS complement(7940..9058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03790 note possible pseudo, frameshifted assembly_gap 8280..8308 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9010..9918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03800 note possible pseudo, frameshifted assembly_gap 9112..9184 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(10031..10408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03810 note possible pseudo, frameshifted CDS complement(10389..10943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 note possible pseudo, frameshifted CDS complement(10943..13267) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791192.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene topA CDS complement(13418..13996) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 14123..15136 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764710.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 15225..15632 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105100245.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(15629..16174) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203456.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(16171..17199) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004305537.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(17337..17534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(17676..19385) product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788185.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(19413..19847) product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763578.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(19885..20877) product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 21011..23023 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765723.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene ligA CDS 23063..23659 product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108458.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(23740..24399) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(24458..25297) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107747.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 25406..26227 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025876514.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 26305..26604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(27084..27494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 27637..27996 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763033.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(28013..28705) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475996.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 28875..29981 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108203.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 30020..31714 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789735.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(31789..32355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 sequence012 source 1..31866 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(254..826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 1125..1925 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788200.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene bamD CDS 1956..2291 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 2437..2712 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791955.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene rpsO CDS 2910..3569 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788593.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 3608..4255 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109031.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene rpe CDS 4291..6420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04110 note possible pseudo, frameshifted CDS 6441..6665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 note possible pseudo, frameshifted CDS 6652..7065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 note possible pseudo, frameshifted CDS 7094..7705 product LolA-like putative outer membrane lipoprotein chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109203.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 7732..8673 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785383.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene trxB CDS 8839..10866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 note possible pseudo, frameshifted assembly_gap 11332..11393 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11814..13070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 13100..15298 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795983.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 15300..16631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 16628..17539 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795937.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene miaA CDS 17536..18495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(18467..18946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 19050..19880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(19945..20613) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203643.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 assembly_gap 19970..19974 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 20686..21336 product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791447.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 21446..22225 product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(22272..23066) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272317.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 23154..24236 product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456217.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 24310..25266 product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766920.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene metF CDS 25502..26413 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 26416..29334 product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107600.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 29406..30443 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203488.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene hemW CDS complement(30451..30924) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963965.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene rlmH CDS 30943..31836 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762206.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene nadC sequence013 source 1..29024 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 236..1588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 assembly_gap 239..255 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1600..3222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 3233..3844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 assembly_gap 4083..4116 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4716..5345 product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966717.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(5396..5677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 6350..9298 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 9451..10116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 note possible pseudo, frameshifted assembly_gap 10092..10098 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10106..10519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 note possible pseudo, frameshifted CDS 10773..13739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(13742..14152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(14238..14426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(14579..15160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(15114..15737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 16034..16243 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789734.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 16324..17268 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202106.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene rsgA CDS 17408..19102 product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797091.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene sulP CDS 19111..19470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(19625..22249) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796226.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene alaS CDS 22352..22687 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831050.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 22760..23335 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203275.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 23332..23886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 24008..26830 product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 sequence014 source 1..28789 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 375..469 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 609..641 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 931..1257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 1540..2022 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene ybaK CDS 2019..3095 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802245.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene aroC CDS 3101..4036 product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761007.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(3984..5051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(5067..6575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(6649..7479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(7483..8922) product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene gldK CDS complement(8928..9923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(9920..10636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 10848..11981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 note possible pseudo, frameshifted CDS 11954..12670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 note possible pseudo, frameshifted CDS complement(12777..13847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 14059..15597 product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786397.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 15594..16019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 16022..17458 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene rpoN CDS 17515..18084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 assembly_gap 18145..18151 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 18341..18544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 note possible pseudo, frameshifted CDS 18562..20244 product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108331.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 20241..21278 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784375.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene ribD CDS 21345..21860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 21873..22109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797802.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 22234..22593 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784350.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 22700..24364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 24523..26613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 26863..27489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(27574..28176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04830 assembly_gap 28189..28388 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence015 source 1..26218 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 503..1411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 1408..2235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 2246..3193 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108316.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene msrB assembly_gap 3557..3615 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3796..4377) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203642.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 4582..7827 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801316.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 7844..9637 product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790207.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(9762..10343) product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(10413..11120) product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072997.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(11132..12544) product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 12893..13099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 13096..13542 product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene tnpA CDS 14088..14738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 14772..18215 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202528.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 18242..20059 product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202534.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 20282..20488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 20623..20811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 20842..21495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 21502..21726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 22197..22574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 22607..23422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 23413..24579 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761753.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 24576..26096 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795907.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 sequence016 source 1..24876 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..4328 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_069129909.1:GLUG motif-containing protein locus_tag LOCUS_05060 CDS 4346..5350 product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108603.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(5353..6027) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993029.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene trmD CDS complement(6024..6929) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108326.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(6910..8388) product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767085.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(8385..9551) product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201998.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 9705..10700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(10702..11163) product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173947.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(11150..11914) product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811165.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene cybH CDS complement(11924..13732) product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502532.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(13717..14802) product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338265.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(14834..15880) product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933452.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene hypE CDS complement(15877..16998) product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933454.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene hypD CDS complement(16976..17290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 17445..23186 product DUF3320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203358.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 23304..24854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 sequence017 source 1..22867 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 213..222 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 457..507 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 537..854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 note possible pseudo, frameshifted CDS 847..2073 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763621.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 2088..3335 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108314.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 3371..4474 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 4487..5791 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 5961..6659 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 6724..7614 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109171.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(7881..11906) product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203260.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(12042..13754) product aspartate-alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786308.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene aspT CDS complement(13838..14761) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813933.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene queG CDS complement(14772..15395) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783668.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(15405..18914) product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108712.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 19146..19658 product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796492.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene argR CDS 19664..20605 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762696.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene argC CDS complement(20615..22810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05360 sequence018 source 1..22209 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 219..237 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 420..472 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(785..1351) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657326.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(1432..2388) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107655.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(2498..2890) product DUF1232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705009.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(2970..4319) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 4558..5037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(5034..5630) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948225.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 5744..7624 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555875.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 7848..8330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(8398..9039) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765911.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(9103..10320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 note possible pseudo, frameshifted CDS complement(10308..10703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 10783..11886 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763566.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(11984..13348) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784864.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene mgtE CDS complement(13348..14139) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760928.