>Feature sequence001 660 442 gene locus_tag LOCUS_00010 660 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 884 1078 gene locus_tag LOCUS_00020 884 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1092 1934 gene locus_tag LOCUS_00030 gene murB 1092 1934 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764915.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00030 1992 3302 gene locus_tag LOCUS_00040 gene murA 1992 3302 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_00040 3486 3947 gene locus_tag LOCUS_00050 3486 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4050 5756 gene locus_tag LOCUS_00060 4050 5756 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107711.1 protein_id gnl|my_center|LOCUS_00060 5758 7203 gene locus_tag LOCUS_00070 5758 7203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7849 7205 gene locus_tag LOCUS_00080 7849 7205 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_00080 8474 7854 gene locus_tag LOCUS_00090 gene rsmG 8474 7854 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765865.1 protein_id gnl|my_center|LOCUS_00090 8758 8492 gene locus_tag LOCUS_00100 8758 8492 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766138.1 protein_id gnl|my_center|LOCUS_00100 8840 10078 gene locus_tag LOCUS_00110 8840 10078 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_00110 11356 10055 gene locus_tag LOCUS_00120 gene tilS 11356 10055 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107882.1 protein_id gnl|my_center|LOCUS_00120 13038 11353 gene locus_tag LOCUS_00130 13038 11353 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107667.1 protein_id gnl|my_center|LOCUS_00130 13893 13123 gene locus_tag LOCUS_00140 13893 13123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14531 13890 gene locus_tag LOCUS_00150 14531 13890 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396078.1 protein_id gnl|my_center|LOCUS_00150 17233 14681 gene locus_tag LOCUS_00160 17233 14681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 17825 17439 gene locus_tag LOCUS_00170 17825 17439 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763033.1 protein_id gnl|my_center|LOCUS_00170 18040 18741 gene locus_tag LOCUS_00180 18040 18741 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764706.1 protein_id gnl|my_center|LOCUS_00180 18753 19160 gene locus_tag LOCUS_00190 18753 19160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 19150 19953 gene locus_tag LOCUS_00200 19150 19953 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_00200 19940 20788 gene locus_tag LOCUS_00210 19940 20788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_00210 20920 22233 gene locus_tag LOCUS_00220 20920 22233 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764912.1 protein_id gnl|my_center|LOCUS_00220 22316 23392 gene locus_tag LOCUS_00230 gene lysA 22316 23392 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788814.1 protein_id gnl|my_center|LOCUS_00230 24304 23411 gene locus_tag LOCUS_00240 24304 23411 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761543.1 protein_id gnl|my_center|LOCUS_00240 25323 24295 gene locus_tag LOCUS_00250 25323 24295 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_00250 25549 25316 gene locus_tag LOCUS_00260 25549 25316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 25727 26743 gene locus_tag LOCUS_00270 25727 26743 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207085.1 protein_id gnl|my_center|LOCUS_00270 26832 28610 gene locus_tag LOCUS_00280 gene sppA 26832 28610 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_00280 28618 29718 gene locus_tag LOCUS_00290 gene lpxK 28618 29718 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765467.1 protein_id gnl|my_center|LOCUS_00290 29768 30583 gene locus_tag LOCUS_00300 29768 30583 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761225.1 protein_id gnl|my_center|LOCUS_00300 30600 31523 gene locus_tag LOCUS_00310 gene thiL 30600 31523 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761224.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00310 31866 33209 gene locus_tag LOCUS_00320 31866 33209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 33240 33572 gene locus_tag LOCUS_00330 gene yajC 33240 33572 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_00330 33608 34594 gene locus_tag LOCUS_00340 33608 34594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 34594 35172 gene locus_tag LOCUS_00350 gene coaE 34594 35172 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764748.1 protein_id gnl|my_center|LOCUS_00350 35959 35120 gene locus_tag LOCUS_00360 35959 35120 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766194.1 protein_id gnl|my_center|LOCUS_00360 36495 35956 gene locus_tag LOCUS_00370 36495 35956 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766193.1 protein_id gnl|my_center|LOCUS_00370 36842 36507 gene locus_tag LOCUS_00380 36842 36507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 38101 36854 gene locus_tag LOCUS_00390 gene thrC 38101 36854 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_00390 39533 38172 gene locus_tag LOCUS_00400 39533 38172 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292596.1 protein_id gnl|my_center|LOCUS_00400 40997 39561 gene locus_tag LOCUS_00410 40997 39561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 41393 41007 gene locus_tag LOCUS_00420 41393 41007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 43827 41377 gene locus_tag LOCUS_00430 gene thrA 43827 41377 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_00430 45410 43830 gene locus_tag LOCUS_00440 45410 43830 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763318.1 protein_id gnl|my_center|LOCUS_00440 45649 46245 gene locus_tag LOCUS_00450 45649 46245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 46247 47611 gene locus_tag LOCUS_00460 gene radA 46247 47611 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764082.1 protein_id gnl|my_center|LOCUS_00460 48875 47688 gene locus_tag LOCUS_00470 gene purT 48875 47688 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092658.1 protein_id gnl|my_center|LOCUS_00470 49900 48944 gene locus_tag LOCUS_00480 49900 48944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00480 51357 49891 gene locus_tag LOCUS_00490 51357 49891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00490 51590 53701 gene locus_tag LOCUS_00500 51590 53701 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_00500 52321 52339 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 53787 54227 gene locus_tag LOCUS_00510 53787 54227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 54978 54202 gene locus_tag LOCUS_00520 54978 54202 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791872.1 protein_id gnl|my_center|LOCUS_00520 55724 54975 gene locus_tag LOCUS_00530 55724 54975 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_00530 55827 56333 gene locus_tag LOCUS_00540 55827 56333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00540 56162 56206 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 56255 56431 gene locus_tag LOCUS_00550 56255 56431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00550 56673 56428 gene locus_tag LOCUS_00560 56673 56428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 57424 56633 gene locus_tag LOCUS_00570 57424 56633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00570 57791 57345 gene locus_tag LOCUS_00580 57791 57345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00580 58830 57784 gene locus_tag LOCUS_00590 58830 57784 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555792.1 protein_id gnl|my_center|LOCUS_00590 >Feature sequence002 219 224 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 324 1109 gene locus_tag LOCUS_00600 324 1109 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503931.1 protein_id gnl|my_center|LOCUS_00600 1549 1175 gene locus_tag LOCUS_00610 1549 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 1787 2128 gene locus_tag LOCUS_00620 1787 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 2125 3195 gene locus_tag LOCUS_00630 2125 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 3207 4304 gene locus_tag LOCUS_00640 gene meaB 3207 4304 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760933.1 protein_id gnl|my_center|LOCUS_00640 4442 5320 gene locus_tag LOCUS_00650 4442 5320 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108933.1 protein_id gnl|my_center|LOCUS_00650 5729 5307 gene locus_tag LOCUS_00660 5729 5307 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763033.1 protein_id gnl|my_center|LOCUS_00660 5918 6091 gene locus_tag LOCUS_00670 5918 6091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 6168 6545 gene locus_tag LOCUS_00680 6168 6545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 6551 7570 gene locus_tag LOCUS_00690 6551 7570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 7567 8535 gene locus_tag LOCUS_00700 7567 8535 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077130071.1 protein_id gnl|my_center|LOCUS_00700 10569 8614 gene locus_tag LOCUS_00710 10569 8614 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109002.1 protein_id gnl|my_center|LOCUS_00710 11032 10670 gene locus_tag LOCUS_00720 11032 10670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 11161 11832 gene locus_tag LOCUS_00730 11161 11832 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965814.1 protein_id gnl|my_center|LOCUS_00730 11844 12683 gene locus_tag LOCUS_00740 11844 12683 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254593.1 protein_id gnl|my_center|LOCUS_00740 13676 12693 gene locus_tag LOCUS_00750 13676 12693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032528599.1 protein_id gnl|my_center|LOCUS_00750 14464 13676 gene locus_tag LOCUS_00760 14464 13676 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203221.1 protein_id gnl|my_center|LOCUS_00760 15000 14461 gene locus_tag LOCUS_00770 15000 14461 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203222.1 protein_id gnl|my_center|LOCUS_00770 15947 15018 gene locus_tag LOCUS_00780 15947 15018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 17633 16032 gene locus_tag LOCUS_00790 gene mutL 17633 16032 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993641.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00790 17707 17728 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20192 18327 gene locus_tag LOCUS_00800 20192 18327 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764125.1 protein_id gnl|my_center|LOCUS_00800 21561 20218 gene locus_tag LOCUS_00810 21561 20218 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760775.1 protein_id gnl|my_center|LOCUS_00810 22459 21686 gene locus_tag LOCUS_00820 22459 21686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 23957 22479 gene locus_tag LOCUS_00830 gene guaB 23957 22479 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791859.1 protein_id gnl|my_center|LOCUS_00830 24657 24061 gene locus_tag LOCUS_00840 24657 24061 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107938.1 protein_id gnl|my_center|LOCUS_00840 25192 24668 gene locus_tag LOCUS_00850 25192 24668 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767850.1 protein_id gnl|my_center|LOCUS_00850 25330 25248 gene locus_tag LOCUS_t00010 25330 25248 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 26301 25396 gene locus_tag LOCUS_00860 26301 25396 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_00860 27362 26313 gene locus_tag LOCUS_00870 27362 26313 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_00870 28288 27446 gene locus_tag LOCUS_00880 28288 27446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 28840 28346 gene locus_tag LOCUS_00890 28840 28346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107200.1 protein_id gnl|my_center|LOCUS_00890 29313 28996 gene locus_tag LOCUS_00900 29313 28996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 30324 29317 gene locus_tag LOCUS_00910 30324 29317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 31433 30393 gene locus_tag LOCUS_00920 31433 30393 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815431.1 protein_id gnl|my_center|LOCUS_00920 33490 31451 gene locus_tag LOCUS_00930 gene metG 33490 31451 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767220.1 protein_id gnl|my_center|LOCUS_00930 34478 33540 gene locus_tag LOCUS_00940 34478 33540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963974.1 protein_id gnl|my_center|LOCUS_00940 35194 34478 gene locus_tag LOCUS_00950 35194 34478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00950 35606 35181 gene locus_tag LOCUS_00960 35606 35181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00960 35228 35255 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35866 37179 gene locus_tag LOCUS_00970 35866 37179 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793004.1 protein_id gnl|my_center|LOCUS_00970 37225 38148 gene locus_tag LOCUS_00980 37225 38148 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786611.1 protein_id gnl|my_center|LOCUS_00980 38156 39361 gene locus_tag LOCUS_00990 38156 39361 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202525.1 protein_id gnl|my_center|LOCUS_00990 39414 42431 gene locus_tag LOCUS_01000 39414 42431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 42431 43195 gene locus_tag LOCUS_01010 42431 43195 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794868.1 protein_id gnl|my_center|LOCUS_01010 43535 44944 gene locus_tag LOCUS_01020 43535 44944 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766268.1 protein_id gnl|my_center|LOCUS_01020 44978 46132 gene locus_tag LOCUS_01030 gene fucO 44978 46132 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783906.1 protein_id gnl|my_center|LOCUS_01030 46618 47001 gene locus_tag LOCUS_01040 46618 47001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 47989 46991 gene locus_tag LOCUS_01050 47989 46991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 48234 48004 gene locus_tag LOCUS_01060 48234 48004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 48712 48296 gene locus_tag LOCUS_01070 48712 48296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 49232 48828 gene locus_tag LOCUS_01080 49232 48828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01080 50918 49410 gene locus_tag LOCUS_01090 50918 49410 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814235.1 protein_id gnl|my_center|LOCUS_01090 52029 51055 gene locus_tag LOCUS_01100 52029 51055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 51942 51951 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 53353 52040 gene locus_tag LOCUS_01110 gene lpdA 53353 52040 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461729.1 protein_id gnl|my_center|LOCUS_01110 53676 53350 gene locus_tag LOCUS_01120 53676 53350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01120 54823 53699 gene locus_tag LOCUS_01130 54823 53699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01130 >Feature sequence003 31 303 gene locus_tag LOCUS_01140 31 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 330 509 gene locus_tag LOCUS_01150 330 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 586 879 gene locus_tag LOCUS_01160 586 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01160 1033 1104 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2388 1141 gene locus_tag LOCUS_01170 2388 1141 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203214.1 protein_id gnl|my_center|LOCUS_01170 3307 2477 gene locus_tag LOCUS_01180 gene pyrF 3307 2477 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202194.1 protein_id gnl|my_center|LOCUS_01180 4419 3310 gene locus_tag LOCUS_01190 gene prfA 4419 3310 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785133.1 protein_id gnl|my_center|LOCUS_01190 4616 5977 gene locus_tag LOCUS_01200 gene tig 4616 5977 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_01200 6146 6793 gene locus_tag LOCUS_01210 gene clpP 6146 6793 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782306.1 protein_id gnl|my_center|LOCUS_01210 6859 8112 gene locus_tag LOCUS_01220 gene clpX 6859 8112 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791864.1 protein_id gnl|my_center|LOCUS_01220 8156 9124 gene locus_tag LOCUS_01230 8156 9124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01230 9099 10358 gene locus_tag LOCUS_01240 9099 10358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01240 10358 11023 gene locus_tag LOCUS_01250 10358 11023 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762400.1 protein_id gnl|my_center|LOCUS_01250 11050 11679 gene locus_tag LOCUS_01260 gene udk 11050 11679 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107155.1 protein_id gnl|my_center|LOCUS_01260 11691 12521 gene locus_tag LOCUS_01270 gene lptB 11691 12521 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760767.1 protein_id gnl|my_center|LOCUS_01270 13086 12499 gene locus_tag LOCUS_01280 13086 12499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 14129 13380 gene locus_tag LOCUS_01290 14129 13380 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202815.1 protein_id gnl|my_center|LOCUS_01290 14167 14769 gene locus_tag LOCUS_01300 gene yihA 14167 14769 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_01300 14828 14983 gene locus_tag LOCUS_01310 14828 14983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 15098 17335 gene locus_tag LOCUS_01320 15098 17335 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787468.1 protein_id gnl|my_center|LOCUS_01320 17319 18158 gene locus_tag LOCUS_01330 17319 18158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 19425 18238 gene locus_tag LOCUS_01340 19425 18238 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941495.1 protein_id gnl|my_center|LOCUS_01340 22511 19422 gene locus_tag LOCUS_01350 22511 19422 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_01350 23596 22523 gene locus_tag LOCUS_01360 23596 22523 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803349.1 protein_id gnl|my_center|LOCUS_01360 24782 24183 gene locus_tag LOCUS_01370 24782 24183 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295313.1 protein_id gnl|my_center|LOCUS_01370 24963 24775 gene locus_tag LOCUS_01380 24963 24775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 26627 25323 gene locus_tag LOCUS_01390 26627 25323 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202760.1 protein_id gnl|my_center|LOCUS_01390 26989 26624 gene locus_tag LOCUS_01400 26989 26624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01400 27683 26979 gene locus_tag LOCUS_01410 27683 26979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01410 27924 27667 gene locus_tag LOCUS_01420 27924 27667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01420 28208 30436 gene locus_tag LOCUS_01430 28208 30436 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032850355.1 protein_id gnl|my_center|LOCUS_01430 30449 31123 gene locus_tag LOCUS_01440 30449 31123 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_01440 32816 31125 gene locus_tag LOCUS_01450 32816 31125 CDS product lipid A phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107999.1 protein_id gnl|my_center|LOCUS_01450 33987 32803 gene locus_tag LOCUS_01460 33987 32803 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695909.1 protein_id gnl|my_center|LOCUS_01460 34199 35152 gene locus_tag LOCUS_01470 34199 35152 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202513.1 protein_id gnl|my_center|LOCUS_01470 35729 35115 gene locus_tag LOCUS_01480 35729 35115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 35910 35650 gene locus_tag LOCUS_01490 35910 35650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 36096 36112 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36205 36660 gene locus_tag LOCUS_01500 36205 36660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 36657 36923 gene locus_tag LOCUS_01510 36657 36923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 37018 38040 gene locus_tag LOCUS_01520 gene pheS 37018 38040 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789293.1 protein_id gnl|my_center|LOCUS_01520 38063 38707 gene locus_tag LOCUS_01530 gene nth 38063 38707 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767855.1 protein_id gnl|my_center|LOCUS_01530 38746 40113 gene locus_tag LOCUS_01540 38746 40113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 40155 42551 gene locus_tag LOCUS_01550 40155 42551 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_01550 43429 42554 gene locus_tag LOCUS_01560 43429 42554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01560 44077 43532 gene locus_tag LOCUS_01570 44077 43532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 44373 44191 gene locus_tag LOCUS_01580 44373 44191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 >Feature sequence004 1603 917 gene locus_tag LOCUS_01590 1603 917 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791123.1 protein_id gnl|my_center|LOCUS_01590 1680 2474 gene locus_tag LOCUS_01600 1680 2474 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791347.1 protein_id gnl|my_center|LOCUS_01600 2849 2478 gene locus_tag LOCUS_01610 2849 2478 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787945.1 protein_id gnl|my_center|LOCUS_01610 4494 2989 gene locus_tag LOCUS_01620 4494 2989 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768282.1 protein_id gnl|my_center|LOCUS_01620 7489 4532 gene locus_tag LOCUS_01630 7489 4532 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108255.1 protein_id gnl|my_center|LOCUS_01630 7301 7319 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7798 8769 gene locus_tag LOCUS_01640 7798 8769 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761539.1 protein_id gnl|my_center|LOCUS_01640 8814 9917 gene locus_tag LOCUS_01650 gene ychF 8814 9917 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203749.1 protein_id gnl|my_center|LOCUS_01650 11131 10100 gene locus_tag LOCUS_01660 11131 10100 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203190.1 protein_id gnl|my_center|LOCUS_01660 11266 12924 gene locus_tag LOCUS_01670 11266 12924 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107663.1 protein_id gnl|my_center|LOCUS_01670 16613 12933 gene locus_tag LOCUS_01680 gene metH 16613 12933 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729624.1 protein_id gnl|my_center|LOCUS_01680 17821 16781 gene locus_tag LOCUS_01690 17821 16781 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203190.1 protein_id gnl|my_center|LOCUS_01690 19937 17829 gene locus_tag LOCUS_01700 19937 17829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 21124 20102 gene locus_tag LOCUS_01710 21124 20102 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_01710 21705 21199 gene locus_tag LOCUS_01720 21705 21199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 22208 21702 gene locus_tag LOCUS_01730 22208 21702 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766431.1 protein_id gnl|my_center|LOCUS_01730 24343 22205 gene locus_tag LOCUS_01740 24343 22205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 26665 24374 gene locus_tag LOCUS_01750 26665 24374 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766293.1 protein_id gnl|my_center|LOCUS_01750 26897 28099 gene locus_tag LOCUS_01760 gene ilvA 26897 28099 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_01760 30029 28248 gene locus_tag LOCUS_01770 gene rpsA 30029 28248 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_01770 32917 30326 gene locus_tag LOCUS_01780 32917 30326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 33617 33015 gene locus_tag LOCUS_01790 33617 33015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 35040 33922 gene locus_tag LOCUS_01800 35040 33922 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202124.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01800 35296 34949 gene locus_tag LOCUS_01810 35296 34949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01810 36388 35396 gene locus_tag LOCUS_01820 gene tsf 36388 35396 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764142.1 protein_id gnl|my_center|LOCUS_01820 36593 36420 gene locus_tag LOCUS_01830 36593 36420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 36642 36804 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37717 37331 gene locus_tag LOCUS_01840 gene rpsI 37717 37331 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_01840 38206 37727 gene locus_tag LOCUS_01850 gene rplM 38206 37727 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782434.1 protein_id gnl|my_center|LOCUS_01850 38668 38432 gene locus_tag LOCUS_01860 38668 38432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 >Feature sequence005 123 731 gene locus_tag LOCUS_01870 123 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 1714 722 gene locus_tag LOCUS_01880 1714 722 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785910.1 protein_id gnl|my_center|LOCUS_01880 2788 1916 gene locus_tag LOCUS_01890 2788 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 4406 2865 gene locus_tag LOCUS_01900 4406 2865 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108979.1 protein_id gnl|my_center|LOCUS_01900 5994 4396 gene locus_tag LOCUS_01910 5994 4396 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790465.1 protein_id gnl|my_center|LOCUS_01910 6841 5981 gene locus_tag LOCUS_01920 6841 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781085.1 protein_id gnl|my_center|LOCUS_01920 7558 6848 gene locus_tag LOCUS_01930 7558 6848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781085.1 protein_id gnl|my_center|LOCUS_01930 10007 7623 gene locus_tag LOCUS_01940 10007 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 10322 10924 gene locus_tag LOCUS_01950 10322 10924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 10933 11754 gene locus_tag LOCUS_01960 10933 11754 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107719.1 protein_id gnl|my_center|LOCUS_01960 12245 11805 gene locus_tag LOCUS_01970 12245 11805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 14909 12318 gene locus_tag LOCUS_01980 gene clpB 14909 12318 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764749.1 protein_id gnl|my_center|LOCUS_01980 15056 15937 gene locus_tag LOCUS_01990 15056 15937 CDS product DUF5106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793053.1 protein_id gnl|my_center|LOCUS_01990 15942 16451 gene locus_tag LOCUS_02000 15942 16451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 16473 17564 gene locus_tag LOCUS_02010 gene mnmA 16473 17564 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202407.1 protein_id gnl|my_center|LOCUS_02010 17596 18186 gene locus_tag LOCUS_02020 17596 18186 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_02020 18214 19596 gene locus_tag LOCUS_02030 18214 19596 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760003.1 protein_id gnl|my_center|LOCUS_02030 19589 20338 gene locus_tag LOCUS_02040 19589 20338 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760001.1 protein_id gnl|my_center|LOCUS_02040 20341 21147 gene locus_tag LOCUS_02050 gene kdsA 20341 21147 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759991.1 protein_id gnl|my_center|LOCUS_02050 21176 22768 gene locus_tag LOCUS_02060 21176 22768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 23049 22732 gene locus_tag LOCUS_02070 23049 22732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02070 23272 23027 gene locus_tag LOCUS_02080 23272 23027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02080 23905 23285 gene locus_tag LOCUS_02090 gene recR 23905 23285 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_02090 24036 24875 gene locus_tag LOCUS_02100 gene panC 24036 24875 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202230.1 protein_id gnl|my_center|LOCUS_02100 25153 25196 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25460 25604 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25645 26007 gene locus_tag LOCUS_02110 25645 26007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02110 