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene rsmA CDS complement(14182..15345) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788940.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene nagA CDS 15586..15819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 15809..16147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(16175..16579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(16684..18024) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108845.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(18063..18788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(18785..20290) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201932.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(20662..20979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 note possible pseudo, frameshifted assembly_gap 20688..20701 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(21126..22160) product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681377.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 sequence019 source 1..21915 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 449..1495 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 1508..2617 product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785234.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene recF CDS 2622..2912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 2924..3394 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791034.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 3437..5203 product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203704.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 5279..5878 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783748.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 5829..6824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 6824..7837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 7847..8338 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764452.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene ribH CDS complement(8339..10009) product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(10039..10800) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694490.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 11037..11477 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108739.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene ybeY CDS 11474..13354 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762875.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene mnmG CDS 13335..13943 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762874.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 13963..15774 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962398.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene uvrC CDS 15818..16825 product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796268.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 16863..17978 product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene pdxA CDS 18127..18816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 18809..19408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 19398..20309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 20439..21782 product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 sequence020 source 1..21698 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 179..257 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 642..780 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 945..1006 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1160..1846 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759971.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 2367..3932 product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767001.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 3929..4636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(4730..5728) product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763359.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(5834..6667) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393681.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(6779..6970) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782152.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene rpsU CDS complement(6991..7224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 7223..9436 product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067209.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 9457..11235 product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene fucI CDS 11296..12597 product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201906.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene fucP CDS complement(12658..16152) product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202755.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(16210..16641) product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764143.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(16605..17687) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763566.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(17997..18236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(18301..18648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(18653..18970) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798232.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 19496..20050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109081.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 20055..20381 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764277.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 assembly_gap 20544..20561 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 20897..21253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05990 sequence021 source 1..21662 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1065..1406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 note possible pseudo, frameshifted CDS complement(1425..2261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 2552..4750 product glycoside hydrolase family 20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107900.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 4753..5424 product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761471.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 5460..8087 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203750.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene mutS CDS complement(8095..8556) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784733.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(8553..9467) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801215.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(9448..10629) product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(10710..11723) product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108789.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene pdxB CDS complement(11705..12175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(12705..13988) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796998.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene purD CDS complement(13998..15536) product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108720.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(15559..16479) product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762864.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(16527..17741) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109012.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(17762..18814) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760823.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(18946..19959) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109013.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(19972..20466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 note possible pseudo, frameshifted CDS complement(20463..21425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 note possible pseudo, internal stop codon, frameshifted assembly_gap 20503..20520 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence022 source 1..21620 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(420..1364) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964468.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(1364..1951) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792010.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 2072..3433 product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212619.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene dacB CDS 3479..4165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 4167..4895 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene rsmI CDS 4928..5791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(5840..6424) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199350787.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene ruvC CDS complement(6421..6729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(6726..7229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(7236..8003) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203723.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(8000..8266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(8408..9067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 9490..11112 product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793275.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 assembly_gap 10100..10165 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11141..13696 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803825.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 13812..14588 product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793749.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 14582..15487 product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765720.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(15580..16125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(17239..19203) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 tRNA complement(19272..19345) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(19528..20226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(20210..20680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 misc_feature complement(20693..>21620) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267789.1:non-ribosomal peptide synthetase locus_tag LOCUS_06380 sequence023 source 1..20937 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1012 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008768057.1:DNA polymerase IV locus_tag LOCUS_06390 CDS 1058..1411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 note possible pseudo, frameshifted CDS 1375..1845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 note possible pseudo, frameshifted CDS complement(1895..2335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 assembly_gap 2079..2094 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2467..5535) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789008.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(5677..7158) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761349.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(7155..8204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(8209..11262) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798729.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(11421..12479) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203162.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(13198..14199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 assembly_gap 14254..14263 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 14852..15005 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 16082..16140 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 16502..17521 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107518.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene tsaD CDS 17541..18791 product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202865.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(18886..19608) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786188.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(19682..20530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 sequence024 source 1..20882 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(666..1757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(1966..3255) product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(3347..4483) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene galK CDS 4634..6520 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202956.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(6595..7077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(7087..7887) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791692.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene mdh assembly_gap 7901..7956 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8326..9618 product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(9615..10934) product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202431.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(11637..12131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 note possible pseudo, frameshifted assembly_gap 12154..12161 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12308..12610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 note possible pseudo, frameshifted CDS complement(12540..13421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 note possible pseudo, frameshifted assembly_gap 12777..12806 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 13430..13483 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA complement(14173..14257) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 assembly_gap 14573..14703 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15256..15738) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(15759..16448) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167232.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene mtnN CDS 16529..17374 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760470.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(17441..18775) product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555756.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 misc_feature complement(18854..>20882) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767789.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase locus_tag LOCUS_06680 sequence025 source 1..20394 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(400..927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(964..3342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(3359..3940) product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108650.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(3969..6740) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203753.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene leuS CDS complement(6768..7712) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802044.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene nadA CDS complement(7847..8116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(8119..8772) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791972.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene upp CDS complement(8798..10162) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(10276..11436) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(11433..12275) product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764890.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 12526..13308 product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864239.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(13315..14553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(14646..15200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(15200..15580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(15577..16071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(16071..16955) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762870.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene deoC CDS complement(16970..17329) product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783700.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(17326..17778) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796976.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene dtd CDS complement(17788..18177) product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764989.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(18190..19560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(19698..20336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 sequence026 source 1..19042 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(17..2254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(2336..3655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(3684..5402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(5430..5942) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963471.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(5948..6670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(6680..6904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 7211..8743 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792044.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene purH CDS 8777..9796 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792050.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 9868..10725 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792052.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene mreC CDS 10732..11253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 11237..13099 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene mrdA CDS 13080..14546 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792061.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene rodA CDS 14604..15248 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786014.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 15245..15904 product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813856.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 16105..16767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 17036..17443 product DUF4332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946351.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 assembly_gap 17378..17410 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17571..18971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 sequence027 source 1..17731 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 595..724 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 988..1317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 1271..2590 product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764324.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene trkA CDS 2590..4065 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769710.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 4136..5725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 note possible pseudo, frameshifted CDS 5736..6941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 note possible pseudo, frameshifted CDS 6992..8299 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107846.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 assembly_gap 8415..8505 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8950..10317) product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787721.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(10287..10910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(10988..13405) product DPP IV N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839992.