26045 26509 gene locus_tag LOCUS_02120 26045 26509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02120 26540 27421 gene locus_tag LOCUS_02130 gene folD 26540 27421 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767914.1 protein_id gnl|my_center|LOCUS_02130 27432 28277 gene locus_tag LOCUS_02140 27432 28277 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_02140 28284 29216 gene locus_tag LOCUS_02150 28284 29216 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763724.1 protein_id gnl|my_center|LOCUS_02150 29226 29519 gene locus_tag LOCUS_02160 29226 29519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 29360 29386 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29479 29757 gene locus_tag LOCUS_02170 29479 29757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 29763 29776 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29941 30055 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30646 31182 gene locus_tag LOCUS_02180 30646 31182 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478802.1 protein_id gnl|my_center|LOCUS_02180 31167 31688 gene locus_tag LOCUS_02190 31167 31688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 31694 32596 gene locus_tag LOCUS_02200 31694 32596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 32598 33341 gene locus_tag LOCUS_02210 32598 33341 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109289.1 protein_id gnl|my_center|LOCUS_02210 34265 33354 gene locus_tag LOCUS_02220 gene dinD 34265 33354 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_02220 34839 34306 gene locus_tag LOCUS_02230 34839 34306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02230 36271 34880 gene locus_tag LOCUS_02240 36271 34880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02240 34888 34907 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35596 35608 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37567 36287 gene locus_tag LOCUS_02250 37567 36287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 37721 37809 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence006 1471 59 gene locus_tag LOCUS_02260 1471 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 2171 1464 gene locus_tag LOCUS_02270 2171 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 2766 2173 gene locus_tag LOCUS_02280 2766 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 3729 3130 gene locus_tag LOCUS_02290 3729 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 3903 5192 gene locus_tag LOCUS_02300 3903 5192 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916221.1 protein_id gnl|my_center|LOCUS_02300 8007 5266 gene locus_tag LOCUS_02310 8007 5266 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_02310 8662 8153 gene locus_tag LOCUS_02320 8662 8153 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906361.1 protein_id gnl|my_center|LOCUS_02320 8795 10567 gene locus_tag LOCUS_02330 8795 10567 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107752.1 protein_id gnl|my_center|LOCUS_02330 10713 11201 gene locus_tag LOCUS_02340 10713 11201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 11678 11202 gene locus_tag LOCUS_02350 gene cdd 11678 11202 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762228.1 protein_id gnl|my_center|LOCUS_02350 13309 11675 gene locus_tag LOCUS_02360 13309 11675 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767963.1 protein_id gnl|my_center|LOCUS_02360 13991 13341 gene locus_tag LOCUS_02370 13991 13341 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763832.1 protein_id gnl|my_center|LOCUS_02370 15395 14007 gene locus_tag LOCUS_02380 gene asnS 15395 14007 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203550.1 protein_id gnl|my_center|LOCUS_02380 16944 15433 gene locus_tag LOCUS_02390 16944 15433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 18499 17156 gene locus_tag LOCUS_02400 gene purB 18499 17156 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791759.1 protein_id gnl|my_center|LOCUS_02400 19195 18530 gene locus_tag LOCUS_02410 19195 18530 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_02410 21522 19210 gene locus_tag LOCUS_02420 21522 19210 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202810.1 protein_id gnl|my_center|LOCUS_02420 21689 22282 gene locus_tag LOCUS_02430 21689 22282 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802804.1 protein_id gnl|my_center|LOCUS_02430 22279 22848 gene locus_tag LOCUS_02440 22279 22848 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_02440 22851 24155 gene locus_tag LOCUS_02450 22851 24155 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_02450 24573 24199 gene locus_tag LOCUS_02460 24573 24199 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762436.1 protein_id gnl|my_center|LOCUS_02460 25947 24586 gene locus_tag LOCUS_02470 25947 24586 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107706.1 protein_id gnl|my_center|LOCUS_02470 26065 26922 gene locus_tag LOCUS_02480 26065 26922 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787611.1 protein_id gnl|my_center|LOCUS_02480 26951 28663 gene locus_tag LOCUS_02490 26951 28663 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765636.1 protein_id gnl|my_center|LOCUS_02490 28735 29679 gene locus_tag LOCUS_02500 28735 29679 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768748.1 protein_id gnl|my_center|LOCUS_02500 30699 29848 gene locus_tag LOCUS_02510 30699 29848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 31247 30705 gene locus_tag LOCUS_02520 31247 30705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 31257 31376 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32490 35726 gene locus_tag LOCUS_02530 32490 35726 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813489.1 protein_id gnl|my_center|LOCUS_02530 35807 37861 gene locus_tag LOCUS_02540 35807 37861 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791949.1 protein_id gnl|my_center|LOCUS_02540 >Feature sequence007 502 140 gene locus_tag LOCUS_02550 502 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02550 741 815 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2383 1040 gene locus_tag LOCUS_02560 2383 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 3181 2429 gene locus_tag LOCUS_02570 gene rlmB 3181 2429 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_02570 4854 3193 gene locus_tag LOCUS_02580 gene recN 4854 3193 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107738.1 protein_id gnl|my_center|LOCUS_02580 5711 4860 gene locus_tag LOCUS_02590 5711 4860 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015543.1 protein_id gnl|my_center|LOCUS_02590 6469 5762 gene locus_tag LOCUS_02600 6469 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02600 6915 6385 gene locus_tag LOCUS_02610 6915 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02610 6520 6526 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7690 6908 gene locus_tag LOCUS_02620 7690 6908 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_02620 8830 7706 gene locus_tag LOCUS_02630 gene dnaN 8830 7706 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762412.1 protein_id gnl|my_center|LOCUS_02630 8961 9001 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9197 11464 gene locus_tag LOCUS_02640 9197 11464 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107585.1 protein_id gnl|my_center|LOCUS_02640 11533 13584 gene locus_tag LOCUS_02650 11533 13584 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108964.1 protein_id gnl|my_center|LOCUS_02650 13691 14152 gene locus_tag LOCUS_02660 13691 14152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02660 14385 14468 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14628 14667 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14833 14857 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15253 15582 gene locus_tag LOCUS_02670 15253 15582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 15757 15569 gene locus_tag LOCUS_02680 15757 15569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 15794 15838 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16393 15854 gene locus_tag LOCUS_02690 16393 15854 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790634.1 protein_id gnl|my_center|LOCUS_02690 17000 16377 gene locus_tag LOCUS_02700 17000 16377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 17267 17076 gene locus_tag LOCUS_02710 17267 17076 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766883.1 protein_id gnl|my_center|LOCUS_02710 17378 17824 gene locus_tag LOCUS_02720 17378 17824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 17799 18764 gene locus_tag LOCUS_02730 17799 18764 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108113.1 protein_id gnl|my_center|LOCUS_02730 18761 19534 gene locus_tag LOCUS_02740 18761 19534 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478755.1 protein_id gnl|my_center|LOCUS_02740 20843 19539 gene locus_tag LOCUS_02750 gene nqrF 20843 19539 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763481.1 protein_id gnl|my_center|LOCUS_02750 21465 20848 gene locus_tag LOCUS_02760 gene nqrE 21465 20848 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763480.1 protein_id gnl|my_center|LOCUS_02760 22111 21485 gene locus_tag LOCUS_02770 22111 21485 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 protein_id gnl|my_center|LOCUS_02770 22818 22117 gene locus_tag LOCUS_02780 22818 22117 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 protein_id gnl|my_center|LOCUS_02780 24029 22815 gene locus_tag LOCUS_02790 24029 22815 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763477.1 protein_id gnl|my_center|LOCUS_02790 25389 24055 gene locus_tag LOCUS_02800 25389 24055 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787198.1 protein_id gnl|my_center|LOCUS_02800 25734 26093 gene locus_tag LOCUS_02810 25734 26093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02810 25970 25990 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26132 26521 gene locus_tag LOCUS_02820 26132 26521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02820 26561 27277 gene locus_tag LOCUS_02830 26561 27277 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763544.1 protein_id gnl|my_center|LOCUS_02830 27284 28012 gene locus_tag LOCUS_02840 27284 28012 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765212.1 protein_id gnl|my_center|LOCUS_02840 28055 28909 gene locus_tag LOCUS_02850 28055 28909 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792001.1 protein_id gnl|my_center|LOCUS_02850 30575 29055 gene locus_tag LOCUS_02860 30575 29055 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841405.1 protein_id gnl|my_center|LOCUS_02860 32302 30677 gene locus_tag LOCUS_02870 32302 30677 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784160.1 protein_id gnl|my_center|LOCUS_02870 35680 32411 gene locus_tag LOCUS_02880 35680 32411 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201969.1 protein_id gnl|my_center|LOCUS_02880 35893 36312 gene locus_tag LOCUS_02890 35893 36312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02890 >Feature sequence008 548 642 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 897 2384 gene locus_tag LOCUS_02900 897 2384 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930448.1 protein_id gnl|my_center|LOCUS_02900 2475 3755 gene locus_tag LOCUS_02910 2475 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 5281 4280 gene locus_tag LOCUS_02920 5281 4280 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032663510.1 protein_id gnl|my_center|LOCUS_02920 5373 6239 gene locus_tag LOCUS_02930 5373 6239 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064377.1 protein_id gnl|my_center|LOCUS_02930 6236 6658 gene locus_tag LOCUS_02940 6236 6658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 6766 7017 gene locus_tag LOCUS_02950 6766 7017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 7104 7310 gene locus_tag LOCUS_02960 7104 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02960 8278 7376 gene locus_tag LOCUS_02970 8278 7376 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_02970 8516 9919 gene locus_tag LOCUS_02980 8516 9919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 9925 10965 gene locus_tag LOCUS_02990 9925 10965 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705392.1 protein_id gnl|my_center|LOCUS_02990 11185 13395 gene locus_tag LOCUS_03000 11185 13395 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201924.1 protein_id gnl|my_center|LOCUS_03000 16674 13471 gene locus_tag LOCUS_03010 gene carB 16674 13471 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799108.1 protein_id gnl|my_center|LOCUS_03010 17132 19801 gene locus_tag LOCUS_03020 17132 19801 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_03020 20006 20572 gene locus_tag LOCUS_03030 20006 20572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 21553 20648 gene locus_tag LOCUS_03040 21553 20648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 24235 22136 gene locus_tag LOCUS_03050 24235 22136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 24365 25684 gene locus_tag LOCUS_03060 24365 25684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 25665 26360 gene locus_tag LOCUS_03070 25665 26360 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787526.1 protein_id gnl|my_center|LOCUS_03070 26510 27412 gene locus_tag LOCUS_03080 26510 27412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 28732 27485 gene locus_tag LOCUS_03090 28732 27485 CDS product DUF4934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767326.1 protein_id gnl|my_center|LOCUS_03090 31078 28889 gene locus_tag LOCUS_03100 31078 28889 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765057.1 protein_id gnl|my_center|LOCUS_03100 32423 31185 gene locus_tag LOCUS_03110 32423 31185 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788259.1 protein_id gnl|my_center|LOCUS_03110 33196 32423 gene locus_tag LOCUS_03120 gene dapF 33196 32423 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202959.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03120 33842 33952 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34616 34116 gene locus_tag LOCUS_03130 34616 34116 CDS product 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762345.1 protein_id gnl|my_center|LOCUS_03130 34631 34651 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence009 1004 102 gene locus_tag LOCUS_03140 gene xerD 1004 102 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761920.1 protein_id gnl|my_center|LOCUS_03140 1523 1014 gene locus_tag LOCUS_03150 1523 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 4077 1507 gene locus_tag LOCUS_03160 4077 1507 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108484.1 protein_id gnl|my_center|LOCUS_03160 5582 4095 gene locus_tag LOCUS_03170 gene cysS 5582 4095 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291350.1 protein_id gnl|my_center|LOCUS_03170 5911 5597 gene locus_tag LOCUS_03180 5911 5597 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_03180 6583 5912 gene locus_tag LOCUS_03190 6583 5912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 7269 6583 gene locus_tag LOCUS_03200 7269 6583 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762585.1 protein_id gnl|my_center|LOCUS_03200 7650 7725 gene locus_tag LOCUS_t00020 7650 7725 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 7917 8969 gene locus_tag LOCUS_03210 7917 8969 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_03210 9454 8990 gene locus_tag LOCUS_03220 9454 8990 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993802.1 protein_id gnl|my_center|LOCUS_03220 9545 10162 gene locus_tag LOCUS_03230 9545 10162 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_03230 10164 11093 gene locus_tag LOCUS_03240 10164 11093 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203664.1 protein_id gnl|my_center|LOCUS_03240 11614 11066 gene locus_tag LOCUS_03250 11614 11066 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_03250 11799 11623 gene locus_tag LOCUS_03260 11799 11623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03260 12878 11796 gene locus_tag LOCUS_03270 gene serS 12878 11796 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785334.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03270 13341 12892 gene locus_tag LOCUS_03280 13341 12892 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763705.1 protein_id gnl|my_center|LOCUS_03280 14327 13461 gene locus_tag LOCUS_03290 14327 13461 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_03290 15410 14397 gene locus_tag LOCUS_03300 15410 14397 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108506.1 protein_id gnl|my_center|LOCUS_03300 17263 15410 gene locus_tag LOCUS_03310 17263 15410 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108505.1 protein_id gnl|my_center|LOCUS_03310 18750 17386 gene locus_tag LOCUS_03320 18750 17386 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766200.1 protein_id gnl|my_center|LOCUS_03320 19507 18737 gene locus_tag LOCUS_03330 19507 18737 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_03330 21201 19510 gene locus_tag LOCUS_03340 21201 19510 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791194.1 protein_id gnl|my_center|LOCUS_03340 24188 21210 gene locus_tag LOCUS_03350 24188 21210 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797422.1 protein_id gnl|my_center|LOCUS_03350 25692 24316 gene locus_tag LOCUS_03360 25692 24316 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790898.1 protein_id gnl|my_center|LOCUS_03360 26684 25689 gene locus_tag LOCUS_03370 26684 25689 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759775.1 protein_id gnl|my_center|LOCUS_03370 28479 26716 gene locus_tag LOCUS_03380 gene lysS 28479 26716 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802230.1 protein_id gnl|my_center|LOCUS_03380 29788 28589 gene locus_tag LOCUS_03390 gene pncB 29788 28589 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203338.1 protein_id gnl|my_center|LOCUS_03390 30333 29776 gene locus_tag LOCUS_03400 30333 29776 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015162.1 protein_id gnl|my_center|LOCUS_03400 30974 30327 gene locus_tag LOCUS_03410 30974 30327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 33198 30964 gene locus_tag LOCUS_03420 33198 30964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 34109 33354 gene locus_tag LOCUS_03430 34109 33354 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783491.1 protein_id gnl|my_center|LOCUS_03430 <34718 34179 gene locus_tag LOCUS_03440 <34718 34179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761732.1:fumarate reductase/succinate dehydrogenase flavoprotein subunit >Feature sequence010 265 329 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5039 3108 gene locus_tag LOCUS_03450 5039 3108 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815393.1 protein_id gnl|my_center|LOCUS_03450 5673 5050 gene locus_tag LOCUS_03460 5673 5050 CDS product HmuY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793333.1 protein_id gnl|my_center|LOCUS_03460 6502 5666 gene locus_tag LOCUS_03470 6502 5666 CDS product calycin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793335.1 protein_id gnl|my_center|LOCUS_03470 6746 7699 gene locus_tag LOCUS_03480 6746 7699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 7757 8062 gene locus_tag LOCUS_03490 7757 8062 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107149.1 protein_id gnl|my_center|LOCUS_03490 8055 8408 gene locus_tag LOCUS_03500 8055 8408 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766714.1 protein_id gnl|my_center|LOCUS_03500 8955 8518 gene locus_tag LOCUS_03510 8955 8518 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760391.1 protein_id gnl|my_center|LOCUS_03510 9434 8991 gene locus_tag LOCUS_03520 9434 8991 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760391.1 protein_id gnl|my_center|LOCUS_03520 10088 9498 gene locus_tag LOCUS_03530 10088 9498 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_03530 11806 10109 gene locus_tag LOCUS_03540 gene aspT 11806 10109 CDS product aspartate-alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107422.1 protein_id gnl|my_center|LOCUS_03540 12385 11879 gene locus_tag LOCUS_03550 12385 11879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 12487 12810 gene locus_tag LOCUS_03560 12487 12810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 14503 12803 gene locus_tag LOCUS_03570 gene aspT 14503 12803 CDS product aspartate-alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107422.1 protein_id gnl|my_center|LOCUS_03570 15150 14551 gene locus_tag LOCUS_03580 15150 14551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 15386 16462 gene locus_tag LOCUS_03590 15386 16462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 16616 17476 gene locus_tag LOCUS_03600 16616 17476 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779810.1 protein_id gnl|my_center|LOCUS_03600 17816 18820 gene locus_tag LOCUS_03610 17816 18820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 19043 21904 gene locus_tag LOCUS_03620 19043 21904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 23953 21905 gene locus_tag LOCUS_03630 23953 21905 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764525.1 protein_id gnl|my_center|LOCUS_03630 24055 24732 gene locus_tag LOCUS_03640 24055 24732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 25700 24798 gene locus_tag LOCUS_03650 25700 24798 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786279.1 protein_id gnl|my_center|LOCUS_03650 28771 25775 gene locus_tag LOCUS_03660 28771 25775 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108299.1 protein_id gnl|my_center|LOCUS_03660 30284 28779 gene locus_tag LOCUS_03670 30284 28779 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259102.1 protein_id gnl|my_center|LOCUS_03670 30454 31911 gene locus_tag LOCUS_03680 30454 31911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067457.1 protein_id gnl|my_center|LOCUS_03680 <32529 31916 gene locus_tag LOCUS_03690 <32529 31916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787518.1:iron ABC transporter permease >Feature sequence011 412 170 gene locus_tag LOCUS_03700 412 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03700 1174 737 gene locus_tag LOCUS_03710 1174 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03710 2366 1257 gene locus_tag LOCUS_03720 2366 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 2773 2402 gene locus_tag LOCUS_03730 2773 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 4236 2851 gene locus_tag LOCUS_03740 4236 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03740 2861 2937 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3385 3423 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4567 4283 gene locus_tag LOCUS_03750 4567 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 5123 4449 gene locus_tag LOCUS_03760 5123 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 7059 5212 gene locus_tag LOCUS_03770 7059 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03770 7877 7221 gene locus_tag LOCUS_03780 7877 7221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03780 9058 7940 gene locus_tag LOCUS_03790 9058 7940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03790 8280 8308 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9918 9010 gene locus_tag LOCUS_03800 9918 9010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03800 9112 9184 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10408 10031 gene locus_tag LOCUS_03810 10408 10031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03810 10943 10389 gene locus_tag LOCUS_03820 10943 10389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03820 13267 10943 gene locus_tag LOCUS_03830 gene topA 13267 10943 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791192.1 protein_id gnl|my_center|LOCUS_03830 13996 13418 gene locus_tag LOCUS_03840 13996 13418 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_03840 14123 15136 gene locus_tag LOCUS_03850 14123 15136 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764710.1 protein_id gnl|my_center|LOCUS_03850 15225 15632 gene locus_tag LOCUS_03860 15225 15632 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105100245.1 protein_id gnl|my_center|LOCUS_03860 16174 15629 gene locus_tag LOCUS_03870 16174 15629 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203456.1 protein_id gnl|my_center|LOCUS_03870 17199 16171 gene locus_tag LOCUS_03880 17199 16171 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004305537.1 protein_id gnl|my_center|LOCUS_03880 17534 17337 gene locus_tag LOCUS_03890 17534 17337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 19385 17676 gene locus_tag LOCUS_03900 19385 17676 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788185.1 protein_id gnl|my_center|LOCUS_03900 19847 19413 gene locus_tag LOCUS_03910 19847 19413 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763578.1 protein_id gnl|my_center|LOCUS_03910 20877 19885 gene locus_tag LOCUS_03920 20877 19885 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_03920 21011 23023 gene locus_tag LOCUS_03930 gene ligA 21011 23023 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765723.1 protein_id gnl|my_center|LOCUS_03930 23063 23659 gene locus_tag LOCUS_03940 23063 23659 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108458.1 protein_id gnl|my_center|LOCUS_03940 24399 23740 gene locus_tag LOCUS_03950 24399 23740 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_03950 25297 24458 gene locus_tag LOCUS_03960 25297 24458 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107747.1 protein_id gnl|my_center|LOCUS_03960 25406 26227 gene locus_tag LOCUS_03970 25406 26227 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025876514.1 protein_id gnl|my_center|LOCUS_03970 26305 26604 gene locus_tag LOCUS_03980 26305 26604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 27494 27084 gene locus_tag LOCUS_03990 27494 27084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 27637 27996 gene locus_tag LOCUS_04000 27637 27996 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763033.1 protein_id gnl|my_center|LOCUS_04000 28705 28013 gene locus_tag LOCUS_04010 28705 28013 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475996.1 protein_id gnl|my_center|LOCUS_04010 28875 29981 gene locus_tag LOCUS_04020 28875 29981 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108203.1 protein_id gnl|my_center|LOCUS_04020 30020 31714 gene locus_tag LOCUS_04030 30020 31714 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789735.1 protein_id gnl|my_center|LOCUS_04030 32355 31789 gene locus_tag LOCUS_04040 32355 31789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 >Feature sequence012 826 254 gene locus_tag LOCUS_04050 826 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 1125 1925 gene locus_tag LOCUS_04060 gene bamD 1125 1925 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788200.1 protein_id gnl|my_center|LOCUS_04060 1956 2291 gene locus_tag LOCUS_04070 1956 2291 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_04070 2437 2712 gene locus_tag LOCUS_04080 gene rpsO 2437 2712 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791955.1 protein_id gnl|my_center|LOCUS_04080 2910 3569 gene locus_tag LOCUS_04090 2910 3569 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788593.1 protein_id gnl|my_center|LOCUS_04090 3608 4255 gene locus_tag LOCUS_04100 gene rpe 3608 4255 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109031.1 protein_id gnl|my_center|LOCUS_04100 4291 6420 gene locus_tag LOCUS_04110 4291 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04110 6441 6665 gene locus_tag LOCUS_04120 6441 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04120 6652 7065 gene locus_tag LOCUS_04130 6652 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04130 7094 7705 gene locus_tag LOCUS_04140 7094 7705 CDS product LolA-like putative outer membrane lipoprotein chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109203.1 protein_id gnl|my_center|LOCUS_04140 7732 8673 gene locus_tag LOCUS_04150 gene trxB 7732 8673 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785383.1 protein_id gnl|my_center|LOCUS_04150 8839 10866 gene locus_tag LOCUS_04160 8839 10866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04160 11332 11393 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11814 13070 gene locus_tag LOCUS_04170 11814 13070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 13100 15298 gene locus_tag LOCUS_04180 13100 15298 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795983.1 protein_id gnl|my_center|LOCUS_04180 15300 16631 gene locus_tag LOCUS_04190 15300 16631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 16628 17539 gene locus_tag LOCUS_04200 gene miaA 16628 17539 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795937.1 protein_id gnl|my_center|LOCUS_04200 17536 18495 gene locus_tag LOCUS_04210 17536 18495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 18946 18467 gene locus_tag LOCUS_04220 18946 18467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 19050 19880 gene locus_tag LOCUS_04230 19050 19880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 20613 19945 gene locus_tag LOCUS_04240 20613 19945 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203643.1 protein_id gnl|my_center|LOCUS_04240 19970 19974 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20686 21336 gene locus_tag LOCUS_04250 20686 21336 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791447.1 protein_id gnl|my_center|LOCUS_04250 21446 22225 gene locus_tag LOCUS_04260 21446 22225 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_04260 23066 22272 gene locus_tag LOCUS_04270 23066 22272 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272317.1 protein_id gnl|my_center|LOCUS_04270 23154 24236 gene locus_tag LOCUS_04280 23154 24236 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456217.1 protein_id gnl|my_center|LOCUS_04280 24310 25266 gene locus_tag LOCUS_04290 gene metF 24310 25266 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766920.1 protein_id gnl|my_center|LOCUS_04290 25502 26413 gene locus_tag LOCUS_04300 25502 26413 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_04300 26416 29334 gene locus_tag LOCUS_04310 26416 29334 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107600.1 protein_id gnl|my_center|LOCUS_04310 29406 30443 gene locus_tag LOCUS_04320 gene hemW 29406 30443 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203488.1 protein_id gnl|my_center|LOCUS_04320 30924 30451 gene locus_tag LOCUS_04330 gene rlmH 30924 30451 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963965.1 protein_id gnl|my_center|LOCUS_04330 30943 31836 gene locus_tag LOCUS_04340 gene nadC 30943 31836 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762206.1 protein_id gnl|my_center|LOCUS_04340 >Feature sequence013 236 1588 gene locus_tag LOCUS_04350 236 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 239 255 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1600 3222 gene locus_tag LOCUS_04360 1600 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 3233 3844 gene locus_tag LOCUS_04370 3233 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 4083 4116 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4716 5345 gene locus_tag LOCUS_04380 4716 5345 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966717.1 protein_id gnl|my_center|LOCUS_04380 5677 5396 gene locus_tag LOCUS_04390 5677 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 6350 9298 gene locus_tag LOCUS_04400 6350 9298 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_04400 9451 10116 gene locus_tag LOCUS_04410 9451 10116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04410 10092 10098 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10106 10519 gene locus_tag LOCUS_04420 10106 10519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04420 10773 13739 gene locus_tag LOCUS_04430 10773 13739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 14152 13742 gene locus_tag LOCUS_04440 14152 13742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 14426 14238 gene locus_tag LOCUS_04450 14426 14238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 15160 14579 gene locus_tag LOCUS_04460 15160 14579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 15737 15114 gene locus_tag LOCUS_04470 15737 15114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 16034 16243 gene locus_tag LOCUS_04480 16034 16243 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789734.1 protein_id gnl|my_center|LOCUS_04480 16324 17268 gene locus_tag LOCUS_04490 gene rsgA 16324 17268 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202106.1 protein_id gnl|my_center|LOCUS_04490 17408 19102 gene locus_tag LOCUS_04500 gene sulP 17408 19102 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797091.1 protein_id gnl|my_center|LOCUS_04500 19111 19470 gene locus_tag LOCUS_04510 19111 19470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 22249 19625 gene locus_tag LOCUS_04520 gene alaS 22249 19625 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796226.1 protein_id gnl|my_center|LOCUS_04520 22352 22687 gene locus_tag LOCUS_04530 22352 22687 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831050.1 protein_id gnl|my_center|LOCUS_04530 22760 23335 gene locus_tag LOCUS_04540 22760 23335 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203275.1 protein_id gnl|my_center|LOCUS_04540 23332 23886 gene locus_tag LOCUS_04550 23332 23886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 24008 26830 gene locus_tag LOCUS_04560 24008 26830 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_04560 >Feature sequence014 375 469 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 609 641 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 931 1257 gene locus_tag LOCUS_04570 931 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 1540 2022 gene locus_tag LOCUS_04580 gene ybaK 1540 2022 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_04580 2019 3095 gene locus_tag LOCUS_04590 gene aroC 2019 3095 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802245.1 protein_id gnl|my_center|LOCUS_04590 3101 4036 gene locus_tag LOCUS_04600 3101 4036 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761007.1 protein_id gnl|my_center|LOCUS_04600 5051 3984 gene locus_tag LOCUS_04610 5051 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 6575 5067 gene locus_tag LOCUS_04620 6575 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 7479 6649 gene locus_tag LOCUS_04630 7479 6649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 8922 7483 gene locus_tag LOCUS_04640 gene gldK 8922 7483 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_04640 9923 8928 gene locus_tag LOCUS_04650 9923 8928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 10636 9920 gene locus_tag LOCUS_04660 10636 9920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 10848 11981 gene locus_tag LOCUS_04670 10848 11981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04670 11954 12670 gene locus_tag LOCUS_04680 11954 12670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04680 13847 12777 gene locus_tag LOCUS_04690 13847 12777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 14059 15597 gene locus_tag LOCUS_04700 14059 15597 CDS product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786397.1 protein_id gnl|my_center|LOCUS_04700 15594 16019 gene locus_tag LOCUS_04710 15594 16019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 16022 17458 gene locus_tag LOCUS_04720 gene rpoN 16022 17458 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_04720 17515 18084 gene locus_tag LOCUS_04730 17515 18084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 18145 18151 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18341 18544 gene locus_tag LOCUS_04740 18341 18544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04740 18562 20244 gene locus_tag LOCUS_04750 18562 20244 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108331.1 protein_id gnl|my_center|LOCUS_04750 20241 21278 gene locus_tag LOCUS_04760 gene ribD 20241 21278 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784375.1 protein_id gnl|my_center|LOCUS_04760 21345 21860 gene locus_tag LOCUS_04770 21345 21860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 21873 22109 gene locus_tag LOCUS_04780 21873 22109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797802.1 protein_id gnl|my_center|LOCUS_04780 22234 22593 gene locus_tag LOCUS_04790 22234 22593 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784350.1 protein_id gnl|my_center|LOCUS_04790 22700 24364 gene locus_tag LOCUS_04800 22700 24364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 24523 26613 gene locus_tag LOCUS_04810 24523 26613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 26863 27489 gene locus_tag LOCUS_04820 26863 27489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 28176 27574 gene locus_tag LOCUS_04830 28176 27574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 28189 28388 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence015 503 1411 gene locus_tag LOCUS_04840 503 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 1408 2235 gene locus_tag LOCUS_04850 1408 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 2246 3193 gene locus_tag LOCUS_04860 gene msrB 2246 3193 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108316.1 protein_id gnl|my_center|LOCUS_04860 3557 3615 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4377 3796 gene locus_tag LOCUS_04870 4377 3796 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203642.1 protein_id gnl|my_center|LOCUS_04870 4582 7827 gene locus_tag LOCUS_04880 4582 7827 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801316.1 protein_id gnl|my_center|LOCUS_04880 7844 9637 gene locus_tag LOCUS_04890 7844 9637 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790207.1 protein_id gnl|my_center|LOCUS_04890 10343 9762 gene locus_tag LOCUS_04900 10343 9762 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_04900 11120 10413 gene locus_tag LOCUS_04910 11120 10413 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072997.1 protein_id gnl|my_center|LOCUS_04910 12544 11132 gene locus_tag LOCUS_04920 12544 11132 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_04920 12893 13099 gene locus_tag LOCUS_04930 12893 13099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 13096 13542 gene locus_tag LOCUS_04940 gene tnpA 13096 13542 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_04940 14088 14738 gene locus_tag LOCUS_04950 14088 14738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 14772 18215 gene locus_tag LOCUS_04960 14772 18215 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202528.1 protein_id gnl|my_center|LOCUS_04960 18242 20059 gene locus_tag LOCUS_04970 18242 20059 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202534.1 protein_id gnl|my_center|LOCUS_04970 20282 20488 gene locus_tag LOCUS_04980 20282 20488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 20623 20811 gene locus_tag LOCUS_04990 20623 20811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 20842 21495 gene locus_tag LOCUS_05000 20842 21495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 21502 21726 gene locus_tag LOCUS_05010 21502 21726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 22197 22574 gene locus_tag LOCUS_05020 22197 22574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 22607 23422 gene locus_tag LOCUS_05030 22607 23422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 23413 24579 gene locus_tag LOCUS_05040 23413 24579 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761753.1 protein_id gnl|my_center|LOCUS_05040 24576 26096 gene locus_tag LOCUS_05050 24576 26096 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795907.1 protein_id gnl|my_center|LOCUS_05050 >Feature sequence016 <1 4328 gene locus_tag LOCUS_05060 <1 4328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_069129909.1:GLUG motif-containing protein 4346 5350 gene locus_tag LOCUS_05070 4346 5350 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108603.1 protein_id gnl|my_center|LOCUS_05070 6027 5353 gene locus_tag LOCUS_05080 gene trmD 6027 5353 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993029.1 protein_id gnl|my_center|LOCUS_05080 6929 6024 gene locus_tag LOCUS_05090 6929 6024 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108326.1 protein_id gnl|my_center|LOCUS_05090 8388 6910 gene locus_tag LOCUS_05100 8388 6910 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767085.1 protein_id gnl|my_center|LOCUS_05100 9551 8385 gene locus_tag LOCUS_05110 9551 8385 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201998.1 protein_id gnl|my_center|LOCUS_05110 9705 10700 gene locus_tag LOCUS_05120 9705 10700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 11163 10702 gene locus_tag LOCUS_05130 11163 10702 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173947.1 protein_id gnl|my_center|LOCUS_05130 11914 11150 gene locus_tag LOCUS_05140 gene cybH 11914 11150 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811165.1 protein_id gnl|my_center|LOCUS_05140 13732 11924 gene locus_tag LOCUS_05150 13732 11924 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502532.1 protein_id gnl|my_center|LOCUS_05150 14802 13717 gene locus_tag LOCUS_05160 14802 13717 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338265.1 protein_id gnl|my_center|LOCUS_05160 15880 14834 gene locus_tag LOCUS_05170 gene hypE 15880 14834 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933452.1 protein_id gnl|my_center|LOCUS_05170 16998 15877 gene locus_tag LOCUS_05180 gene hypD 16998 15877 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933454.1 protein_id gnl|my_center|LOCUS_05180 17290 16976 gene locus_tag LOCUS_05190 17290 16976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 17445 23186 gene locus_tag LOCUS_05200 17445 23186 CDS product DUF3320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203358.1 protein_id gnl|my_center|LOCUS_05200 23304 24854 gene locus_tag LOCUS_05210 23304 24854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 >Feature sequence017 213 222 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 457 507 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 537 854 gene locus_tag LOCUS_05220 537 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05220 847 2073 gene locus_tag LOCUS_05230 847 2073 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763621.1 protein_id gnl|my_center|LOCUS_05230 2088 3335 gene locus_tag LOCUS_05240 2088 3335 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108314.1 protein_id gnl|my_center|LOCUS_05240 3371 4474 gene locus_tag LOCUS_05250 3371 4474 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_05250 4487 5791 gene locus_tag LOCUS_05260 4487 5791 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_05260 5961 6659 gene locus_tag LOCUS_05270 5961 6659 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_05270 6724 7614 gene locus_tag LOCUS_05280 6724 7614 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109171.1 protein_id gnl|my_center|LOCUS_05280 11906 7881 gene locus_tag LOCUS_05290 11906 7881 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203260.1 protein_id gnl|my_center|LOCUS_05290 13754 12042 gene locus_tag LOCUS_05300 gene aspT 13754 12042 CDS product aspartate-alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786308.1 protein_id gnl|my_center|LOCUS_05300 14761 13838 gene locus_tag LOCUS_05310 gene queG 14761 13838 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813933.1 protein_id gnl|my_center|LOCUS_05310 15395 14772 gene locus_tag LOCUS_05320 15395 14772 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783668.1 protein_id gnl|my_center|LOCUS_05320 18914 15405 gene locus_tag LOCUS_05330 18914 15405 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108712.1 protein_id gnl|my_center|LOCUS_05330 19146 19658 gene locus_tag LOCUS_05340 gene argR 19146 19658 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796492.1 protein_id gnl|my_center|LOCUS_05340 19664 20605 gene locus_tag LOCUS_05350 gene argC 19664 20605 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762696.1 protein_id gnl|my_center|LOCUS_05350 22810 20615 gene locus_tag LOCUS_05360 22810 20615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 >Feature sequence018 219 237 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 420 472 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1351 785 gene locus_tag LOCUS_05370 1351 785 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657326.1 protein_id gnl|my_center|LOCUS_05370 2388 1432 gene locus_tag LOCUS_05380 2388 1432 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107655.1 protein_id gnl|my_center|LOCUS_05380 2890 2498 gene locus_tag LOCUS_05390 2890 2498 CDS product DUF1232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705009.1 protein_id gnl|my_center|LOCUS_05390 4319 2970 gene locus_tag LOCUS_05400 4319 2970 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_05400 4558 5037 gene locus_tag LOCUS_05410 4558 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 5630 5034 gene locus_tag LOCUS_05420 5630 5034 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948225.1 protein_id gnl|my_center|LOCUS_05420 5744 7624 gene locus_tag LOCUS_05430 5744 7624 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555875.1 protein_id gnl|my_center|LOCUS_05430 7848 8330 gene locus_tag LOCUS_05440 7848 8330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 9039 8398 gene locus_tag LOCUS_05450 9039 8398 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765911.1 protein_id gnl|my_center|LOCUS_05450 10320 9103 gene locus_tag LOCUS_05460 10320 9103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05460 10703 10308 gene locus_tag LOCUS_05470 10703 10308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 10783 11886 gene locus_tag LOCUS_05480 10783 11886 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763566.1 protein_id gnl|my_center|LOCUS_05480 13348 11984 gene locus_tag LOCUS_05490 gene mgtE 13348 11984 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784864.1 protein_id gnl|my_center|LOCUS_05490 14139 13348 gene locus_tag LOCUS_05500 gene rsmA 14139 13348 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760928.1 protein_id gnl|my_center|LOCUS_05500 15345 14182 gene locus_tag LOCUS_05510 gene nagA 15345 14182 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788940.1 protein_id gnl|my_center|LOCUS_05510 15586 15819 gene locus_tag LOCUS_05520 15586 15819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 15809 16147 gene locus_tag LOCUS_05530 15809 16147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 16579 16175 gene locus_tag LOCUS_05540 16579 16175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 18024 16684 gene locus_tag LOCUS_05550 18024 16684 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108845.1 protein_id gnl|my_center|LOCUS_05550 18788 18063 gene locus_tag LOCUS_05560 18788 18063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 20290 18785 gene locus_tag LOCUS_05570 20290 18785 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201932.1 protein_id gnl|my_center|LOCUS_05570 20979 20662 gene locus_tag LOCUS_05580 20979 20662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05580 20688 20701 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22160 21126 gene locus_tag LOCUS_05590 22160 21126 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681377.1 protein_id gnl|my_center|LOCUS_05590 >Feature sequence019 449 1495 gene locus_tag LOCUS_05600 449 1495 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 protein_id gnl|my_center|LOCUS_05600 1508 2617 gene locus_tag LOCUS_05610 gene recF 1508 2617 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785234.1 protein_id gnl|my_center|LOCUS_05610 2622 2912 gene locus_tag LOCUS_05620 2622 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 2924 3394 gene locus_tag LOCUS_05630 2924 3394 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791034.1 protein_id gnl|my_center|LOCUS_05630 3437 5203 gene locus_tag LOCUS_05640 3437 5203 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203704.1 protein_id gnl|my_center|LOCUS_05640 5279 5878 gene locus_tag LOCUS_05650 5279 5878 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783748.1 protein_id gnl|my_center|LOCUS_05650 5829 6824 gene locus_tag LOCUS_05660 5829 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 6824 7837 gene locus_tag LOCUS_05670 6824 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 7847 8338 gene locus_tag LOCUS_05680 gene ribH 7847 8338 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764452.1 protein_id gnl|my_center|LOCUS_05680 10009 8339 gene locus_tag LOCUS_05690 10009 8339 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_05690 10800 10039 gene locus_tag LOCUS_05700 10800 10039 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694490.1 protein_id gnl|my_center|LOCUS_05700 11037 11477 gene locus_tag LOCUS_05710 gene ybeY 11037 11477 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108739.1 protein_id gnl|my_center|LOCUS_05710 11474 13354 gene locus_tag LOCUS_05720 gene mnmG 11474 13354 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762875.1 protein_id gnl|my_center|LOCUS_05720 13335 13943 gene locus_tag LOCUS_05730 13335 13943 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762874.1 protein_id gnl|my_center|LOCUS_05730 13963 15774 gene locus_tag LOCUS_05740 gene uvrC 13963 15774 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962398.1 protein_id gnl|my_center|LOCUS_05740 15818 16825 gene locus_tag LOCUS_05750 15818 16825 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796268.1 protein_id gnl|my_center|LOCUS_05750 16863 17978 gene locus_tag LOCUS_05760 gene pdxA 16863 17978 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_05760 18127 18816 gene locus_tag LOCUS_05770 18127 18816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 18809 19408 gene locus_tag LOCUS_05780 18809 19408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 19398 20309 gene locus_tag LOCUS_05790 19398 20309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 20439 21782 gene locus_tag LOCUS_05800 20439 21782 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_05800 >Feature sequence020 179 257 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 642 780 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 945 1006 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1160 1846 gene locus_tag LOCUS_05810 1160 1846 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759971.1 protein_id gnl|my_center|LOCUS_05810 2367 3932 gene locus_tag LOCUS_05820 2367 3932 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767001.1 protein_id gnl|my_center|LOCUS_05820 3929 4636 gene locus_tag LOCUS_05830 3929 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 5728 4730 gene locus_tag LOCUS_05840 5728 4730 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763359.1 protein_id gnl|my_center|LOCUS_05840 6667 5834 gene locus_tag LOCUS_05850 6667 5834 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393681.1 protein_id gnl|my_center|LOCUS_05850 6970 6779 gene locus_tag LOCUS_05860 gene rpsU 6970 6779 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782152.1 protein_id gnl|my_center|LOCUS_05860 7224 6991 gene locus_tag LOCUS_05870 7224 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 7223 9436 gene locus_tag LOCUS_05880 7223 9436 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067209.1 protein_id gnl|my_center|LOCUS_05880 9457 11235 gene locus_tag LOCUS_05890 gene fucI 9457 11235 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_05890 11296 12597 gene locus_tag LOCUS_05900 gene fucP 11296 12597 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201906.1 protein_id gnl|my_center|LOCUS_05900 16152 12658 gene locus_tag LOCUS_05910 16152 12658 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202755.1 protein_id gnl|my_center|LOCUS_05910 16641 16210 gene locus_tag LOCUS_05920 16641 16210 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764143.1 protein_id gnl|my_center|LOCUS_05920 17687 16605 gene locus_tag LOCUS_05930 17687 16605 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763566.1 protein_id gnl|my_center|LOCUS_05930 18236 17997 gene locus_tag LOCUS_05940 18236 17997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 18648 18301 gene locus_tag LOCUS_05950 18648 18301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 18970 18653 gene locus_tag LOCUS_05960 18970 18653 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798232.1 protein_id gnl|my_center|LOCUS_05960 19496 20050 gene locus_tag LOCUS_05970 19496 20050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109081.1 protein_id gnl|my_center|LOCUS_05970 20055 20381 gene locus_tag LOCUS_05980 20055 20381 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764277.1 protein_id gnl|my_center|LOCUS_05980 20544 20561 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20897 21253 gene locus_tag LOCUS_05990 20897 21253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 >Feature sequence021 1406 1065 gene locus_tag LOCUS_06000 1406 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06000 2261 1425 gene locus_tag LOCUS_06010 2261 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 2552 4750 gene locus_tag LOCUS_06020 2552 4750 CDS product glycoside hydrolase family 20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107900.1 protein_id gnl|my_center|LOCUS_06020 4753 5424 gene locus_tag LOCUS_06030 4753 5424 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761471.1 protein_id gnl|my_center|LOCUS_06030 5460 8087 gene locus_tag LOCUS_06040 gene mutS 5460 8087 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203750.1 protein_id gnl|my_center|LOCUS_06040 8556 8095 gene locus_tag LOCUS_06050 8556 8095 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784733.1 protein_id gnl|my_center|LOCUS_06050 9467 8553 gene locus_tag LOCUS_06060 9467 8553 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801215.1 protein_id gnl|my_center|LOCUS_06060 10629 9448 gene locus_tag LOCUS_06070 10629 9448 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_06070 11723 10710 gene locus_tag LOCUS_06080 gene pdxB 11723 10710 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108789.1 protein_id gnl|my_center|LOCUS_06080 12175 11705 gene locus_tag LOCUS_06090 12175 11705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 13988 12705 gene locus_tag LOCUS_06100 gene purD 13988 12705 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796998.1 protein_id gnl|my_center|LOCUS_06100 15536 13998 gene locus_tag LOCUS_06110 15536 13998 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108720.1 protein_id gnl|my_center|LOCUS_06110 16479 15559 gene locus_tag LOCUS_06120 16479 15559 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762864.1 protein_id gnl|my_center|LOCUS_06120 17741 16527 gene locus_tag LOCUS_06130 17741 16527 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109012.1 protein_id gnl|my_center|LOCUS_06130 18814 17762 gene locus_tag LOCUS_06140 18814 17762 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760823.1 protein_id gnl|my_center|LOCUS_06140 19959 18946 gene locus_tag LOCUS_06150 19959 18946 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109013.1 protein_id gnl|my_center|LOCUS_06150 20466 19972 gene locus_tag LOCUS_06160 20466 19972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06160 21425 20463 gene locus_tag LOCUS_06170 21425 20463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06170 20503 20520 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence022 1364 420 gene locus_tag LOCUS_06180 1364 420 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964468.1 protein_id gnl|my_center|LOCUS_06180 1951 1364 gene locus_tag LOCUS_06190 1951 1364 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792010.1 protein_id gnl|my_center|LOCUS_06190 2072 3433 gene locus_tag LOCUS_06200 gene dacB 2072 3433 