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 13619..14176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769509.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(14185..15234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 assembly_gap 15289..15437 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15601..16080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 assembly_gap 16093..16163 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(16581..16757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 note possible pseudo, frameshifted assembly_gap 16819..16976 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence028 source 1..17372 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 269..334 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 488..1108 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene rplD CDS 1128..1418 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007747932.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene rplW CDS 1425..2252 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791545.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene rplB CDS 2275..2541 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene rpsS CDS 2584..2994 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558069.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene rplV CDS 2997..3743 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782201.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene rpsC CDS 3777..4208 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558067.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene rplP CDS 4215..4412 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762039.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene rpmC CDS 4421..4678 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770213.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene rpsQ CDS 4681..5046 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296340.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene rplN CDS 5070..5390 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene rplX CDS 5390..5938 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675434.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene rplE CDS 5958..6227 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene rpsN assembly_gap 6328..6344 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6357..6668 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782213.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene rpsH CDS 6685..7248 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765429.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene rplF CDS 7269..7610 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791562.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene rplR CDS 7616..8134 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene rpsE CDS 8146..8325 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296332.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene rpmD CDS 8343..8789 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762046.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene rplO CDS 8795..10147 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762047.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene secY CDS 10178..10960 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108453.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene map CDS 10973..11191 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene infA CDS 11363..11743 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296328.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene rpsM CDS 11753..12142 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene rpsK CDS 12316..12921 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762050.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene rpsD CDS 12944..13936 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762051.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 13943..14470 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762052.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene rplQ CDS 14688..15983 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785741.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene eno CDS complement(16065..16922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07480 sequence029 source 1..17027 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 417..2591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(2685..3071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 3213..4127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 note possible pseudo, frameshifted CDS 4195..4674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 note possible pseudo, frameshifted CDS 4922..6178 product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080707197.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 6175..7143 product DUF5119 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927908.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 7201..7371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 7380..8273 product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303108.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 note possible pseudo, frameshifted CDS complement(8348..8893) product DUF3332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765673.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(8917..10203) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802904.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(10316..11482) product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764417.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(11494..12348) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764240.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 12642..13076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 note possible pseudo, frameshifted assembly_gap 13028..13033 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(13277..14899) product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762276.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(15193..15456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(15623..16357) product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784670.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(16354..16926) product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786205.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 sequence030 source 1..16997 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 89..688 product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212230.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene ureE CDS 688..1404 product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212231.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 1452..2075 product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212232.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene ureG CDS 2082..3041 product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815718.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 3067..4047 product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815719.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene yut CDS 4050..5432 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728727.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 5448..6422 product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941934.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 6437..7228 product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941935.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene cbiQ CDS 7232..7933 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941936.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 7983..8738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 note possible pseudo, frameshifted CDS 8701..9858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07760 note possible pseudo, frameshifted CDS 10220..10567 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795194.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene ssb CDS 10591..11751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07780 note possible pseudo, frameshifted assembly_gap 11639..11658 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11833..12567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 note possible pseudo, frameshifted CDS 12551..13903 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108187.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(13882..14478) product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783983.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(14480..15514) product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404472.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(15729..16130) product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765511.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(16124..16786) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene ung tRNA 16872..16944 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 sequence031 source 1..16564 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 601..1380 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202775.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(1377..2594) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(2594..5359) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796991.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene polA CDS complement(5407..5892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(6020..7564) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(7569..8549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(8672..9331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(9328..9711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(9745..10395) product DUF4294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201836.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(10489..11958) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108697.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene nadB assembly_gap 10498..10584 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12001..13341) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762738.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(13349..14167) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765576.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene panB CDS complement(14214..14915) product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108550.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(14938..15480) product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760894.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(15471..16274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 sequence032 source 1..16547 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 647..1285 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784381.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene pyrE CDS 1306..1725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 1722..2207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 2263..3063 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203333.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 tRNA 3146..3220 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 3464..4384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 4395..6284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 6422..6727 product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107149.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 7105..9183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 9253..10176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 note possible pseudo, frameshifted CDS 10116..10412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 note possible pseudo, frameshifted assembly_gap 10126..10150 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10409..11620 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704482.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(11738..12331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(12446..13789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(13952..15421) product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109168.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(15638..16522) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761561.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene dapA sequence033 source 1..16261 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..691 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202940.1:bifunctional fucokinase/fucose-1-phosphate guanylyltransferase locus_tag LOCUS_08150 assembly_gap 617..656 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(669..1421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 note possible pseudo, frameshifted CDS complement(1566..1934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 note possible pseudo, frameshifted CDS complement(1946..2464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(2439..3047) product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797930.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene nadD CDS complement(3059..3640) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790592.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene gmk CDS complement(3660..4535) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769918.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 4612..5307 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766373.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene tsaB CDS complement(5304..5726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(5874..6149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(6146..6970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(6972..7349) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804269.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(7363..8193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(8190..9047) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770315.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 9145..9804 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109215.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene mazG note possible pseudo, frameshifted CDS 10037..10375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 assembly_gap 10587..10654 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10683..10919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 note possible pseudo, internal stop codon, frameshifted assembly_gap 10885..10891 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10894..11175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 note possible pseudo, internal stop codon, frameshifted CDS 11283..12335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08330 note possible pseudo, internal stop codon, frameshifted assembly_gap 12150..12191 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12313..12660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 12660..12839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(12998..14011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 note possible pseudo, frameshifted CDS complement(13915..14934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 note possible pseudo, frameshifted CDS 15252..16028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 note possible pseudo, frameshifted sequence034 source 1..16171 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 148..190 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 541..605 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 905..1081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 1201..2034 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(2166..2843) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797003.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(2840..3724) product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108714.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(3711..4562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 4789..5694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 5702..5995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 6387..7157 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405060.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 7164..7727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 7631..8767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 8794..9984 product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404923.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 10000..13572 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107458.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene ileS CDS 13922..14233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 note possible pseudo, frameshifted CDS 14316..15035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 misc_feature complement(15145..>16171) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005798520.1:glutamine--tRNA ligase/YqeY domain fusion protein locus_tag LOCUS_08530 sequence035 source 1..15946 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(478..975) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760349.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene bcp CDS complement(1201..4110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(4079..6487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(6591..6869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(7034..7513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(7529..7957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(8001..8564) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(8599..9780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802082.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(9783..11003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 note possible pseudo, frameshifted CDS complement(11005..12387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08630 note possible pseudo, frameshifted CDS complement(12384..12926) product DUF4924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786016.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 assembly_gap 12852..12876 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12901..14466) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(14471..15799) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787452.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 sequence036 source 1..14990 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 299..436 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 709..1572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 1864..2859 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 2891..3775 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 3786..4775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202862.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 4781..5767 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 5788..6261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 6218..6952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 6936..7799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 7802..9625 product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765731.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 9622..10410 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765730.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 10533..10790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787898.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 10853..11977 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765729.