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212619.1 protein_id gnl|my_center|LOCUS_06200 3479 4165 gene locus_tag LOCUS_06210 3479 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 4167 4895 gene locus_tag LOCUS_06220 gene rsmI 4167 4895 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_06220 4928 5791 gene locus_tag LOCUS_06230 4928 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 6424 5840 gene locus_tag LOCUS_06240 gene ruvC 6424 5840 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199350787.1 protein_id gnl|my_center|LOCUS_06240 6729 6421 gene locus_tag LOCUS_06250 6729 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 7229 6726 gene locus_tag LOCUS_06260 7229 6726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 8003 7236 gene locus_tag LOCUS_06270 8003 7236 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203723.1 protein_id gnl|my_center|LOCUS_06270 8266 8000 gene locus_tag LOCUS_06280 8266 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 9067 8408 gene locus_tag LOCUS_06290 9067 8408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 9490 11112 gene locus_tag LOCUS_06300 9490 11112 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793275.1 protein_id gnl|my_center|LOCUS_06300 10100 10165 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11141 13696 gene locus_tag LOCUS_06310 11141 13696 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803825.1 protein_id gnl|my_center|LOCUS_06310 13812 14588 gene locus_tag LOCUS_06320 13812 14588 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793749.1 protein_id gnl|my_center|LOCUS_06320 14582 15487 gene locus_tag LOCUS_06330 14582 15487 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765720.1 protein_id gnl|my_center|LOCUS_06330 16125 15580 gene locus_tag LOCUS_06340 16125 15580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 19203 17239 gene locus_tag LOCUS_06350 19203 17239 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_06350 19345 19272 gene locus_tag LOCUS_t00030 19345 19272 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 20226 19528 gene locus_tag LOCUS_06360 20226 19528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 20680 20210 gene locus_tag LOCUS_06370 20680 20210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 <21620 20693 gene locus_tag LOCUS_06380 <21620 20693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267789.1:non-ribosomal peptide synthetase >Feature sequence023 <1 1012 gene locus_tag LOCUS_06390 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008768057.1:DNA polymerase IV 1058 1411 gene locus_tag LOCUS_06400 1058 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06400 1375 1845 gene locus_tag LOCUS_06410 1375 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06410 2335 1895 gene locus_tag LOCUS_06420 2335 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 2079 2094 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5535 2467 gene locus_tag LOCUS_06430 5535 2467 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789008.1 protein_id gnl|my_center|LOCUS_06430 7158 5677 gene locus_tag LOCUS_06440 7158 5677 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761349.1 protein_id gnl|my_center|LOCUS_06440 8204 7155 gene locus_tag LOCUS_06450 8204 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 11262 8209 gene locus_tag LOCUS_06460 11262 8209 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798729.1 protein_id gnl|my_center|LOCUS_06460 12479 11421 gene locus_tag LOCUS_06470 12479 11421 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203162.1 protein_id gnl|my_center|LOCUS_06470 14199 13198 gene locus_tag LOCUS_06480 14199 13198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 14254 14263 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14852 15005 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16082 16140 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16502 17521 gene locus_tag LOCUS_06490 gene tsaD 16502 17521 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107518.1 protein_id gnl|my_center|LOCUS_06490 17541 18791 gene locus_tag LOCUS_06500 17541 18791 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202865.1 protein_id gnl|my_center|LOCUS_06500 19608 18886 gene locus_tag LOCUS_06510 19608 18886 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786188.1 protein_id gnl|my_center|LOCUS_06510 20530 19682 gene locus_tag LOCUS_06520 20530 19682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 >Feature sequence024 1757 666 gene locus_tag LOCUS_06530 1757 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 3255 1966 gene locus_tag LOCUS_06540 3255 1966 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_06540 4483 3347 gene locus_tag LOCUS_06550 gene galK 4483 3347 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 protein_id gnl|my_center|LOCUS_06550 4634 6520 gene locus_tag LOCUS_06560 4634 6520 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202956.1 protein_id gnl|my_center|LOCUS_06560 7077 6595 gene locus_tag LOCUS_06570 7077 6595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 7887 7087 gene locus_tag LOCUS_06580 gene mdh 7887 7087 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791692.1 protein_id gnl|my_center|LOCUS_06580 7901 7956 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8326 9618 gene locus_tag LOCUS_06590 8326 9618 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_06590 10934 9615 gene locus_tag LOCUS_06600 10934 9615 CDS product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202431.1 protein_id gnl|my_center|LOCUS_06600 12131 11637 gene locus_tag LOCUS_06610 12131 11637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06610 12154 12161 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12610 12308 gene locus_tag LOCUS_06620 12610 12308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06620 13421 12540 gene locus_tag LOCUS_06630 13421 12540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06630 12777 12806 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13430 13483 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14257 14173 gene locus_tag LOCUS_t00040 14257 14173 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14573 14703 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15738 15256 gene locus_tag LOCUS_06640 15738 15256 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_06640 16448 15759 gene locus_tag LOCUS_06650 gene mtnN 16448 15759 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167232.1 protein_id gnl|my_center|LOCUS_06650 16529 17374 gene locus_tag LOCUS_06660 16529 17374 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760470.1 protein_id gnl|my_center|LOCUS_06660 18775 17441 gene locus_tag LOCUS_06670 18775 17441 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555756.1 protein_id gnl|my_center|LOCUS_06670 <20882 18854 gene locus_tag LOCUS_06680 <20882 18854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767789.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence025 927 400 gene locus_tag LOCUS_06690 927 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 3342 964 gene locus_tag LOCUS_06700 3342 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 3940 3359 gene locus_tag LOCUS_06710 3940 3359 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108650.1 protein_id gnl|my_center|LOCUS_06710 6740 3969 gene locus_tag LOCUS_06720 gene leuS 6740 3969 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203753.1 protein_id gnl|my_center|LOCUS_06720 7712 6768 gene locus_tag LOCUS_06730 gene nadA 7712 6768 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802044.1 protein_id gnl|my_center|LOCUS_06730 8116 7847 gene locus_tag LOCUS_06740 8116 7847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 8772 8119 gene locus_tag LOCUS_06750 gene upp 8772 8119 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791972.1 protein_id gnl|my_center|LOCUS_06750 10162 8798 gene locus_tag LOCUS_06760 10162 8798 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 protein_id gnl|my_center|LOCUS_06760 11436 10276 gene locus_tag LOCUS_06770 11436 10276 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 protein_id gnl|my_center|LOCUS_06770 12275 11433 gene locus_tag LOCUS_06780 12275 11433 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764890.1 protein_id gnl|my_center|LOCUS_06780 12526 13308 gene locus_tag LOCUS_06790 12526 13308 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864239.1 protein_id gnl|my_center|LOCUS_06790 14553 13315 gene locus_tag LOCUS_06800 14553 13315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 15200 14646 gene locus_tag LOCUS_06810 15200 14646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 15580 15200 gene locus_tag LOCUS_06820 15580 15200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 16071 15577 gene locus_tag LOCUS_06830 16071 15577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 16955 16071 gene locus_tag LOCUS_06840 gene deoC 16955 16071 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762870.1 protein_id gnl|my_center|LOCUS_06840 17329 16970 gene locus_tag LOCUS_06850 17329 16970 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783700.1 protein_id gnl|my_center|LOCUS_06850 17778 17326 gene locus_tag LOCUS_06860 gene dtd 17778 17326 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796976.1 protein_id gnl|my_center|LOCUS_06860 18177 17788 gene locus_tag LOCUS_06870 18177 17788 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764989.1 protein_id gnl|my_center|LOCUS_06870 19560 18190 gene locus_tag LOCUS_06880 19560 18190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 20336 19698 gene locus_tag LOCUS_06890 20336 19698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 >Feature sequence026 2254 17 gene locus_tag LOCUS_06900 2254 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 3655 2336 gene locus_tag LOCUS_06910 3655 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 5402 3684 gene locus_tag LOCUS_06920 5402 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 5942 5430 gene locus_tag LOCUS_06930 5942 5430 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963471.1 protein_id gnl|my_center|LOCUS_06930 6670 5948 gene locus_tag LOCUS_06940 6670 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 6904 6680 gene locus_tag LOCUS_06950 6904 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 7211 8743 gene locus_tag LOCUS_06960 gene purH 7211 8743 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792044.1 protein_id gnl|my_center|LOCUS_06960 8777 9796 gene locus_tag LOCUS_06970 8777 9796 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792050.1 protein_id gnl|my_center|LOCUS_06970 9868 10725 gene locus_tag LOCUS_06980 gene mreC 9868 10725 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792052.1 protein_id gnl|my_center|LOCUS_06980 10732 11253 gene locus_tag LOCUS_06990 10732 11253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 11237 13099 gene locus_tag LOCUS_07000 gene mrdA 11237 13099 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_07000 13080 14546 gene locus_tag LOCUS_07010 gene rodA 13080 14546 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792061.1 protein_id gnl|my_center|LOCUS_07010 14604 15248 gene locus_tag LOCUS_07020 14604 15248 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786014.1 protein_id gnl|my_center|LOCUS_07020 15245 15904 gene locus_tag LOCUS_07030 15245 15904 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813856.1 protein_id gnl|my_center|LOCUS_07030 16105 16767 gene locus_tag LOCUS_07040 16105 16767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 17036 17443 gene locus_tag LOCUS_07050 17036 17443 CDS product DUF4332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946351.1 protein_id gnl|my_center|LOCUS_07050 17378 17410 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17571 18971 gene locus_tag LOCUS_07060 17571 18971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 >Feature sequence027 595 724 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 988 1317 gene locus_tag LOCUS_07070 988 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 1271 2590 gene locus_tag LOCUS_07080 gene trkA 1271 2590 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764324.1 protein_id gnl|my_center|LOCUS_07080 2590 4065 gene locus_tag LOCUS_07090 2590 4065 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769710.1 protein_id gnl|my_center|LOCUS_07090 4136 5725 gene locus_tag LOCUS_07100 4136 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07100 5736 6941 gene locus_tag LOCUS_07110 5736 6941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07110 6992 8299 gene locus_tag LOCUS_07120 6992 8299 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107846.1 protein_id gnl|my_center|LOCUS_07120 8415 8505 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10317 8950 gene locus_tag LOCUS_07130 10317 8950 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787721.1 protein_id gnl|my_center|LOCUS_07130 10910 10287 gene locus_tag LOCUS_07140 10910 10287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 13405 10988 gene locus_tag LOCUS_07150 13405 10988 CDS product DPP IV N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839992.1 protein_id gnl|my_center|LOCUS_07150 13619 14176 gene locus_tag LOCUS_07160 13619 14176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769509.1 protein_id gnl|my_center|LOCUS_07160 15234 14185 gene locus_tag LOCUS_07170 15234 14185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 15289 15437 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16080 15601 gene locus_tag LOCUS_07180 16080 15601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 16093 16163 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16757 16581 gene locus_tag LOCUS_07190 16757 16581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07190 16819 16976 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence028 269 334 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 488 1108 gene locus_tag LOCUS_07200 gene rplD 488 1108 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_07200 1128 1418 gene locus_tag LOCUS_07210 gene rplW 1128 1418 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007747932.1 protein_id gnl|my_center|LOCUS_07210 1425 2252 gene locus_tag LOCUS_07220 gene rplB 1425 2252 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791545.1 protein_id gnl|my_center|LOCUS_07220 2275 2541 gene locus_tag LOCUS_07230 gene rpsS 2275 2541 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_07230 2584 2994 gene locus_tag LOCUS_07240 gene rplV 2584 2994 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558069.1 protein_id gnl|my_center|LOCUS_07240 2997 3743 gene locus_tag LOCUS_07250 gene rpsC 2997 3743 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782201.1 protein_id gnl|my_center|LOCUS_07250 3777 4208 gene locus_tag LOCUS_07260 gene rplP 3777 4208 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558067.1 protein_id gnl|my_center|LOCUS_07260 4215 4412 gene locus_tag LOCUS_07270 gene rpmC 4215 4412 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762039.1 protein_id gnl|my_center|LOCUS_07270 4421 4678 gene locus_tag LOCUS_07280 gene rpsQ 4421 4678 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770213.1 protein_id gnl|my_center|LOCUS_07280 4681 5046 gene locus_tag LOCUS_07290 gene rplN 4681 5046 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296340.1 protein_id gnl|my_center|LOCUS_07290 5070 5390 gene locus_tag LOCUS_07300 gene rplX 5070 5390 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_07300 5390 5938 gene locus_tag LOCUS_07310 gene rplE 5390 5938 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675434.1 protein_id gnl|my_center|LOCUS_07310 5958 6227 gene locus_tag LOCUS_07320 gene rpsN 5958 6227 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_07320 6328 6344 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6357 6668 gene locus_tag LOCUS_07330 gene rpsH 6357 6668 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782213.1 protein_id gnl|my_center|LOCUS_07330 6685 7248 gene locus_tag LOCUS_07340 gene rplF 6685 7248 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765429.1 protein_id gnl|my_center|LOCUS_07340 7269 7610 gene locus_tag LOCUS_07350 gene rplR 7269 7610 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791562.1 protein_id gnl|my_center|LOCUS_07350 7616 8134 gene locus_tag LOCUS_07360 gene rpsE 7616 8134 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 protein_id gnl|my_center|LOCUS_07360 8146 8325 gene locus_tag LOCUS_07370 gene rpmD 8146 8325 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296332.1 protein_id gnl|my_center|LOCUS_07370 8343 8789 gene locus_tag LOCUS_07380 gene rplO 8343 8789 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762046.1 protein_id gnl|my_center|LOCUS_07380 8795 10147 gene locus_tag LOCUS_07390 gene secY 8795 10147 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762047.1 protein_id gnl|my_center|LOCUS_07390 10178 10960 gene locus_tag LOCUS_07400 gene map 10178 10960 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108453.1 protein_id gnl|my_center|LOCUS_07400 10973 11191 gene locus_tag LOCUS_07410 gene infA 10973 11191 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_07410 11363 11743 gene locus_tag LOCUS_07420 gene rpsM 11363 11743 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296328.1 protein_id gnl|my_center|LOCUS_07420 11753 12142 gene locus_tag LOCUS_07430 gene rpsK 11753 12142 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_07430 12316 12921 gene locus_tag LOCUS_07440 gene rpsD 12316 12921 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762050.1 protein_id gnl|my_center|LOCUS_07440 12944 13936 gene locus_tag LOCUS_07450 12944 13936 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762051.1 protein_id gnl|my_center|LOCUS_07450 13943 14470 gene locus_tag LOCUS_07460 gene rplQ 13943 14470 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762052.1 protein_id gnl|my_center|LOCUS_07460 14688 15983 gene locus_tag LOCUS_07470 gene eno 14688 15983 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785741.1 protein_id gnl|my_center|LOCUS_07470 16922 16065 gene locus_tag LOCUS_07480 16922 16065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 >Feature sequence029 417 2591 gene locus_tag LOCUS_07490 417 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 3071 2685 gene locus_tag LOCUS_07500 3071 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 3213 4127 gene locus_tag LOCUS_07510 3213 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07510 4195 4674 gene locus_tag LOCUS_07520 4195 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07520 4922 6178 gene locus_tag LOCUS_07530 4922 6178 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080707197.1 protein_id gnl|my_center|LOCUS_07530 6175 7143 gene locus_tag LOCUS_07540 6175 7143 CDS product DUF5119 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927908.1 protein_id gnl|my_center|LOCUS_07540 7201 7371 gene locus_tag LOCUS_07550 7201 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 7380 8273 gene locus_tag LOCUS_07560 7380 8273 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303108.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07560 8893 8348 gene locus_tag LOCUS_07570 8893 8348 CDS product DUF3332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765673.1 protein_id gnl|my_center|LOCUS_07570 10203 8917 gene locus_tag LOCUS_07580 10203 8917 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802904.1 protein_id gnl|my_center|LOCUS_07580 11482 10316 gene locus_tag LOCUS_07590 11482 10316 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764417.1 protein_id gnl|my_center|LOCUS_07590 12348 11494 gene locus_tag LOCUS_07600 12348 11494 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764240.1 protein_id gnl|my_center|LOCUS_07600 12642 13076 gene locus_tag LOCUS_07610 12642 13076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07610 13028 13033 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14899 13277 gene locus_tag LOCUS_07620 14899 13277 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762276.1 protein_id gnl|my_center|LOCUS_07620 15456 15193 gene locus_tag LOCUS_07630 15456 15193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 16357 15623 gene locus_tag LOCUS_07640 16357 15623 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784670.1 protein_id gnl|my_center|LOCUS_07640 16926 16354 gene locus_tag LOCUS_07650 16926 16354 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786205.1 protein_id gnl|my_center|LOCUS_07650 >Feature sequence030 89 688 gene locus_tag LOCUS_07660 gene ureE 89 688 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212230.1 protein_id gnl|my_center|LOCUS_07660 688 1404 gene locus_tag LOCUS_07670 688 1404 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212231.1 protein_id gnl|my_center|LOCUS_07670 1452 2075 gene locus_tag LOCUS_07680 gene ureG 1452 2075 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212232.1 protein_id gnl|my_center|LOCUS_07680 2082 3041 gene locus_tag LOCUS_07690 2082 3041 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815718.1 protein_id gnl|my_center|LOCUS_07690 3067 4047 gene locus_tag LOCUS_07700 gene yut 3067 4047 CDS product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815719.1 protein_id gnl|my_center|LOCUS_07700 4050 5432 gene locus_tag LOCUS_07710 4050 5432 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728727.1 protein_id gnl|my_center|LOCUS_07710 5448 6422 gene locus_tag LOCUS_07720 5448 6422 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941934.1 protein_id gnl|my_center|LOCUS_07720 6437 7228 gene locus_tag LOCUS_07730 gene cbiQ 6437 7228 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941935.1 protein_id gnl|my_center|LOCUS_07730 7232 7933 gene locus_tag LOCUS_07740 7232 7933 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941936.1 protein_id gnl|my_center|LOCUS_07740 7983 8738 gene locus_tag LOCUS_07750 7983 8738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07750 8701 9858 gene locus_tag LOCUS_07760 8701 9858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07760 10220 10567 gene locus_tag LOCUS_07770 gene ssb 10220 10567 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795194.1 protein_id gnl|my_center|LOCUS_07770 10591 11751 gene locus_tag LOCUS_07780 10591 11751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07780 11639 11658 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11833 12567 gene locus_tag LOCUS_07790 11833 12567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07790 12551 13903 gene locus_tag LOCUS_07800 12551 13903 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108187.1 protein_id gnl|my_center|LOCUS_07800 14478 13882 gene locus_tag LOCUS_07810 14478 13882 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783983.1 protein_id gnl|my_center|LOCUS_07810 15514 14480 gene locus_tag LOCUS_07820 15514 14480 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404472.1 protein_id gnl|my_center|LOCUS_07820 16130 15729 gene locus_tag LOCUS_07830 16130 15729 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765511.1 protein_id gnl|my_center|LOCUS_07830 16786 16124 gene locus_tag LOCUS_07840 gene ung 16786 16124 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_07840 16872 16944 gene locus_tag LOCUS_t00050 16872 16944 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence031 601 1380 gene locus_tag LOCUS_07850 601 1380 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202775.1 protein_id gnl|my_center|LOCUS_07850 2594 1377 gene locus_tag LOCUS_07860 2594 1377 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_07860 5359 2594 gene locus_tag LOCUS_07870 gene polA 5359 2594 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796991.1 protein_id gnl|my_center|LOCUS_07870 5892 5407 gene locus_tag LOCUS_07880 5892 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 7564 6020 gene locus_tag LOCUS_07890 7564 6020 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_07890 8549 7569 gene locus_tag LOCUS_07900 8549 7569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 9331 8672 gene locus_tag LOCUS_07910 9331 8672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 9711 9328 gene locus_tag LOCUS_07920 9711 9328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 10395 9745 gene locus_tag LOCUS_07930 10395 9745 CDS product DUF4294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201836.1 protein_id gnl|my_center|LOCUS_07930 11958 10489 gene locus_tag LOCUS_07940 gene nadB 11958 10489 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108697.1 protein_id gnl|my_center|LOCUS_07940 10498 10584 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13341 12001 gene locus_tag LOCUS_07950 13341 12001 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762738.1 protein_id gnl|my_center|LOCUS_07950 14167 13349 gene locus_tag LOCUS_07960 gene panB 14167 13349 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765576.1 protein_id gnl|my_center|LOCUS_07960 14915 14214 gene locus_tag LOCUS_07970 14915 14214 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108550.1 protein_id gnl|my_center|LOCUS_07970 15480 14938 gene locus_tag LOCUS_07980 15480 14938 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760894.1 protein_id gnl|my_center|LOCUS_07980 16274 15471 gene locus_tag LOCUS_07990 16274 15471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 >Feature sequence032 647 1285 gene locus_tag LOCUS_08000 gene pyrE 647 1285 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784381.1 protein_id gnl|my_center|LOCUS_08000 1306 1725 gene locus_tag LOCUS_08010 1306 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 1722 2207 gene locus_tag LOCUS_08020 1722 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 2263 3063 gene locus_tag LOCUS_08030 2263 3063 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203333.1 protein_id gnl|my_center|LOCUS_08030 3146 3220 gene locus_tag LOCUS_t00060 3146 3220 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3464 4384 gene locus_tag LOCUS_08040 3464 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 4395 6284 gene locus_tag LOCUS_08050 4395 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 6422 6727 gene locus_tag LOCUS_08060 6422 6727 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107149.1 protein_id gnl|my_center|LOCUS_08060 7105 9183 gene locus_tag LOCUS_08070 7105 9183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 9253 10176 gene locus_tag LOCUS_08080 9253 10176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08080 10116 10412 gene locus_tag LOCUS_08090 10116 10412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08090 10126 10150 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10409 11620 gene locus_tag LOCUS_08100 10409 11620 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704482.1 protein_id gnl|my_center|LOCUS_08100 12331 11738 gene locus_tag LOCUS_08110 12331 11738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 13789 12446 gene locus_tag LOCUS_08120 13789 12446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 15421 13952 gene locus_tag LOCUS_08130 15421 13952 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109168.1 protein_id gnl|my_center|LOCUS_08130 16522 15638 gene locus_tag LOCUS_08140 gene dapA 16522 15638 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761561.1 protein_id gnl|my_center|LOCUS_08140 >Feature sequence033 <1 691 gene locus_tag LOCUS_08150 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202940.1:bifunctional fucokinase/fucose-1-phosphate guanylyltransferase 617 656 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1421 669 gene locus_tag LOCUS_08160 1421 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08160 1934 1566 gene locus_tag LOCUS_08170 1934 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08170 2464 1946 gene locus_tag LOCUS_08180 2464 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 3047 2439 gene locus_tag LOCUS_08190 gene nadD 3047 2439 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797930.1 protein_id gnl|my_center|LOCUS_08190 3640 3059 gene locus_tag LOCUS_08200 gene gmk 3640 3059 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790592.1 protein_id gnl|my_center|LOCUS_08200 4535 3660 gene locus_tag LOCUS_08210 4535 3660 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769918.1 protein_id gnl|my_center|LOCUS_08210 4612 5307 gene locus_tag LOCUS_08220 gene tsaB 4612 5307 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766373.1 protein_id gnl|my_center|LOCUS_08220 5726 5304 gene locus_tag LOCUS_08230 5726 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 6149 5874 gene locus_tag LOCUS_08240 6149 5874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 6970 6146 gene locus_tag LOCUS_08250 6970 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 7349 6972 gene locus_tag LOCUS_08260 7349 6972 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804269.1 protein_id gnl|my_center|LOCUS_08260 8193 7363 gene locus_tag LOCUS_08270 8193 7363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 9047 8190 gene locus_tag LOCUS_08280 9047 8190 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770315.1 protein_id gnl|my_center|LOCUS_08280 9145 9804 gene locus_tag LOCUS_08290 gene mazG 9145 9804 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109215.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08290 10037 10375 gene locus_tag LOCUS_08300 10037 10375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 10587 10654 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10683 10919 gene locus_tag LOCUS_08310 10683 10919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08310 10885 10891 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10894 11175 gene locus_tag LOCUS_08320 10894 11175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08320 11283 12335 gene locus_tag LOCUS_08330 11283 12335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08330 12150 12191 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12313 12660 gene locus_tag LOCUS_08340 12313 12660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 12660 12839 gene locus_tag LOCUS_08350 12660 12839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 14011 12998 gene locus_tag LOCUS_08360 14011 12998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08360 14934 13915 gene locus_tag LOCUS_08370 14934 13915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08370 15252 16028 gene locus_tag LOCUS_08380 15252 16028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08380 >Feature sequence034 148 190 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 541 605 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 905 1081 gene locus_tag LOCUS_08390 905 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 1201 2034 gene locus_tag LOCUS_08400 1201 2034 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_08400 2843 2166 gene locus_tag LOCUS_08410 2843 2166 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797003.1 protein_id gnl|my_center|LOCUS_08410 3724 2840 gene locus_tag LOCUS_08420 3724 2840 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108714.1 protein_id gnl|my_center|LOCUS_08420 4562 3711 gene locus_tag LOCUS_08430 4562 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 4789 5694 gene locus_tag LOCUS_08440 4789 5694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 5702 5995 gene locus_tag LOCUS_08450 5702 5995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 6387 7157 gene locus_tag LOCUS_08460 6387 7157 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405060.1 protein_id gnl|my_center|LOCUS_08460 7164 7727 gene locus_tag LOCUS_08470 7164 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 7631 8767 gene locus_tag LOCUS_08480 7631 8767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 8794 9984 gene locus_tag LOCUS_08490 8794 9984 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404923.1 protein_id gnl|my_center|LOCUS_08490 10000 13572 gene locus_tag LOCUS_08500 gene ileS 10000 13572 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107458.1 protein_id gnl|my_center|LOCUS_08500 13922 14233 gene locus_tag LOCUS_08510 13922 14233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08510 14316 15035 gene locus_tag LOCUS_08520 14316 15035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 <16171 15145 gene locus_tag LOCUS_08530 <16171 15145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005798520.1:glutamine--tRNA ligase/YqeY domain fusion protein >Feature sequence035 975 478 gene locus_tag LOCUS_08540 gene bcp 975 478 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760349.1 protein_id gnl|my_center|LOCUS_08540 4110 1201 gene locus_tag LOCUS_08550 4110 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 6487 4079 gene locus_tag LOCUS_08560 6487 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 6869 6591 gene locus_tag LOCUS_08570 6869 6591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 7513 7034 gene locus_tag LOCUS_08580 7513 7034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 7957 7529 gene locus_tag LOCUS_08590 7957 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 8564 8001 gene locus_tag LOCUS_08600 8564 8001 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_08600 9780 8599 gene locus_tag LOCUS_08610 9780 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802082.1 protein_id gnl|my_center|LOCUS_08610 11003 9783 gene locus_tag LOCUS_08620 11003 9783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08620 12387 11005 gene locus_tag LOCUS_08630 12387 11005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08630 12926 12384 gene locus_tag LOCUS_08640 12926 12384 CDS product DUF4924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786016.1 protein_id gnl|my_center|LOCUS_08640 12852 12876 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14466 12901 gene locus_tag LOCUS_08650 14466 12901 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_08650 15799 14471 gene locus_tag LOCUS_08660 15799 14471 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787452.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence036 299 436 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 709 1572 gene locus_tag LOCUS_08670 709 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 1864 2859 gene locus_tag LOCUS_08680 1864 2859 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_08680 2891 3775 gene locus_tag LOCUS_08690 2891 3775 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_08690 3786 4775 gene locus_tag LOCUS_08700 3786 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202862.1 protein_id gnl|my_center|LOCUS_08700 4781 5767 gene locus_tag LOCUS_08710 4781 5767 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_08710 5788 6261 gene locus_tag LOCUS_08720 5788 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 6218 6952 gene locus_tag LOCUS_08730 6218 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 6936 7799 gene locus_tag LOCUS_08740 6936 7799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 7802 9625 gene locus_tag LOCUS_08750 7802 9625 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765731.1 protein_id gnl|my_center|LOCUS_08750 9622 10410 gene locus_tag LOCUS_08760 9622 10410 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765730.1 protein_id gnl|my_center|LOCUS_08760 10533 10790 gene locus_tag LOCUS_08770 10533 10790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787898.1 protein_id gnl|my_center|LOCUS_08770 10853 11977 gene locus_tag LOCUS_08780 10853 11977 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765729.1 protein_id gnl|my_center|LOCUS_08780 12338 11979 gene locus_tag LOCUS_08790 12338 11979 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804269.1 protein_id gnl|my_center|LOCUS_08790 13115 12345 gene locus_tag LOCUS_08800 13115 12345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 13951 13112 gene locus_tag LOCUS_08810 13951 13112 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770315.1 protein_id gnl|my_center|LOCUS_08810 14495 13965 gene locus_tag LOCUS_08820 14495 13965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 14503 14542 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence037 202 1554 gene locus_tag LOCUS_08830 202 1554 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_08830 1620 2105 gene locus_tag LOCUS_08840 1620 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 2102 2584 gene locus_tag LOCUS_08850 2102 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 2620 3378 gene locus_tag LOCUS_08860 2620 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 3510 4106 gene locus_tag LOCUS_08870 3510 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 5280 4084 gene locus_tag LOCUS_08880 5280 4084 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785790.1 protein_id gnl|my_center|LOCUS_08880 5583 6497 gene locus_tag LOCUS_08890 gene rsmH 5583 6497 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784016.1 protein_id gnl|my_center|LOCUS_08890 6523 6870 gene locus_tag LOCUS_08900 6523 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 6867 8909 gene locus_tag LOCUS_08910 6867 8909 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108840.1 protein_id gnl|my_center|LOCUS_08910 8127 8136 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8938 9624 gene locus_tag LOCUS_08920 8938 9624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08920 9525 9551 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9633 10355 gene locus_tag LOCUS_08930 9633 10355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08930 10373 11635 gene locus_tag LOCUS_08940 gene mraY 10373 11635 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796732.1 protein_id gnl|my_center|LOCUS_08940 11638 12192 gene locus_tag LOCUS_08950 11638 12192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08950 12149 12727 gene locus_tag LOCUS_08960 12149 12727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08960 12160 12175 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12652 12969 gene locus_tag LOCUS_08970 12652 12969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08970 12995 14005 gene locus_tag LOCUS_08980 12995 14005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08980 14016 14294 gene locus_tag LOCUS_08990 14016 14294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08990 >Feature sequence038 800 378 gene locus_tag LOCUS_09000 800 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 1018 2916 gene locus_tag LOCUS_09010 gene speA 1018 2916 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767598.1 protein_id gnl|my_center|LOCUS_09010 2919 3689 gene locus_tag LOCUS_09020 gene truA 2919 3689 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785168.1 protein_id gnl|my_center|LOCUS_09020 3703 5286 gene locus_tag LOCUS_09030 3703 5286 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_09030 5308 6486 gene locus_tag LOCUS_09040 5308 6486 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789686.1 protein_id gnl|my_center|LOCUS_09040 6492 7580 gene locus_tag LOCUS_09050 6492 7580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 7597 7938 gene locus_tag LOCUS_09060 gene queD 7597 7938 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790409.1 protein_id gnl|my_center|LOCUS_09060 7932 8495 gene locus_tag LOCUS_09070 7932 8495 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840540.1 protein_id gnl|my_center|LOCUS_09070 10273 8654 gene locus_tag LOCUS_09080 10273 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964295.1 protein_id gnl|my_center|LOCUS_09080 11302 10307 gene locus_tag LOCUS_09090 11302 10307 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763547.1 protein_id gnl|my_center|LOCUS_09090 11563 11345 gene locus_tag LOCUS_09100 11563 11345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 11856 13154 gene locus_tag LOCUS_09110 11856 13154 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_09110 13782 13917 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence039 233 406 gene locus_tag LOCUS_09120 233 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 541 1080 gene locus_tag LOCUS_09130 541 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 2122 1166 gene locus_tag LOCUS_09140 2122 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 2758 2237 gene locus_tag LOCUS_09150 2758 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 3459 3040 gene locus_tag LOCUS_09160 3459 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 4442 3555 gene locus_tag LOCUS_09170 4442 3555 CDS product YwqG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799764.1 protein_id gnl|my_center|LOCUS_09170 4667 4936 gene locus_tag LOCUS_09180 4667 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 6780 5377 gene locus_tag LOCUS_09190 6780 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 7015 6773 gene locus_tag LOCUS_09200 7015 6773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 7283 7427 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7537 8892 gene locus_tag LOCUS_09210 7537 8892 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303152.1 protein_id gnl|my_center|LOCUS_09210 8882 9562 gene locus_tag LOCUS_09220 8882 9562 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107418.1 protein_id gnl|my_center|LOCUS_09220 9563 9862 gene locus_tag LOCUS_09230 9563 9862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 9849 10322 gene locus_tag LOCUS_09240 9849 10322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 11768 10422 gene locus_tag LOCUS_09250 11768 10422 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108638.1 protein_id gnl|my_center|LOCUS_09250 12046 11816 gene locus_tag LOCUS_09260 12046 11816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 12350 11973 gene locus_tag LOCUS_09270 12350 11973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 14145 12538 gene locus_tag LOCUS_09280 14145 12538 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795092.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence040 299 1486 gene locus_tag LOCUS_09290 gene recA 299 1486 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_229032746.1 protein_id gnl|my_center|LOCUS_09290 1493 2521 gene locus_tag LOCUS_09300 1493 2521 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783520.1 protein_id gnl|my_center|LOCUS_09300 2518 2793 gene locus_tag LOCUS_09310 2518 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 2795 3214 gene locus_tag LOCUS_09320 gene aroQ 2795 3214 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761921.1 protein_id gnl|my_center|LOCUS_09320 3211 4236 gene locus_tag LOCUS_09330 3211 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 4221 4853 gene locus_tag LOCUS_09340 4221 4853 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765299.1 protein_id gnl|my_center|LOCUS_09340 5495 4923 gene locus_tag LOCUS_09350 5495 4923 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202636.1 protein_id gnl|my_center|LOCUS_09350 6914 5598 gene locus_tag LOCUS_09360 6914 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 9904 6911 gene locus_tag LOCUS_09370 9904 6911 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261805.1 protein_id gnl|my_center|LOCUS_09370 11123 10164 gene locus_tag LOCUS_09380 11123 10164 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096849.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09380 11362 12138 gene locus_tag LOCUS_09390 11362 12138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 >Feature sequence041 56 1444 gene locus_tag LOCUS_09400 56 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 1448 2044 gene locus_tag LOCUS_09410 1448 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 2041 2505 gene locus_tag LOCUS_09420 2041 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 4919 2502 gene locus_tag LOCUS_09430 4919 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 6024 4930 gene locus_tag LOCUS_09440 6024 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 7045 6041 gene locus_tag LOCUS_09450 7045 6041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 8106 7045 gene locus_tag LOCUS_09460 8106 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 9139 8126 gene locus_tag LOCUS_09470 9139 8126 CDS product DUF5119 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109634.1 protein_id gnl|my_center|LOCUS_09470 10305 9136 gene locus_tag LOCUS_09480 10305 9136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 10588 13800 gene locus_tag LOCUS_09490 10588 13800 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_09490 >Feature sequence042 <1 1140 gene locus_tag LOCUS_09500 <1 1140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788278.1:tryptophan synthase subunit beta 1160 2575 gene locus_tag LOCUS_09510 1160 2575 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788280.1 protein_id gnl|my_center|LOCUS_09510 2575 3153 gene locus_tag LOCUS_09520 2575 3153 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_09520 3157 4152 gene locus_tag LOCUS_09530 gene trpD 3157 4152 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803789.1 protein_id gnl|my_center|LOCUS_09530 4157 4942 gene locus_tag LOCUS_09540 gene trpC 4157 4942 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765048.1 protein_id gnl|my_center|LOCUS_09540 4926 5618 gene locus_tag LOCUS_09550 4926 5618 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202963.1 protein_id gnl|my_center|LOCUS_09550 5593 6372 gene locus_tag LOCUS_09560 gene trpA 5593 6372 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788291.1 protein_id gnl|my_center|LOCUS_09560 7390 6353 gene locus_tag LOCUS_09570 7390 6353 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801668.1 protein_id gnl|my_center|LOCUS_09570 8227 7397 gene locus_tag LOCUS_09580 8227 7397 CDS product DUF3316 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762529.1 protein_id gnl|my_center|LOCUS_09580 10957 8252 gene locus_tag LOCUS_09590 10957 8252 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032528589.1 protein_id gnl|my_center|LOCUS_09590 11809 11096 gene locus_tag LOCUS_09600 11809 11096 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768977.1 protein_id gnl|my_center|LOCUS_09600 13100 11835 gene locus_tag LOCUS_09610 13100 11835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09610 <13633 12982 gene locus_tag LOCUS_09620 <13633 12982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202920.1:phenylalanine--tRNA ligase subunit beta note possible pseudo, frameshifted >Feature sequence043 2120 270 gene locus_tag LOCUS_09630 gene mutA 2120 270 CDS product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108132.1 protein_id gnl|my_center|LOCUS_09630 2772 2311 gene locus_tag LOCUS_09640 gene smpB 2772 2311 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_09640 3357 2800 gene locus_tag LOCUS_09650 3357 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 3461 3886 gene locus_tag LOCUS_09660 3461 3886 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785768.1 protein_id gnl|my_center|LOCUS_09660 4548 3961 gene locus_tag LOCUS_09670 gene folE 4548 3961 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087639.1 protein_id gnl|my_center|LOCUS_09670 5047 4550 gene locus_tag LOCUS_09680 5047 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 5888 5211 gene locus_tag LOCUS_09690 gene tpiA 5888 5211 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760849.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09690 7256 5976 gene locus_tag LOCUS_09700 7256 5976 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_09700 7800 7246 gene locus_tag LOCUS_09710 7800 7246 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109023.1 protein_id gnl|my_center|LOCUS_09710 8340 8167 gene locus_tag LOCUS_09720 8340 8167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 9747 8518 gene locus_tag LOCUS_09730 9747 8518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 12251 9789 gene locus_tag LOCUS_09740 gene gyrA 12251 9789 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787886.1 protein_id gnl|my_center|LOCUS_09740 12258 12316 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12479 12498 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12621 13358 gene locus_tag LOCUS_09750 12621 13358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09750 13298 13311 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence044 409 65 gene locus_tag LOCUS_09760 409 65 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766714.1 protein_id gnl|my_center|LOCUS_09760 701 402 gene locus_tag LOCUS_09770 701 402 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107149.1 protein_id gnl|my_center|LOCUS_09770 1370 4489 gene locus_tag LOCUS_09780 1370 4489 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_09780 4508 6109 gene locus_tag LOCUS_09790 4508 6109 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768282.1 protein_id gnl|my_center|LOCUS_09790 6134 7015 gene locus_tag LOCUS_09800 6134 7015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 7220 7254 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7872 7420 gene locus_tag LOCUS_09810 7872 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 8195 7869 gene locus_tag LOCUS_09820 8195 7869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 8246 8285 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8561 8869 gene locus_tag LOCUS_09830 8561 8869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 8877 9395 gene locus_tag LOCUS_09840 8877 9395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09840 9420 9710 gene locus_tag LOCUS_09850 9420 9710 CDS product DUF3098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762818.1 protein_id gnl|my_center|LOCUS_09850 9713 10546 gene locus_tag LOCUS_09860 9713 10546 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767449.1 protein_id gnl|my_center|LOCUS_09860 10556 11275 gene locus_tag LOCUS_09870 gene truB 10556 11275 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783635.1 protein_id gnl|my_center|LOCUS_09870 11310 12362 gene locus_tag LOCUS_09880 gene queA 11310 12362 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783637.1 protein_id gnl|my_center|LOCUS_09880 13330 12590 gene locus_tag LOCUS_09890 gene recO 13330 12590 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962443.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence045 657 2456 gene locus_tag LOCUS_09900 657 2456 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202130.1 protein_id gnl|my_center|LOCUS_09900 2538 3932 gene locus_tag LOCUS_09910 2538 3932 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788605.1 protein_id gnl|my_center|LOCUS_09910 3968 4918 gene locus_tag LOCUS_09920 gene cysK 3968 4918 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_09920 5660 4920 gene locus_tag LOCUS_09930 5660 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 5746 6474 gene locus_tag LOCUS_09940 5746 6474 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108359.1 protein_id gnl|my_center|LOCUS_09940 6628 7953 gene locus_tag LOCUS_09950 6628 7953 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202308.1 protein_id gnl|my_center|LOCUS_09950 8001 8975 gene locus_tag LOCUS_09960 gene floA 8001 8975 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760314.1 protein_id gnl|my_center|LOCUS_09960 8989 10437 gene locus_tag LOCUS_09970 8989 10437 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203233.1 protein_id gnl|my_center|LOCUS_09970 10441 11253 gene locus_tag LOCUS_09980 10441 11253 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786401.1 protein_id gnl|my_center|LOCUS_09980 11256 12011 gene locus_tag LOCUS_09990 gene kdsB 11256 12011 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 protein_id gnl|my_center|LOCUS_09990 12008 13303 gene locus_tag LOCUS_10000 12008 13303 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202792.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence046 553 338 gene locus_tag LOCUS_10010 553 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10010 554 655 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1397 1410 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1966 1457 gene locus_tag LOCUS_10020 1966 1457 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789793.1 protein_id gnl|my_center|LOCUS_10020 2734 2132 gene locus_tag LOCUS_10030 2734 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10030 2148 2171 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3816 2734 gene locus_tag LOCUS_10040 3816 2734 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760854.1 protein_id gnl|my_center|LOCUS_10040 5029 3845 gene locus_tag LOCUS_10050 5029 3845 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760855.1 protein_id gnl|my_center|LOCUS_10050 5867 5019 gene locus_tag LOCUS_10060 5867 5019 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993542.1 protein_id gnl|my_center|LOCUS_10060 7498 6131 gene locus_tag LOCUS_10070 gene hisS 7498 6131 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 protein_id gnl|my_center|LOCUS_10070 10125 7504 gene locus_tag LOCUS_10080 10125 7504 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801208.1 protein_id gnl|my_center|LOCUS_10080 10363 10437 gene locus_tag LOCUS_t00070 10363 10437 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13079 10614 gene locus_tag LOCUS_10090 gene galB 13079 10614 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202546.1 protein_id gnl|my_center|LOCUS_10090 >Feature sequence047 1468 632 gene locus_tag LOCUS_10100 1468 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 2407 1526 gene locus_tag LOCUS_10110 2407 1526 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_10110 3156 2416 gene locus_tag LOCUS_10120 3156 2416 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269488.1 protein_id gnl|my_center|LOCUS_10120 2612 2618 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4517 3300 gene locus_tag LOCUS_10130 4517 3300 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_10130 4601 6217 gene locus_tag LOCUS_10140 4601 6217 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763401.1 protein_id gnl|my_center|LOCUS_10140 6220 6513 gene locus_tag LOCUS_10150 6220 6513 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760502.1 protein_id gnl|my_center|LOCUS_10150 6980 6501 gene locus_tag LOCUS_10160 6980 6501 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761554.1 protein_id gnl|my_center|LOCUS_10160 7023 8066 gene locus_tag LOCUS_10170 gene holA 7023 8066 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_10170 8673 8059 gene locus_tag LOCUS_10180 8673 8059 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765085.1 protein_id gnl|my_center|LOCUS_10180 10716 8758 gene locus_tag LOCUS_10190 10716 8758 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107334.1 protein_id gnl|my_center|LOCUS_10190 10898 11446 gene locus_tag LOCUS_10200 10898 11446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 12392 11451 gene locus_tag LOCUS_10210 12392 11451 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767386.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence048 225 2627 gene locus_tag LOCUS_10220 225 2627 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229518.1 protein_id gnl|my_center|LOCUS_10220 3024 2797 gene locus_tag LOCUS_10230 3024 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 3632 3465 gene locus_tag LOCUS_10240 3632 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10240 4845 3586 gene locus_tag LOCUS_10250 4845 3586 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794507.