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(11979..12338) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804269.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(12345..13115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(13112..13951) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770315.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(13965..14495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 assembly_gap 14503..14542 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence037 source 1..14487 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 202..1554 product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 1620..2105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 2102..2584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 2620..3378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 3510..4106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(4084..5280) product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785790.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 5583..6497 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784016.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene rsmH CDS 6523..6870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 6867..8909 product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108840.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 assembly_gap 8127..8136 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8938..9624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 note possible pseudo, frameshifted assembly_gap 9525..9551 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9633..10355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 note possible pseudo, frameshifted CDS 10373..11635 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796732.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene mraY CDS 11638..12192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 note possible pseudo, frameshifted CDS 12149..12727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08960 note possible pseudo, frameshifted assembly_gap 12160..12175 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12652..12969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 note possible pseudo, frameshifted CDS 12995..14005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08980 note possible pseudo, frameshifted CDS 14016..14294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 note possible pseudo, frameshifted sequence038 source 1..14458 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(378..800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 1018..2916 product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767598.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene speA CDS 2919..3689 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785168.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene truA CDS 3703..5286 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 5308..6486 product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789686.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 6492..7580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 7597..7938 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790409.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene queD CDS 7932..8495 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840540.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(8654..10273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964295.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(10307..11302) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763547.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(11345..11563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 11856..13154 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 assembly_gap 13782..13917 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence039 source 1..14450 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 233..406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 541..1080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(1166..2122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(2237..2758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(3040..3459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(3555..4442) product YwqG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799764.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 4667..4936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(5377..6780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(6773..7015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 assembly_gap 7283..7427 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7537..8892 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303152.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 8882..9562 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107418.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 9563..9862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 9849..10322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(10422..11768) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108638.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(11816..12046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(11973..12350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(12538..14145) product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795092.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 sequence040 source 1..13870 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 299..1486 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_229032746.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene recA CDS 1493..2521 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783520.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 2518..2793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 2795..3214 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761921.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene aroQ CDS 3211..4236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 4221..4853 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765299.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(4923..5495) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202636.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(5598..6914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(6911..9904) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261805.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(10164..11123) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096849.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 note possible pseudo, frameshifted CDS 11362..12138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 sequence041 source 1..13836 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 56..1444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 1448..2044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 2041..2505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(2502..4919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(4930..6024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(6041..7045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(7045..8106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(8126..9139) product DUF5119 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109634.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(9136..10305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 10588..13800 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 sequence042 source 1..13633 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788278.1:tryptophan synthase subunit beta locus_tag LOCUS_09500 CDS 1160..2575 product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788280.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 2575..3153 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 3157..4152 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803789.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene trpD CDS 4157..4942 product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765048.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene trpC CDS 4926..5618 product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202963.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 5593..6372 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788291.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene trpA CDS complement(6353..7390) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801668.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(7397..8227) product DUF3316 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762529.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(8252..10957) product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032528589.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(11096..11809) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768977.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(11835..13100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09610 note possible pseudo, frameshifted misc_feature complement(12982..>13633) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202920.1:phenylalanine--tRNA ligase subunit beta note possible pseudo, frameshifted locus_tag LOCUS_09620 sequence043 source 1..13503 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(270..2120) product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108132.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene mutA CDS complement(2311..2772) product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene smpB CDS complement(2800..3357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 3461..3886 product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785768.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(3961..4548) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087639.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene folE CDS complement(4550..5047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(5211..5888) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760849.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene tpiA note possible pseudo, frameshifted CDS complement(5976..7256) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(7246..7800) product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109023.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(8167..8340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(8518..9747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(9789..12251) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787886.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene gyrA assembly_gap 12258..12316 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 12479..12498 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12621..13358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 note possible pseudo, frameshifted assembly_gap 13298..13311 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence044 source 1..13439 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(65..409) product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766714.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(402..701) product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107149.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 1370..4489 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 4508..6109 product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768282.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 6134..7015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 assembly_gap 7220..7254 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7420..7872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(7869..8195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 assembly_gap 8246..8285 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8561..8869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 8877..9395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 note possible pseudo, frameshifted CDS 9420..9710 product DUF3098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762818.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 9713..10546 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767449.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 10556..11275 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783635.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene truB CDS 11310..12362 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783637.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene queA CDS complement(12590..13330) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962443.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene recO sequence045 source 1..13335 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 657..2456 product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202130.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 2538..3932 product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788605.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 3968..4918 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene cysK CDS complement(4920..5660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 5746..6474 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108359.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 6628..7953 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202308.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 8001..8975 product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760314.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene floA CDS 8989..10437 product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203233.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 10441..11253 product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786401.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 11256..12011 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene kdsB CDS 12008..13303 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202792.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 sequence046 source 1..13282 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(338..553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 note possible pseudo, frameshifted assembly_gap 554..655 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1397..1410 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1457..1966) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789793.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(2132..2734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 note possible pseudo, frameshifted assembly_gap 2148..2171 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2734..3816) product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760854.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(3845..5029) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760855.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(5019..5867) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993542.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(6131..7498) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene hisS CDS complement(7504..10125) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801208.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 tRNA 10363..10437 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(10614..13079) product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202546.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene galB sequence047 source 1..12747 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(632..1468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(1526..2407) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(2416..3156) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269488.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 assembly_gap 2612..2618 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3300..4517) product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 4601..6217 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763401.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 6220..6513 product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760502.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(6501..6980) product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761554.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 7023..8066 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene holA CDS complement(8059..8673) product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765085.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(8758..10716) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107334.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 10898..11446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(11451..12392) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767386.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 sequence048 source 1..12572 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 225..2627 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229518.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(2797..3024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(3465..3632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 note possible pseudo, frameshifted CDS complement(3586..4845) product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794507.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 note possible pseudo, frameshifted CDS complement(5036..6169) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 assembly_gap 6550..6585 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6838..6869 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7104..7682) product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780311.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(7746..8180) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815090.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(8266..8637) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361979.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(8621..9661) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840521.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene rlmN CDS complement(9664..10692) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787710.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(10696..11421) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202221.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 11510..12076 product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 12080..12571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 sequence049 source 1..12404 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 760..3123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 3362..4240 product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648596.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene rhuM CDS 4684..5772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10370 assembly_gap 4794..4806 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6008..6063 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6174..6674) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255233.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(6678..7871) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795161.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(7885..8238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(8235..10505) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761713.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene rnr misc_feature complement(10788..