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10250 6169 5036 gene locus_tag LOCUS_10260 6169 5036 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_10260 6550 6585 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6838 6869 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7682 7104 gene locus_tag LOCUS_10270 7682 7104 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780311.1 protein_id gnl|my_center|LOCUS_10270 8180 7746 gene locus_tag LOCUS_10280 8180 7746 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815090.1 protein_id gnl|my_center|LOCUS_10280 8637 8266 gene locus_tag LOCUS_10290 8637 8266 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361979.1 protein_id gnl|my_center|LOCUS_10290 9661 8621 gene locus_tag LOCUS_10300 gene rlmN 9661 8621 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840521.1 protein_id gnl|my_center|LOCUS_10300 10692 9664 gene locus_tag LOCUS_10310 10692 9664 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787710.1 protein_id gnl|my_center|LOCUS_10310 11421 10696 gene locus_tag LOCUS_10320 11421 10696 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202221.1 protein_id gnl|my_center|LOCUS_10320 11510 12076 gene locus_tag LOCUS_10330 11510 12076 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_10330 12080 12571 gene locus_tag LOCUS_10340 12080 12571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 >Feature sequence049 760 3123 gene locus_tag LOCUS_10350 760 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 3362 4240 gene locus_tag LOCUS_10360 gene rhuM 3362 4240 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648596.1 protein_id gnl|my_center|LOCUS_10360 4684 5772 gene locus_tag LOCUS_10370 4684 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 4794 4806 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6008 6063 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6674 6174 gene locus_tag LOCUS_10380 6674 6174 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255233.1 protein_id gnl|my_center|LOCUS_10380 7871 6678 gene locus_tag LOCUS_10390 7871 6678 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795161.1 protein_id gnl|my_center|LOCUS_10390 8238 7885 gene locus_tag LOCUS_10400 8238 7885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 10505 8235 gene locus_tag LOCUS_10410 gene rnr 10505 8235 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761713.1 protein_id gnl|my_center|LOCUS_10410 <12404 10788 gene locus_tag LOCUS_10420 <12404 10788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783987.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence050 102 704 gene locus_tag LOCUS_10430 102 704 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763511.1 protein_id gnl|my_center|LOCUS_10430 1182 784 gene locus_tag LOCUS_10440 1182 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10440 2184 1447 gene locus_tag LOCUS_10450 2184 1447 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_10450 3615 2194 gene locus_tag LOCUS_10460 3615 2194 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_10460 3732 4487 gene locus_tag LOCUS_10470 3732 4487 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_10470 4504 5478 gene locus_tag LOCUS_10480 4504 5478 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764761.1 protein_id gnl|my_center|LOCUS_10480 6939 6667 gene locus_tag LOCUS_10490 6939 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 7778 7500 gene locus_tag LOCUS_10500 7778 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 10032 7882 gene locus_tag LOCUS_10510 10032 7882 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202602.1 protein_id gnl|my_center|LOCUS_10510 11247 10048 gene locus_tag LOCUS_10520 11247 10048 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769686.1 protein_id gnl|my_center|LOCUS_10520 <12305 11232 gene locus_tag LOCUS_10530 <12305 11232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813548.1:1-acyl-sn-glycerol-3-phosphate acyltransferase >Feature sequence051 2005 566 gene locus_tag LOCUS_10540 2005 566 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109230.1 protein_id gnl|my_center|LOCUS_10540 2196 2738 gene locus_tag LOCUS_10550 gene hpt 2196 2738 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785529.1 protein_id gnl|my_center|LOCUS_10550 2778 3359 gene locus_tag LOCUS_10560 2778 3359 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760056.1 protein_id gnl|my_center|LOCUS_10560 3409 3972 gene locus_tag LOCUS_10570 3409 3972 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893583.1 protein_id gnl|my_center|LOCUS_10570 4038 4604 gene locus_tag LOCUS_10580 4038 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 4617 7097 gene locus_tag LOCUS_10590 gene priA 4617 7097 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203607.1 protein_id gnl|my_center|LOCUS_10590 7110 11345 gene locus_tag LOCUS_10600 7110 11345 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161799605.1 protein_id gnl|my_center|LOCUS_10600 11289 11342 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11482 11682 gene locus_tag LOCUS_10610 11482 11682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 11960 11694 gene locus_tag LOCUS_10620 11960 11694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10620 >Feature sequence052 379 41 gene locus_tag LOCUS_10630 gene cas2 379 41 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_10630 1307 390 gene locus_tag LOCUS_10640 gene cas1 1307 390 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_10640 5449 1310 gene locus_tag LOCUS_10650 gene cas9 5449 1310 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963637.1 protein_id gnl|my_center|LOCUS_10650 5724 7472 gene locus_tag LOCUS_10660 gene glaB 5724 7472 CDS product alpha-1,3-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202199.1 protein_id gnl|my_center|LOCUS_10660 7534 7749 gene locus_tag LOCUS_10670 7534 7749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 11578 7817 gene locus_tag LOCUS_10680 gene dnaE 11578 7817 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992125.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence053 <1 572 gene locus_tag LOCUS_10690 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926908.1:HesA/MoeB/ThiF family protein 661 1035 gene locus_tag LOCUS_10700 661 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 1055 2233 gene locus_tag LOCUS_10710 1055 2233 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764617.1 protein_id gnl|my_center|LOCUS_10710 2309 2680 gene locus_tag LOCUS_10720 2309 2680 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785723.1 protein_id gnl|my_center|LOCUS_10720 4014 2890 gene locus_tag LOCUS_10730 4014 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 5274 4327 gene locus_tag LOCUS_10740 5274 4327 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_10740 6328 5258 gene locus_tag LOCUS_10750 gene serC 6328 5258 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794503.1 protein_id gnl|my_center|LOCUS_10750 6528 7070 gene locus_tag LOCUS_10760 6528 7070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 8207 7149 gene locus_tag LOCUS_10770 8207 7149 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108932.1 protein_id gnl|my_center|LOCUS_10770 9812 8292 gene locus_tag LOCUS_10780 9812 8292 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence054 2341 680 gene locus_tag LOCUS_10790 gene argS 2341 680 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765307.1 protein_id gnl|my_center|LOCUS_10790 747 768 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3790 2501 gene locus_tag LOCUS_10800 3790 2501 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769170.1 protein_id gnl|my_center|LOCUS_10800 3906 4415 gene locus_tag LOCUS_10810 3906 4415 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783866.1 protein_id gnl|my_center|LOCUS_10810 4412 5239 gene locus_tag LOCUS_10820 4412 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10820 5194 5589 gene locus_tag LOCUS_10830 5194 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 5596 6240 gene locus_tag LOCUS_10840 5596 6240 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201899.1 protein_id gnl|my_center|LOCUS_10840 6686 6252 gene locus_tag LOCUS_10850 gene mscL 6686 6252 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785250.1 protein_id gnl|my_center|LOCUS_10850 6857 8245 gene locus_tag LOCUS_10860 6857 8245 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784328.1 protein_id gnl|my_center|LOCUS_10860 8405 9412 gene locus_tag LOCUS_10870 gene gap 8405 9412 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_10870 10513 9524 gene locus_tag LOCUS_10880 10513 9524 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791878.1 protein_id gnl|my_center|LOCUS_10880 10527 10570 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11223 10744 gene locus_tag LOCUS_10890 11223 10744 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814383.1 protein_id gnl|my_center|LOCUS_10890 11850 11440 gene locus_tag LOCUS_10900 11850 11440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 >Feature sequence055 601 38 gene locus_tag LOCUS_10910 gene pth 601 38 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_10910 1269 619 gene locus_tag LOCUS_10920 1269 619 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760337.1 protein_id gnl|my_center|LOCUS_10920 1459 3291 gene locus_tag LOCUS_10930 1459 3291 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203738.1 protein_id gnl|my_center|LOCUS_10930 10563 3295 gene locus_tag LOCUS_10940 gene sprA 10563 3295 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062175791.1 protein_id gnl|my_center|LOCUS_10940 11293 10712 gene locus_tag LOCUS_10950 gene ruvA 11293 10712 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790555.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence056 1364 807 gene locus_tag LOCUS_10960 1364 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 1481 3928 gene locus_tag LOCUS_10970 1481 3928 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109374.1 protein_id gnl|my_center|LOCUS_10970 6332 3930 gene locus_tag LOCUS_10980 gene feoB 6332 3930 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795491.1 protein_id gnl|my_center|LOCUS_10980 6997 6437 gene locus_tag LOCUS_10990 6997 6437 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658777.1 protein_id gnl|my_center|LOCUS_10990 8651 7017 gene locus_tag LOCUS_11000 8651 7017 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764456.1 protein_id gnl|my_center|LOCUS_11000 9103 8669 gene locus_tag LOCUS_11010 9103 8669 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785242.1 protein_id gnl|my_center|LOCUS_11010 11079 9115 gene locus_tag LOCUS_11020 11079 9115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202019.1 protein_id gnl|my_center|LOCUS_11020 >Feature sequence057 684 163 gene locus_tag LOCUS_11030 684 163 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_11030 185 222 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 831 1973 gene locus_tag LOCUS_11040 831 1973 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760045.1 protein_id gnl|my_center|LOCUS_11040 1933 1970 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2116 4056 gene locus_tag LOCUS_11050 2116 4056 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796864.1 protein_id gnl|my_center|LOCUS_11050 4066 4722 gene locus_tag LOCUS_11060 4066 4722 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770252.1 protein_id gnl|my_center|LOCUS_11060 4719 5288 gene locus_tag LOCUS_11070 4719 5288 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764144.1 protein_id gnl|my_center|LOCUS_11070 5337 6533 gene locus_tag LOCUS_11080 gene porV 5337 6533 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_11080 6538 7026 gene locus_tag LOCUS_11090 gene ispF 6538 7026 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 protein_id gnl|my_center|LOCUS_11090 7369 8997 gene locus_tag LOCUS_11100 7369 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 9257 10606 gene locus_tag LOCUS_11110 9257 10606 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 protein_id gnl|my_center|LOCUS_11110 10606 10866 gene locus_tag LOCUS_11120 10606 10866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 >Feature sequence058 1670 219 gene locus_tag LOCUS_11130 1670 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11130 3351 1642 gene locus_tag LOCUS_11140 3351 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11140 1674 1699 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4482 3367 gene locus_tag LOCUS_11150 4482 3367 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303157.1 protein_id gnl|my_center|LOCUS_11150 5923 4511 gene locus_tag LOCUS_11160 5923 4511 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765715.1 protein_id gnl|my_center|LOCUS_11160 6042 6169 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6236 6586 gene locus_tag LOCUS_11170 6236 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 6662 6797 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7063 7341 gene locus_tag LOCUS_11180 7063 7341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 7890 8579 gene locus_tag LOCUS_11190 7890 8579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 8579 9481 gene locus_tag LOCUS_11200 gene metA 8579 9481 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796420.1 protein_id gnl|my_center|LOCUS_11200 10171 9491 gene locus_tag LOCUS_11210 10171 9491 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_11210 10297 10836 gene locus_tag LOCUS_11220 10297 10836 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789526.1 protein_id gnl|my_center|LOCUS_11220 10921 >11483 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgtgaattgctttcattttttgtaactttgttcca >Feature sequence059 2034 2792 gene locus_tag LOCUS_11230 2034 2792 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763940.1 protein_id gnl|my_center|LOCUS_11230 4254 2866 gene locus_tag LOCUS_11240 gene dnaA 4254 2866 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759760.1 protein_id gnl|my_center|LOCUS_11240 5508 4588 gene locus_tag LOCUS_11250 5508 4588 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 protein_id gnl|my_center|LOCUS_11250 6706 5546 gene locus_tag LOCUS_11260 6706 5546 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840465.1 protein_id gnl|my_center|LOCUS_11260 7079 7975 gene locus_tag LOCUS_11270 7079 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 7991 8893 gene locus_tag LOCUS_11280 7991 8893 CDS product CepA family extended-spectrum class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202336.1 protein_id gnl|my_center|LOCUS_11280 9196 9687 gene locus_tag LOCUS_11290 9196 9687 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107474.1 protein_id gnl|my_center|LOCUS_11290 10242 9778 gene locus_tag LOCUS_11300 10242 9778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 10581 10351 gene locus_tag LOCUS_11310 10581 10351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11310 <11419 10517 gene locus_tag LOCUS_11320 <11419 10517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764496.1:bifunctional dihydroorotate dehydrogenase B NAD binding subunit/NADPH-dependent glutamate synthase note possible pseudo, frameshifted >Feature sequence060 148 654 gene locus_tag LOCUS_11330 148 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 1264 725 gene locus_tag LOCUS_11340 1264 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 2112 1264 gene locus_tag LOCUS_11350 gene prmA 2112 1264 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795115.1 protein_id gnl|my_center|LOCUS_11350 2430 2161 gene locus_tag LOCUS_11360 2430 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 2793 2455 gene locus_tag LOCUS_11370 2793 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 3086 2886 gene locus_tag LOCUS_11380 3086 2886 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776445.1 protein_id gnl|my_center|LOCUS_11380 3304 3107 gene locus_tag LOCUS_11390 3304 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 4347 3445 gene locus_tag LOCUS_11400 4347 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 5507 4344 gene locus_tag LOCUS_11410 5507 4344 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141120.1 protein_id gnl|my_center|LOCUS_11410 6435 5623 gene locus_tag LOCUS_11420 6435 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 6925 6458 gene locus_tag LOCUS_11430 gene ndk 6925 6458 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770040.1 protein_id gnl|my_center|LOCUS_11430 8958 7180 gene locus_tag LOCUS_11440 gene recG 8958 7180 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172726565.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11440 9266 8940 gene locus_tag LOCUS_11450 9266 8940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11450 11007 9436 gene locus_tag LOCUS_11460 11007 9436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11460 >Feature sequence061 570 759 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 999 1031 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2230 1190 gene locus_tag LOCUS_11470 2230 1190 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11470 3248 2634 gene locus_tag LOCUS_11480 3248 2634 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783653.1 protein_id gnl|my_center|LOCUS_11480 3857 3459 gene locus_tag LOCUS_11490 3857 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 4608 3859 gene locus_tag LOCUS_11500 4608 3859 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_11500 5523 4627 gene locus_tag LOCUS_11510 5523 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 6084 5536 gene locus_tag LOCUS_11520 6084 5536 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767456.1 protein_id gnl|my_center|LOCUS_11520 8696 6114 gene locus_tag LOCUS_11530 8696 6114 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_11530 9649 8693 gene locus_tag LOCUS_11540 9649 8693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 10786 9680 gene locus_tag LOCUS_11550 10786 9680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 11175 10786 gene locus_tag LOCUS_11560 11175 10786 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813773.1 protein_id gnl|my_center|LOCUS_11560 >Feature sequence062 1220 315 gene locus_tag LOCUS_11570 1220 315 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108326.1 protein_id gnl|my_center|LOCUS_11570 2291 1305 gene locus_tag LOCUS_11580 2291 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 2651 2304 gene locus_tag LOCUS_11590 2651 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 3054 2653 gene locus_tag LOCUS_11600 3054 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 4304 3051 gene locus_tag LOCUS_11610 4304 3051 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459687.1 protein_id gnl|my_center|LOCUS_11610 5365 5057 gene locus_tag LOCUS_11620 5365 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 7479 5581 gene locus_tag LOCUS_11630 gene dnaK 7479 5581 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764765.1 protein_id gnl|my_center|LOCUS_11630 7880 8302 gene locus_tag LOCUS_11640 gene mce 7880 8302 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561104.1 protein_id gnl|my_center|LOCUS_11640 8340 9812 gene locus_tag LOCUS_11650 8340 9812 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780626.1 protein_id gnl|my_center|LOCUS_11650 9476 9554 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9785 9793 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9856 10818 gene locus_tag LOCUS_11660 9856 10818 CDS product OadG family transporter subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789537.1 protein_id gnl|my_center|LOCUS_11660 >Feature sequence063 <1 546 gene locus_tag LOCUS_11670 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404923.1:D-alanine--D-alanine ligase family protein note possible pseudo, frameshifted 543 797 gene locus_tag LOCUS_11680 543 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11680 797 1726 gene locus_tag LOCUS_11690 797 1726 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769713.1 protein_id gnl|my_center|LOCUS_11690 1739 2710 gene locus_tag LOCUS_11700 gene ftsY 1739 2710 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107516.1 protein_id gnl|my_center|LOCUS_11700 2710 4014 gene locus_tag LOCUS_11710 gene rimO 2710 4014 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765734.1 protein_id gnl|my_center|LOCUS_11710 4011 4916 gene locus_tag LOCUS_11720 4011 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11720 4877 5101 gene locus_tag LOCUS_11730 4877 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 5102 6532 gene locus_tag LOCUS_11740 5102 6532 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203597.1 protein_id gnl|my_center|LOCUS_11740 6529 7827 gene locus_tag LOCUS_11750 6529 7827 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691388.1 protein_id gnl|my_center|LOCUS_11750 7829 9412 gene locus_tag LOCUS_11760 7829 9412 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804150.1 protein_id gnl|my_center|LOCUS_11760 9912 9427 gene locus_tag LOCUS_11770 gene nrdG 9912 9427 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867062.1 protein_id gnl|my_center|LOCUS_11770 <11201 9912 gene locus_tag LOCUS_11780 <11201 9912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436320.1:anaerobic ribonucleoside triphosphate reductase >Feature sequence064 134 6 gene locus_tag LOCUS_11790 134 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 1036 101 gene locus_tag LOCUS_11800 1036 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 225 286 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1258 2271 gene locus_tag LOCUS_11810 1258 2271 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109241.1 protein_id gnl|my_center|LOCUS_11810 3273 2362 gene locus_tag LOCUS_11820 3273 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 4441 3308 gene locus_tag LOCUS_11830 4441 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 5064 4438 gene locus_tag LOCUS_11840 5064 4438 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 protein_id gnl|my_center|LOCUS_11840 5334 6044 gene locus_tag LOCUS_11850 gene pyrH 5334 6044 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759596.1 protein_id gnl|my_center|LOCUS_11850 6080 6406 gene locus_tag LOCUS_11860 6080 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11860 6403 6618 gene locus_tag LOCUS_11870 6403 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11870 7617 6691 gene locus_tag LOCUS_11880 7617 6691 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202975.1 protein_id gnl|my_center|LOCUS_11880 7775 8194 gene locus_tag LOCUS_11890 7775 8194 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795574.1 protein_id gnl|my_center|LOCUS_11890 8234 9727 gene locus_tag LOCUS_11900 8234 9727 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence065 4 1530 gene locus_tag LOCUS_11910 4 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1543 3579 gene locus_tag LOCUS_11920 1543 3579 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202217.1 protein_id gnl|my_center|LOCUS_11920 4394 3594 gene locus_tag LOCUS_11930 gene fmt 4394 3594 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019538492.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11930 4549 4391 gene locus_tag LOCUS_11940 4549 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 5683 4553 gene locus_tag LOCUS_11950 5683 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 7122 5812 gene locus_tag LOCUS_11960 7122 5812 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839941.1 protein_id gnl|my_center|LOCUS_11960 8063 7131 gene locus_tag LOCUS_11970 8063 7131 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_11970 9253 8060 gene locus_tag LOCUS_11980 9253 8060 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808836.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence066 230 354 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 961 1018 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1097 1906 gene locus_tag LOCUS_11990 1097 1906 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_11990 1903 2988 gene locus_tag LOCUS_12000 1903 2988 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791183.1 protein_id gnl|my_center|LOCUS_12000 3030 4475 gene locus_tag LOCUS_12010 3030 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 4632 6707 gene locus_tag LOCUS_12020 4632 6707 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108600.1 protein_id gnl|my_center|LOCUS_12020 7571 6768 gene locus_tag LOCUS_12030 7571 6768 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_12030 9199 8126 gene locus_tag LOCUS_12040 9199 8126 CDS product clostripain-related cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107416.1 protein_id gnl|my_center|LOCUS_12040 9207 9282 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10026 9445 gene locus_tag LOCUS_12050 10026 9445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 10298 10393 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence067 360 1208 gene locus_tag LOCUS_12060 360 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 2766 1225 gene locus_tag LOCUS_12070 gene gltX 2766 1225 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791502.1 protein_id gnl|my_center|LOCUS_12070 3917 2904 gene locus_tag LOCUS_12080 3917 2904 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_12080 4111 5289 gene locus_tag LOCUS_12090 4111 5289 CDS product fragipain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788546.1 protein_id gnl|my_center|LOCUS_12090 5299 6438 gene locus_tag LOCUS_12100 5299 6438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 6702 6520 gene locus_tag LOCUS_12110 6702 6520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 6899 8434 gene locus_tag LOCUS_12120 gene recJ 6899 8434 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203525.1 protein_id gnl|my_center|LOCUS_12120 8431 9366 gene locus_tag LOCUS_12130 8431 9366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12130 9293 9628 gene locus_tag LOCUS_12140 9293 9628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12140 9582 10295 gene locus_tag LOCUS_12150 9582 10295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12150 >Feature sequence068 2527 179 gene locus_tag LOCUS_12160 2527 179 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_12160 3992 3231 gene locus_tag LOCUS_12170 3992 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 5164 6234 gene locus_tag LOCUS_12180 gene carA 5164 6234 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788241.1 protein_id gnl|my_center|LOCUS_12180 6256 7107 gene locus_tag LOCUS_12190 6256 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12190 7100 9430 gene locus_tag LOCUS_12200 7100 9430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12200 7328 7410 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence069 3 206 gene locus_tag LOCUS_12210 3 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 323 802 gene locus_tag LOCUS_12220 323 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 796 1707 gene locus_tag LOCUS_12230 796 1707 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108326.1 protein_id gnl|my_center|LOCUS_12230 1700 2548 gene locus_tag LOCUS_12240 1700 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 2560 2847 gene locus_tag LOCUS_12250 2560 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 3456 2854 gene locus_tag LOCUS_12260 gene hisIE 3456 2854 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762399.1 protein_id gnl|my_center|LOCUS_12260 4221 3466 gene locus_tag LOCUS_12270 gene hisF 4221 3466 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762398.1 protein_id gnl|my_center|LOCUS_12270 4946 4215 gene locus_tag LOCUS_12280 gene hisA 4946 4215 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203120.1 protein_id gnl|my_center|LOCUS_12280 5536 4943 gene locus_tag LOCUS_12290 gene hisH 5536 4943 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107745.1 protein_id gnl|my_center|LOCUS_12290 6600 5533 gene locus_tag LOCUS_12300 gene hisB 6600 5533 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766230.1 protein_id gnl|my_center|LOCUS_12300 7646 6600 gene locus_tag LOCUS_12310 gene hisC 7646 6600 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766231.1 protein_id gnl|my_center|LOCUS_12310 8919 7639 gene locus_tag LOCUS_12320 gene hisD 8919 7639 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203178.1 protein_id gnl|my_center|LOCUS_12320 9737 8931 gene locus_tag LOCUS_12330 gene hisG 9737 8931 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760516.