>12404) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783987.1:DNA topoisomerase (ATP-hydrolyzing) subunit B locus_tag LOCUS_10420 sequence050 source 1..12305 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 102..704 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763511.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(784..1182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10440 note possible pseudo, frameshifted CDS complement(1447..2184) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(2194..3615) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 3732..4487 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 4504..5478 product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764761.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(6667..6939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(7500..7778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(7882..10032) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202602.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(10048..11247) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769686.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 misc_feature complement(11232..>12305) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813548.1:1-acyl-sn-glycerol-3-phosphate acyltransferase locus_tag LOCUS_10530 sequence051 source 1..12237 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(566..2005) product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109230.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 2196..2738 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785529.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene hpt CDS 2778..3359 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760056.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 3409..3972 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893583.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 4038..4604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 4617..7097 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203607.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene priA CDS 7110..11345 product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161799605.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 assembly_gap 11289..11342 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11482..11682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(11694..11960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 note possible pseudo, frameshifted sequence052 source 1..12176 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(41..379) product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene cas2 CDS complement(390..1307) product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene cas1 CDS complement(1310..5449) product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963637.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene cas9 CDS 5724..7472 product alpha-1,3-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202199.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene glaB CDS 7534..7749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(7817..11578) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992125.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene dnaE sequence053 source 1..12122 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..572 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926908.1:HesA/MoeB/ThiF family protein locus_tag LOCUS_10690 CDS 661..1035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 1055..2233 product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764617.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 2309..2680 product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785723.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(2890..4014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(4327..5274) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(5258..6328) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794503.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene serC CDS 6528..7070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(7149..8207) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108932.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(8292..9812) product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 sequence054 source 1..11981 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(680..2341) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765307.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene argS assembly_gap 747..768 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2501..3790) product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769170.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 3906..4415 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783866.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 4412..5239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 note possible pseudo, frameshifted CDS 5194..5589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 5596..6240 product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201899.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(6252..6686) product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785250.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene mscL CDS 6857..8245 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784328.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 8405..9412 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene gap CDS complement(9524..10513) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791878.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 assembly_gap 10527..10570 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(10744..11223) product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814383.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(11440..11850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 sequence055 source 1..11578 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(38..601) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene pth CDS complement(619..1269) product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760337.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 1459..3291 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203738.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(3295..10563) product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062175791.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene sprA CDS complement(10712..11293) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790555.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene ruvA sequence056 source 1..11541 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(807..1364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 1481..3928 product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109374.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(3930..6332) product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795491.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene feoB CDS complement(6437..6997) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658777.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(7017..8651) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764456.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(8669..9103) product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785242.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(9115..11079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202019.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 sequence057 source 1..11512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(163..684) product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 assembly_gap 185..222 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 831..1973 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760045.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 assembly_gap 1933..1970 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2116..4056 product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796864.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 4066..4722 product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770252.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 4719..5288 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764144.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 5337..6533 product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene porV CDS 6538..7026 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene ispF CDS 7369..8997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 9257..10606 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 10606..10866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 sequence058 source 1..11483 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(219..1670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 note possible pseudo, frameshifted CDS complement(1642..3351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 note possible pseudo, frameshifted assembly_gap 1674..1699 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3367..4482) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303157.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(4511..5923) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765715.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 assembly_gap 6042..6169 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6236..6586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 assembly_gap 6662..6797 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7063..7341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 7890..8579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 8579..9481 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796420.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene metA CDS complement(9491..10171) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 10297..10836 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789526.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 repeat_region 10921..>11483 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgtgaattgctttcattttttgtaactttgttcca sequence059 source 1..11419 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2034..2792 product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763940.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(2866..4254) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759760.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene dnaA CDS complement(4588..5508) product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(5546..6706) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840465.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 7079..7975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 7991..8893 product CepA family extended-spectrum class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202336.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 9196..9687 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107474.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(9778..10242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(10351..10581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11310 note possible pseudo, frameshifted misc_feature complement(10517..>11419) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764496.1:bifunctional dihydroorotate dehydrogenase B NAD binding subunit/NADPH-dependent glutamate synthase note possible pseudo, frameshifted locus_tag LOCUS_11320 sequence060 source 1..11268 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 148..654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(725..1264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(1264..2112) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795115.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene prmA CDS complement(2161..2430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(2455..2793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(2886..3086) product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776445.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(3107..3304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(3445..4347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(4344..5507) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141120.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(5623..6435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(6458..6925) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770040.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene ndk CDS complement(7180..8958) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172726565.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene recG note possible pseudo, frameshifted CDS complement(8940..9266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 note possible pseudo, frameshifted CDS complement(9436..11007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 note possible pseudo, frameshifted sequence061 source 1..11260 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 570..759 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 999..1031 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1190..2230) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 note possible pseudo, frameshifted CDS complement(2634..3248) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783653.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(3459..3857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(3859..4608) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(4627..5523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(5536..6084) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767456.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(6114..8696) product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(8693..9649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(9680..10786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(10786..11175) product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813773.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 sequence062 source 1..11215 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(315..1220) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108326.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(1305..2291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(2304..2651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(2653..3054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(3051..4304) product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459687.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(5057..5365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(5581..7479) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764765.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene dnaK CDS 7880..8302 product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561104.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene mce CDS 8340..9812 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780626.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 assembly_gap 9476..9554 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9785..9793 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9856..10818 product OadG family transporter subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789537.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 sequence063 source 1..11201 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..546 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404923.1:D-alanine--D-alanine ligase family protein note possible pseudo, frameshifted locus_tag LOCUS_11670 CDS 543..797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 note possible pseudo, frameshifted CDS 797..1726 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769713.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 1739..2710 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107516.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene ftsY CDS 2710..4014 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765734.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene rimO CDS 4011..4916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 note possible pseudo, frameshifted CDS 4877..5101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 5102..6532 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203597.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 6529..7827 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691388.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 7829..9412 product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804150.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(9427..9912) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867062.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene nrdG misc_feature complement(9912..>11201) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436320.1:anaerobic ribonucleoside triphosphate reductase locus_tag LOCUS_11780 sequence064 source 1..10807 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(6..134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(101..1036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 assembly_gap 225..286 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1258..2271 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109241.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(2362..3273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(3308..4441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(4438..5064) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 5334..6044 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759596.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene pyrH CDS 6080..6406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 note possible pseudo, frameshifted CDS 6403..6618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 note possible pseudo, frameshifted CDS complement(6691..7617) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202975.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 7775..8194 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795574.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 8234..9727 product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 sequence065 source 1..10554 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 4..1530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 1543..3579 product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202217.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(3594..4394) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019538492.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene fmt note possible pseudo, frameshifted CDS complement(4391..4549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(4553..5683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(5812..7122) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839941.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(7131..8063) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(8060..9253) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808836.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 sequence066 source 1..10531 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 230..354 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 961..1018 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1097..1906 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 1903..2988 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791183.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 3030..4475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 4632..6707 product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108600.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(6768..7571) product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(8126..9199) product clostripain-related cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107416.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 assembly_gap 9207..9282 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9445..10026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 assembly_gap 10298..10393 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence067 source 1..10439 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 360..1208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(1225..2766) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791502.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene gltX CDS complement(2904..3917) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 4111..5289 product fragipain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788546.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 5299..6438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(6520..6702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 6899..8434 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203525.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene recJ CDS 8431..9366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 note possible pseudo, frameshifted CDS 9293..9628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 note possible pseudo, frameshifted CDS 9582..10295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12150 note possible pseudo, frameshifted sequence068 source 1..10144 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(179..2527) product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(3231..3992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 5164..6234 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788241.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene carA CDS 6256..7107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 note possible pseudo, frameshifted CDS 7100..9430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 note possible pseudo, frameshifted assembly_gap 7328..7410 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence069 source 1..9990 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 323..802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 796..1707 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108326.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 1700..2548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 2560..2847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(2854..3456) product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762399.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene hisIE CDS complement(3466..4221) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762398.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene hisF CDS complement(4215..4946) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203120.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene hisA CDS complement(4943..5536) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107745.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene hisH CDS complement(5533..6600) product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766230.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene hisB CDS complement(6600..7646) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766231.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene hisC CDS complement(7639..8919) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203178.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene hisD CDS complement(8931..9737) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760516.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene hisG sequence070 source 1..9875 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..709 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764298.1:NADH-quinone oxidoreductase subunit M locus_tag LOCUS_12340 CDS 726..2168 product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992198.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(2479..2937) product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene tnpA CDS 3445..3747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 note possible pseudo, frameshifted assembly_gap 3705..3717 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3749..6751 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992680.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 7177..8763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 assembly_gap 7206..7275 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9147..9425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 note possible pseudo, frameshifted sequence071 source 1..9818 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 63..4589 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107318.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene gltB CDS 4613..6016 product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763133.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 assembly_gap 4636..4678 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6090..6848) product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943655.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(7083..8042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 note possible pseudo, frameshifted CDS complement(8005..9255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 note possible pseudo, frameshifted tRNA 9431..9513 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 sequence072 source 1..9639 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 163..216 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 370..410 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 770..1261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 note possible pseudo, frameshifted CDS 1207..1998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 note possible pseudo, frameshifted assembly_gap 1213..1222 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1986..3116 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107783.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 3179..4489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 4549..6438 product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763745.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 6431..7648 product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763746.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(7736..9586) product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 assembly_gap 8382..8444 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence073 source 1..9604 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(757..2109) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786507.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(2231..2884) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538563.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(2889..3338) product DUF4494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762440.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(3366..5420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 assembly_gap 5833..5842 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5960..7051 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766068.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene mltG CDS 7048..7290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(7266..8426) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108203.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(8440..8739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 note possible pseudo, frameshifted CDS complement(8660..8989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 note possible pseudo, frameshifted assembly_gap 9032..9167 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9313..9358 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence074 source 1..9546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(553..897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 1063..1890 product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 1880..2572 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 2741..4237 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763196.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 4243..5637 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763197.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene leuC CDS 5650..6249 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene leuD CDS 6253..7284 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789841.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene leuB CDS 7297..8733 product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108966.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(8811..9137) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784741.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene trxA sequence075 source 1..9502 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(89..667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(669..1295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(1393..2115) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785882.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(2138..3916) product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785879.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(4044..5306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 note possible pseudo, frameshifted CDS complement(5335..5520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 note possible pseudo, frameshifted CDS complement(5583..5873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 note possible pseudo, frameshifted CDS complement(5887..8046) product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765304.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(8051..9451) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765688.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 sequence076 source 1..9260 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 123..243 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(392..1840) product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202208.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(1837..3261) product DUF6057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202209.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 assembly_gap 3320..3365 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3410..3655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 note possible pseudo, frameshifted CDS complement(3649..5109) product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769526.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 note possible pseudo, frameshifted CDS complement(5125..8184) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202210.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(8327..8536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 note possible pseudo, frameshifted CDS 8747..9064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 sequence077 source 1..9178 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(223..1959) product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136013900.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(1980..4742) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016266957.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 assembly_gap 4788..4861 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5228..7798) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461661.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 assembly_gap 5735..5789 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8158..9117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12900 note possible pseudo, frameshifted assembly_gap 8995..9036 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence078 source 1..9112 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 145..149 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 355..2790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 note possible pseudo, frameshifted assembly_gap 387..581 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2828..3694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12920 assembly_gap 4262..4309 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4363..4959) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937344.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 5366..5836 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791379.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene greA CDS 5839..6243 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791382.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 assembly_gap 6704..6840 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6860..7510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 7507..8619 product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 sequence079 source 1..8869 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(50..137) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(188..562) product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760453.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(540..1328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794237.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(1328..3946) product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202271.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(3954..4406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 note possible pseudo, frameshifted CDS complement(4493..4702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 note possible pseudo, frameshifted CDS complement(4911..5945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13030 note possible pseudo, frameshifted assembly_gap 4947..4992 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6092..6451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 6593..7018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(7029..8198) product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695909.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 misc_feature complement(8329..>8869) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062695721.1:ATP-dependent zinc metalloprotease FtsH locus_tag LOCUS_13070 sequence080 source 1..8811 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 54..416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13080 assembly_gap 171..181 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 616..2016 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764220.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene cls assembly_gap 842..878 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2116..2409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 2414..2722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 2851..3129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 3126..4565 product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790424.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene rny CDS 4581..5930 product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766922.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene ricT CDS 5920..6342 product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766923.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene gldH CDS 6349..6981 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943184.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 6978..8153 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790476.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 sequence081 source 1..8695 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(387..4016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(4041..5303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(5360..6325) product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108433.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 misc_feature complement(6439..>8695) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108434.1:Mfa1 family fimbria major subunit locus_tag LOCUS_13210 sequence082 source 1..8553 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1858..2472 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795972.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 2484..4064 product DUF4435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208070.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 4057..4917 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072012.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 4987..6687 product aspartate-alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107422.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene aspT CDS 6728..7309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13260 note possible pseudo, frameshifted CDS 7285..8361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 note possible pseudo, frameshifted sequence083 source 1..8279 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 228..1589 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762587.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 1589..1879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 1872..3233 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762587.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 3352..4140 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767053.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene folP assembly_gap 4234..4343 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4621..4746 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA 5282..5361 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(5416..7950) product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202101.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 sequence084 source 1..8234 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 238..340 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 341..1054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 1179..3227 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765725.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene htpG CDS 3606..4160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13350 note possible pseudo, frameshifted assembly_gap 3623..3656 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4355..4395 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4641..5552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 note possible pseudo, frameshifted assembly_gap 4683..4692 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5556..5879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 assembly_gap 5884..5946 estimated_length known gap_type within scaffold linkage_evidence paired-ends misc_feature complement(6346..>8234) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107202.1:putative porin locus_tag LOCUS_13380 sequence085 source 1..8059 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 416..2392 product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964267.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 2398..4656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 4764..5066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 5068..5451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 5500..6237 product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764531.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 6224..7456 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785451.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 sequence086 source 1..7981 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2050..4266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(4363..5556) product anaerobic sulfatase-maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766211.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 5656..7248 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555796.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 assembly_gap 7478..7556 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence087 source 1..7818 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(57..1379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 assembly_gap 122..134 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1516..2013) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929781.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(2020..4407) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202791.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(4500..7166) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203461.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 misc_feature complement(7185..>7818) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769973.1:adenosylcobalamin-dependent ribonucleoside-diphosphate reductase locus_tag LOCUS_13520 sequence088 source 1..7673 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 427..2412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 2477..2878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 2975..3226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(3277..3915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 3800..4009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(4253..4684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(4681..6081) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765753.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(6087..7346) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765754.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 sequence089 source 1..7635 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..846 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108949.1:POTRA domain-containing protein locus_tag LOCUS_13610 CDS 933..1448 product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 1506..2003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 2096..2923 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202028.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene murI CDS 2945..3811 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117757.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 3824..5026 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202530.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(5023..5724) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(5715..6188) product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762666.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(6181..7041) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202032.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene prmC misc_feature complement(7026..>7635) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107320.1:carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit locus_tag LOCUS_13700 sequence090 source 1..7592 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 244..1908 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791282.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 1905..4091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 note possible pseudo, frameshifted assembly_gap 3998..4017 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4022..5218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 note possible pseudo, frameshifted CDS complement(5202..6518) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782289.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene der CDS complement(6574..7467) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760765.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene era sequence091 source 1..7568 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(49..1293) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765689.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene serB CDS complement(1315..2163) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(2201..4522) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840909.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 4617..5090 product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790644.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 5080..5865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(5876..6325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 6536..6955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(6915..7532) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802121.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 sequence092 source 1..7458 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(416..2041) product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786793.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 assembly_gap 1688..1697 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2241..5330) product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108778.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(5426..6055) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764014.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene frr CDS complement(6108..6470) product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 assembly_gap 6618..6698 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6966..6970 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 7131..7231 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence093 source 1..7386 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 809..1801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 1878..3506 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109236.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 3582..5597 product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202540.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(5686..5964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(6237..7115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 sequence094 source 1..7368 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(224..517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(477..674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(699..2651) product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028668016.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(2680..3066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13960 note possible pseudo, internal stop codon, frameshifted CDS complement(3069..5324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 note possible pseudo, internal stop codon, frameshifted assembly_gap 3574..3640 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5340..5762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 note possible pseudo, internal stop codon misc_feature complement(6040..>7368) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203707.1:DUF6067 family protein locus_tag LOCUS_13990 sequence095 source 1..7223 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(112..2238) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762033.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene fusA CDS complement(2282..2812) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791536.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene rpsG CDS complement(2941..3324) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene rpsL CDS 3634..4803 product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(4818..6287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 note possible pseudo, internal stop codon, frameshifted CDS complement(6446..6628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 note possible pseudo, internal stop codon, frameshifted assembly_gap 6646..6695 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence096 source 1..7127 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(37..1146) product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764152.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(1165..1959) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791725.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene trmB CDS 2043..2648 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061849.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene queC CDS 2734..6588 product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202282.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(6642..6878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14100 sequence097 source 1..6967 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 165..328 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1360..5403) product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108776.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 assembly_gap 5971..5996 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6122..6133 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6140..6727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 note possible pseudo, frameshifted assembly_gap 6304..6352 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6772..6811 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence098 source 1..6882 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 350..398 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 553..587 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 728..1360 product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763022.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 1357..2727 product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783910.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 2760..4070 product L-fucose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694544.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 4129..5076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 5060..5854 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761063.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 5851..6342 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689852.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 sequence099 source 1..6755 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3324 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791958.1:TonB-dependent receptor locus_tag LOCUS_14190 CDS 3337..5355 product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797392.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 sequence100 source 1..6547 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 213..271 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(479..1882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(1902..2033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(2011..3267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(3360..4841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(4960..5904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 misc_feature complement(5901..>6547) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_080707197.1:DUF3575 domain-containing protein locus_tag LOCUS_14260 assembly_gap 6309..6327 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence101 source 1..6508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 227..1426 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(1456..2205) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763423.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(2210..3208) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763424.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(3285..4505) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765923.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(4519..5139) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786909.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 note possible pseudo, internal stop codon CDS complement(5278..6441) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794794.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 sequence102 source 1..6507 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(103..1686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(1707..5027) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(5138..6424) product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 sequence103 source 1..6421 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(160..870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(867..1742) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760837.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(1754..2038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 2290..3009 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760838.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 3062..3832 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 3848..4282 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760840.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 4294..5085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 sequence104 source 1..6177 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 582..2522 product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256716.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(2492..3142) product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108280.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(3147..3713) product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene pnuC CDS complement(3744..4808) product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767297.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 5129..5638 product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238395.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 assembly_gap 5811..5927 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence105 source 1..5998 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(256..633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 760..1746 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 2186..3379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(3571..5673) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene pnp assembly_gap 5675..5732 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence106 source 1..5951 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(496..2457) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764299.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene nuoL CDS complement(2536..2847) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775579.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene nuoK CDS complement(2854..3369) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764300.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(3401..4027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(4062..4943) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202768.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 misc_feature complement(4974..>5951) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787491.1:F0F1 ATP synthase subunit alpha locus_tag LOCUS_14570 sequence107 source 1..5885 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 131..1135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 note possible pseudo, frameshifted CDS 1676..2428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 2548..3393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 3511..4149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 note possible pseudo, frameshifted CDS 4143..4304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(4357..4683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(4802..5098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14640 note possible pseudo, frameshifted CDS complement(5079..5435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 note possible pseudo, frameshifted CDS complement(5536..5778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 sequence108 source 1..5692 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 555..1718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 1813..3189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 3285..5603 product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202543.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 sequence109 source 1..5676 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1198 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_116269310.1:tetratricopeptide repeat protein note possible pseudo, internal stop codon, frameshifted locus_tag LOCUS_14700 CDS 1212..2510 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116269310.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 note possible pseudo, internal stop codon, frameshifted CDS 2604..4013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(4193..5467) product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 sequence110 source 1..5585 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 147..160 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(599..1516) product DUF5106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107815.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(1524..2126) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 2261..2716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 2854..3327 product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783918.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene rimP CDS 3351..4502 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene nusA CDS 4478..4615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 assembly_gap 4960..5003 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence111 source 1..5504 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(31..2061) product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202545.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(2063..3223) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993669.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(3213..4127) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759877.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene miaA CDS complement(4124..5356) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786005.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene pepT sequence112 source 1..5445 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1023..3002 product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109002.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(3090..4130) product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108145.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene asnA CDS complement(4227..4820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14860 sequence113 source 1..5445 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(843..1511) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763050.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(1532..2554) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 assembly_gap 2556..2590 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2828..3844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 note possible pseudo, frameshifted CDS complement(3891..4322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 note possible pseudo, frameshifted CDS complement(4472..4681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14910 note possible pseudo, frameshifted assembly_gap 4716..4810 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4991..5100 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence114 source 1..5443 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 148..1494 product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(1507..1716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(1713..2354) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785374.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(2351..3004) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795149.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene bioD CDS complement(3001..3885) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403744.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene lgt CDS complement(3875..4267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 note possible pseudo, frameshifted CDS complement(4333..5190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 note possible pseudo, frameshifted sequence115 source 1..5339 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 209..1351 product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107393.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene nspC CDS 1351..2250 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784336.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 assembly_gap 2167..2215 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2339..3046 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene radC CDS complement(3051..4145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(4154..5086) product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769957.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 sequence116 source 1..5338 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(229..801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 note possible pseudo, frameshifted assembly_gap 262..302 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(885..1724) product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796486.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(1840..2760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 assembly_gap 2770..2901 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3024..3242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(3281..4957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(5029..5337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 sequence117 source 1..5225 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1147..1689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(1763..3865) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107338.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(3883..4656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 assembly_gap 4682..4802 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4966..5061 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence118 source 1..5058 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 67..741 product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759606.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 750..1448 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784737.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene pssA CDS 1594..1812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(1855..3057) product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(3057..4508) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032496674.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 misc_feature complement(4555..>5058) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202169.1:4-O-beta-D-mannosyl-D-glucose phosphorylase locus_tag LOCUS_15180 sequence119 source 1..4994 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence120 source 1..4981 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(623..1087) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766127.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene rpiB CDS 1503..4721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 sequence121 source 1..4967 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(683..2086) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962791.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene mnmE CDS complement(2094..2834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 3147..4250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 4294..4803 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788597.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene tpx sequence122 source 1..4809 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 336..358 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 479..515 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 561..848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 note possible pseudo, frameshifted CDS complement(845..1288) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene tsaE CDS complement(1290..2807) product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(2804..4102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 sequence123 source 1..4778 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 169..1674 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787476.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene atpD CDS 1712..1945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 1939..3051 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787483.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene atpB CDS 3086..3331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 3348..3845 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761391.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene atpF CDS 3856..4401 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815471.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 sequence124 source 1..4613 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(219..1106) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784893.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(1231..4491) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005821947.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 sequence125 source 1..4540 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(402..1007) product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788396.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene prfH CDS complement(1004..2248) product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682062.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 2296..3333 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107967.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 3490..4500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 sequence126 source 1..4397 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(432..596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 905..1912 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 1909..2760 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 2765..3712 product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 sequence127 source 1..4380 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 1695..1810 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1978..2066 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2107..2307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(2386..3171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 note possible pseudo, frameshifted assembly_gap 3260..3304 estimated_length known gap_type within scaffold linkage_evidence paired-ends misc_feature complement(3520..>4380) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858826.1:cytochrome ubiquinol oxidase subunit I locus_tag LOCUS_15470 sequence128 source 1..4369 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(544..2571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 assembly_gap 553..580 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2593..2919) product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422748.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene yciH CDS complement(2926..3354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(3373..3792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 assembly_gap 3876..3952 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence129 source 1..4354 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1964..3085 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783796.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 assembly_gap 2383..2440 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence130 source 1..4352 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(287..1576) product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(1695..2579) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(2589..3770) product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763289.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 misc_feature complement(3783..>4352) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767782.1:DUF4980 domain-containing protein locus_tag LOCUS_15560 sequence131 source 1..4293 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(605..1126) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761611.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(1137..1973) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788374.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 2350..3789 product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784276.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 sequence132 source 1..4206 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 242..1897 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109236.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 2073..3077 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814336.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 sequence133 source 1..4198 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 43..393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963519.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 461..1372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(1400..3523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(3520..4167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 sequence134 source 1..4159 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(774..1358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(1434..1748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(1754..2272) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761107.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene rimM CDS complement(2272..2862) product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(2968..3714) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762708.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene fabG sequence135 source 1..4121 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 108..1196 product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764441.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 sequence136 source 1..4074 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 81..1796 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963786.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene menD CDS 1789..2613 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795543.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene menB CDS 2613..3671 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202359.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 sequence137 source 1..4067 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 77..2263 product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765057.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 2434..4047 product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene asnB sequence138 source 1..3843 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 note possible pseudo, frameshifted CDS 336..548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15780 note possible pseudo, frameshifted CDS 587..2221 product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761034.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene ilvB assembly_gap 2199..2214 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2730..2823 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2835..3257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 note possible pseudo, frameshifted assembly_gap 3055..3089 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3289..3513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 sequence139 source 1..3824 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 163..217 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 389..486 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(525..845) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759984.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene rplU CDS 1150..2193 product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760868.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 2211..2786 product DUF4827 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109033.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 assembly_gap 3478..3569 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence140 source 1..3706 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(269..1051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 note possible pseudo, internal stop codon, frameshifted CDS 1183..2385 product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789686.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 2709..3638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15870 sequence141 source 1..3650 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 811..3270 product excinuclease ABC subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389901.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 assembly_gap 3213..3259 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence142 source 1..3580 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 271..290 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 310..1311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 1308..1877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 note possible pseudo, frameshifted CDS 1959..2879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15910 note possible pseudo, frameshifted CDS 2845..3159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(3156..3380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 note possible pseudo, frameshifted assembly_gap 3411..3455 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence143 source 1..3545 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 97..369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 734..1957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 1982..2332 product DUF4491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767264.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 2530..3036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 note possible pseudo, frameshifted sequence144 source 1..3495 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(72..1010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 sequence145 source 1..3350 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 124..175 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(628..1857) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762301.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(1854..3065) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 sequence146 source 1..3304 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 71..1411 product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839735.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 assembly_gap 1453..1470 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1721..1760 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2537..2563 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2718..2837 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3006..3126 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence147 source 1..3218 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(580..1134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 assembly_gap 1159..1256 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1613..3145 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788141.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene dnaB sequence148 source 1..3150 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 46..1554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 1551..1970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 2088..2501 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761720.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 2498..3061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 note possible pseudo, frameshifted assembly_gap 2966..3019 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence149 source 1..3091 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 839..2374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 note possible pseudo, frameshifted CDS 2453..3025 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775969.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene ahpC sequence150 source 1..2951 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(268..426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(430..852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(1037..1603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 sequence151 source 1..2951 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005804122.1:tyrosine recombinase XerC locus_tag LOCUS_16130 CDS 710..1003 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782154.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene raiA CDS complement(1019..1990) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109173.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 2208..2912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 sequence152 source 1..2866 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1774..2184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 assembly_gap 1793..1813 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2186..2365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 assembly_gap 2382..2547 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence153 source 1..2782 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 157..208 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(274..1368) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051287133.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(1401..2498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 sequence154 source 1..2738 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 172..328 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(628..921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 1063..2598 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203710.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 sequence155 source 1..2668 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(53..385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 note possible pseudo, frameshifted CDS complement(599..2386) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203603.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 sequence156 source 1..2635 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..897 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790883.1:methylmalonyl-CoA mutase locus_tag LOCUS_16250 assembly_gap 828..866 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(924..1979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 assembly_gap 2248..2347 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence157 source 1..2586 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 140..232 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 936..1667 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787548.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene pyrB note possible pseudo, frameshifted assembly_gap 1634..1651 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1670..1819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 note possible pseudo, frameshifted assembly_gap 2192..2205 estimated_length known gap_type within scaffold linkage_evidence paired-ends