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence070 <1 709 gene locus_tag LOCUS_12340 <1 709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764298.1:NADH-quinone oxidoreductase subunit M 726 2168 gene locus_tag LOCUS_12350 726 2168 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992198.1 protein_id gnl|my_center|LOCUS_12350 2937 2479 gene locus_tag LOCUS_12360 gene tnpA 2937 2479 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_12360 3445 3747 gene locus_tag LOCUS_12370 3445 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12370 3705 3717 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3749 6751 gene locus_tag LOCUS_12380 3749 6751 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992680.1 protein_id gnl|my_center|LOCUS_12380 7177 8763 gene locus_tag LOCUS_12390 7177 8763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 7206 7275 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9147 9425 gene locus_tag LOCUS_12400 9147 9425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12400 >Feature sequence071 63 4589 gene locus_tag LOCUS_12410 gene gltB 63 4589 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107318.1 protein_id gnl|my_center|LOCUS_12410 4613 6016 gene locus_tag LOCUS_12420 4613 6016 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763133.1 protein_id gnl|my_center|LOCUS_12420 4636 4678 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6848 6090 gene locus_tag LOCUS_12430 6848 6090 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943655.1 protein_id gnl|my_center|LOCUS_12430 8042 7083 gene locus_tag LOCUS_12440 8042 7083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12440 9255 8005 gene locus_tag LOCUS_12450 9255 8005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12450 9431 9513 gene locus_tag LOCUS_t00080 9431 9513 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence072 163 216 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 370 410 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 770 1261 gene locus_tag LOCUS_12460 770 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12460 1207 1998 gene locus_tag LOCUS_12470 1207 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12470 1213 1222 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1986 3116 gene locus_tag LOCUS_12480 1986 3116 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107783.1 protein_id gnl|my_center|LOCUS_12480 3179 4489 gene locus_tag LOCUS_12490 3179 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 4549 6438 gene locus_tag LOCUS_12500 4549 6438 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763745.1 protein_id gnl|my_center|LOCUS_12500 6431 7648 gene locus_tag LOCUS_12510 6431 7648 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763746.1 protein_id gnl|my_center|LOCUS_12510 9586 7736 gene locus_tag LOCUS_12520 9586 7736 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 protein_id gnl|my_center|LOCUS_12520 8382 8444 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence073 2109 757 gene locus_tag LOCUS_12530 2109 757 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786507.1 protein_id gnl|my_center|LOCUS_12530 2884 2231 gene locus_tag LOCUS_12540 2884 2231 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538563.1 protein_id gnl|my_center|LOCUS_12540 3338 2889 gene locus_tag LOCUS_12550 3338 2889 CDS product DUF4494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762440.1 protein_id gnl|my_center|LOCUS_12550 5420 3366 gene locus_tag LOCUS_12560 5420 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 5833 5842 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5960 7051 gene locus_tag LOCUS_12570 gene mltG 5960 7051 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766068.1 protein_id gnl|my_center|LOCUS_12570 7048 7290 gene locus_tag LOCUS_12580 7048 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 8426 7266 gene locus_tag LOCUS_12590 8426 7266 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108203.1 protein_id gnl|my_center|LOCUS_12590 8739 8440 gene locus_tag LOCUS_12600 8739 8440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12600 8989 8660 gene locus_tag LOCUS_12610 8989 8660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12610 9032 9167 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9313 9358 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence074 897 553 gene locus_tag LOCUS_12620 897 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1063 1890 gene locus_tag LOCUS_12630 1063 1890 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_12630 1880 2572 gene locus_tag LOCUS_12640 1880 2572 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_12640 2741 4237 gene locus_tag LOCUS_12650 2741 4237 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763196.1 protein_id gnl|my_center|LOCUS_12650 4243 5637 gene locus_tag LOCUS_12660 gene leuC 4243 5637 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763197.1 protein_id gnl|my_center|LOCUS_12660 5650 6249 gene locus_tag LOCUS_12670 gene leuD 5650 6249 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_12670 6253 7284 gene locus_tag LOCUS_12680 gene leuB 6253 7284 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789841.1 protein_id gnl|my_center|LOCUS_12680 7297 8733 gene locus_tag LOCUS_12690 7297 8733 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108966.1 protein_id gnl|my_center|LOCUS_12690 9137 8811 gene locus_tag LOCUS_12700 gene trxA 9137 8811 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784741.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence075 667 89 gene locus_tag LOCUS_12710 667 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 1295 669 gene locus_tag LOCUS_12720 1295 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 2115 1393 gene locus_tag LOCUS_12730 2115 1393 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785882.1 protein_id gnl|my_center|LOCUS_12730 3916 2138 gene locus_tag LOCUS_12740 3916 2138 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785879.1 protein_id gnl|my_center|LOCUS_12740 5306 4044 gene locus_tag LOCUS_12750 5306 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12750 5520 5335 gene locus_tag LOCUS_12760 5520 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12760 5873 5583 gene locus_tag LOCUS_12770 5873 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12770 8046 5887 gene locus_tag LOCUS_12780 8046 5887 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765304.1 protein_id gnl|my_center|LOCUS_12780 9451 8051 gene locus_tag LOCUS_12790 9451 8051 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765688.1 protein_id gnl|my_center|LOCUS_12790 >Feature sequence076 123 243 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1840 392 gene locus_tag LOCUS_12800 1840 392 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202208.1 protein_id gnl|my_center|LOCUS_12800 3261 1837 gene locus_tag LOCUS_12810 3261 1837 CDS product DUF6057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202209.1 protein_id gnl|my_center|LOCUS_12810 3320 3365 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3655 3410 gene locus_tag LOCUS_12820 3655 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12820 5109 3649 gene locus_tag LOCUS_12830 5109 3649 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769526.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12830 8184 5125 gene locus_tag LOCUS_12840 8184 5125 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202210.1 protein_id gnl|my_center|LOCUS_12840 8536 8327 gene locus_tag LOCUS_12850 8536 8327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12850 8747 9064 gene locus_tag LOCUS_12860 8747 9064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 >Feature sequence077 1959 223 gene locus_tag LOCUS_12870 1959 223 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136013900.1 protein_id gnl|my_center|LOCUS_12870 4742 1980 gene locus_tag LOCUS_12880 4742 1980 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016266957.1 protein_id gnl|my_center|LOCUS_12880 4788 4861 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7798 5228 gene locus_tag LOCUS_12890 7798 5228 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461661.1 protein_id gnl|my_center|LOCUS_12890 5735 5789 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8158 9117 gene locus_tag LOCUS_12900 8158 9117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12900 8995 9036 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence078 145 149 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 355 2790 gene locus_tag LOCUS_12910 355 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12910 387 581 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2828 3694 gene locus_tag LOCUS_12920 2828 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 4262 4309 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4959 4363 gene locus_tag LOCUS_12930 4959 4363 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937344.1 protein_id gnl|my_center|LOCUS_12930 5366 5836 gene locus_tag LOCUS_12940 gene greA 5366 5836 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791379.1 protein_id gnl|my_center|LOCUS_12940 5839 6243 gene locus_tag LOCUS_12950 5839 6243 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791382.1 protein_id gnl|my_center|LOCUS_12950 6704 6840 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6860 7510 gene locus_tag LOCUS_12960 6860 7510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 7507 8619 gene locus_tag LOCUS_12970 7507 8619 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence079 137 50 gene locus_tag LOCUS_t00090 137 50 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 562 188 gene locus_tag LOCUS_12980 562 188 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760453.1 protein_id gnl|my_center|LOCUS_12980 1328 540 gene locus_tag LOCUS_12990 1328 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794237.1 protein_id gnl|my_center|LOCUS_12990 3946 1328 gene locus_tag LOCUS_13000 3946 1328 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202271.1 protein_id gnl|my_center|LOCUS_13000 4406 3954 gene locus_tag LOCUS_13010 4406 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13010 4702 4493 gene locus_tag LOCUS_13020 4702 4493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13020 5945 4911 gene locus_tag LOCUS_13030 5945 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13030 4947 4992 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6451 6092 gene locus_tag LOCUS_13040 6451 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 6593 7018 gene locus_tag LOCUS_13050 6593 7018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 8198 7029 gene locus_tag LOCUS_13060 8198 7029 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695909.1 protein_id gnl|my_center|LOCUS_13060 <8869 8329 gene locus_tag LOCUS_13070 <8869 8329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062695721.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence080 54 416 gene locus_tag LOCUS_13080 54 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 171 181 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 616 2016 gene locus_tag LOCUS_13090 gene cls 616 2016 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764220.1 protein_id gnl|my_center|LOCUS_13090 842 878 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2116 2409 gene locus_tag LOCUS_13100 2116 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 2414 2722 gene locus_tag LOCUS_13110 2414 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 2851 3129 gene locus_tag LOCUS_13120 2851 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 3126 4565 gene locus_tag LOCUS_13130 gene rny 3126 4565 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790424.1 protein_id gnl|my_center|LOCUS_13130 4581 5930 gene locus_tag LOCUS_13140 gene ricT 4581 5930 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766922.1 protein_id gnl|my_center|LOCUS_13140 5920 6342 gene locus_tag LOCUS_13150 gene gldH 5920 6342 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766923.1 protein_id gnl|my_center|LOCUS_13150 6349 6981 gene locus_tag LOCUS_13160 6349 6981 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943184.1 protein_id gnl|my_center|LOCUS_13160 6978 8153 gene locus_tag LOCUS_13170 6978 8153 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790476.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence081 4016 387 gene locus_tag LOCUS_13180 4016 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 5303 4041 gene locus_tag LOCUS_13190 5303 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 6325 5360 gene locus_tag LOCUS_13200 6325 5360 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108433.1 protein_id gnl|my_center|LOCUS_13200 <8695 6439 gene locus_tag LOCUS_13210 <8695 6439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108434.1:Mfa1 family fimbria major subunit >Feature sequence082 1858 2472 gene locus_tag LOCUS_13220 1858 2472 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795972.1 protein_id gnl|my_center|LOCUS_13220 2484 4064 gene locus_tag LOCUS_13230 2484 4064 CDS product DUF4435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208070.1 protein_id gnl|my_center|LOCUS_13230 4057 4917 gene locus_tag LOCUS_13240 4057 4917 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072012.1 protein_id gnl|my_center|LOCUS_13240 4987 6687 gene locus_tag LOCUS_13250 gene aspT 4987 6687 CDS product aspartate-alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107422.1 protein_id gnl|my_center|LOCUS_13250 6728 7309 gene locus_tag LOCUS_13260 6728 7309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13260 7285 8361 gene locus_tag LOCUS_13270 7285 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13270 >Feature sequence083 228 1589 gene locus_tag LOCUS_13280 228 1589 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762587.1 protein_id gnl|my_center|LOCUS_13280 1589 1879 gene locus_tag LOCUS_13290 1589 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1872 3233 gene locus_tag LOCUS_13300 1872 3233 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762587.1 protein_id gnl|my_center|LOCUS_13300 3352 4140 gene locus_tag LOCUS_13310 gene folP 3352 4140 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767053.1 protein_id gnl|my_center|LOCUS_13310 4234 4343 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4621 4746 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5282 5361 gene locus_tag LOCUS_t00100 5282 5361 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7950 5416 gene locus_tag LOCUS_13320 7950 5416 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202101.1 protein_id gnl|my_center|LOCUS_13320 >Feature sequence084 238 340 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 341 1054 gene locus_tag LOCUS_13330 341 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 1179 3227 gene locus_tag LOCUS_13340 gene htpG 1179 3227 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765725.1 protein_id gnl|my_center|LOCUS_13340 3606 4160 gene locus_tag LOCUS_13350 3606 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13350 3623 3656 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4355 4395 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4641 5552 gene locus_tag LOCUS_13360 4641 5552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13360 4683 4692 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5879 5556 gene locus_tag LOCUS_13370 5879 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 5884 5946 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <8234 6346 gene locus_tag LOCUS_13380 <8234 6346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107202.1:putative porin >Feature sequence085 416 2392 gene locus_tag LOCUS_13390 416 2392 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964267.1 protein_id gnl|my_center|LOCUS_13390 2398 4656 gene locus_tag LOCUS_13400 2398 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 4764 5066 gene locus_tag LOCUS_13410 4764 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 5068 5451 gene locus_tag LOCUS_13420 5068 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 5500 6237 gene locus_tag LOCUS_13430 5500 6237 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764531.1 protein_id gnl|my_center|LOCUS_13430 6224 7456 gene locus_tag LOCUS_13440 6224 7456 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785451.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence086 2050 4266 gene locus_tag LOCUS_13450 2050 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 5556 4363 gene locus_tag LOCUS_13460 5556 4363 CDS product anaerobic sulfatase-maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766211.1 protein_id gnl|my_center|LOCUS_13460 5656 7248 gene locus_tag LOCUS_13470 5656 7248 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555796.1 protein_id gnl|my_center|LOCUS_13470 7478 7556 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence087 1379 57 gene locus_tag LOCUS_13480 1379 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 122 134 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2013 1516 gene locus_tag LOCUS_13490 2013 1516 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929781.1 protein_id gnl|my_center|LOCUS_13490 4407 2020 gene locus_tag LOCUS_13500 4407 2020 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202791.1 protein_id gnl|my_center|LOCUS_13500 7166 4500 gene locus_tag LOCUS_13510 7166 4500 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203461.1 protein_id gnl|my_center|LOCUS_13510 <7818 7185 gene locus_tag LOCUS_13520 <7818 7185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769973.1:adenosylcobalamin-dependent ribonucleoside-diphosphate reductase >Feature sequence088 427 2412 gene locus_tag LOCUS_13530 427 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 2477 2878 gene locus_tag LOCUS_13540 2477 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 2975 3226 gene locus_tag LOCUS_13550 2975 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 3915 3277 gene locus_tag LOCUS_13560 3915 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 3800 4009 gene locus_tag LOCUS_13570 3800 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 4684 4253 gene locus_tag LOCUS_13580 4684 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 6081 4681 gene locus_tag LOCUS_13590 6081 4681 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765753.1 protein_id gnl|my_center|LOCUS_13590 7346 6087 gene locus_tag LOCUS_13600 7346 6087 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765754.1 protein_id gnl|my_center|LOCUS_13600 >Feature sequence089 <1 846 gene locus_tag LOCUS_13610 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108949.1:POTRA domain-containing protein 933 1448 gene locus_tag LOCUS_13620 933 1448 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_13620 1506 2003 gene locus_tag LOCUS_13630 1506 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 2096 2923 gene locus_tag LOCUS_13640 gene murI 2096 2923 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202028.1 protein_id gnl|my_center|LOCUS_13640 2945 3811 gene locus_tag LOCUS_13650 2945 3811 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117757.1 protein_id gnl|my_center|LOCUS_13650 3824 5026 gene locus_tag LOCUS_13660 3824 5026 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202530.1 protein_id gnl|my_center|LOCUS_13660 5724 5023 gene locus_tag LOCUS_13670 5724 5023 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_13670 6188 5715 gene locus_tag LOCUS_13680 6188 5715 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762666.1 protein_id gnl|my_center|LOCUS_13680 7041 6181 gene locus_tag LOCUS_13690 gene prmC 7041 6181 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202032.1 protein_id gnl|my_center|LOCUS_13690 <7635 7026 gene locus_tag LOCUS_13700 <7635 7026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107320.1:carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit >Feature sequence090 244 1908 gene locus_tag LOCUS_13710 244 1908 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791282.1 protein_id gnl|my_center|LOCUS_13710 1905 4091 gene locus_tag LOCUS_13720 1905 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13720 3998 4017 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4022 5218 gene locus_tag LOCUS_13730 4022 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13730 6518 5202 gene locus_tag LOCUS_13740 gene der 6518 5202 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782289.1 protein_id gnl|my_center|LOCUS_13740 7467 6574 gene locus_tag LOCUS_13750 gene era 7467 6574 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760765.1 protein_id gnl|my_center|LOCUS_13750 >Feature sequence091 1293 49 gene locus_tag LOCUS_13760 gene serB 1293 49 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765689.1 protein_id gnl|my_center|LOCUS_13760 2163 1315 gene locus_tag LOCUS_13770 2163 1315 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_13770 4522 2201 gene locus_tag LOCUS_13780 4522 2201 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840909.1 protein_id gnl|my_center|LOCUS_13780 4617 5090 gene locus_tag LOCUS_13790 4617 5090 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790644.1 protein_id gnl|my_center|LOCUS_13790 5080 5865 gene locus_tag LOCUS_13800 5080 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 6325 5876 gene locus_tag LOCUS_13810 6325 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 6536 6955 gene locus_tag LOCUS_13820 6536 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 7532 6915 gene locus_tag LOCUS_13830 7532 6915 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802121.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence092 2041 416 gene locus_tag LOCUS_13840 2041 416 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786793.1 protein_id gnl|my_center|LOCUS_13840 1688 1697 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5330 2241 gene locus_tag LOCUS_13850 5330 2241 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108778.1 protein_id gnl|my_center|LOCUS_13850 6055 5426 gene locus_tag LOCUS_13860 gene frr 6055 5426 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764014.1 protein_id gnl|my_center|LOCUS_13860 6470 6108 gene locus_tag LOCUS_13870 6470 6108 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_13870 6618 6698 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6966 6970 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7131 7231 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence093 809 1801 gene locus_tag LOCUS_13880 809 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1878 3506 gene locus_tag LOCUS_13890 1878 3506 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109236.1 protein_id gnl|my_center|LOCUS_13890 3582 5597 gene locus_tag LOCUS_13900 3582 5597 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202540.1 protein_id gnl|my_center|LOCUS_13900 5964 5686 gene locus_tag LOCUS_13910 5964 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 7115 6237 gene locus_tag LOCUS_13920 7115 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 >Feature sequence094 517 224 gene locus_tag LOCUS_13930 517 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 674 477 gene locus_tag LOCUS_13940 674 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 2651 699 gene locus_tag LOCUS_13950 2651 699 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028668016.1 protein_id gnl|my_center|LOCUS_13950 3066 2680 gene locus_tag LOCUS_13960 3066 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13960 5324 3069 gene locus_tag LOCUS_13970 5324 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13970 3574 3640 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5762 5340 gene locus_tag LOCUS_13980 5762 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13980 <7368 6040 gene locus_tag LOCUS_13990 <7368 6040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203707.1:DUF6067 family protein >Feature sequence095 2238 112 gene locus_tag LOCUS_14000 gene fusA 2238 112 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762033.1 protein_id gnl|my_center|LOCUS_14000 2812 2282 gene locus_tag LOCUS_14010 gene rpsG 2812 2282 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791536.1 protein_id gnl|my_center|LOCUS_14010 3324 2941 gene locus_tag LOCUS_14020 gene rpsL 3324 2941 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 protein_id gnl|my_center|LOCUS_14020 3634 4803 gene locus_tag LOCUS_14030 3634 4803 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_14030 6287 4818 gene locus_tag LOCUS_14040 6287 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14040 6628 6446 gene locus_tag LOCUS_14050 6628 6446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14050 6646 6695 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence096 1146 37 gene locus_tag LOCUS_14060 1146 37 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764152.1 protein_id gnl|my_center|LOCUS_14060 1959 1165 gene locus_tag LOCUS_14070 gene trmB 1959 1165 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791725.1 protein_id gnl|my_center|LOCUS_14070 2043 2648 gene locus_tag LOCUS_14080 gene queC 2043 2648 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061849.1 protein_id gnl|my_center|LOCUS_14080 2734 6588 gene locus_tag LOCUS_14090 2734 6588 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202282.1 protein_id gnl|my_center|LOCUS_14090 6878 6642 gene locus_tag LOCUS_14100 6878 6642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 >Feature sequence097 165 328 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5403 1360 gene locus_tag LOCUS_14110 5403 1360 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108776.1 protein_id gnl|my_center|LOCUS_14110 5971 5996 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6122 6133 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6140 6727 gene locus_tag LOCUS_14120 6140 6727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14120 6304 6352 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6772 6811 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence098 350 398 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 553 587 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 728 1360 gene locus_tag LOCUS_14130 728 1360 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763022.1 protein_id gnl|my_center|LOCUS_14130 1357 2727 gene locus_tag LOCUS_14140 1357 2727 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783910.1 protein_id gnl|my_center|LOCUS_14140 2760 4070 gene locus_tag LOCUS_14150 2760 4070 CDS product L-fucose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694544.1 protein_id gnl|my_center|LOCUS_14150 4129 5076 gene locus_tag LOCUS_14160 4129 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 5060 5854 gene locus_tag LOCUS_14170 5060 5854 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761063.1 protein_id gnl|my_center|LOCUS_14170 5851 6342 gene locus_tag LOCUS_14180 5851 6342 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689852.1 protein_id gnl|my_center|LOCUS_14180 >Feature sequence099 <1 3324 gene locus_tag LOCUS_14190 <1 3324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791958.1:TonB-dependent receptor 3337 5355 gene locus_tag LOCUS_14200 3337 5355 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797392.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence100 213 271 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1882 479 gene locus_tag LOCUS_14210 1882 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 2033 1902 gene locus_tag LOCUS_14220 2033 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 3267 2011 gene locus_tag LOCUS_14230 3267 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 4841 3360 gene locus_tag LOCUS_14240 4841 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 5904 4960 gene locus_tag LOCUS_14250 5904 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 <6547 5901 gene locus_tag LOCUS_14260 <6547 5901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_080707197.1:DUF3575 domain-containing protein 6309 6327 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence101 227 1426 gene locus_tag LOCUS_14270 227 1426 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_14270 2205 1456 gene locus_tag LOCUS_14280 2205 1456 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763423.1 protein_id gnl|my_center|LOCUS_14280 3208 2210 gene locus_tag LOCUS_14290 3208 2210 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763424.1 protein_id gnl|my_center|LOCUS_14290 4505 3285 gene locus_tag LOCUS_14300 4505 3285 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765923.1 protein_id gnl|my_center|LOCUS_14300 5139 4519 gene locus_tag LOCUS_14310 5139 4519 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786909.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14310 6441 5278 gene locus_tag LOCUS_14320 6441 5278 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794794.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence102 1686 103 gene locus_tag LOCUS_14330 1686 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 5027 1707 gene locus_tag LOCUS_14340 5027 1707 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_14340 6424 5138 gene locus_tag LOCUS_14350 6424 5138 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence103 870 160 gene locus_tag LOCUS_14360 870 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 1742 867 gene locus_tag LOCUS_14370 1742 867 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760837.1 protein_id gnl|my_center|LOCUS_14370 2038 1754 gene locus_tag LOCUS_14380 2038 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 2290 3009 gene locus_tag LOCUS_14390 2290 3009 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760838.1 protein_id gnl|my_center|LOCUS_14390 3062 3832 gene locus_tag LOCUS_14400 3062 3832 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_14400 3848 4282 gene locus_tag LOCUS_14410 3848 4282 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760840.1 protein_id gnl|my_center|LOCUS_14410 4294 5085 gene locus_tag LOCUS_14420 4294 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence104 582 2522 gene locus_tag LOCUS_14430 582 2522 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256716.1 protein_id gnl|my_center|LOCUS_14430 3142 2492 gene locus_tag LOCUS_14440 3142 2492 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108280.1 protein_id gnl|my_center|LOCUS_14440 3713 3147 gene locus_tag LOCUS_14450 gene pnuC 3713 3147 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_14450 4808 3744 gene locus_tag LOCUS_14460 4808 3744 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767297.1 protein_id gnl|my_center|LOCUS_14460 5129 5638 gene locus_tag LOCUS_14470 5129 5638 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238395.1 protein_id gnl|my_center|LOCUS_14470 5811 5927 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence105 633 256 gene locus_tag LOCUS_14480 633 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 760 1746 gene locus_tag LOCUS_14490 760 1746 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_14490 2186 3379 gene locus_tag LOCUS_14500 2186 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 5673 3571 gene locus_tag LOCUS_14510 gene pnp 5673 3571 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_14510 5675 5732 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence106 2457 496 gene locus_tag LOCUS_14520 gene nuoL 2457 496 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764299.1 protein_id gnl|my_center|LOCUS_14520 2847 2536 gene locus_tag LOCUS_14530 gene nuoK 2847 2536 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775579.1 protein_id gnl|my_center|LOCUS_14530 3369 2854 gene locus_tag LOCUS_14540 3369 2854 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764300.1 protein_id gnl|my_center|LOCUS_14540 4027 3401 gene locus_tag LOCUS_14550 4027 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 4943 4062 gene locus_tag LOCUS_14560 4943 4062 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202768.1 protein_id gnl|my_center|LOCUS_14560 <5951 4974 gene locus_tag LOCUS_14570 <5951 4974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787491.1:F0F1 ATP synthase subunit alpha >Feature sequence107 131 1135 gene locus_tag LOCUS_14580 131 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14580 1676 2428 gene locus_tag LOCUS_14590 1676 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 2548 3393 gene locus_tag LOCUS_14600 2548 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 3511 4149 gene locus_tag LOCUS_14610 3511 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14610 4143 4304 gene locus_tag LOCUS_14620 4143 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 4683 4357 gene locus_tag LOCUS_14630 4683 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 5098 4802 gene locus_tag LOCUS_14640 5098 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14640 5435 5079 gene locus_tag LOCUS_14650 5435 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14650 5778 5536 gene locus_tag LOCUS_14660 5778 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence108 555 1718 gene locus_tag LOCUS_14670 555 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1813 3189 gene locus_tag LOCUS_14680 1813 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 3285 5603 gene locus_tag LOCUS_14690 3285 5603 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202543.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence109 <1 1198 gene locus_tag LOCUS_14700 <1 1198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_116269310.1:tetratricopeptide repeat protein note possible pseudo, internal stop codon, frameshifted 1212 2510 gene locus_tag LOCUS_14710 1212 2510 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116269310.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14710 2604 4013 gene locus_tag LOCUS_14720 2604 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 5467 4193 gene locus_tag LOCUS_14730 5467 4193 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_14730 >Feature sequence110 147 160 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1516 599 gene locus_tag LOCUS_14740 1516 599 CDS product DUF5106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107815.1 protein_id gnl|my_center|LOCUS_14740 2126 1524 gene locus_tag LOCUS_14750 2126 1524 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 protein_id gnl|my_center|LOCUS_14750 2261 2716 gene locus_tag LOCUS_14760 2261 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 2854 3327 gene locus_tag LOCUS_14770 gene rimP 2854 3327 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783918.1 protein_id gnl|my_center|LOCUS_14770 3351 4502 gene locus_tag LOCUS_14780 gene nusA 3351 4502 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_14780 4478 4615 gene locus_tag LOCUS_14790 4478 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 4960 5003 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence111 2061 31 gene locus_tag LOCUS_14800 2061 31 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202545.1 protein_id gnl|my_center|LOCUS_14800 3223 2063 gene locus_tag LOCUS_14810 3223 2063 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993669.1 protein_id gnl|my_center|LOCUS_14810 4127 3213 gene locus_tag LOCUS_14820 gene miaA 4127 3213 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759877.1 protein_id gnl|my_center|LOCUS_14820 5356 4124 gene locus_tag LOCUS_14830 gene pepT 5356 4124 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786005.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence112 1023 3002 gene locus_tag LOCUS_14840 1023 3002 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109002.1 protein_id gnl|my_center|LOCUS_14840 4130 3090 gene locus_tag LOCUS_14850 gene asnA 4130 3090 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108145.1 protein_id gnl|my_center|LOCUS_14850 4820 4227 gene locus_tag LOCUS_14860 4820 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 >Feature sequence113 1511 843 gene locus_tag LOCUS_14870 1511 843 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763050.1 protein_id gnl|my_center|LOCUS_14870 2554 1532 gene locus_tag LOCUS_14880 2554 1532 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_14880 2556 2590 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3844 2828 gene locus_tag LOCUS_14890 3844 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14890 4322 3891 gene locus_tag LOCUS_14900 4322 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14900 4681 4472 gene locus_tag LOCUS_14910 4681 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14910 4716 4810 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4991 5100 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence114 148 1494 gene locus_tag LOCUS_14920 148 1494 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_14920 1716 1507 gene locus_tag LOCUS_14930 1716 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 2354 1713 gene locus_tag LOCUS_14940 2354 1713 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785374.1 protein_id gnl|my_center|LOCUS_14940 3004 2351 gene locus_tag LOCUS_14950 gene bioD 3004 2351 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795149.1 protein_id gnl|my_center|LOCUS_14950 3885 3001 gene locus_tag LOCUS_14960 gene lgt 3885 3001 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403744.1 protein_id gnl|my_center|LOCUS_14960 4267 3875 gene locus_tag LOCUS_14970 4267 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14970 5190 4333 gene locus_tag LOCUS_14980 5190 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14980 >Feature sequence115 209 1351 gene locus_tag LOCUS_14990 gene nspC 209 1351 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107393.1 protein_id gnl|my_center|LOCUS_14990 1351 2250 gene locus_tag LOCUS_15000 1351 2250 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784336.1 protein_id gnl|my_center|LOCUS_15000 2167 2215 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2339 3046 gene locus_tag LOCUS_15010 gene radC 2339 3046 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_15010 4145 3051 gene locus_tag LOCUS_15020 4145 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 5086 4154 gene locus_tag LOCUS_15030 5086 4154 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769957.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence116 801 229 gene locus_tag LOCUS_15040 801 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15040 262 302 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1724 885 gene locus_tag LOCUS_15050 1724 885 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796486.1 protein_id gnl|my_center|LOCUS_15050 2760 1840 gene locus_tag LOCUS_15060 2760 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 2770 2901 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3024 3242 gene locus_tag LOCUS_15070 3024 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 4957 3281 gene locus_tag LOCUS_15080 4957 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 5337 5029 gene locus_tag LOCUS_15090 5337 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 >Feature sequence117 1689 1147 gene locus_tag LOCUS_15100 1689 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 3865 1763 gene locus_tag LOCUS_15110 3865 1763 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107338.1 protein_id gnl|my_center|LOCUS_15110 4656 3883 gene locus_tag LOCUS_15120 4656 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 4682 4802 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4966 5061 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence118 67 741 gene locus_tag LOCUS_15130 67 741 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759606.1 protein_id gnl|my_center|LOCUS_15130 750 1448 gene locus_tag LOCUS_15140 gene pssA 750 1448 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784737.1 protein_id gnl|my_center|LOCUS_15140 1594 1812 gene locus_tag LOCUS_15150 1594 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 3057 1855 gene locus_tag LOCUS_15160 3057 1855 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_15160 4508 3057 gene locus_tag LOCUS_15170 4508 3057 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032496674.1 protein_id gnl|my_center|LOCUS_15170 <5058 4555 gene locus_tag LOCUS_15180 <5058 4555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202169.1:4-O-beta-D-mannosyl-D-glucose phosphorylase >Feature sequence119 >Feature sequence120 1087 623 gene locus_tag LOCUS_15190 gene rpiB 1087 623 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766127.1 protein_id gnl|my_center|LOCUS_15190 1503 4721 gene locus_tag LOCUS_15200 1503 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence121 2086 683 gene locus_tag LOCUS_15210 gene mnmE 2086 683 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962791.1 protein_id gnl|my_center|LOCUS_15210 2834 2094 gene locus_tag LOCUS_15220 2834 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 3147 4250 gene locus_tag LOCUS_15230 3147 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 4294 4803 gene locus_tag LOCUS_15240 gene tpx 4294 4803 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788597.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence122 336 358 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 479 515 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 561 848 gene locus_tag LOCUS_15250 561 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15250 1288 845 gene locus_tag LOCUS_15260 gene tsaE 1288 845 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_15260 2807 1290 gene locus_tag LOCUS_15270 2807 1290 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_15270 4102 2804 gene locus_tag LOCUS_15280 4102 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 >Feature sequence123 169 1674 gene locus_tag LOCUS_15290 gene atpD 169 1674 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787476.1 protein_id gnl|my_center|LOCUS_15290 1712 1945 gene locus_tag LOCUS_15300 1712 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 1939 3051 gene locus_tag LOCUS_15310 gene atpB 1939 3051 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787483.1 protein_id gnl|my_center|LOCUS_15310 3086 3331 gene locus_tag LOCUS_15320 3086 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 3348 3845 gene locus_tag LOCUS_15330 gene atpF 3348 3845 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761391.1 protein_id gnl|my_center|LOCUS_15330 3856 4401 gene locus_tag LOCUS_15340 3856 4401 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815471.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence124 1106 219 gene locus_tag LOCUS_15350 1106 219 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784893.1 protein_id gnl|my_center|LOCUS_15350 4491 1231 gene locus_tag LOCUS_15360 4491 1231 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005821947.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence125 1007 402 gene locus_tag LOCUS_15370 gene prfH 1007 402 CDS product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788396.1 protein_id gnl|my_center|LOCUS_15370 2248 1004 gene locus_tag LOCUS_15380 2248 1004 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682062.1 protein_id gnl|my_center|LOCUS_15380 2296 3333 gene locus_tag LOCUS_15390 2296 3333 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107967.1 protein_id gnl|my_center|LOCUS_15390 3490 4500 gene locus_tag LOCUS_15400 3490 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence126 596 432 gene locus_tag LOCUS_15410 596 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 905 1912 gene locus_tag LOCUS_15420 905 1912 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_15420 1909 2760 gene locus_tag LOCUS_15430 1909 2760 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_15430 2765 3712 gene locus_tag LOCUS_15440 2765 3712 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence127 1695 1810 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1978 2066 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2107 2307 gene locus_tag LOCUS_15450 2107 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 3171 2386 gene locus_tag LOCUS_15460 3171 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15460 3260 3304 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <4380 3520 gene locus_tag LOCUS_15470 <4380 3520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858826.1:cytochrome ubiquinol oxidase subunit I >Feature sequence128 2571 544 gene locus_tag LOCUS_15480 2571 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 553 580 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2919 2593 gene locus_tag LOCUS_15490 gene yciH 2919 2593 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422748.1 protein_id gnl|my_center|LOCUS_15490 3354 2926 gene locus_tag LOCUS_15500 3354 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 3792 3373 gene locus_tag LOCUS_15510 3792 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 3876 3952 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence129 1964 3085 gene locus_tag LOCUS_15520 1964 3085 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783796.1 protein_id gnl|my_center|LOCUS_15520 2383 2440 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence130 1576 287 gene locus_tag LOCUS_15530 1576 287 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_15530 2579 1695 gene locus_tag LOCUS_15540 2579 1695 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_15540 3770 2589 gene locus_tag LOCUS_15550 3770 2589 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763289.1 protein_id gnl|my_center|LOCUS_15550 <4352 3783 gene locus_tag LOCUS_15560 <4352 3783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767782.1:DUF4980 domain-containing protein >Feature sequence131 1126 605 gene locus_tag LOCUS_15570 1126 605 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761611.1 protein_id gnl|my_center|LOCUS_15570 1973 1137 gene locus_tag LOCUS_15580 1973 1137 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788374.1 protein_id gnl|my_center|LOCUS_15580 2350 3789 gene locus_tag LOCUS_15590 2350 3789 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784276.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence132 242 1897 gene locus_tag LOCUS_15600 242 1897 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109236.1 protein_id gnl|my_center|LOCUS_15600 2073 3077 gene locus_tag LOCUS_15610 2073 3077 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814336.1 protein_id gnl|my_center|LOCUS_15610 >Feature sequence133 43 393 gene locus_tag LOCUS_15620 43 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963519.1 protein_id gnl|my_center|LOCUS_15620 461 1372 gene locus_tag LOCUS_15630 461 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 3523 1400 gene locus_tag LOCUS_15640 3523 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 4167 3520 gene locus_tag LOCUS_15650 4167 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence134 1358 774 gene locus_tag LOCUS_15660 1358 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 1748 1434 gene locus_tag LOCUS_15670 1748 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 2272 1754 gene locus_tag LOCUS_15680 gene rimM 2272 1754 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761107.1 protein_id gnl|my_center|LOCUS_15680 2862 2272 gene locus_tag LOCUS_15690 2862 2272 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_15690 3714 2968 gene locus_tag LOCUS_15700 gene fabG 3714 2968 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762708.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence135 108 1196 gene locus_tag LOCUS_15710 108 1196 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764441.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence136 81 1796 gene locus_tag LOCUS_15720 gene menD 81 1796 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963786.1 protein_id gnl|my_center|LOCUS_15720 1789 2613 gene locus_tag LOCUS_15730 gene menB 1789 2613 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795543.1 protein_id gnl|my_center|LOCUS_15730 2613 3671 gene locus_tag LOCUS_15740 2613 3671 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202359.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence137 77 2263 gene locus_tag LOCUS_15750 77 2263 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765057.1 protein_id gnl|my_center|LOCUS_15750 2434 4047 gene locus_tag LOCUS_15760 gene asnB 2434 4047 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence138 1 384 gene locus_tag LOCUS_15770 1 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15770 336 548 gene locus_tag LOCUS_15780 336 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15780 587 2221 gene locus_tag LOCUS_15790 gene ilvB 587 2221 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761034.1 protein_id gnl|my_center|LOCUS_15790 2199 2214 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2730 2823 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2835 3257 gene locus_tag LOCUS_15800 2835 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15800 3055 3089 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3289 3513 gene locus_tag LOCUS_15810 3289 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 >Feature sequence139 163 217 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 389 486 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 845 525 gene locus_tag LOCUS_15820 gene rplU 845 525 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759984.1 protein_id gnl|my_center|LOCUS_15820 1150 2193 gene locus_tag LOCUS_15830 1150 2193 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760868.1 protein_id gnl|my_center|LOCUS_15830 2211 2786 gene locus_tag LOCUS_15840 2211 2786 CDS product DUF4827 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109033.1 protein_id gnl|my_center|LOCUS_15840 3478 3569 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence140 1051 269 gene locus_tag LOCUS_15850 1051 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15850 1183 2385 gene locus_tag LOCUS_15860 1183 2385 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789686.1 protein_id gnl|my_center|LOCUS_15860 2709 3638 gene locus_tag LOCUS_15870 2709 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 >Feature sequence141 811 3270 gene locus_tag LOCUS_15880 811 3270 CDS product excinuclease ABC subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389901.1 protein_id gnl|my_center|LOCUS_15880 3213 3259 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence142 271 290 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 310 1311 gene locus_tag LOCUS_15890 310 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 1308 1877 gene locus_tag LOCUS_15900 1308 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15900 1959 2879 gene locus_tag LOCUS_15910 1959 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15910 2845 3159 gene locus_tag LOCUS_15920 2845 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 3380 3156 gene locus_tag LOCUS_15930 3380 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15930 3411 3455 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence143 97 369 gene locus_tag LOCUS_15940 97 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 734 1957 gene locus_tag LOCUS_15950 734 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1982 2332 gene locus_tag LOCUS_15960 1982 2332 CDS product DUF4491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767264.1 protein_id gnl|my_center|LOCUS_15960 2530 3036 gene locus_tag LOCUS_15970 2530 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15970 >Feature sequence144 1010 72 gene locus_tag LOCUS_15980 1010 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 >Feature sequence145 124 175 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1857 628 gene locus_tag LOCUS_15990 1857 628 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762301.1 protein_id gnl|my_center|LOCUS_15990 3065 1854 gene locus_tag LOCUS_16000 3065 1854 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence146 71 1411 gene locus_tag LOCUS_16010 71 1411 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839735.1 protein_id gnl|my_center|LOCUS_16010 1453 1470 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1721 1760 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2537 2563 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2718 2837 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3006 3126 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence147 1134 580 gene locus_tag LOCUS_16020 1134 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1159 1256 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1613 3145 gene locus_tag LOCUS_16030 gene dnaB 1613 3145 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788141.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence148 46 1554 gene locus_tag LOCUS_16040 46 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 1551 1970 gene locus_tag LOCUS_16050 1551 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 2088 2501 gene locus_tag LOCUS_16060 2088 2501 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761720.1 protein_id gnl|my_center|LOCUS_16060 2498 3061 gene locus_tag LOCUS_16070 2498 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16070 2966 3019 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence149 839 2374 gene locus_tag LOCUS_16080 839 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16080 2453 3025 gene locus_tag LOCUS_16090 gene ahpC 2453 3025 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775969.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence150 426 268 gene locus_tag LOCUS_16100 426 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 852 430 gene locus_tag LOCUS_16110 852 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 1603 1037 gene locus_tag LOCUS_16120 1603 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence151 <1 720 gene locus_tag LOCUS_16130 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005804122.1:tyrosine recombinase XerC 710 1003 gene locus_tag LOCUS_16140 gene raiA 710 1003 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782154.1 protein_id gnl|my_center|LOCUS_16140 1990 1019 gene locus_tag LOCUS_16150 1990 1019 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109173.1 protein_id gnl|my_center|LOCUS_16150 2208 2912 gene locus_tag LOCUS_16160 2208 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 >Feature sequence152 2184 1774 gene locus_tag LOCUS_16170 2184 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 1793 1813 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2365 2186 gene locus_tag LOCUS_16180 2365 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 2382 2547 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence153 157 208 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1368 274 gene locus_tag LOCUS_16190 1368 274 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051287133.1 protein_id gnl|my_center|LOCUS_16190 2498 1401 gene locus_tag LOCUS_16200 2498 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence154 172 328 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 921 628 gene locus_tag LOCUS_16210 921 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1063 2598 gene locus_tag LOCUS_16220 1063 2598 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203710.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence155 385 53 gene locus_tag LOCUS_16230 385 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16230 2386 599 gene locus_tag LOCUS_16240 2386 599 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203603.1 protein_id gnl|my_center|LOCUS_16240 >Feature sequence156 <1 897 gene locus_tag LOCUS_16250 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790883.1:methylmalonyl-CoA mutase 828 866 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1979 924 gene locus_tag LOCUS_16260 1979 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 2248 2347 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence157 140 232 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 936 1667 gene locus_tag LOCUS_16270 gene pyrB 936 1667 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787548.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16270 1634 1651 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1670 1819 gene locus_tag LOCUS_16280 1670 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16280 2192 2205 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends