>Feature sequence001 1503 217 gene locus_tag LOCUS_00010 1503 217 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941087.1 protein_id gnl|my_center|LOCUS_00010 2043 1612 gene locus_tag LOCUS_00020 2043 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3015 2050 gene locus_tag LOCUS_00030 3015 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4894 3026 gene locus_tag LOCUS_00040 4894 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5710 4925 gene locus_tag LOCUS_00050 5710 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6296 5850 gene locus_tag LOCUS_00060 6296 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7617 6304 gene locus_tag LOCUS_00070 7617 6304 CDS product FliI/YscN family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941081.1 protein_id gnl|my_center|LOCUS_00070 8596 7637 gene locus_tag LOCUS_00080 8596 7637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9626 8583 gene locus_tag LOCUS_00090 gene fliG 9626 8583 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941079.1 protein_id gnl|my_center|LOCUS_00090 11294 9642 gene locus_tag LOCUS_00100 gene fliF 11294 9642 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546552.1 protein_id gnl|my_center|LOCUS_00100 11636 11313 gene locus_tag LOCUS_00110 11636 11313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12087 11653 gene locus_tag LOCUS_00120 gene flgC 12087 11653 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_00120 12494 12087 gene locus_tag LOCUS_00130 gene flgB 12494 12087 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941075.1 protein_id gnl|my_center|LOCUS_00130 13438 12491 gene locus_tag LOCUS_00140 13438 12491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16162 13457 gene locus_tag LOCUS_00150 16162 13457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 16721 17212 gene locus_tag LOCUS_00160 16721 17212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 17214 18002 gene locus_tag LOCUS_00170 17214 18002 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_00170 18005 18742 gene locus_tag LOCUS_00180 18005 18742 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_00180 18742 19551 gene locus_tag LOCUS_00190 18742 19551 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545262.1 protein_id gnl|my_center|LOCUS_00190 19676 20062 gene locus_tag LOCUS_00200 19676 20062 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962927.1 protein_id gnl|my_center|LOCUS_00200 20318 21280 gene locus_tag LOCUS_00210 20318 21280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 22095 21430 gene locus_tag LOCUS_00220 22095 21430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 22909 25446 gene locus_tag LOCUS_00230 22909 25446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 25499 26929 gene locus_tag LOCUS_00240 25499 26929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 27341 26967 gene locus_tag LOCUS_00250 27341 26967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 27357 28691 gene locus_tag LOCUS_00260 gene trmFO 27357 28691 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131150.1 protein_id gnl|my_center|LOCUS_00260 31012 28829 gene locus_tag LOCUS_00270 31012 28829 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 protein_id gnl|my_center|LOCUS_00270 33277 31109 gene locus_tag LOCUS_00280 33277 31109 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090481.1 protein_id gnl|my_center|LOCUS_00280 33806 34606 gene locus_tag LOCUS_00290 33806 34606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 34593 36428 gene locus_tag LOCUS_00300 34593 36428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 37484 36582 gene locus_tag LOCUS_00310 37484 36582 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933054.1 protein_id gnl|my_center|LOCUS_00310 38959 37487 gene locus_tag LOCUS_00320 38959 37487 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404788.1 protein_id gnl|my_center|LOCUS_00320 39945 38956 gene locus_tag LOCUS_00330 39945 38956 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146738.1 protein_id gnl|my_center|LOCUS_00330 40260 41021 gene locus_tag LOCUS_00340 40260 41021 CDS product lycopene cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174499.1 protein_id gnl|my_center|LOCUS_00340 41018 41974 gene locus_tag LOCUS_00350 41018 41974 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411125.1 protein_id gnl|my_center|LOCUS_00350 41971 42705 gene locus_tag LOCUS_00360 41971 42705 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646283.1 protein_id gnl|my_center|LOCUS_00360 44614 42764 gene locus_tag LOCUS_00370 gene glmS 44614 42764 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_00370 45986 44616 gene locus_tag LOCUS_00380 gene glmU 45986 44616 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015965.1 protein_id gnl|my_center|LOCUS_00380 46034 46726 gene locus_tag LOCUS_00390 46034 46726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 46713 47144 gene locus_tag LOCUS_00400 46713 47144 CDS product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 protein_id gnl|my_center|LOCUS_00400 47267 47986 gene locus_tag LOCUS_00410 47267 47986 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867638.1 protein_id gnl|my_center|LOCUS_00410 49447 48047 gene locus_tag LOCUS_00420 49447 48047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 49760 49942 gene locus_tag LOCUS_00430 49760 49942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 50129 50959 gene locus_tag LOCUS_00440 50129 50959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 51357 51974 gene locus_tag LOCUS_00450 51357 51974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 52666 52055 gene locus_tag LOCUS_00460 52666 52055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 52858 53628 gene locus_tag LOCUS_00470 52858 53628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 53637 54803 gene locus_tag LOCUS_00480 53637 54803 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_00480 54811 55701 gene locus_tag LOCUS_00490 gene murB 54811 55701 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990117.1 protein_id gnl|my_center|LOCUS_00490 56114 57826 gene locus_tag LOCUS_00500 56114 57826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 59234 57900 gene locus_tag LOCUS_00510 gene murC 59234 57900 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_00510 60283 59282 gene locus_tag LOCUS_00520 60283 59282 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081611101.1 protein_id gnl|my_center|LOCUS_00520 61533 60442 gene locus_tag LOCUS_00530 gene queG 61533 60442 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572974.1 protein_id gnl|my_center|LOCUS_00530 61779 62648 gene locus_tag LOCUS_00540 61779 62648 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_00540 62863 65913 gene locus_tag LOCUS_00550 62863 65913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 65917 66735 gene locus_tag LOCUS_00560 65917 66735 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262214.1 protein_id gnl|my_center|LOCUS_00560 67424 66744 gene locus_tag LOCUS_00570 67424 66744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 67794 71285 gene locus_tag LOCUS_00580 67794 71285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 73275 71278 gene locus_tag LOCUS_00590 73275 71278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 73811 77053 gene locus_tag LOCUS_00600 73811 77053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 79164 77134 gene locus_tag LOCUS_00610 79164 77134 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203339.1 protein_id gnl|my_center|LOCUS_00610 79723 79184 gene locus_tag LOCUS_00620 79723 79184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 80923 79856 gene locus_tag LOCUS_00630 gene murG 80923 79856 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_00630 81836 80916 gene locus_tag LOCUS_00640 gene ftsW 81836 80916 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_00640 83439 82063 gene locus_tag LOCUS_00650 gene murD 83439 82063 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_00650 84522 83446 gene locus_tag LOCUS_00660 gene mraY 84522 83446 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_00660 85940 84543 gene locus_tag LOCUS_00670 85940 84543 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963518.1 protein_id gnl|my_center|LOCUS_00670 86369 85950 gene locus_tag LOCUS_00680 86369 85950 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971878.1 protein_id gnl|my_center|LOCUS_00680 87846 86371 gene locus_tag LOCUS_00690 87846 86371 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881134.1 protein_id gnl|my_center|LOCUS_00690 88466 88140 gene locus_tag LOCUS_00700 88466 88140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 88968 88642 gene locus_tag LOCUS_00710 88968 88642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 90838 88961 gene locus_tag LOCUS_00720 90838 88961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 91577 90828 gene locus_tag LOCUS_00730 91577 90828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 92204 91587 gene locus_tag LOCUS_00740 92204 91587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 94624 92654 gene locus_tag LOCUS_00750 94624 92654 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_00750 94817 94626 gene locus_tag LOCUS_00760 94817 94626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 95779 94898 gene locus_tag LOCUS_00770 gene rsmH 95779 94898 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881225.1 protein_id gnl|my_center|LOCUS_00770 95990 96904 gene locus_tag LOCUS_00780 95990 96904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 97048 97578 gene locus_tag LOCUS_00790 gene hpt 97048 97578 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479701.1 protein_id gnl|my_center|LOCUS_00790 97767 99017 gene locus_tag LOCUS_00800 97767 99017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 100750 99092 gene locus_tag LOCUS_00810 100750 99092 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_00810 101913 100750 gene locus_tag LOCUS_00820 101913 100750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 102482 101910 gene locus_tag LOCUS_00830 102482 101910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 102693 102445 gene locus_tag LOCUS_00840 102693 102445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 106273 102683 gene locus_tag LOCUS_00850 106273 102683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 107613 106270 gene locus_tag LOCUS_00860 107613 106270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 108194 107613 gene locus_tag LOCUS_00870 108194 107613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 109708 108305 gene locus_tag LOCUS_00880 109708 108305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 111119 109773 gene locus_tag LOCUS_00890 gene dacB 111119 109773 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108699.1 protein_id gnl|my_center|LOCUS_00890 111258 112766 gene locus_tag LOCUS_00900 111258 112766 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727704.1 protein_id gnl|my_center|LOCUS_00900 112902 113954 gene locus_tag LOCUS_00910 112902 113954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 114769 113918 gene locus_tag LOCUS_00920 114769 113918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 115051 118197 gene locus_tag LOCUS_00930 115051 118197 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839353.1 protein_id gnl|my_center|LOCUS_00930 119170 118271 gene locus_tag LOCUS_00940 119170 118271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 120036 119191 gene locus_tag LOCUS_00950 gene motA 120036 119191 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546161.1 protein_id gnl|my_center|LOCUS_00950 120209 121966 gene locus_tag LOCUS_00960 120209 121966 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693234.1 protein_id gnl|my_center|LOCUS_00960 122217 123326 gene locus_tag LOCUS_00970 122217 123326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 124265 123384 gene locus_tag LOCUS_00980 124265 123384 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074451.1 protein_id gnl|my_center|LOCUS_00980 124375 125496 gene locus_tag LOCUS_00990 124375 125496 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072127.1 protein_id gnl|my_center|LOCUS_00990 125498 126316 gene locus_tag LOCUS_01000 gene fghA 125498 126316 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000419039.1 protein_id gnl|my_center|LOCUS_01000 126704 126934 gene locus_tag LOCUS_01010 126704 126934 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809912.1 protein_id gnl|my_center|LOCUS_01010 126927 127517 gene locus_tag LOCUS_01020 126927 127517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 127521 127841 gene locus_tag LOCUS_01030 127521 127841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 128006 128749 gene locus_tag LOCUS_01040 128006 128749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 128746 130236 gene locus_tag LOCUS_01050 128746 130236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 130845 130354 gene locus_tag LOCUS_01060 130845 130354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 131086 132105 gene locus_tag LOCUS_01070 131086 132105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 132057 132989 gene locus_tag LOCUS_01080 132057 132989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 132993 133448 gene locus_tag LOCUS_01090 gene smpB 132993 133448 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545050.1 protein_id gnl|my_center|LOCUS_01090 133562 134248 gene locus_tag LOCUS_01100 133562 134248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 134808 134272 gene locus_tag LOCUS_01110 134808 134272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 135043 135819 gene locus_tag LOCUS_01120 135043 135819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 137002 135821 gene locus_tag LOCUS_01130 gene aroA 137002 135821 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013873.1 protein_id gnl|my_center|LOCUS_01130 138033 137005 gene locus_tag LOCUS_01140 gene aroC 138033 137005 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962924.1 protein_id gnl|my_center|LOCUS_01140 139783 138020 gene locus_tag LOCUS_01150 139783 138020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 140843 139785 gene locus_tag LOCUS_01160 gene aroB 140843 139785 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052388.1 protein_id gnl|my_center|LOCUS_01160 141888 140845 gene locus_tag LOCUS_01170 gene aroF 141888 140845 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_01170 142963 141851 gene locus_tag LOCUS_01180 142963 141851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 144419 143112 gene locus_tag LOCUS_01190 144419 143112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 145242 144442 gene locus_tag LOCUS_01200 gene rsmA 145242 144442 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814989.1 protein_id gnl|my_center|LOCUS_01200 146300 145230 gene locus_tag LOCUS_01210 gene tsaD 146300 145230 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056353.1 protein_id gnl|my_center|LOCUS_01210 146631 147944 gene locus_tag LOCUS_01220 146631 147944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 148710 147946 gene locus_tag LOCUS_01230 148710 147946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 149012 148710 gene locus_tag LOCUS_01240 149012 148710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 >Feature sequence002 853 461 gene locus_tag LOCUS_01250 853 461 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049863.1 protein_id gnl|my_center|LOCUS_01250 1019 1408 gene locus_tag LOCUS_01260 1019 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 2196 1459 gene locus_tag LOCUS_01270 2196 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 2927 3832 gene locus_tag LOCUS_01280 2927 3832 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074323.1 protein_id gnl|my_center|LOCUS_01280 3903 4937 gene locus_tag LOCUS_01290 gene pheS 3903 4937 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021092.1 protein_id gnl|my_center|LOCUS_01290 4952 7381 gene locus_tag LOCUS_01300 gene pheT 4952 7381 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016058.1 protein_id gnl|my_center|LOCUS_01300 7723 7427 gene locus_tag LOCUS_01310 7723 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 8106 8441 gene locus_tag LOCUS_01320 8106 8441 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_01320 8502 9011 gene locus_tag LOCUS_01330 8502 9011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 9008 9700 gene locus_tag LOCUS_01340 9008 9700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 11301 9697 gene locus_tag LOCUS_01350 11301 9697 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920646.1 protein_id gnl|my_center|LOCUS_01350 11830 12750 gene locus_tag LOCUS_01360 11830 12750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 12750 13844 gene locus_tag LOCUS_01370 12750 13844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 13915 14586 gene locus_tag LOCUS_01380 13915 14586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 14928 15713 gene locus_tag LOCUS_01390 14928 15713 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_01390 15703 16470 gene locus_tag LOCUS_01400 15703 16470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 16488 17255 gene locus_tag LOCUS_01410 gene phnC 16488 17255 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078092.1 protein_id gnl|my_center|LOCUS_01410 17265 18284 gene locus_tag LOCUS_01420 gene phnE 17265 18284 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127689.1 protein_id gnl|my_center|LOCUS_01420 19323 18547 gene locus_tag LOCUS_01430 19323 18547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 19637 20614 gene locus_tag LOCUS_01440 19637 20614 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626171.1 protein_id gnl|my_center|LOCUS_01440 20697 23111 gene locus_tag LOCUS_01450 20697 23111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 23124 24140 gene locus_tag LOCUS_01460 23124 24140 CDS product bifunctional 3-dehydroquinate synthase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545527.1 protein_id gnl|my_center|LOCUS_01460 24730 24137 gene locus_tag LOCUS_01470 24730 24137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 25449 24736 gene locus_tag LOCUS_01480 25449 24736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 25640 26170 gene locus_tag LOCUS_01490 25640 26170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 26870 26157 gene locus_tag LOCUS_01500 26870 26157 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762294.1 protein_id gnl|my_center|LOCUS_01500 27021 31223 gene locus_tag LOCUS_01510 27021 31223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 31226 31543 gene locus_tag LOCUS_01520 31226 31543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 31540 32718 gene locus_tag LOCUS_01530 31540 32718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 32968 32786 gene locus_tag LOCUS_01540 gene rpmG 32968 32786 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963553.1 protein_id gnl|my_center|LOCUS_01540 33225 33530 gene locus_tag LOCUS_01550 gene rpsN 33225 33530 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872167.1 protein_id gnl|my_center|LOCUS_01550 34997 33618 gene locus_tag LOCUS_01560 34997 33618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 36096 35338 gene locus_tag LOCUS_01570 36096 35338 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228666.1 protein_id gnl|my_center|LOCUS_01570 36439 36098 gene locus_tag LOCUS_01580 36439 36098 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142756.1 protein_id gnl|my_center|LOCUS_01580 38455 36515 gene locus_tag LOCUS_01590 gene acs 38455 36515 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391322.1 protein_id gnl|my_center|LOCUS_01590 40441 38522 gene locus_tag LOCUS_01600 40441 38522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 41657 40653 gene locus_tag LOCUS_01610 41657 40653 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327978.1 protein_id gnl|my_center|LOCUS_01610 42614 41727 gene locus_tag LOCUS_01620 42614 41727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 43764 42649 gene locus_tag LOCUS_01630 gene proB 43764 42649 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583199.1 protein_id gnl|my_center|LOCUS_01630 43951 44136 gene locus_tag LOCUS_01640 43951 44136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 44201 45781 gene locus_tag LOCUS_01650 44201 45781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 45762 46748 gene locus_tag LOCUS_01660 45762 46748 CDS product acryloyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233163.1 protein_id gnl|my_center|LOCUS_01660 46850 47296 gene locus_tag LOCUS_01670 46850 47296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 48423 47338 gene locus_tag LOCUS_01680 48423 47338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 48772 49137 gene locus_tag LOCUS_01690 48772 49137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 50414 49134 gene locus_tag LOCUS_01700 gene hmgA 50414 49134 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035691.1 protein_id gnl|my_center|LOCUS_01700 51105 51260 gene locus_tag LOCUS_01710 51105 51260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 51771 51343 gene locus_tag LOCUS_01720 51771 51343 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933604.1 protein_id gnl|my_center|LOCUS_01720 52873 51998 gene locus_tag LOCUS_01730 52873 51998 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085811.1 protein_id gnl|my_center|LOCUS_01730 53959 53015 gene locus_tag LOCUS_01740 53959 53015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 54648 53971 gene locus_tag LOCUS_01750 54648 53971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 56336 54648 gene locus_tag LOCUS_01760 56336 54648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 57735 56467 gene locus_tag LOCUS_01770 57735 56467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 58664 57732 gene locus_tag LOCUS_01780 58664 57732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 59158 58661 gene locus_tag LOCUS_01790 59158 58661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 59784 59215 gene locus_tag LOCUS_01800 59784 59215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 60292 59843 gene locus_tag LOCUS_01810 gene xcpT 60292 59843 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_01810 61557 60328 gene locus_tag LOCUS_01820 gene gspF 61557 60328 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465194.1 protein_id gnl|my_center|LOCUS_01820 61953 62459 gene locus_tag LOCUS_01830 61953 62459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 63102 62518 gene locus_tag LOCUS_01840 63102 62518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 65121 63433 gene locus_tag LOCUS_01850 gene gspE 65121 63433 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041913993.1 protein_id gnl|my_center|LOCUS_01850 67623 65128 gene locus_tag LOCUS_01860 gene gspD 67623 65128 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173419.1 protein_id gnl|my_center|LOCUS_01860 68779 67640 gene locus_tag LOCUS_01870 68779 67640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 70468 69095 gene locus_tag LOCUS_01880 70468 69095 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_01880 70804 71508 gene locus_tag LOCUS_01890 70804 71508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 71681 73426 gene locus_tag LOCUS_01900 71681 73426 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142721.1 protein_id gnl|my_center|LOCUS_01900 76450 73535 gene locus_tag LOCUS_01910 76450 73535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 77843 76674 gene locus_tag LOCUS_01920 77843 76674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 77832 78689 gene locus_tag LOCUS_01930 77832 78689 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271588.1 protein_id gnl|my_center|LOCUS_01930 79818 78862 gene locus_tag LOCUS_01940 79818 78862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 80431 81144 gene locus_tag LOCUS_01950 gene rnc 80431 81144 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851153.1 protein_id gnl|my_center|LOCUS_01950 81134 82027 gene locus_tag LOCUS_01960 gene era 81134 82027 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144405.1 protein_id gnl|my_center|LOCUS_01960 82011 83486 gene locus_tag LOCUS_01970 gene der 82011 83486 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942865.1 protein_id gnl|my_center|LOCUS_01970 84277 83600 gene locus_tag LOCUS_01980 84277 83600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 84890 84390 gene locus_tag LOCUS_01990 84890 84390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 85070 85465 gene locus_tag LOCUS_02000 85070 85465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 87227 85485 gene locus_tag LOCUS_02010 87227 85485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 88573 87566 gene locus_tag LOCUS_02020 88573 87566 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183315.1 protein_id gnl|my_center|LOCUS_02020 90012 88582 gene locus_tag LOCUS_02030 90012 88582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 91977 90136 gene locus_tag LOCUS_02040 91977 90136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 92297 91983 gene locus_tag LOCUS_02050 92297 91983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 92386 93081 gene locus_tag LOCUS_02060 92386 93081 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965730.1 protein_id gnl|my_center|LOCUS_02060 93734 93135 gene locus_tag LOCUS_02070 93734 93135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 94188 93784 gene locus_tag LOCUS_02080 94188 93784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 94387 94190 gene locus_tag LOCUS_02090 94387 94190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 94688 95083 gene locus_tag LOCUS_02100 94688 95083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 95084 95248 gene locus_tag LOCUS_02110 95084 95248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 95241 96041 gene locus_tag LOCUS_02120 95241 96041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 96058 96969 gene locus_tag LOCUS_02130 96058 96969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 97136 97684 gene locus_tag LOCUS_02140 97136 97684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 97684 98541 gene locus_tag LOCUS_02150 97684 98541 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231451.1 protein_id gnl|my_center|LOCUS_02150 99409 98942 gene locus_tag LOCUS_02160 99409 98942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 100837 99437 gene locus_tag LOCUS_02170 100837 99437 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_02170 101256 101627 gene locus_tag LOCUS_02180 101256 101627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 101763 101605 gene locus_tag LOCUS_02190 101763 101605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 101884 103320 gene locus_tag LOCUS_02200 101884 103320 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071802696.1 protein_id gnl|my_center|LOCUS_02200 103450 103866 gene locus_tag LOCUS_02210 103450 103866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 103882 104217 gene locus_tag LOCUS_02220 103882 104217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 104226 104510 gene locus_tag LOCUS_02230 104226 104510 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460331.1 protein_id gnl|my_center|LOCUS_02230 104510 106699 gene locus_tag LOCUS_02240 104510 106699 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_02240 106961 107620 gene locus_tag LOCUS_02250 106961 107620 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946775.1 protein_id gnl|my_center|LOCUS_02250 107746 107883 gene locus_tag LOCUS_02260 107746 107883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 108278 107925 gene locus_tag LOCUS_02270 108278 107925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 108778 108275 gene locus_tag LOCUS_02280 108778 108275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 108895 109188 gene locus_tag LOCUS_02290 108895 109188 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003015870.1 protein_id gnl|my_center|LOCUS_02290 109715 109185 gene locus_tag LOCUS_02300 109715 109185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 110241 109708 gene locus_tag LOCUS_02310 110241 109708 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388480.1 protein_id gnl|my_center|LOCUS_02310 110419 110916 gene locus_tag LOCUS_02320 110419 110916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 110883 112133 gene locus_tag LOCUS_02330 110883 112133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 112126 113505 gene locus_tag LOCUS_02340 112126 113505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 113518 116634 gene locus_tag LOCUS_02350 113518 116634 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941986.1 protein_id gnl|my_center|LOCUS_02350 116627 116971 gene locus_tag LOCUS_02360 116627 116971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 116971 117681 gene locus_tag LOCUS_02370 116971 117681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 117695 118078 gene locus_tag LOCUS_02380 117695 118078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 118172 118543 gene locus_tag LOCUS_02390 118172 118543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 118837 119370 gene locus_tag LOCUS_02400 118837 119370 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023392.1 protein_id gnl|my_center|LOCUS_02400 119360 121249 gene locus_tag LOCUS_02410 119360 121249 CDS product cytochrome c/FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103008.1 protein_id gnl|my_center|LOCUS_02410 121250 122059 gene locus_tag LOCUS_02420 121250 122059 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212588.1 protein_id gnl|my_center|LOCUS_02420 >Feature sequence003 914 147 gene locus_tag LOCUS_02430 914 147 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928794.1 protein_id gnl|my_center|LOCUS_02430 1142 2023 gene locus_tag LOCUS_02440 1142 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 2096 2671 gene locus_tag LOCUS_02450 2096 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 2675 5476 gene locus_tag LOCUS_02460 2675 5476 CDS product 1-deoxy-D-xylulose-5-phosphate synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258659.1 protein_id gnl|my_center|LOCUS_02460 5452 6204 gene locus_tag LOCUS_02470 5452 6204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 7246 8949 gene locus_tag LOCUS_02480 7246 8949 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206616.1 protein_id gnl|my_center|LOCUS_02480 9220 10161 gene locus_tag LOCUS_02490 9220 10161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 10814 10164 gene locus_tag LOCUS_02500 10814 10164 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206262.1 protein_id gnl|my_center|LOCUS_02500 11765 10815 gene locus_tag LOCUS_02510 11765 10815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 11957 12721 gene locus_tag LOCUS_02520 gene fabI 11957 12721 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421886.1 protein_id gnl|my_center|LOCUS_02520 12766 13344 gene locus_tag LOCUS_02530 12766 13344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 13387 13575 gene locus_tag LOCUS_02540 13387 13575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 14610 13687 gene locus_tag LOCUS_02550 gene trxB 14610 13687 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940581.1 protein_id gnl|my_center|LOCUS_02550 14814 15104 gene locus_tag LOCUS_02560 14814 15104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 16121 15117 gene locus_tag LOCUS_02570 16121 15117 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074319.1 protein_id gnl|my_center|LOCUS_02570 17524 16793 gene locus_tag LOCUS_02580 17524 16793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 17705 18184 gene locus_tag LOCUS_02590 17705 18184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 18362 19900 gene locus_tag LOCUS_02600 18362 19900 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245514.1 protein_id gnl|my_center|LOCUS_02600 20680 20030 gene locus_tag LOCUS_02610 20680 20030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 21320 20670 gene locus_tag LOCUS_02620 21320 20670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 23339 22161 gene locus_tag LOCUS_02630 23339 22161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 23687 25345 gene locus_tag LOCUS_02640 gene ggt 23687 25345 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528596.1 protein_id gnl|my_center|LOCUS_02640 26380 25373 gene locus_tag LOCUS_02650 26380 25373 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932879.1 protein_id gnl|my_center|LOCUS_02650 26540 29401 gene locus_tag LOCUS_02660 26540 29401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 29550 31445 gene locus_tag LOCUS_02670 gene speA 29550 31445 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144058.1 protein_id gnl|my_center|LOCUS_02670 31769 33034 gene locus_tag LOCUS_02680 31769 33034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 33056 33985 gene locus_tag LOCUS_02690 33056 33985 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948657.1 protein_id gnl|my_center|LOCUS_02690 34506 36047 gene locus_tag LOCUS_02700 34506 36047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 36223 37842 gene locus_tag LOCUS_02710 36223 37842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 37953 38369 gene locus_tag LOCUS_02720 37953 38369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 39044 38400 gene locus_tag LOCUS_02730 39044 38400 CDS product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074052.1 protein_id gnl|my_center|LOCUS_02730 39214 39041 gene locus_tag LOCUS_02740 39214 39041 CDS product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008265.1 protein_id gnl|my_center|LOCUS_02740 39551 39877 gene locus_tag LOCUS_02750 39551 39877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 40540 41028 gene locus_tag LOCUS_02760 40540 41028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 40979 41365 gene locus_tag LOCUS_02770 40979 41365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 41380 41802 gene locus_tag LOCUS_02780 41380 41802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 42527 42009 gene locus_tag LOCUS_02790 42527 42009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 43087 42554 gene locus_tag LOCUS_02800 43087 42554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 44793 43738 gene locus_tag LOCUS_02810 44793 43738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 45678 44893 gene locus_tag LOCUS_02820 45678 44893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 45932 48727 gene locus_tag LOCUS_02830 45932 48727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 49761 48730 gene locus_tag LOCUS_02840 49761 48730 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_02840 50856 49828 gene locus_tag LOCUS_02850 50856 49828 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603891.1 protein_id gnl|my_center|LOCUS_02850 51872 50853 gene locus_tag LOCUS_02860 51872 50853 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759810.1 protein_id gnl|my_center|LOCUS_02860 53504 51885 gene locus_tag LOCUS_02870 53504 51885 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001970104.1 protein_id gnl|my_center|LOCUS_02870 53769 54374 gene locus_tag LOCUS_02880 53769 54374 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349540.1 protein_id gnl|my_center|LOCUS_02880 54371 55348 gene locus_tag LOCUS_02890 54371 55348 CDS product agmatinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_02890 55804 55439 gene locus_tag LOCUS_02900 gene dksA 55804 55439 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312570.1 protein_id gnl|my_center|LOCUS_02900 56738 56908 gene locus_tag LOCUS_02910 56738 56908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 56918 57862 gene locus_tag LOCUS_02920 56918 57862 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337019.1 protein_id gnl|my_center|LOCUS_02920 58402 57872 gene locus_tag LOCUS_02930 gene fxsA 58402 57872 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483998.1 protein_id gnl|my_center|LOCUS_02930 60382 58844 gene locus_tag LOCUS_02940 60382 58844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 61853 60384 gene locus_tag LOCUS_02950 61853 60384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 63201 61846 gene locus_tag LOCUS_02960 63201 61846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 65831 63201 gene locus_tag LOCUS_02970 65831 63201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 66530 69319 gene locus_tag LOCUS_02980 66530 69319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 69426 70604 gene locus_tag LOCUS_02990 69426 70604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 70604 71608 gene locus_tag LOCUS_03000 70604 71608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 71618 72625 gene locus_tag LOCUS_03010 71618 72625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 72710 73105 gene locus_tag LOCUS_03020 72710 73105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 73644 74414 gene locus_tag LOCUS_03030 73644 74414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 75282 74512 gene locus_tag LOCUS_03040 75282 74512 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949043.1 protein_id gnl|my_center|LOCUS_03040 77579 75279 gene locus_tag LOCUS_03050 77579 75279 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_03050 78830 77592 gene locus_tag LOCUS_03060 78830 77592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 79611 78820 gene locus_tag LOCUS_03070 79611 78820 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_03070 80341 82215 gene locus_tag LOCUS_03080 80341 82215 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250730.1 protein_id gnl|my_center|LOCUS_03080 82652 84529 gene locus_tag LOCUS_03090 82652 84529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 84775 85866 gene locus_tag LOCUS_03100 84775 85866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 85856 88474 gene locus_tag LOCUS_03110 85856 88474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 88633 90165 gene locus_tag LOCUS_03120 88633 90165 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_03120 97950 90226 gene locus_tag LOCUS_03130 97950 90226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 98869 98162 gene locus_tag LOCUS_03140 98869 98162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 99095 98892 gene locus_tag LOCUS_03150 99095 98892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 99256 100230 gene locus_tag LOCUS_03160 gene rfaD 99256 100230 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937788.1 protein_id gnl|my_center|LOCUS_03160 100635 101393 gene locus_tag LOCUS_03170 100635 101393 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887221.1 protein_id gnl|my_center|LOCUS_03170 101377 102120 gene locus_tag LOCUS_03180 gene tsaA 101377 102120 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_03180 103127 102336 gene locus_tag LOCUS_03190 103127 102336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 103326 104207 gene locus_tag LOCUS_03200 103326 104207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 105316 104204 gene locus_tag LOCUS_03210 gene ribD 105316 104204 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896839.1 protein_id gnl|my_center|LOCUS_03210 106359 105313 gene locus_tag LOCUS_03220 gene hppD 106359 105313 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706478.1 protein_id gnl|my_center|LOCUS_03220 106873 108276 gene locus_tag LOCUS_03230 106873 108276 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941440.1 protein_id gnl|my_center|LOCUS_03230 109665 108646 gene locus_tag LOCUS_03240 109665 108646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 >Feature sequence004 535 2466 gene locus_tag LOCUS_03250 535 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 3297 2470 gene locus_tag LOCUS_03260 3297 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 3431 4333 gene locus_tag LOCUS_03270 gene kdsA 3431 4333 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545456.1 protein_id gnl|my_center|LOCUS_03270 4477 5496 gene locus_tag LOCUS_03280 gene lptF 4477 5496 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_03280 6254 5493 gene locus_tag LOCUS_03290 6254 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 8206 6731 gene locus_tag LOCUS_03300 8206 6731 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393971.1 protein_id gnl|my_center|LOCUS_03300 8895 8203 gene locus_tag LOCUS_03310 8895 8203 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272485.1 protein_id gnl|my_center|LOCUS_03310 10271 9015 gene locus_tag LOCUS_03320 10271 9015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 10913 10278 gene locus_tag LOCUS_03330 10913 10278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 11999 12763 gene locus_tag LOCUS_03340 11999 12763 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861569.1 protein_id gnl|my_center|LOCUS_03340 12908 13642 gene locus_tag LOCUS_03350 12908 13642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 14801 13695 gene locus_tag LOCUS_03360 gene ald 14801 13695 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243280.1 protein_id gnl|my_center|LOCUS_03360 15813 14911 gene locus_tag LOCUS_03370 gene lpxC 15813 14911 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940177.1 protein_id gnl|my_center|LOCUS_03370 16026 16208 gene locus_tag LOCUS_03380 16026 16208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 16486 17607 gene locus_tag LOCUS_03390 16486 17607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 18696 17668 gene locus_tag LOCUS_03400 gene ruvB 18696 17668 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691202.1 protein_id gnl|my_center|LOCUS_03400 19278 18700 gene locus_tag LOCUS_03410 gene ruvA 19278 18700 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947019.1 protein_id gnl|my_center|LOCUS_03410 19511 19750 gene locus_tag LOCUS_03420 19511 19750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 19890 21566 gene locus_tag LOCUS_03430 gene fadD 19890 21566 CDS product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169210.1 protein_id gnl|my_center|LOCUS_03430 22108 21608 gene locus_tag LOCUS_03440 gene ruvC 22108 21608 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933328.1 protein_id gnl|my_center|LOCUS_03440 22857 22105 gene locus_tag LOCUS_03450 22857 22105 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_03450 23064 23828 gene locus_tag LOCUS_03460 23064 23828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 23934 24500 gene locus_tag LOCUS_03470 gene efp 23934 24500 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_03470 24600 25646 gene locus_tag LOCUS_03480 24600 25646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 25643 29620 gene locus_tag LOCUS_03490 25643 29620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 29617 32391 gene locus_tag LOCUS_03500 29617 32391 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546673.1 protein_id gnl|my_center|LOCUS_03500 32532 32849 gene locus_tag LOCUS_03510 gene clpS 32532 32849 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072575.1 protein_id gnl|my_center|LOCUS_03510 32846 35077 gene locus_tag LOCUS_03520 gene clpA 32846 35077 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420182.1 protein_id gnl|my_center|LOCUS_03520 35242 36132 gene locus_tag LOCUS_03530 gene htpX 35242 36132 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264281.1 protein_id gnl|my_center|LOCUS_03530 36132 36617 gene locus_tag LOCUS_03540 36132 36617 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_03540 36751 37092 gene locus_tag LOCUS_03550 36751 37092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 38012 37182 gene locus_tag LOCUS_03560 38012 37182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 38551 39471 gene locus_tag LOCUS_03570 38551 39471 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359341.1 protein_id gnl|my_center|LOCUS_03570 40102 41418 gene locus_tag LOCUS_03580 40102 41418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 42249 41419 gene locus_tag LOCUS_03590 42249 41419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 42431 43381 gene locus_tag LOCUS_03600 42431 43381 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037668.1 protein_id gnl|my_center|LOCUS_03600 44335 43430 gene locus_tag LOCUS_03610 44335 43430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 45094 44483 gene locus_tag LOCUS_03620 45094 44483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 45468 45091 gene locus_tag LOCUS_03630 45468 45091 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_03630 46349 45465 gene locus_tag LOCUS_03640 46349 45465 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412005.1 protein_id gnl|my_center|LOCUS_03640 46634 47956 gene locus_tag LOCUS_03650 46634 47956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 49251 47953 gene locus_tag LOCUS_03660 49251 47953 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_03660 51424 49316 gene locus_tag LOCUS_03670 gene pnp 51424 49316 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_03670 51865 51596 gene locus_tag LOCUS_03680 gene rpsO 51865 51596 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006202929.1 protein_id gnl|my_center|LOCUS_03680 53034 51997 gene locus_tag LOCUS_03690 53034 51997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 53570 53190 gene locus_tag LOCUS_03700 gene rbfA 53570 53190 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428234.1 protein_id gnl|my_center|LOCUS_03700 56413 53570 gene locus_tag LOCUS_03710 56413 53570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 57968 56511 gene locus_tag LOCUS_03720 57968 56511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 58467 57979 gene locus_tag LOCUS_03730 gene rimP 58467 57979 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231915.1 protein_id gnl|my_center|LOCUS_03730 59193 58759 gene locus_tag LOCUS_03740 gene rimI 59193 58759 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370458.1 protein_id gnl|my_center|LOCUS_03740 59801 59193 gene locus_tag LOCUS_03750 59801 59193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 61557 60355 gene locus_tag LOCUS_03760 61557 60355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 61777 61863 gene locus_tag LOCUS_t00010 61777 61863 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 62150 62686 gene locus_tag LOCUS_03770 62150 62686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 63237 62734 gene locus_tag LOCUS_03780 63237 62734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 65885 63228 gene locus_tag LOCUS_03790 65885 63228 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_03790 66077 66493 gene locus_tag LOCUS_03800 gene mscL 66077 66493 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070864.1 protein_id gnl|my_center|LOCUS_03800 66631 66840 gene locus_tag LOCUS_03810 66631 66840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 67243 67722 gene locus_tag LOCUS_03820 67243 67722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 68768 67779 gene locus_tag LOCUS_03830 68768 67779 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245931.1 protein_id gnl|my_center|LOCUS_03830 69299 68877 gene locus_tag LOCUS_03840 69299 68877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 69408 69950 gene locus_tag LOCUS_03850 69408 69950 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117406.1 protein_id gnl|my_center|LOCUS_03850 70035 70661 gene locus_tag LOCUS_03860 70035 70661 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 protein_id gnl|my_center|LOCUS_03860 70921 71994 gene locus_tag LOCUS_03870 70921 71994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 72079 73068 gene locus_tag LOCUS_03880 72079 73068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 73377 73859 gene locus_tag LOCUS_03890 73377 73859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 73903 75135 gene locus_tag LOCUS_03900 73903 75135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 79445 75132 gene locus_tag LOCUS_03910 79445 75132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 80359 79460 gene locus_tag LOCUS_03920 80359 79460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 81097 80801 gene locus_tag LOCUS_03930 81097 80801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 82530 82048 gene locus_tag LOCUS_03940 82530 82048 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443925.1 protein_id gnl|my_center|LOCUS_03940 83606 83193 gene locus_tag LOCUS_03950 83606 83193 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396765.1 protein_id gnl|my_center|LOCUS_03950 83772 84347 gene locus_tag LOCUS_03960 gene sodB 83772 84347 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357051.1 protein_id gnl|my_center|LOCUS_03960 84429 84761 gene locus_tag LOCUS_03970 84429 84761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 85408 84830 gene locus_tag LOCUS_03980 85408 84830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 86326 85580 gene locus_tag LOCUS_03990 86326 85580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 87162 86323 gene locus_tag LOCUS_04000 87162 86323 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 protein_id gnl|my_center|LOCUS_04000 87304 88695 gene locus_tag LOCUS_04010 87304 88695 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707048.1 protein_id gnl|my_center|LOCUS_04010 88688 90022 gene locus_tag LOCUS_04020 88688 90022 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393050.1 protein_id gnl|my_center|LOCUS_04020 90283 91989 gene locus_tag LOCUS_04030 90283 91989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 92886 92041 gene locus_tag LOCUS_04040 92886 92041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 93118 93423 gene locus_tag LOCUS_04050 93118 93423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 >Feature sequence005 431 2212 gene locus_tag LOCUS_04060 431 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 2561 3703 gene locus_tag LOCUS_04070 2561 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 4357 3743 gene locus_tag LOCUS_04080 4357 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 5253 4864 gene locus_tag LOCUS_04090 5253 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 6391 5375 gene locus_tag LOCUS_04100 6391 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 8147 6768 gene locus_tag LOCUS_04110 8147 6768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 9060 8239 gene locus_tag LOCUS_04120 9060 8239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 9310 11661 gene locus_tag LOCUS_04130 gene mrcB 9310 11661 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707274.1 protein_id gnl|my_center|LOCUS_04130 11670 12080 gene locus_tag LOCUS_04140 11670 12080 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086294.1 protein_id gnl|my_center|LOCUS_04140 13358 12432 gene locus_tag LOCUS_04150 13358 12432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 14539 13550 gene locus_tag LOCUS_04160 14539 13550 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112591.1 protein_id gnl|my_center|LOCUS_04160 15015 14539 gene locus_tag LOCUS_04170 15015 14539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 15543 17387 gene locus_tag LOCUS_04180 15543 17387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 17398 18846 gene locus_tag LOCUS_04190 17398 18846 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_04190 19757 19242 gene locus_tag LOCUS_04200 19757 19242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 20341 20769 gene locus_tag LOCUS_04210 gene rplM 20341 20769 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016252.1 protein_id gnl|my_center|LOCUS_04210 20782 21171 gene locus_tag LOCUS_04220 gene rpsI 20782 21171 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390000.1 protein_id gnl|my_center|LOCUS_04220 21496 22740 gene locus_tag LOCUS_04230 21496 22740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 23678 22743 gene locus_tag LOCUS_04240 23678 22743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 24879 23989 gene locus_tag LOCUS_04250 24879 23989 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791421.1 protein_id gnl|my_center|LOCUS_04250 26148 25405 gene locus_tag LOCUS_04260 26148 25405 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354922.1 protein_id gnl|my_center|LOCUS_04260 26329 27192 gene locus_tag LOCUS_04270 26329 27192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 27698 27213 gene locus_tag LOCUS_04280 27698 27213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 28132 27902 gene locus_tag LOCUS_04290 28132 27902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 29706 28132 gene locus_tag LOCUS_04300 29706 28132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 31066 29870 gene locus_tag LOCUS_04310 31066 29870 CDS product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537819.1 protein_id gnl|my_center|LOCUS_04310 31641 31150 gene locus_tag LOCUS_04320 gene coaD 31641 31150 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704185.1 protein_id gnl|my_center|LOCUS_04320 32192 31641 gene locus_tag LOCUS_04330 gene rsmD 32192 31641 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_04330 32693 32271 gene locus_tag LOCUS_04340 32693 32271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 34167 32668 gene locus_tag LOCUS_04350 34167 32668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 34312 34130 gene locus_tag LOCUS_04360 34312 34130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 35955 34309 gene locus_tag LOCUS_04370 35955 34309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 36527 35952 gene locus_tag LOCUS_04380 36527 35952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 37449 36520 gene locus_tag LOCUS_04390 37449 36520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 38031 37612 gene locus_tag LOCUS_04400 38031 37612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 38473 38045 gene locus_tag LOCUS_04410 gene fliS 38473 38045 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943663.1 protein_id gnl|my_center|LOCUS_04410 39855 38497 gene locus_tag LOCUS_04420 39855 38497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 40212 41930 gene locus_tag LOCUS_04430 gene msbA 40212 41930 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_04430 41872 42507 gene locus_tag LOCUS_04440 gene yqiA 41872 42507 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262650.1 protein_id gnl|my_center|LOCUS_04440 42919 42536 gene locus_tag LOCUS_04450 42919 42536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 43928 43092 gene locus_tag LOCUS_04460 43928 43092 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_04460 44375 45073 gene locus_tag LOCUS_04470 44375 45073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 45353 46186 gene locus_tag LOCUS_04480 45353 46186 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_04480 47012 46263 gene locus_tag LOCUS_04490 47012 46263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 47542 48369 gene locus_tag LOCUS_04500 47542 48369 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_04500 49580 49269 gene locus_tag LOCUS_04510 49580 49269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 49683 50435 gene locus_tag LOCUS_04520 gene truC 49683 50435 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456757.1 protein_id gnl|my_center|LOCUS_04520 50803 51966 gene locus_tag LOCUS_04530 50803 51966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 52762 52046 gene locus_tag LOCUS_04540 52762 52046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 53252 52764 gene locus_tag LOCUS_04550 gene rfaE2 53252 52764 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896999.1 protein_id gnl|my_center|LOCUS_04550 54154 53252 gene locus_tag LOCUS_04560 54154 53252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 54937 54182 gene locus_tag LOCUS_04570 54937 54182 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430913.1 protein_id gnl|my_center|LOCUS_04570 55826 54930 gene locus_tag LOCUS_04580 gene prmA 55826 54930 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903455.1 protein_id gnl|my_center|LOCUS_04580 56074 56628 gene locus_tag LOCUS_04590 56074 56628 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108825999.1 protein_id gnl|my_center|LOCUS_04590 56861 56730 gene locus_tag LOCUS_04600 56861 56730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 57774 57154 gene locus_tag LOCUS_04610 57774 57154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 59579 58140 gene locus_tag LOCUS_04620 59579 58140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 60441 59899 gene locus_tag LOCUS_04630 gene fliW 60441 59899 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510650.1 protein_id gnl|my_center|LOCUS_04630 60897 60667 gene locus_tag LOCUS_04640 gene csrA 60897 60667 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957970.1 protein_id gnl|my_center|LOCUS_04640 61981 60980 gene locus_tag LOCUS_04650 gene flgL 61981 60980 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460796.1 protein_id gnl|my_center|LOCUS_04650 63412 61985 gene locus_tag LOCUS_04660 gene flgK 63412 61985 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943669.1 protein_id gnl|my_center|LOCUS_04660 63953 63447 gene locus_tag LOCUS_04670 63953 63447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 64326 63997 gene locus_tag LOCUS_04680 64326 63997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 66098 64773 gene locus_tag LOCUS_04690 66098 64773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 67035 66376 gene locus_tag LOCUS_04700 67035 66376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 68249 67272 gene locus_tag LOCUS_04710 68249 67272 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_04710 69067 68333 gene locus_tag LOCUS_04720 69067 68333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 70020 69064 gene locus_tag LOCUS_04730 70020 69064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 70803 70024 gene locus_tag LOCUS_04740 gene flgG 70803 70024 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_04740 71622 70813 gene locus_tag LOCUS_04750 gene flgF 71622 70813 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671871.1 protein_id gnl|my_center|LOCUS_04750 72139 73020 gene locus_tag LOCUS_04760 72139 73020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 73170 73640 gene locus_tag LOCUS_04770 73170 73640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 73743 74912 gene locus_tag LOCUS_04780 73743 74912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 75204 76079 gene locus_tag LOCUS_04790 75204 76079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 77258 76146 gene locus_tag LOCUS_04800 gene recA 77258 76146 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947527.1 protein_id gnl|my_center|LOCUS_04800 77886 77398 gene locus_tag LOCUS_04810 77886 77398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 78516 79784 gene locus_tag LOCUS_04820 78516 79784 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_04820 79993 80460 gene locus_tag LOCUS_04830 gene recX 79993 80460 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703240.1 protein_id gnl|my_center|LOCUS_04830 80644 81285 gene locus_tag LOCUS_04840 80644 81285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 81282 82277 gene locus_tag LOCUS_04850 gene mutY 81282 82277 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303166.1 protein_id gnl|my_center|LOCUS_04850 82208 83293 gene locus_tag LOCUS_04860 82208 83293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 83357 83887 gene locus_tag LOCUS_04870 83357 83887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 84769 83891 gene locus_tag LOCUS_04880 84769 83891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 85088 84732 gene locus_tag LOCUS_04890 85088 84732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 86920 85337 gene locus_tag LOCUS_04900 86920 85337 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667199.1 protein_id gnl|my_center|LOCUS_04900 87745 86936 gene locus_tag LOCUS_04910 87745 86936 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808075.1 protein_id gnl|my_center|LOCUS_04910 87844 89052 gene locus_tag LOCUS_04920 87844 89052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 89690 89049 gene locus_tag LOCUS_04930 89690 89049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 89849 90721 gene locus_tag LOCUS_04940 89849 90721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 90743 91558 gene locus_tag LOCUS_04950 90743 91558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 91759 92892 gene locus_tag LOCUS_04960 gene citZ 91759 92892 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 protein_id gnl|my_center|LOCUS_04960 >Feature sequence006 929 45 gene locus_tag LOCUS_04970 gene xerD 929 45 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439987.1 protein_id gnl|my_center|LOCUS_04970 2072 1221 gene locus_tag LOCUS_04980 2072 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 2417 2956 gene locus_tag LOCUS_04990 2417 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 3781 2969 gene locus_tag LOCUS_05000 3781 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 4277 5227 gene locus_tag LOCUS_05010 4277 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 7298 5208 gene locus_tag LOCUS_05020 7298 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 8606 7299 gene locus_tag LOCUS_05030 8606 7299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 9513 8596 gene locus_tag LOCUS_05040 9513 8596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 11396 9639 gene locus_tag LOCUS_05050 11396 9639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 12063 11890 gene locus_tag LOCUS_05060 12063 11890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 12291 12794 gene locus_tag LOCUS_05070 12291 12794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 13039 13125 gene locus_tag LOCUS_t00020 13039 13125 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13754 13152 gene locus_tag LOCUS_05080 13754 13152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 15879 13906 gene locus_tag LOCUS_05090 15879 13906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 17399 16134 gene locus_tag LOCUS_05100 17399 16134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 17583 17888 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19564 18437 gene locus_tag LOCUS_05110 gene dnaJ 19564 18437 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004170.1 protein_id gnl|my_center|LOCUS_05110 19728 20741 gene locus_tag LOCUS_05120 19728 20741 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940158.1 protein_id gnl|my_center|LOCUS_05120 20738 21409 gene locus_tag LOCUS_05130 20738 21409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 21433 22752 gene locus_tag LOCUS_05140 21433 22752 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002878575.1 protein_id gnl|my_center|LOCUS_05140 23915 22755 gene locus_tag LOCUS_05150 gene pseC 23915 22755 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867760.1 protein_id gnl|my_center|LOCUS_05150 24941 23916 gene locus_tag LOCUS_05160 gene pseB 24941 23916 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163498402.1 protein_id gnl|my_center|LOCUS_05160 24987 25790 gene locus_tag LOCUS_05170 gene pseF 24987 25790 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097862.1 protein_id gnl|my_center|LOCUS_05170 27201 25771 gene locus_tag LOCUS_05180 27201 25771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 28033 27266 gene locus_tag LOCUS_05190 28033 27266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 28869 28030 gene locus_tag LOCUS_05200 28869 28030 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963402.1 protein_id gnl|my_center|LOCUS_05200 29808 28960 gene locus_tag LOCUS_05210 29808 28960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 30476 29805 gene locus_tag LOCUS_05220 gene yieH 30476 29805 CDS product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703909.1 protein_id gnl|my_center|LOCUS_05220 31513 30473 gene locus_tag LOCUS_05230 gene pseI 31513 30473 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920708.1 protein_id gnl|my_center|LOCUS_05230 32117 31515 gene locus_tag LOCUS_05240 32117 31515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 32869 32114 gene locus_tag LOCUS_05250 32869 32114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 33773 32952 gene locus_tag LOCUS_05260 33773 32952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 34112 33780 gene locus_tag LOCUS_05270 34112 33780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 34801 34109 gene locus_tag LOCUS_05280 34801 34109 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776105.1 protein_id gnl|my_center|LOCUS_05280 35743 35000 gene locus_tag LOCUS_05290 35743 35000 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922089.1 protein_id gnl|my_center|LOCUS_05290 38303 38920 gene locus_tag LOCUS_05300 38303 38920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 39914 40606 gene locus_tag LOCUS_05310 39914 40606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 41347 40610 gene locus_tag LOCUS_05320 41347 40610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 41940 41404 gene locus_tag LOCUS_05330 41940 41404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 43581 42172 gene locus_tag LOCUS_05340 43581 42172 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_05340 45207 43597 gene locus_tag LOCUS_05350 45207 43597 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_05350 46409 45204 gene locus_tag LOCUS_05360 46409 45204 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_05360 47479 46409 gene locus_tag LOCUS_05370 47479 46409 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_05370 49183 47483 gene locus_tag LOCUS_05380 gene pilB 49183 47483 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_05380 50101 49262 gene locus_tag LOCUS_05390 50101 49262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 51023 50070 gene locus_tag LOCUS_05400 51023 50070 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942133.1 protein_id gnl|my_center|LOCUS_05400 51760 51065 gene locus_tag LOCUS_05410 51760 51065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 52950 51877 gene locus_tag LOCUS_05420 52950 51877 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880036.1 protein_id gnl|my_center|LOCUS_05420 54037 52982 gene locus_tag LOCUS_05430 54037 52982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 55419 54235 gene locus_tag LOCUS_05440 55419 54235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 56303 55428 gene locus_tag LOCUS_05450 56303 55428 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948625.1 protein_id gnl|my_center|LOCUS_05450 57294 56275 gene locus_tag LOCUS_05460 gene lpxK 57294 56275 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626176.1 protein_id gnl|my_center|LOCUS_05460 58445 57291 gene locus_tag LOCUS_05470 gene lpxB 58445 57291 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_05470 59382 58435 gene locus_tag LOCUS_05480 59382 58435 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947102.1 protein_id gnl|my_center|LOCUS_05480 60158 59379 gene locus_tag LOCUS_05490 gene lpxA 60158 59379 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095662.1 protein_id gnl|my_center|LOCUS_05490 60668 60171 gene locus_tag LOCUS_05500 gene fabZ 60668 60171 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942905.1 protein_id gnl|my_center|LOCUS_05500 61285 60770 gene locus_tag LOCUS_05510 61285 60770 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554721.1 protein_id gnl|my_center|LOCUS_05510 63654 61303 gene locus_tag LOCUS_05520 gene bamA 63654 61303 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_05520 64493 63786 gene locus_tag LOCUS_05530 64493 63786 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962793.1 protein_id gnl|my_center|LOCUS_05530 65688 64486 gene locus_tag LOCUS_05540 65688 64486 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939648.1 protein_id gnl|my_center|LOCUS_05540 66679 65681 gene locus_tag LOCUS_05550 gene prfB 66679 65681 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989230.1 protein_id gnl|my_center|LOCUS_05550 67941 66925 gene locus_tag LOCUS_05560 67941 66925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 69932 67995 gene locus_tag LOCUS_05570 69932 67995 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103757.1 protein_id gnl|my_center|LOCUS_05570 70651 70992 gene locus_tag LOCUS_05580 70651 70992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 71099 72583 gene locus_tag LOCUS_05590 71099 72583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 73572 72580 gene locus_tag LOCUS_05600 73572 72580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 74986 73574 gene locus_tag LOCUS_05610 74986 73574 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927109.1 protein_id gnl|my_center|LOCUS_05610 76282 75218 gene locus_tag LOCUS_05620 76282 75218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 76447 77313 gene locus_tag LOCUS_05630 76447 77313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 77378 78382 gene locus_tag LOCUS_05640 77378 78382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 79217 78363 gene locus_tag LOCUS_05650 79217 78363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 80202 79210 gene locus_tag LOCUS_05660 80202 79210 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966336.1 protein_id gnl|my_center|LOCUS_05660 81490 80195 gene locus_tag LOCUS_05670 81490 80195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 82998 81487 gene locus_tag LOCUS_05680 82998 81487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 83750 82995 gene locus_tag LOCUS_05690 83750 82995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 84651 83755 gene locus_tag LOCUS_05700 gene gldA 84651 83755 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_05700 85962 84700 gene locus_tag LOCUS_05710 85962 84700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 86260 86940 gene locus_tag LOCUS_05720 86260 86940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 >Feature sequence007 634 389 gene locus_tag LOCUS_05730 634 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 763 1068 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4718 1116 gene locus_tag LOCUS_05740 gene smc 4718 1116 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941791.1 protein_id gnl|my_center|LOCUS_05740 7382 4728 gene locus_tag LOCUS_05750 gene ppdK 7382 4728 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_05750 8726 7395 gene locus_tag LOCUS_05760 8726 7395 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_05760 8906 9286 gene locus_tag LOCUS_05770 8906 9286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 10586 9312 gene locus_tag LOCUS_05780 10586 9312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 10986 12530 gene locus_tag LOCUS_05790 10986 12530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 13200 12547 gene locus_tag LOCUS_05800 13200 12547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 13948 13211 gene locus_tag LOCUS_05810 13948 13211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 14730 13909 gene locus_tag LOCUS_05820 14730 13909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 14931 17465 gene locus_tag LOCUS_05830 14931 17465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 17591 18241 gene locus_tag LOCUS_05840 17591 18241 CDS product glutathione binding-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974611.1 protein_id gnl|my_center|LOCUS_05840 19928 19134 gene locus_tag LOCUS_05850 19928 19134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 20558 20995 gene locus_tag LOCUS_05860 20558 20995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 21197 23395 gene locus_tag LOCUS_05870 21197 23395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 24623 23466 gene locus_tag LOCUS_05880 24623 23466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 26502 24853 gene locus_tag LOCUS_05890 26502 24853 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941675.1 protein_id gnl|my_center|LOCUS_05890 28551 26662 gene locus_tag LOCUS_05900 28551 26662 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099968.1 protein_id gnl|my_center|LOCUS_05900 29281 28535 gene locus_tag LOCUS_05910 29281 28535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 30345 29278 gene locus_tag LOCUS_05920 30345 29278 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_05920 31346 30345 gene locus_tag LOCUS_05930 31346 30345 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_05930 32389 31346 gene locus_tag LOCUS_05940 32389 31346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 33260 32382 gene locus_tag LOCUS_05950 33260 32382 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_05950 34249 33257 gene locus_tag LOCUS_05960 34249 33257 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_05960 34433 35260 gene locus_tag LOCUS_05970 34433 35260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 35278 35526 gene locus_tag LOCUS_05980 35278 35526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 35536 36906 gene locus_tag LOCUS_05990 35536 36906 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_05990 37078 37728 gene locus_tag LOCUS_06000 37078 37728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 38012 38302 gene locus_tag LOCUS_06010 gene spoVG 38012 38302 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832195.1 protein_id gnl|my_center|LOCUS_06010 38376 38450 gene locus_tag LOCUS_t00030 38376 38450 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 41340 39154 gene locus_tag LOCUS_06020 gene katG 41340 39154 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942744.1 protein_id gnl|my_center|LOCUS_06020 42486 41605 gene locus_tag LOCUS_06030 gene rimK 42486 41605 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946163.1 protein_id gnl|my_center|LOCUS_06030 43089 42511 gene locus_tag LOCUS_06040 43089 42511 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025312.1 protein_id gnl|my_center|LOCUS_06040 43478 44818 gene locus_tag LOCUS_06050 gene hemN 43478 44818 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853363.1 protein_id gnl|my_center|LOCUS_06050 46446 44827 gene locus_tag LOCUS_06060 gene ycjM 46446 44827 CDS product glucosylglycerate phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602336.1 protein_id gnl|my_center|LOCUS_06060 47659 46433 gene locus_tag LOCUS_06070 47659 46433 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004069588.1 protein_id gnl|my_center|LOCUS_06070 47660 49264 gene locus_tag LOCUS_06080 47660 49264 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121424.1 protein_id gnl|my_center|LOCUS_06080 50370 49294 gene locus_tag LOCUS_06090 gene dinB 50370 49294 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086018.1 protein_id gnl|my_center|LOCUS_06090 52854 51235 gene locus_tag LOCUS_06100 52854 51235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 53575 52865 gene locus_tag LOCUS_06110 53575 52865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 53760 54428 gene locus_tag LOCUS_06120 53760 54428 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966925.1 protein_id gnl|my_center|LOCUS_06120 54947 54594 gene locus_tag LOCUS_06130 54947 54594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 56162 55035 gene locus_tag LOCUS_06140 56162 55035 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070593.1 protein_id gnl|my_center|LOCUS_06140 57769 56393 gene locus_tag LOCUS_06150 57769 56393 CDS product M17 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533676.1 protein_id gnl|my_center|LOCUS_06150 58021 59454 gene locus_tag LOCUS_06160 58021 59454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 61519 59489 gene locus_tag LOCUS_06170 61519 59489 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891905.1 protein_id gnl|my_center|LOCUS_06170 62231 61587 gene locus_tag LOCUS_06180 62231 61587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 63041 62430 gene locus_tag LOCUS_06190 gene pyrE 63041 62430 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475979.1 protein_id gnl|my_center|LOCUS_06190 63725 63042 gene locus_tag LOCUS_06200 gene pyrF 63725 63042 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083510.1 protein_id gnl|my_center|LOCUS_06200 66976 63734 gene locus_tag LOCUS_06210 gene carB 66976 63734 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126101.1 protein_id gnl|my_center|LOCUS_06210 68057 66969 gene locus_tag LOCUS_06220 68057 66969 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828679.1 protein_id gnl|my_center|LOCUS_06220 68983 68054 gene locus_tag LOCUS_06230 68983 68054 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245123.1 protein_id gnl|my_center|LOCUS_06230 69475 69041 gene locus_tag LOCUS_06240 69475 69041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 69945 70430 gene locus_tag LOCUS_06250 69945 70430 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736521.1 protein_id gnl|my_center|LOCUS_06250 70449 71387 gene locus_tag LOCUS_06260 70449 71387 CDS product S-adenosylmethionine decarboxylase SpeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071983.1 protein_id gnl|my_center|LOCUS_06260 71395 72249 gene locus_tag LOCUS_06270 gene speE 71395 72249 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_06270 72393 74291 gene locus_tag LOCUS_06280 gene htpG 72393 74291 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943026.1 protein_id gnl|my_center|LOCUS_06280 78496 74330 gene locus_tag LOCUS_06290 78496 74330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 82088 78528 gene locus_tag LOCUS_06300 82088 78528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 82286 82134 gene locus_tag LOCUS_06310 82286 82134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 >Feature sequence008 200 2341 gene locus_tag LOCUS_06320 200 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 2361 3287 gene locus_tag LOCUS_06330 2361 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 4116 3541 gene locus_tag LOCUS_06340 4116 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 5416 4223 gene locus_tag LOCUS_06350 5416 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 5470 5970 gene locus_tag LOCUS_06360 5470 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 6075 6563 gene locus_tag LOCUS_06370 6075 6563 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_06370 7375 6566 gene locus_tag LOCUS_06380 7375 6566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 9111 7438 gene locus_tag LOCUS_06390 gene ettA 9111 7438 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_06390 9274 9489 gene locus_tag LOCUS_06400 9274 9489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 9499 9810 gene locus_tag LOCUS_06410 gene bolA 9499 9810 CDS product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261442.1 protein_id gnl|my_center|LOCUS_06410 9884 11959 gene locus_tag LOCUS_06420 9884 11959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 12578 11964 gene locus_tag LOCUS_06430 12578 11964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 13585 12791 gene locus_tag LOCUS_06440 13585 12791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 15755 13722 gene locus_tag LOCUS_06450 gene rep 15755 13722 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455214.1 protein_id gnl|my_center|LOCUS_06450 16996 16217 gene locus_tag LOCUS_06460 16996 16217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 17427 17002 gene locus_tag LOCUS_06470 17427 17002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 18473 17559 gene locus_tag LOCUS_06480 18473 17559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 18587 19057 gene locus_tag LOCUS_06490 18587 19057 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110309.1 protein_id gnl|my_center|LOCUS_06490 19054 20094 gene locus_tag LOCUS_06500 gene dusC 19054 20094 CDS product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706065.1 protein_id gnl|my_center|LOCUS_06500 20139 21962 gene locus_tag LOCUS_06510 20139 21962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 22011 22265 gene locus_tag LOCUS_06520 gene grxC 22011 22265 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114715.1 protein_id gnl|my_center|LOCUS_06520 23480 22281 gene locus_tag LOCUS_06530 23480 22281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 23608 24021 gene locus_tag LOCUS_06540 gene cheY 23608 24021 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005996243.1 protein_id gnl|my_center|LOCUS_06540 24042 24926 gene locus_tag LOCUS_06550 24042 24926 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193057.1 protein_id gnl|my_center|LOCUS_06550 24930 26126 gene locus_tag LOCUS_06560 24930 26126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 27845 26199 gene locus_tag LOCUS_06570 27845 26199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 28185 28892 gene locus_tag LOCUS_06580 gene phoB 28185 28892 CDS product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208685.1 protein_id gnl|my_center|LOCUS_06580 28913 29188 gene locus_tag LOCUS_06590 28913 29188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 29275 29199 gene locus_tag LOCUS_t00040 29275 29199 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 30020 29382 gene locus_tag LOCUS_06600 30020 29382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 31015 30083 gene locus_tag LOCUS_06610 31015 30083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 32268 31063 gene locus_tag LOCUS_06620 32268 31063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 35699 32235 gene locus_tag LOCUS_06630 gene dnaE 35699 32235 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_06630 35837 37384 gene locus_tag LOCUS_06640 gene guaA 35837 37384 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439265.1 protein_id gnl|my_center|LOCUS_06640 37536 38363 gene locus_tag LOCUS_06650 37536 38363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 39206 38364 gene locus_tag LOCUS_06660 39206 38364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 39535 39194 gene locus_tag LOCUS_06670 39535 39194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 40159 39539 gene locus_tag LOCUS_06680 40159 39539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 40273 41148 gene locus_tag LOCUS_06690 40273 41148 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114721.1 protein_id gnl|my_center|LOCUS_06690 41722 41141 gene locus_tag LOCUS_06700 41722 41141 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137608.1 protein_id gnl|my_center|LOCUS_06700 41870 42886 gene locus_tag LOCUS_06710 41870 42886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 42996 43979 gene locus_tag LOCUS_06720 42996 43979 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983101.1 protein_id gnl|my_center|LOCUS_06720 44823 43981 gene locus_tag LOCUS_06730 44823 43981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 46041 45046 gene locus_tag LOCUS_06740 46041 45046 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475978.1 protein_id gnl|my_center|LOCUS_06740 48108 46045 gene locus_tag LOCUS_06750 48108 46045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 48230 49150 gene locus_tag LOCUS_06760 gene gshB 48230 49150 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482451.1 protein_id gnl|my_center|LOCUS_06760 49238 50152 gene locus_tag LOCUS_06770 49238 50152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 50951 50163 gene locus_tag LOCUS_06780 50951 50163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 51754 50948 gene locus_tag LOCUS_06790 51754 50948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 53866 51755 gene locus_tag LOCUS_06800 gene metG 53866 51755 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694519.1 protein_id gnl|my_center|LOCUS_06800 54687 54085 gene locus_tag LOCUS_06810 gene pdxH 54687 54085 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403320.1 protein_id gnl|my_center|LOCUS_06810 54872 55426 gene locus_tag LOCUS_06820 54872 55426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 55723 55565 gene locus_tag LOCUS_06830 55723 55565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 56444 56220 gene locus_tag LOCUS_06840 56444 56220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 57243 56632 gene locus_tag LOCUS_06850 gene rnhB 57243 56632 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113866.1 protein_id gnl|my_center|LOCUS_06850 58490 57240 gene locus_tag LOCUS_06860 58490 57240 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228728.1 protein_id gnl|my_center|LOCUS_06860 59347 58487 gene locus_tag LOCUS_06870 59347 58487 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920726.1 protein_id gnl|my_center|LOCUS_06870 59879 60238 gene locus_tag LOCUS_06880 59879 60238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 60406 60702 gene locus_tag LOCUS_06890 60406 60702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 60706 61341 gene locus_tag LOCUS_06900 60706 61341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 61731 61327 gene locus_tag LOCUS_06910 61731 61327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 62363 61734 gene locus_tag LOCUS_06920 gene rpsD 62363 61734 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124564.1 protein_id gnl|my_center|LOCUS_06920 65652 62659 gene locus_tag LOCUS_06930 65652 62659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 66198 65872 gene locus_tag LOCUS_06940 66198 65872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 66701 66327 gene locus_tag LOCUS_06950 gene rplS 66701 66327 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893806.1 protein_id gnl|my_center|LOCUS_06950 67538 66762 gene locus_tag LOCUS_06960 gene trmD 67538 66762 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417802.1 protein_id gnl|my_center|LOCUS_06960 68111 67542 gene locus_tag LOCUS_06970 gene rimM 68111 67542 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699991.1 protein_id gnl|my_center|LOCUS_06970 68387 70045 gene locus_tag LOCUS_06980 68387 70045 CDS product protease-like activity factor CPAF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872247.1 protein_id gnl|my_center|LOCUS_06980 71551 70268 gene locus_tag LOCUS_06990 71551 70268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 71912 73528 gene locus_tag LOCUS_07000 71912 73528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 75010 73553 gene locus_tag LOCUS_07010 gene thiI 75010 73553 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762723.1 protein_id gnl|my_center|LOCUS_07010 76420 75110 gene locus_tag LOCUS_07020 76420 75110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 77752 76625 gene locus_tag LOCUS_07030 77752 76625 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405909.1 protein_id gnl|my_center|LOCUS_07030 78691 77786 gene locus_tag LOCUS_07040 gene prpB 78691 77786 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112517.1 protein_id gnl|my_center|LOCUS_07040 <79197 78691 gene locus_tag LOCUS_07050 <79197 78691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005112515.1:MmgE/PrpD family protein >Feature sequence009 1435 674 gene locus_tag LOCUS_07060 1435 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 2517 1594 gene locus_tag LOCUS_07070 2517 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 3302 2514 gene locus_tag LOCUS_07080 3302 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 4089 3292 gene locus_tag LOCUS_07090 4089 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 4227 4469 gene locus_tag LOCUS_07100 4227 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 4381 4755 gene locus_tag LOCUS_07110 4381 4755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 4764 5972 gene locus_tag LOCUS_07120 4764 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 6908 6000 gene locus_tag LOCUS_07130 gene metF 6908 6000 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933036.1 protein_id gnl|my_center|LOCUS_07130 7109 11131 gene locus_tag LOCUS_07140 7109 11131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 11128 11868 gene locus_tag LOCUS_07150 11128 11868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 13643 11862 gene locus_tag LOCUS_07160 13643 11862 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649895.1 protein_id gnl|my_center|LOCUS_07160 15485 13683 gene locus_tag LOCUS_07170 15485 13683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 15611 16222 gene locus_tag LOCUS_07180 gene coaE 15611 16222 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 protein_id gnl|my_center|LOCUS_07180 16829 16194 gene locus_tag LOCUS_07190 16829 16194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 16901 18001 gene locus_tag LOCUS_07200 16901 18001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 18357 19769 gene locus_tag LOCUS_07210 18357 19769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 20863 19766 gene locus_tag LOCUS_07220 20863 19766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 21038 21802 gene locus_tag LOCUS_07230 21038 21802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 21811 22932 gene locus_tag LOCUS_07240 21811 22932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 22988 25738 gene locus_tag LOCUS_07250 22988 25738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 25711 28764 gene locus_tag LOCUS_07260 25711 28764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 28855 29394 gene locus_tag LOCUS_07270 28855 29394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 29395 30228 gene locus_tag LOCUS_07280 29395 30228 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_07280 30252 30827 gene locus_tag LOCUS_07290 30252 30827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 32409 30820 gene locus_tag LOCUS_07300 gene nadB 32409 30820 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_07300 32593 34935 gene locus_tag LOCUS_07310 32593 34935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 34942 36459 gene locus_tag LOCUS_07320 34942 36459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 36475 37617 gene locus_tag LOCUS_07330 gene alr 36475 37617 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396112.1 protein_id gnl|my_center|LOCUS_07330 37589 38383 gene locus_tag LOCUS_07340 37589 38383 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545987.1 protein_id gnl|my_center|LOCUS_07340 38380 39132 gene locus_tag LOCUS_07350 38380 39132 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_07350 39129 40511 gene locus_tag LOCUS_07360 39129 40511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 40620 42434 gene locus_tag LOCUS_07370 40620 42434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 42431 43138 gene locus_tag LOCUS_07380 42431 43138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 43141 44040 gene locus_tag LOCUS_07390 gene ilvE 43141 44040 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528161.1 protein_id gnl|my_center|LOCUS_07390 44030 45199 gene locus_tag LOCUS_07400 44030 45199 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812701.1 protein_id gnl|my_center|LOCUS_07400 45192 45686 gene locus_tag LOCUS_07410 45192 45686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 45874 48201 gene locus_tag LOCUS_07420 45874 48201 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444460.1 protein_id gnl|my_center|LOCUS_07420 48205 48750 gene locus_tag LOCUS_07430 48205 48750 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933033.1 protein_id gnl|my_center|LOCUS_07430 48754 49491 gene locus_tag LOCUS_07440 48754 49491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 49928 49488 gene locus_tag LOCUS_07450 49928 49488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 50345 51196 gene locus_tag LOCUS_07460 50345 51196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 51300 52292 gene locus_tag LOCUS_07470 51300 52292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 52327 53049 gene locus_tag LOCUS_07480 52327 53049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 53069 53620 gene locus_tag LOCUS_07490 53069 53620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 53623 54129 gene locus_tag LOCUS_07500 53623 54129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 54129 57104 gene locus_tag LOCUS_07510 54129 57104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 57101 57994 gene locus_tag LOCUS_07520 57101 57994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 58004 58252 gene locus_tag LOCUS_07530 58004 58252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 58257 59696 gene locus_tag LOCUS_07540 58257 59696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 59774 60631 gene locus_tag LOCUS_07550 59774 60631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 60628 63117 gene locus_tag LOCUS_07560 60628 63117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 63129 63755 gene locus_tag LOCUS_07570 63129 63755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 64255 63818 gene locus_tag LOCUS_07580 64255 63818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 65887 64385 gene locus_tag LOCUS_07590 65887 64385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 67400 65988 gene locus_tag LOCUS_07600 67400 65988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 68273 67647 gene locus_tag LOCUS_07610 68273 67647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 68817 69344 gene locus_tag LOCUS_07620 68817 69344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 69341 71035 gene locus_tag LOCUS_07630 69341 71035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 71048 71527 gene locus_tag LOCUS_07640 gene nuoE 71048 71527 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540773.1 protein_id gnl|my_center|LOCUS_07640 71535 72824 gene locus_tag LOCUS_07650 gene nuoF 71535 72824 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829484.1 protein_id gnl|my_center|LOCUS_07650 73110 73415 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence010 171 96 gene locus_tag LOCUS_t00050 171 96 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 756 223 gene locus_tag LOCUS_07660 756 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 1947 778 gene locus_tag LOCUS_07670 1947 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 2201 3451 gene locus_tag LOCUS_07680 gene gshA 2201 3451 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947573.1 protein_id gnl|my_center|LOCUS_07680 3998 3429 gene locus_tag LOCUS_07690 3998 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 4488 6212 gene locus_tag LOCUS_07700 4488 6212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 6463 6765 gene locus_tag LOCUS_07710 6463 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 8352 6856 gene locus_tag LOCUS_07720 8352 6856 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191270.1 protein_id gnl|my_center|LOCUS_07720 8933 9535 gene locus_tag LOCUS_07730 gene clpP 8933 9535 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880859.1 protein_id gnl|my_center|LOCUS_07730 10292 10606 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11219 13714 gene locus_tag LOCUS_07740 gene lon 11219 13714 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071918.1 protein_id gnl|my_center|LOCUS_07740 14232 15755 gene locus_tag LOCUS_07750 14232 15755 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267230.1 protein_id gnl|my_center|LOCUS_07750 16537 15800 gene locus_tag LOCUS_07760 16537 15800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 16926 16552 gene locus_tag LOCUS_07770 16926 16552 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861394.1 protein_id gnl|my_center|LOCUS_07770 18081 16933 gene locus_tag LOCUS_07780 18081 16933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 19161 18085 gene locus_tag LOCUS_07790 19161 18085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 19997 19146 gene locus_tag LOCUS_07800 19997 19146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 20296 21594 gene locus_tag LOCUS_07810 gene tig 20296 21594 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942437.1 protein_id gnl|my_center|LOCUS_07810 21869 22480 gene locus_tag LOCUS_07820 21869 22480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 23925 22561 gene locus_tag LOCUS_07830 23925 22561 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_07830 25034 23922 gene locus_tag LOCUS_07840 25034 23922 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305385.1 protein_id gnl|my_center|LOCUS_07840 25956 25039 gene locus_tag LOCUS_07850 gene ftsX 25956 25039 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005660149.1 protein_id gnl|my_center|LOCUS_07850 26612 25953 gene locus_tag LOCUS_07860 gene ftsE 26612 25953 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173889.1 protein_id gnl|my_center|LOCUS_07860 26886 26632 gene locus_tag LOCUS_07870 26886 26632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 28553 27129 gene locus_tag LOCUS_07880 28553 27129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 28841 30619 gene locus_tag LOCUS_07890 28841 30619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 30610 31254 gene locus_tag LOCUS_07900 30610 31254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 31802 31251 gene locus_tag LOCUS_07910 31802 31251 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337318.1 protein_id gnl|my_center|LOCUS_07910 33031 31811 gene locus_tag LOCUS_07920 33031 31811 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964478.1 protein_id gnl|my_center|LOCUS_07920 34223 33021 gene locus_tag LOCUS_07930 gene sufD 34223 33021 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211806.1 protein_id gnl|my_center|LOCUS_07930 34984 34232 gene locus_tag LOCUS_07940 gene sufC 34984 34232 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946339.1 protein_id gnl|my_center|LOCUS_07940 35409 35002 gene locus_tag LOCUS_07950 35409 35002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 35504 35819 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37264 36791 gene locus_tag LOCUS_07960 37264 36791 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037893.1 protein_id gnl|my_center|LOCUS_07960 37742 38491 gene locus_tag LOCUS_07970 37742 38491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 38742 39470 gene locus_tag LOCUS_07980 gene tolQ 38742 39470 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_07980 39480 39893 gene locus_tag LOCUS_07990 gene tolR 39480 39893 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_07990 39896 40639 gene locus_tag LOCUS_08000 39896 40639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 40651 42045 gene locus_tag LOCUS_08010 gene tolB 40651 42045 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932320.1 protein_id gnl|my_center|LOCUS_08010 42047 44461 gene locus_tag LOCUS_08020 gene glnE 42047 44461 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640211.1 protein_id gnl|my_center|LOCUS_08020 44546 45214 gene locus_tag LOCUS_08030 gene lirB 44546 45214 CDS product type IV secretion system effector LirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947678.1 protein_id gnl|my_center|LOCUS_08030 45598 50784 gene locus_tag LOCUS_08040 45598 50784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 51342 52163 gene locus_tag LOCUS_08050 51342 52163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 52756 52244 gene locus_tag LOCUS_08060 52756 52244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 54107 52746 gene locus_tag LOCUS_08070 54107 52746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 54707 55279 gene locus_tag LOCUS_08080 54707 55279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 56092 55385 gene locus_tag LOCUS_08090 gene motD 56092 55385 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947506.1 protein_id gnl|my_center|LOCUS_08090 56843 56085 gene locus_tag LOCUS_08100 56843 56085 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081357594.1 protein_id gnl|my_center|LOCUS_08100 58107 57127 gene locus_tag LOCUS_08110 58107 57127 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103017237.1 protein_id gnl|my_center|LOCUS_08110 58919 58104 gene locus_tag LOCUS_08120 58919 58104 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545091.1 protein_id gnl|my_center|LOCUS_08120 59848 58940 gene locus_tag LOCUS_08130 59848 58940 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256056.1 protein_id gnl|my_center|LOCUS_08130 61638 59848 gene locus_tag LOCUS_08140 gene typA 61638 59848 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941168.1 protein_id gnl|my_center|LOCUS_08140 62535 61810 gene locus_tag LOCUS_08150 62535 61810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 63557 62532 gene locus_tag LOCUS_08160 gene dusB 63557 62532 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941670.1 protein_id gnl|my_center|LOCUS_08160 64326 63763 gene locus_tag LOCUS_08170 64326 63763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 64844 64398 gene locus_tag LOCUS_08180 64844 64398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 65395 64865 gene locus_tag LOCUS_08190 65395 64865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 67355 65478 gene locus_tag LOCUS_08200 67355 65478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 69150 67348 gene locus_tag LOCUS_08210 69150 67348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 69553 69275 gene locus_tag LOCUS_08220 69553 69275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 69556 70515 gene locus_tag LOCUS_08230 69556 70515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 71331 70690 gene locus_tag LOCUS_08240 71331 70690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence011 1196 1564 gene locus_tag LOCUS_08250 1196 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 2029 4719 gene locus_tag LOCUS_08260 2029 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 6630 4723 gene locus_tag LOCUS_08270 6630 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 7673 6816 gene locus_tag LOCUS_08280 7673 6816 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548604.1 protein_id gnl|my_center|LOCUS_08280 7861 8799 gene locus_tag LOCUS_08290 7861 8799 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463734.1 protein_id gnl|my_center|LOCUS_08290 10689 9205 gene locus_tag LOCUS_08300 10689 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 11290 10823 gene locus_tag LOCUS_08310 11290 10823 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889792.1 protein_id gnl|my_center|LOCUS_08310 12161 11259 gene locus_tag LOCUS_08320 12161 11259 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926799.1 protein_id gnl|my_center|LOCUS_08320 14452 12161 gene locus_tag LOCUS_08330 14452 12161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 15909 14467 gene locus_tag LOCUS_08340 gene gatB 15909 14467 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_08340 17362 15899 gene locus_tag LOCUS_08350 gene gatA 17362 15899 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772005.1 protein_id gnl|my_center|LOCUS_08350 17646 17362 gene locus_tag LOCUS_08360 gene gatC 17646 17362 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143272.1 protein_id gnl|my_center|LOCUS_08360 17819 19909 gene locus_tag LOCUS_08370 gene ligA 17819 19909 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443716.1 protein_id gnl|my_center|LOCUS_08370 20154 19960 gene locus_tag LOCUS_08380 20154 19960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 20428 21891 gene locus_tag LOCUS_08390 20428 21891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 22167 22346 gene locus_tag LOCUS_08400 22167 22346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 22521 22856 gene locus_tag LOCUS_08410 22521 22856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 22853 23542 gene locus_tag LOCUS_08420 22853 23542 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582696.1 protein_id gnl|my_center|LOCUS_08420 23940 25070 gene locus_tag LOCUS_08430 23940 25070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 27417 25030 gene locus_tag LOCUS_08440 27417 25030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 27977 27531 gene locus_tag LOCUS_08450 27977 27531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 28625 27981 gene locus_tag LOCUS_08460 gene fsa 28625 27981 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870474.1 protein_id gnl|my_center|LOCUS_08460 29194 28655 gene locus_tag LOCUS_08470 29194 28655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 29866 29204 gene locus_tag LOCUS_08480 gene dapB 29866 29204 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938900.1 protein_id gnl|my_center|LOCUS_08480 30739 29867 gene locus_tag LOCUS_08490 gene dapA 30739 29867 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564763.1 protein_id gnl|my_center|LOCUS_08490 31496 30741 gene locus_tag LOCUS_08500 gene dapF 31496 30741 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_08500 31705 31493 gene locus_tag LOCUS_08510 31705 31493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 32595 31711 gene locus_tag LOCUS_08520 32595 31711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 35603 32982 gene locus_tag LOCUS_08530 35603 32982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 36053 36445 gene locus_tag LOCUS_08540 36053 36445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 36669 36472 gene locus_tag LOCUS_08550 36669 36472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 38987 37551 gene locus_tag LOCUS_08560 38987 37551 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048440.1 protein_id gnl|my_center|LOCUS_08560 40293 39847 gene locus_tag LOCUS_08570 gene rplI 40293 39847 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_08570 41107 40271 gene locus_tag LOCUS_08580 41107 40271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 41613 41203 gene locus_tag LOCUS_08590 41613 41203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 42207 41950 gene locus_tag LOCUS_08600 42207 41950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 42478 42269 gene locus_tag LOCUS_08610 42478 42269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 42998 43711 gene locus_tag LOCUS_08620 42998 43711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 43704 44579 gene locus_tag LOCUS_08630 43704 44579 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245141.1 protein_id gnl|my_center|LOCUS_08630 44931 45230 gene locus_tag LOCUS_08640 44931 45230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 46970 45357 gene locus_tag LOCUS_08650 46970 45357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 47932 47687 gene locus_tag LOCUS_08660 47932 47687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 49327 48329 gene locus_tag LOCUS_08670 49327 48329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 53151 49528 gene locus_tag LOCUS_08680 53151 49528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 53610 54386 gene locus_tag LOCUS_08690 53610 54386 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_08690 54401 55363 gene locus_tag LOCUS_08700 54401 55363 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817156.1 protein_id gnl|my_center|LOCUS_08700 55631 56275 gene locus_tag LOCUS_08710 55631 56275 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392265.1 protein_id gnl|my_center|LOCUS_08710 56334 57149 gene locus_tag LOCUS_08720 56334 57149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 57151 58125 gene locus_tag LOCUS_08730 57151 58125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 58136 59074 gene locus_tag LOCUS_08740 58136 59074 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940693.1 protein_id gnl|my_center|LOCUS_08740 59075 60064 gene locus_tag LOCUS_08750 gene pdxA 59075 60064 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545509.1 protein_id gnl|my_center|LOCUS_08750 60075 61442 gene locus_tag LOCUS_08760 60075 61442 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544969.1 protein_id gnl|my_center|LOCUS_08760 63766 64078 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 64578 65420 gene locus_tag LOCUS_08770 64578 65420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 65510 65671 gene locus_tag LOCUS_08780 65510 65671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 66054 65746 gene locus_tag LOCUS_08790 66054 65746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 66775 66083 gene locus_tag LOCUS_08800 66775 66083 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_08800 67164 66778 gene locus_tag LOCUS_08810 67164 66778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 67378 67145 gene locus_tag LOCUS_08820 67378 67145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 68196 67378 gene locus_tag LOCUS_08830 68196 67378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 <70355 68177 gene locus_tag LOCUS_08840 <70355 68177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003429305.1:DNA gyrase subunit A >Feature sequence012 236 937 gene locus_tag LOCUS_08850 236 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 2296 1034 gene locus_tag LOCUS_08860 gene eno 2296 1034 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975715.1 protein_id gnl|my_center|LOCUS_08860 3200 2589 gene locus_tag LOCUS_08870 3200 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 4670 3273 gene locus_tag LOCUS_08880 4670 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 6084 4972 gene locus_tag LOCUS_08890 6084 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 6656 6081 gene locus_tag LOCUS_08900 6656 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 6945 6616 gene locus_tag LOCUS_08910 6945 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 7476 7189 gene locus_tag LOCUS_08920 7476 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 8209 7730 gene locus_tag LOCUS_08930 8209 7730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 10150 8747 gene locus_tag LOCUS_08940 10150 8747 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_08940 10429 11142 gene locus_tag LOCUS_08950 10429 11142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 12211 11144 gene locus_tag LOCUS_08960 12211 11144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 13850 12516 gene locus_tag LOCUS_08970 13850 12516 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_08970 15155 14172 gene locus_tag LOCUS_08980 15155 14172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 15373 16128 gene locus_tag LOCUS_08990 15373 16128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 16876 16346 gene locus_tag LOCUS_09000 16876 16346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 16985 17833 gene locus_tag LOCUS_09010 16985 17833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 17887 18212 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18449 19300 gene locus_tag LOCUS_09020 18449 19300 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640607.1 protein_id gnl|my_center|LOCUS_09020 19574 19368 gene locus_tag LOCUS_09030 19574 19368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 19723 20289 gene locus_tag LOCUS_09040 19723 20289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 20277 21323 gene locus_tag LOCUS_09050 20277 21323 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266146.1 protein_id gnl|my_center|LOCUS_09050 21700 21365 gene locus_tag LOCUS_09060 21700 21365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 22387 23247 gene locus_tag LOCUS_09070 22387 23247 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326458.1 protein_id gnl|my_center|LOCUS_09070 23250 24287 gene locus_tag LOCUS_09080 23250 24287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 24341 25495 gene locus_tag LOCUS_09090 24341 25495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 26991 25492 gene locus_tag LOCUS_09100 26991 25492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 27456 28346 gene locus_tag LOCUS_09110 27456 28346 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257650.1 protein_id gnl|my_center|LOCUS_09110 28803 28591 gene locus_tag LOCUS_09120 28803 28591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 29378 28893 gene locus_tag LOCUS_09130 29378 28893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 29981 29412 gene locus_tag LOCUS_09140 29981 29412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 30601 29990 gene locus_tag LOCUS_09150 gene rpoE 30601 29990 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_09150 31475 30849 gene locus_tag LOCUS_09160 31475 30849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 32135 31719 gene locus_tag LOCUS_09170 32135 31719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 34342 32144 gene locus_tag LOCUS_09180 34342 32144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 35295 34339 gene locus_tag LOCUS_09190 35295 34339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 36169 35273 gene locus_tag LOCUS_09200 36169 35273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 37376 36432 gene locus_tag LOCUS_09210 37376 36432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 38355 37426 gene locus_tag LOCUS_09220 38355 37426 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262600.1 protein_id gnl|my_center|LOCUS_09220 39614 38520 gene locus_tag LOCUS_09230 39614 38520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 40925 39615 gene locus_tag LOCUS_09240 40925 39615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 42590 40926 gene locus_tag LOCUS_09250 42590 40926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 43818 42745 gene locus_tag LOCUS_09260 gene rlmN 43818 42745 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_09260 44241 45539 gene locus_tag LOCUS_09270 44241 45539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 46543 45536 gene locus_tag LOCUS_09280 gene rfaE1 46543 45536 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_09280 47540 46536 gene locus_tag LOCUS_09290 47540 46536 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735619.1 protein_id gnl|my_center|LOCUS_09290 47826 49085 gene locus_tag LOCUS_09300 gene gdhA 47826 49085 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080520.1 protein_id gnl|my_center|LOCUS_09300 49200 49604 gene locus_tag LOCUS_09310 gene mutT 49200 49604 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262628.1 protein_id gnl|my_center|LOCUS_09310 49610 50866 gene locus_tag LOCUS_09320 49610 50866 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250274.1 protein_id gnl|my_center|LOCUS_09320 50879 52225 gene locus_tag LOCUS_09330 50879 52225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 52466 52780 gene locus_tag LOCUS_09340 52466 52780 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_09340 53989 52787 gene locus_tag LOCUS_09350 53989 52787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 54126 54782 gene locus_tag LOCUS_09360 54126 54782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 55138 57381 gene locus_tag LOCUS_09370 55138 57381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 57381 58223 gene locus_tag LOCUS_09380 57381 58223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 58408 59292 gene locus_tag LOCUS_09390 58408 59292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 59371 60363 gene locus_tag LOCUS_09400 59371 60363 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941035.1 protein_id gnl|my_center|LOCUS_09400 61246 60347 gene locus_tag LOCUS_09410 61246 60347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 62669 61251 gene locus_tag LOCUS_09420 62669 61251 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440276.1 protein_id gnl|my_center|LOCUS_09420 65090 65398 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence013 658 164 gene locus_tag LOCUS_09430 658 164 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964095.1 protein_id gnl|my_center|LOCUS_09430 1289 696 gene locus_tag LOCUS_09440 1289 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 1731 2069 gene locus_tag LOCUS_09450 gene glnB 1731 2069 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211554.1 protein_id gnl|my_center|LOCUS_09450 2123 3538 gene locus_tag LOCUS_09460 gene glnA 2123 3538 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_09460 3820 4125 gene locus_tag LOCUS_09470 3820 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 5012 4200 gene locus_tag LOCUS_09480 5012 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 5267 6961 gene locus_tag LOCUS_09490 5267 6961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 7245 8633 gene locus_tag LOCUS_09500 7245 8633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 8695 10020 gene locus_tag LOCUS_09510 8695 10020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 10598 10107 gene locus_tag LOCUS_09520 10598 10107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 12097 10598 gene locus_tag LOCUS_09530 12097 10598 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228236.1 protein_id gnl|my_center|LOCUS_09530 13194 12100 gene locus_tag LOCUS_09540 13194 12100 CDS product DUF444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233828.1 protein_id gnl|my_center|LOCUS_09540 15278 13209 gene locus_tag LOCUS_09550 15278 13209 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256854.1 protein_id gnl|my_center|LOCUS_09550 15701 16498 gene locus_tag LOCUS_09560 15701 16498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 16531 17514 gene locus_tag LOCUS_09570 16531 17514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 18273 17548 gene locus_tag LOCUS_09580 18273 17548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 18503 19057 gene locus_tag LOCUS_09590 18503 19057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 19682 19221 gene locus_tag LOCUS_09600 19682 19221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 21522 19813 gene locus_tag LOCUS_09610 21522 19813 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924857.1 protein_id gnl|my_center|LOCUS_09610 22393 21902 gene locus_tag LOCUS_09620 22393 21902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 22642 23187 gene locus_tag LOCUS_09630 22642 23187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 23672 23292 gene locus_tag LOCUS_09640 23672 23292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 25073 23775 gene locus_tag LOCUS_09650 25073 23775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 25668 25084 gene locus_tag LOCUS_09660 gene lpoB 25668 25084 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750164.1 protein_id gnl|my_center|LOCUS_09660 26239 25790 gene locus_tag LOCUS_09670 26239 25790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 28248 26419 gene locus_tag LOCUS_09680 28248 26419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 29279 28248 gene locus_tag LOCUS_09690 29279 28248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 29763 29272 gene locus_tag LOCUS_09700 29763 29272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 30810 29767 gene locus_tag LOCUS_09710 30810 29767 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_09710 30955 31407 gene locus_tag LOCUS_09720 30955 31407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 33044 31404 gene locus_tag LOCUS_09730 33044 31404 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723738.1 protein_id gnl|my_center|LOCUS_09730 33503 33048 gene locus_tag LOCUS_09740 33503 33048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 33628 34383 gene locus_tag LOCUS_09750 33628 34383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 35777 34455 gene locus_tag LOCUS_09760 gene pepP 35777 34455 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_09760 36712 35780 gene locus_tag LOCUS_09770 36712 35780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 37436 36696 gene locus_tag LOCUS_09780 37436 36696 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880470.1 protein_id gnl|my_center|LOCUS_09780 38296 37436 gene locus_tag LOCUS_09790 38296 37436 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_09790 38517 38296 gene locus_tag LOCUS_09800 38517 38296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 39821 38520 gene locus_tag LOCUS_09810 gene xseA 39821 38520 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460216.1 protein_id gnl|my_center|LOCUS_09810 40200 40421 gene locus_tag LOCUS_09820 40200 40421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 40858 43332 gene locus_tag LOCUS_09830 40858 43332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 43885 45477 gene locus_tag LOCUS_09840 43885 45477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 45548 48379 gene locus_tag LOCUS_09850 45548 48379 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943755.1 protein_id gnl|my_center|LOCUS_09850 48391 51165 gene locus_tag LOCUS_09860 gene uvrA 48391 51165 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545482.1 protein_id gnl|my_center|LOCUS_09860 52139 51183 gene locus_tag LOCUS_09870 52139 51183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 52519 54075 gene locus_tag LOCUS_09880 52519 54075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 54423 54842 gene locus_tag LOCUS_09890 54423 54842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 54960 56000 gene locus_tag LOCUS_09900 54960 56000 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933710.1 protein_id gnl|my_center|LOCUS_09900 55997 56977 gene locus_tag LOCUS_09910 55997 56977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 57174 58052 gene locus_tag LOCUS_09920 57174 58052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 59191 58076 gene locus_tag LOCUS_09930 59191 58076 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693152.1 protein_id gnl|my_center|LOCUS_09930 61161 59206 gene locus_tag LOCUS_09940 61161 59206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 61577 62362 gene locus_tag LOCUS_09950 61577 62362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 62435 63292 gene locus_tag LOCUS_09960 62435 63292 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_09960 63289 64107 gene locus_tag LOCUS_09970 63289 64107 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453817.1 protein_id gnl|my_center|LOCUS_09970 64146 65255 gene locus_tag LOCUS_09980 gene nagZ 64146 65255 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 protein_id gnl|my_center|LOCUS_09980 >Feature sequence014 614 156 gene locus_tag LOCUS_09990 614 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 750 2300 gene locus_tag LOCUS_10000 gene lnt 750 2300 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_10000 2453 4771 gene locus_tag LOCUS_10010 2453 4771 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458990.1 protein_id gnl|my_center|LOCUS_10010 5572 4781 gene locus_tag LOCUS_10020 5572 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 5905 6597 gene locus_tag LOCUS_10030 5905 6597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 7636 6641 gene locus_tag LOCUS_10040 7636 6641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 7832 8167 gene locus_tag LOCUS_10050 7832 8167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 8272 8568 gene locus_tag LOCUS_10060 8272 8568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 8657 10156 gene locus_tag LOCUS_10070 8657 10156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 10475 12559 gene locus_tag LOCUS_10080 10475 12559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 12906 12568 gene locus_tag LOCUS_10090 12906 12568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 13405 12896 gene locus_tag LOCUS_10100 13405 12896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 15138 14431 gene locus_tag LOCUS_10110 15138 14431 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795919.1 protein_id gnl|my_center|LOCUS_10110 16316 15405 gene locus_tag LOCUS_10120 gene hslO 16316 15405 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943960.1 protein_id gnl|my_center|LOCUS_10120 16470 17051 gene locus_tag LOCUS_10130 16470 17051 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110705.1 protein_id gnl|my_center|LOCUS_10130 17227 20184 gene locus_tag LOCUS_10140 gene pruA 17227 20184 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940575.1 protein_id gnl|my_center|LOCUS_10140 21069 20101 gene locus_tag LOCUS_10150 21069 20101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 22991 21066 gene locus_tag LOCUS_10160 22991 21066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 23690 23058 gene locus_tag LOCUS_10170 23690 23058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 23995 27252 gene locus_tag LOCUS_10180 23995 27252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 27675 27319 gene locus_tag LOCUS_10190 27675 27319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 28069 27686 gene locus_tag LOCUS_10200 28069 27686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 28490 28059 gene locus_tag LOCUS_10210 28490 28059 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381641.1 protein_id gnl|my_center|LOCUS_10210 28602 29663 gene locus_tag LOCUS_10220 28602 29663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 30253 29720 gene locus_tag LOCUS_10230 30253 29720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 30512 31675 gene locus_tag LOCUS_10240 30512 31675 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943259.1 protein_id gnl|my_center|LOCUS_10240 32377 31841 gene locus_tag LOCUS_10250 32377 31841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 32557 32763 gene locus_tag LOCUS_10260 32557 32763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 33168 32848 gene locus_tag LOCUS_10270 33168 32848 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368778.1 protein_id gnl|my_center|LOCUS_10270 33847 33161 gene locus_tag LOCUS_10280 33847 33161 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338452.1 protein_id gnl|my_center|LOCUS_10280 34415 34828 gene locus_tag LOCUS_10290 34415 34828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 36671 34836 gene locus_tag LOCUS_10300 gene recQ 36671 34836 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091724.1 protein_id gnl|my_center|LOCUS_10300 36806 38626 gene locus_tag LOCUS_10310 36806 38626 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814586.1 protein_id gnl|my_center|LOCUS_10310 39961 38690 gene locus_tag LOCUS_10320 39961 38690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904381.1 protein_id gnl|my_center|LOCUS_10320 40207 40668 gene locus_tag LOCUS_10330 40207 40668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 40893 41165 gene locus_tag LOCUS_10340 40893 41165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 41266 41814 gene locus_tag LOCUS_10350 41266 41814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 41915 43078 gene locus_tag LOCUS_10360 41915 43078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 43080 43826 gene locus_tag LOCUS_10370 43080 43826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 43976 45811 gene locus_tag LOCUS_10380 43976 45811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 46374 45841 gene locus_tag LOCUS_10390 46374 45841 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477123.1 protein_id gnl|my_center|LOCUS_10390 47466 46381 gene locus_tag LOCUS_10400 47466 46381 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661226.1 protein_id gnl|my_center|LOCUS_10400 48158 47646 gene locus_tag LOCUS_10410 48158 47646 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_10410 48635 48195 gene locus_tag LOCUS_10420 48635 48195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 49107 49436 gene locus_tag LOCUS_10430 49107 49436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 50482 49490 gene locus_tag LOCUS_10440 50482 49490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 52082 50883 gene locus_tag LOCUS_10450 52082 50883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 52438 52875 gene locus_tag LOCUS_10460 52438 52875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 53863 52898 gene locus_tag LOCUS_10470 gene hemB 53863 52898 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056277.1 protein_id gnl|my_center|LOCUS_10470 55296 53968 gene locus_tag LOCUS_10480 55296 53968 CDS product putative Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929970.1 protein_id gnl|my_center|LOCUS_10480 56929 55463 gene locus_tag LOCUS_10490 56929 55463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 57598 57188 gene locus_tag LOCUS_10500 57598 57188 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026616068.1 protein_id gnl|my_center|LOCUS_10500 59346 57595 gene locus_tag LOCUS_10510 59346 57595 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524145.1 protein_id gnl|my_center|LOCUS_10510 59601 60602 gene locus_tag LOCUS_10520 59601 60602 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080850.1 protein_id gnl|my_center|LOCUS_10520 60683 61642 gene locus_tag LOCUS_10530 60683 61642 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970773.1 protein_id gnl|my_center|LOCUS_10530 63157 61718 gene locus_tag LOCUS_10540 63157 61718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 >Feature sequence015 473 763 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 932 1235 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1275 3446 gene locus_tag LOCUS_10550 gene secA 1275 3446 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545108.1 protein_id gnl|my_center|LOCUS_10550 5105 3537 gene locus_tag LOCUS_10560 5105 3537 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390860.1 protein_id gnl|my_center|LOCUS_10560 5229 6734 gene locus_tag LOCUS_10570 5229 6734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 6861 9059 gene locus_tag LOCUS_10580 6861 9059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 9201 11291 gene locus_tag LOCUS_10590 gene ppk1 9201 11291 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126011.1 protein_id gnl|my_center|LOCUS_10590 11294 12220 gene locus_tag LOCUS_10600 11294 12220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 12281 13216 gene locus_tag LOCUS_10610 12281 13216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 13209 13715 gene locus_tag LOCUS_10620 13209 13715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 14286 13825 gene locus_tag LOCUS_10630 14286 13825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 15124 14633 gene locus_tag LOCUS_10640 15124 14633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 16256 15231 gene locus_tag LOCUS_10650 gene hemE 16256 15231 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924954.1 protein_id gnl|my_center|LOCUS_10650 16949 16266 gene locus_tag LOCUS_10660 16949 16266 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583597.1 protein_id gnl|my_center|LOCUS_10660 17875 16946 gene locus_tag LOCUS_10670 17875 16946 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360255.1 protein_id gnl|my_center|LOCUS_10670 19148 17865 gene locus_tag LOCUS_10680 gene hemL 19148 17865 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444486.1 protein_id gnl|my_center|LOCUS_10680 20747 19161 gene locus_tag LOCUS_10690 20747 19161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 21925 20744 gene locus_tag LOCUS_10700 gene hemA 21925 20744 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869638.1 protein_id gnl|my_center|LOCUS_10700 22354 23244 gene locus_tag LOCUS_10710 22354 23244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 25812 24136 gene locus_tag LOCUS_10720 25812 24136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 26062 27708 gene locus_tag LOCUS_10730 26062 27708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 27866 29575 gene locus_tag LOCUS_10740 27866 29575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 29975 31081 gene locus_tag LOCUS_10750 29975 31081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 32309 31074 gene locus_tag LOCUS_10760 32309 31074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 33954 32302 gene locus_tag LOCUS_10770 33954 32302 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759730.1 protein_id gnl|my_center|LOCUS_10770 35103 33964 gene locus_tag LOCUS_10780 35103 33964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 36870 35104 gene locus_tag LOCUS_10790 36870 35104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 37418 39820 gene locus_tag LOCUS_10800 37418 39820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 41906 39900 gene locus_tag LOCUS_10810 41906 39900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 42229 42651 gene locus_tag LOCUS_10820 42229 42651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 42630 43352 gene locus_tag LOCUS_10830 42630 43352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 43599 44003 gene locus_tag LOCUS_10840 43599 44003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 44123 44713 gene locus_tag LOCUS_10850 44123 44713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 44966 46297 gene locus_tag LOCUS_10860 44966 46297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 46490 49834 gene locus_tag LOCUS_10870 46490 49834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 50111 50464 gene locus_tag LOCUS_10880 50111 50464 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940568.1 protein_id gnl|my_center|LOCUS_10880 50465 51082 gene locus_tag LOCUS_10890 50465 51082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 51082 52248 gene locus_tag LOCUS_10900 51082 52248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 53495 52383 gene locus_tag LOCUS_10910 53495 52383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 53927 55921 gene locus_tag LOCUS_10920 53927 55921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 59387 55914 gene locus_tag LOCUS_10930 59387 55914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 59731 60084 gene locus_tag LOCUS_tm00010 59731 60084 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 60249 61469 gene locus_tag LOCUS_10940 60249 61469 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938819.1 protein_id gnl|my_center|LOCUS_10940 61462 62013 gene locus_tag LOCUS_10950 61462 62013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 62099 62305 gene locus_tag LOCUS_10960 62099 62305 CDS product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531627.1 protein_id gnl|my_center|LOCUS_10960 62298 62531 gene locus_tag LOCUS_10970 62298 62531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence016 274 843 gene locus_tag LOCUS_10980 274 843 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545727.1 protein_id gnl|my_center|LOCUS_10980 840 1862 gene locus_tag LOCUS_10990 gene trpS 840 1862 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546811.1 protein_id gnl|my_center|LOCUS_10990 1863 3425 gene locus_tag LOCUS_11000 1863 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 3440 5293 gene locus_tag LOCUS_11010 3440 5293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 6218 5349 gene locus_tag LOCUS_11020 6218 5349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 6835 8046 gene locus_tag LOCUS_11030 6835 8046 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943206.1 protein_id gnl|my_center|LOCUS_11030 8043 9128 gene locus_tag LOCUS_11040 gene mnmA 8043 9128 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_11040 9116 10534 gene locus_tag LOCUS_11050 gene mtaB 9116 10534 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_11050 10537 10743 gene locus_tag LOCUS_11060 10537 10743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 10730 11458 gene locus_tag LOCUS_11070 10730 11458 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962702.1 protein_id gnl|my_center|LOCUS_11070 11979 12758 gene locus_tag LOCUS_11080 11979 12758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 13629 12772 gene locus_tag LOCUS_11090 13629 12772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 14167 13640 gene locus_tag LOCUS_11100 14167 13640 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994781.1 protein_id gnl|my_center|LOCUS_11100 14365 15744 gene locus_tag LOCUS_11110 14365 15744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11110 15737 17353 gene locus_tag LOCUS_11120 15737 17353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 17360 18688 gene locus_tag LOCUS_11130 gene astB 17360 18688 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072652.1 protein_id gnl|my_center|LOCUS_11130 18877 19647 gene locus_tag LOCUS_11140 18877 19647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 23444 19689 gene locus_tag LOCUS_11150 23444 19689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 23959 23792 gene locus_tag LOCUS_11160 23959 23792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 24388 28482 gene locus_tag LOCUS_11170 24388 28482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 29631 28633 gene locus_tag LOCUS_11180 29631 28633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 30357 29632 gene locus_tag LOCUS_11190 30357 29632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 30746 31270 gene locus_tag LOCUS_11200 30746 31270 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_11200 31286 34372 gene locus_tag LOCUS_11210 31286 34372 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372295.1 protein_id gnl|my_center|LOCUS_11210 34372 35730 gene locus_tag LOCUS_11220 gene nrfD 34372 35730 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063680.1 protein_id gnl|my_center|LOCUS_11220 35723 36247 gene locus_tag LOCUS_11230 35723 36247 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277765.1 protein_id gnl|my_center|LOCUS_11230 36248 36781 gene locus_tag LOCUS_11240 36248 36781 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872574.1 protein_id gnl|my_center|LOCUS_11240 36783 37982 gene locus_tag LOCUS_11250 36783 37982 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453372.1 protein_id gnl|my_center|LOCUS_11250 38110 38898 gene locus_tag LOCUS_11260 38110 38898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 39158 41011 gene locus_tag LOCUS_11270 39158 41011 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940968.1 protein_id gnl|my_center|LOCUS_11270 41015 41497 gene locus_tag LOCUS_11280 41015 41497 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839906.1 protein_id gnl|my_center|LOCUS_11280 41576 43678 gene locus_tag LOCUS_11290 41576 43678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 43688 45643 gene locus_tag LOCUS_11300 43688 45643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 46378 45719 gene locus_tag LOCUS_11310 46378 45719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 46514 48448 gene locus_tag LOCUS_11320 gene thrS 46514 48448 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_11320 48491 49087 gene locus_tag LOCUS_11330 gene infC 48491 49087 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070690874.1 protein_id gnl|my_center|LOCUS_11330 49543 50022 gene locus_tag LOCUS_11340 49543 50022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 50611 50255 gene locus_tag LOCUS_11350 50611 50255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 50877 51071 gene locus_tag LOCUS_11360 gene rpmI 50877 51071 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429729.1 protein_id gnl|my_center|LOCUS_11360 51087 51431 gene locus_tag LOCUS_11370 gene rplT 51087 51431 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942165.1 protein_id gnl|my_center|LOCUS_11370 52106 52588 gene locus_tag LOCUS_11380 52106 52588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 52594 53343 gene locus_tag LOCUS_11390 52594 53343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 53691 53437 gene locus_tag LOCUS_11400 53691 53437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 54235 55950 gene locus_tag LOCUS_11410 54235 55950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 57468 56005 gene locus_tag LOCUS_11420 57468 56005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 57705 58574 gene locus_tag LOCUS_11430 gene mreC 57705 58574 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942723.1 protein_id gnl|my_center|LOCUS_11430 58580 59125 gene locus_tag LOCUS_11440 58580 59125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 59122 61086 gene locus_tag LOCUS_11450 gene mrdA 59122 61086 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_11450 61090 62199 gene locus_tag LOCUS_11460 gene rodA 61090 62199 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_11460 >Feature sequence017 810 61 gene locus_tag LOCUS_11470 gene lmtA 810 61 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_11470 1215 907 gene locus_tag LOCUS_11480 1215 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1298 1912 gene locus_tag LOCUS_11490 1298 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 3547 1907 gene locus_tag LOCUS_11500 3547 1907 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403181.1 protein_id gnl|my_center|LOCUS_11500 4090 3671 gene locus_tag LOCUS_11510 4090 3671 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440098.1 protein_id gnl|my_center|LOCUS_11510 5223 4321 gene locus_tag LOCUS_11520 5223 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 5282 6451 gene locus_tag LOCUS_11530 5282 6451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 6634 7611 gene locus_tag LOCUS_11540 6634 7611 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071820.1 protein_id gnl|my_center|LOCUS_11540 7613 8254 gene locus_tag LOCUS_11550 gene maiA 7613 8254 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207986.1 protein_id gnl|my_center|LOCUS_11550 8775 8251 gene locus_tag LOCUS_11560 8775 8251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 9313 9498 gene locus_tag LOCUS_11570 9313 9498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 9510 9695 gene locus_tag LOCUS_11580 9510 9695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 9717 10172 gene locus_tag LOCUS_11590 9717 10172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 10166 10411 gene locus_tag LOCUS_11600 10166 10411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 10423 11025 gene locus_tag LOCUS_11610 10423 11025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 11015 11527 gene locus_tag LOCUS_11620 11015 11527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 11524 12414 gene locus_tag LOCUS_11630 11524 12414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 12433 13923 gene locus_tag LOCUS_11640 12433 13923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 14100 16307 gene locus_tag LOCUS_11650 14100 16307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 16304 17179 gene locus_tag LOCUS_11660 16304 17179 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136348290.1 protein_id gnl|my_center|LOCUS_11660 17200 18813 gene locus_tag LOCUS_11670 17200 18813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 18819 19109 gene locus_tag LOCUS_11680 18819 19109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 19979 19557 gene locus_tag LOCUS_11690 19979 19557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 20445 19972 gene locus_tag LOCUS_11700 20445 19972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 20419 21057 gene locus_tag LOCUS_11710 20419 21057 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224979.1 protein_id gnl|my_center|LOCUS_11710 22162 21110 gene locus_tag LOCUS_11720 22162 21110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 22323 23915 gene locus_tag LOCUS_11730 22323 23915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 24045 24656 gene locus_tag LOCUS_11740 24045 24656 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192886228.1 protein_id gnl|my_center|LOCUS_11740 24942 26099 gene locus_tag LOCUS_11750 24942 26099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 26109 26693 gene locus_tag LOCUS_11760 26109 26693 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976220.1 protein_id gnl|my_center|LOCUS_11760 27828 26668 gene locus_tag LOCUS_11770 27828 26668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 29333 28158 gene locus_tag LOCUS_11780 29333 28158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 31242 29587 gene locus_tag LOCUS_11790 gene groL 31242 29587 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_11790 31570 31274 gene locus_tag LOCUS_11800 gene groES 31570 31274 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_11800 32170 32568 gene locus_tag LOCUS_11810 32170 32568 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123285.1 protein_id gnl|my_center|LOCUS_11810 33414 32623 gene locus_tag LOCUS_11820 33414 32623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 34171 34638 gene locus_tag LOCUS_11830 34171 34638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 37120 34772 gene locus_tag LOCUS_11840 37120 34772 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962626.1 protein_id gnl|my_center|LOCUS_11840 38111 37143 gene locus_tag LOCUS_11850 38111 37143 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_11850 43899 38716 gene locus_tag LOCUS_11860 43899 38716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 46046 43986 gene locus_tag LOCUS_11870 46046 43986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 47697 46276 gene locus_tag LOCUS_11880 47697 46276 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179969.1 protein_id gnl|my_center|LOCUS_11880 47835 48764 gene locus_tag LOCUS_11890 47835 48764 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444347.1 protein_id gnl|my_center|LOCUS_11890 48945 49904 gene locus_tag LOCUS_11900 48945 49904 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191946.1 protein_id gnl|my_center|LOCUS_11900 50641 49901 gene locus_tag LOCUS_11910 50641 49901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 51603 50845 gene locus_tag LOCUS_11920 gene map 51603 50845 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233698.1 protein_id gnl|my_center|LOCUS_11920 52074 51998 gene locus_tag LOCUS_t00060 52074 51998 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 52223 52813 gene locus_tag LOCUS_11930 gene gmhA 52223 52813 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016435.1 protein_id gnl|my_center|LOCUS_11930 52868 52957 gene locus_tag LOCUS_t00070 52868 52957 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 53420 53019 gene locus_tag LOCUS_11940 gene fosLL 53420 53019 CDS product fosfomycin resistance glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207881.1 protein_id gnl|my_center|LOCUS_11940 54100 53423 gene locus_tag LOCUS_11950 54100 53423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 56154 54448 gene locus_tag LOCUS_11960 56154 54448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 56619 57137 gene locus_tag LOCUS_11970 56619 57137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 57866 57219 gene locus_tag LOCUS_11980 57866 57219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 58068 58526 gene locus_tag LOCUS_11990 58068 58526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 >Feature sequence018 961 26 gene locus_tag LOCUS_12000 961 26 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004121002.1 protein_id gnl|my_center|LOCUS_12000 1288 2241 gene locus_tag LOCUS_12010 gene pip 1288 2241 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141435.1 protein_id gnl|my_center|LOCUS_12010 3002 2295 gene locus_tag LOCUS_12020 3002 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 4040 3285 gene locus_tag LOCUS_12030 4040 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 4928 4509 gene locus_tag LOCUS_12040 4928 4509 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971509.1 protein_id gnl|my_center|LOCUS_12040 7111 4967 gene locus_tag LOCUS_12050 gene fadJ 7111 4967 CDS product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098155.1 protein_id gnl|my_center|LOCUS_12050 8408 7113 gene locus_tag LOCUS_12060 8408 7113 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947326.1 protein_id gnl|my_center|LOCUS_12060 8719 9549 gene locus_tag LOCUS_12070 8719 9549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 11415 9553 gene locus_tag LOCUS_12080 11415 9553 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884040.1 protein_id gnl|my_center|LOCUS_12080 11810 14101 gene locus_tag LOCUS_12090 11810 14101 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_12090 14102 15424 gene locus_tag LOCUS_12100 gene hflX 14102 15424 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048525537.1 protein_id gnl|my_center|LOCUS_12100 15440 15700 gene locus_tag LOCUS_12110 15440 15700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 15717 16088 gene locus_tag LOCUS_12120 15717 16088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 16196 16810 gene locus_tag LOCUS_12130 16196 16810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 16833 17732 gene locus_tag LOCUS_12140 16833 17732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 18928 17747 gene locus_tag LOCUS_12150 18928 17747 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841461.1 protein_id gnl|my_center|LOCUS_12150 19136 19738 gene locus_tag LOCUS_12160 19136 19738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 20424 19735 gene locus_tag LOCUS_12170 20424 19735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 22517 20622 gene locus_tag LOCUS_12180 22517 20622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 23536 22691 gene locus_tag LOCUS_12190 23536 22691 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_12190 24530 23526 gene locus_tag LOCUS_12200 24530 23526 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877935.1 protein_id gnl|my_center|LOCUS_12200 24790 25722 gene locus_tag LOCUS_12210 24790 25722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 25715 26713 gene locus_tag LOCUS_12220 25715 26713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 26819 27643 gene locus_tag LOCUS_12230 26819 27643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 29221 27986 gene locus_tag LOCUS_12240 29221 27986 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_12240 29621 29223 gene locus_tag LOCUS_12250 29621 29223 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223132.1 protein_id gnl|my_center|LOCUS_12250 29798 30382 gene locus_tag LOCUS_12260 29798 30382 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933158.1 protein_id gnl|my_center|LOCUS_12260 31920 30379 gene locus_tag LOCUS_12270 31920 30379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 33869 32028 gene locus_tag LOCUS_12280 33869 32028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 33989 34450 gene locus_tag LOCUS_12290 33989 34450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 34479 35756 gene locus_tag LOCUS_12300 gene lysA 34479 35756 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_12300 35756 36652 gene locus_tag LOCUS_12310 35756 36652 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266764.1 protein_id gnl|my_center|LOCUS_12310 38007 36718 gene locus_tag LOCUS_12320 38007 36718 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261378.1 protein_id gnl|my_center|LOCUS_12320 38306 38590 gene locus_tag LOCUS_12330 38306 38590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 38754 39506 gene locus_tag LOCUS_12340 38754 39506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 39527 40408 gene locus_tag LOCUS_12350 39527 40408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 41523 40462 gene locus_tag LOCUS_12360 41523 40462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_12360 41805 42668 gene locus_tag LOCUS_12370 41805 42668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 42688 43557 gene locus_tag LOCUS_12380 42688 43557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 45421 43856 gene locus_tag LOCUS_12390 45421 43856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 46194 46119 gene locus_tag LOCUS_t00080 46194 46119 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 46499 47947 gene locus_tag LOCUS_12400 46499 47947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 47919 48431 gene locus_tag LOCUS_12410 47919 48431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 49183 48425 gene locus_tag LOCUS_12420 49183 48425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 51233 49167 gene locus_tag LOCUS_12430 51233 49167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 51539 51351 gene locus_tag LOCUS_12440 51539 51351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 52056 51601 gene locus_tag LOCUS_12450 52056 51601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 53266 52067 gene locus_tag LOCUS_12460 53266 52067 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_12460 53944 53279 gene locus_tag LOCUS_12470 53944 53279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 54132 54620 gene locus_tag LOCUS_12480 gene nrdR 54132 54620 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_12480 54633 55040 gene locus_tag LOCUS_12490 gene nusB 54633 55040 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460271.1 protein_id gnl|my_center|LOCUS_12490 56016 55093 gene locus_tag LOCUS_12500 56016 55093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 56243 56605 gene locus_tag LOCUS_12510 56243 56605 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723377.1 protein_id gnl|my_center|LOCUS_12510 57095 56613 gene locus_tag LOCUS_12520 57095 56613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 >Feature sequence019 188 544 gene locus_tag LOCUS_12530 188 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 985 683 gene locus_tag LOCUS_12540 985 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1630 998 gene locus_tag LOCUS_12550 1630 998 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100797.1 protein_id gnl|my_center|LOCUS_12550 3197 1617 gene locus_tag LOCUS_12560 gene ctaD 3197 1617 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102008.1 protein_id gnl|my_center|LOCUS_12560 4161 3208 gene locus_tag LOCUS_12570 gene coxB 4161 3208 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220059.1 protein_id gnl|my_center|LOCUS_12570 4992 4162 gene locus_tag LOCUS_12580 4992 4162 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885550.1 protein_id gnl|my_center|LOCUS_12580 5155 5006 gene locus_tag LOCUS_12590 5155 5006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 6745 5696 gene locus_tag LOCUS_12600 6745 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 9383 6738 gene locus_tag LOCUS_12610 9383 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 10902 10048 gene locus_tag LOCUS_12620 10902 10048 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070739.1 protein_id gnl|my_center|LOCUS_12620 11204 12238 gene locus_tag LOCUS_12630 11204 12238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 12473 14677 gene locus_tag LOCUS_12640 12473 14677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 14818 15756 gene locus_tag LOCUS_12650 14818 15756 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753043.1 protein_id gnl|my_center|LOCUS_12650 16209 16424 gene locus_tag LOCUS_12660 16209 16424 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694169.1 protein_id gnl|my_center|LOCUS_12660 19785 16507 gene locus_tag LOCUS_12670 19785 16507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 20641 20117 gene locus_tag LOCUS_12680 20641 20117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 21190 23010 gene locus_tag LOCUS_12690 gene dnaX 21190 23010 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_12690 23010 23336 gene locus_tag LOCUS_12700 23010 23336 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001996460.1 protein_id gnl|my_center|LOCUS_12700 23340 23939 gene locus_tag LOCUS_12710 gene recR 23340 23939 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016369.1 protein_id gnl|my_center|LOCUS_12710 23939 24529 gene locus_tag LOCUS_12720 23939 24529 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_12720 25933 24563 gene locus_tag LOCUS_12730 25933 24563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 27523 26054 gene locus_tag LOCUS_12740 27523 26054 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263242.1 protein_id gnl|my_center|LOCUS_12740 27716 28666 gene locus_tag LOCUS_12750 gene nadA 27716 28666 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762783.1 protein_id gnl|my_center|LOCUS_12750 28666 29217 gene locus_tag LOCUS_12760 28666 29217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 29903 29262 gene locus_tag LOCUS_12770 29903 29262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 30386 29997 gene locus_tag LOCUS_12780 30386 29997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 31496 30513 gene locus_tag LOCUS_12790 31496 30513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 31684 31890 gene locus_tag LOCUS_12800 31684 31890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 32356 31817 gene locus_tag LOCUS_12810 32356 31817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 32569 33630 gene locus_tag LOCUS_12820 32569 33630 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107120.1 protein_id gnl|my_center|LOCUS_12820 33901 35049 gene locus_tag LOCUS_12830 33901 35049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 35053 35433 gene locus_tag LOCUS_12840 35053 35433 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456625.1 protein_id gnl|my_center|LOCUS_12840 35598 36071 gene locus_tag LOCUS_12850 35598 36071 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983897.1 protein_id gnl|my_center|LOCUS_12850 36323 36087 gene locus_tag LOCUS_12860 36323 36087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 36564 37760 gene locus_tag LOCUS_12870 36564 37760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 38930 37818 gene locus_tag LOCUS_12880 38930 37818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 39958 39017 gene locus_tag LOCUS_12890 39958 39017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 40241 39948 gene locus_tag LOCUS_12900 40241 39948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 41227 40415 gene locus_tag LOCUS_12910 41227 40415 CDS product aspartoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124406.1 protein_id gnl|my_center|LOCUS_12910 41358 42773 gene locus_tag LOCUS_12920 41358 42773 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262708.1 protein_id gnl|my_center|LOCUS_12920 42796 43563 gene locus_tag LOCUS_12930 42796 43563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 43670 44536 gene locus_tag LOCUS_12940 43670 44536 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230515.1 protein_id gnl|my_center|LOCUS_12940 44846 45715 gene locus_tag LOCUS_12950 44846 45715 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468574.1 protein_id gnl|my_center|LOCUS_12950 45716 46312 gene locus_tag LOCUS_12960 45716 46312 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043335393.1 protein_id gnl|my_center|LOCUS_12960 47724 46426 gene locus_tag LOCUS_12970 47724 46426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 47999 48349 gene locus_tag LOCUS_12980 47999 48349 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116259.1 protein_id gnl|my_center|LOCUS_12980 48584 49525 gene locus_tag LOCUS_12990 48584 49525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 50263 49571 gene locus_tag LOCUS_13000 50263 49571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 50349 51074 gene locus_tag LOCUS_13010 50349 51074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 51071 51859 gene locus_tag LOCUS_13020 gene panB 51071 51859 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443983.1 protein_id gnl|my_center|LOCUS_13020 51859 52608 gene locus_tag LOCUS_13030 gene panC 51859 52608 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948362.1 protein_id gnl|my_center|LOCUS_13030 52595 53134 gene locus_tag LOCUS_13040 gene coaC 52595 53134 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284123.1 protein_id gnl|my_center|LOCUS_13040 53131 53793 gene locus_tag LOCUS_13050 53131 53793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13050 53777 54550 gene locus_tag LOCUS_13060 53777 54550 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946646.1 protein_id gnl|my_center|LOCUS_13060 54567 54932 gene locus_tag LOCUS_13070 54567 54932 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880271.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence020 945 361 gene locus_tag LOCUS_13080 945 361 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 protein_id gnl|my_center|LOCUS_13080 1650 949 gene locus_tag LOCUS_13090 1650 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 2683 1991 gene locus_tag LOCUS_13100 2683 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 3162 2845 gene locus_tag LOCUS_13110 3162 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 3358 4425 gene locus_tag LOCUS_13120 gene bfmBAA 3358 4425 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398565.1 protein_id gnl|my_center|LOCUS_13120 4425 5480 gene locus_tag LOCUS_13130 gene bfmBAB 4425 5480 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398638.1 protein_id gnl|my_center|LOCUS_13130 5593 6450 gene locus_tag LOCUS_13140 5593 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 7465 6509 gene locus_tag LOCUS_13150 7465 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 8138 7707 gene locus_tag LOCUS_13160 8138 7707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 8627 8316 gene locus_tag LOCUS_13170 8627 8316 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388230.1 protein_id gnl|my_center|LOCUS_13170 9615 8629 gene locus_tag LOCUS_13180 9615 8629 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_13180 10748 9984 gene locus_tag LOCUS_13190 10748 9984 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675011.1 protein_id gnl|my_center|LOCUS_13190 11062 11259 gene locus_tag LOCUS_13200 11062 11259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 11908 11306 gene locus_tag LOCUS_13210 11908 11306 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405414.1 protein_id gnl|my_center|LOCUS_13210 13736 11901 gene locus_tag LOCUS_13220 13736 11901 CDS product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972986.1 protein_id gnl|my_center|LOCUS_13220 14119 15534 gene locus_tag LOCUS_13230 14119 15534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 16141 16449 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16987 17295 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17445 18614 gene locus_tag LOCUS_13240 17445 18614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 19040 18696 gene locus_tag LOCUS_13250 19040 18696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 20016 19237 gene locus_tag LOCUS_13260 20016 19237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 20189 21649 gene locus_tag LOCUS_13270 20189 21649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 22973 21612 gene locus_tag LOCUS_13280 gene hmrM 22973 21612 CDS product sodium-coupled multidrug efflux MATE transporter HmrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693623.1 protein_id gnl|my_center|LOCUS_13280 23877 23203 gene locus_tag LOCUS_13290 23877 23203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 24170 26077 gene locus_tag LOCUS_13300 24170 26077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 26074 27348 gene locus_tag LOCUS_13310 26074 27348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 27348 27770 gene locus_tag LOCUS_13320 27348 27770 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390464.1 protein_id gnl|my_center|LOCUS_13320 27754 29370 gene locus_tag LOCUS_13330 27754 29370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 31836 29317 gene locus_tag LOCUS_13340 31836 29317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 31964 32929 gene locus_tag LOCUS_13350 31964 32929 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895564.1 protein_id gnl|my_center|LOCUS_13350 33673 32930 gene locus_tag LOCUS_13360 33673 32930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 35410 33842 gene locus_tag LOCUS_13370 35410 33842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 35678 35753 gene locus_tag LOCUS_t00090 35678 35753 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 37733 36000 gene locus_tag LOCUS_13380 37733 36000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 38809 38063 gene locus_tag LOCUS_13390 38809 38063 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146406780.1 protein_id gnl|my_center|LOCUS_13390 39281 38913 gene locus_tag LOCUS_13400 39281 38913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 39968 39423 gene locus_tag LOCUS_13410 gene pgsA 39968 39423 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531610.1 protein_id gnl|my_center|LOCUS_13410 40095 40634 gene locus_tag LOCUS_13420 40095 40634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 40621 41013 gene locus_tag LOCUS_13430 40621 41013 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_13430 41015 41980 gene locus_tag LOCUS_13440 gene glpX 41015 41980 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214469.1 protein_id gnl|my_center|LOCUS_13440 41981 42268 gene locus_tag LOCUS_13450 41981 42268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 42399 42998 gene locus_tag LOCUS_13460 42399 42998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 43114 44079 gene locus_tag LOCUS_13470 43114 44079 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106059.1 protein_id gnl|my_center|LOCUS_13470 48120 44443 gene locus_tag LOCUS_13480 48120 44443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 48876 52427 gene locus_tag LOCUS_13490 48876 52427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 53383 52424 gene locus_tag LOCUS_13500 53383 52424 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037251612.1 protein_id gnl|my_center|LOCUS_13500 >Feature sequence021 355 1119 gene locus_tag LOCUS_13510 355 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 1119 2501 gene locus_tag LOCUS_13520 1119 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 2495 3403 gene locus_tag LOCUS_13530 2495 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 3788 3405 gene locus_tag LOCUS_13540 3788 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 4940 3789 gene locus_tag LOCUS_13550 4940 3789 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045809.1 protein_id gnl|my_center|LOCUS_13550 5476 5015 gene locus_tag LOCUS_13560 5476 5015 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021290.1 protein_id gnl|my_center|LOCUS_13560 7367 5463 gene locus_tag LOCUS_13570 7367 5463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 8800 7364 gene locus_tag LOCUS_13580 8800 7364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 10789 8948 gene locus_tag LOCUS_13590 10789 8948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 12442 11039 gene locus_tag LOCUS_13600 12442 11039 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956710.1 protein_id gnl|my_center|LOCUS_13600 12574 13896 gene locus_tag LOCUS_13610 12574 13896 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860275.1 protein_id gnl|my_center|LOCUS_13610 16284 14068 gene locus_tag LOCUS_13620 16284 14068 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481838.1 protein_id gnl|my_center|LOCUS_13620 16822 18087 gene locus_tag LOCUS_13630 16822 18087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 18099 19811 gene locus_tag LOCUS_13640 18099 19811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 20375 19890 gene locus_tag LOCUS_13650 20375 19890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 20797 20375 gene locus_tag LOCUS_13660 20797 20375 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206922.1 protein_id gnl|my_center|LOCUS_13660 21210 20794 gene locus_tag LOCUS_13670 21210 20794 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479368.1 protein_id gnl|my_center|LOCUS_13670 22073 21222 gene locus_tag LOCUS_13680 22073 21222 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_13680 22166 22792 gene locus_tag LOCUS_13690 22166 22792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 22858 23688 gene locus_tag LOCUS_13700 22858 23688 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228232.1 protein_id gnl|my_center|LOCUS_13700 25108 23645 gene locus_tag LOCUS_13710 25108 23645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 25408 26124 gene locus_tag LOCUS_13720 25408 26124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 26143 26553 gene locus_tag LOCUS_13730 26143 26553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 26584 26871 gene locus_tag LOCUS_13740 26584 26871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 27849 26929 gene locus_tag LOCUS_13750 27849 26929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 28748 28062 gene locus_tag LOCUS_13760 gene ung 28748 28062 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038854.1 protein_id gnl|my_center|LOCUS_13760 29776 28748 gene locus_tag LOCUS_13770 29776 28748 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928819.1 protein_id gnl|my_center|LOCUS_13770 29934 30515 gene locus_tag LOCUS_13780 29934 30515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 32157 30610 gene locus_tag LOCUS_13790 gene ahpF 32157 30610 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202340.1 protein_id gnl|my_center|LOCUS_13790 32789 32223 gene locus_tag LOCUS_13800 gene ahpC 32789 32223 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775969.1 protein_id gnl|my_center|LOCUS_13800 33721 33233 gene locus_tag LOCUS_13810 33721 33233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 34693 33743 gene locus_tag LOCUS_13820 34693 33743 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766770.1 protein_id gnl|my_center|LOCUS_13820 36059 34752 gene locus_tag LOCUS_13830 36059 34752 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_13830 36772 36230 gene locus_tag LOCUS_13840 gene can 36772 36230 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964129.1 protein_id gnl|my_center|LOCUS_13840 37419 36949 gene locus_tag LOCUS_13850 37419 36949 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086103.1 protein_id gnl|my_center|LOCUS_13850 38963 37590 gene locus_tag LOCUS_13860 38963 37590 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403679.1 protein_id gnl|my_center|LOCUS_13860 39639 39118 gene locus_tag LOCUS_13870 39639 39118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 40563 40012 gene locus_tag LOCUS_13880 40563 40012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 40936 43182 gene locus_tag LOCUS_13890 40936 43182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 43423 44223 gene locus_tag LOCUS_13900 43423 44223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 44321 44809 gene locus_tag LOCUS_13910 44321 44809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112531.1 protein_id gnl|my_center|LOCUS_13910 44968 45699 gene locus_tag LOCUS_13920 44968 45699 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921905.1 protein_id gnl|my_center|LOCUS_13920 45852 46763 gene locus_tag LOCUS_13930 45852 46763 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089318.1 protein_id gnl|my_center|LOCUS_13930 46760 47524 gene locus_tag LOCUS_13940 46760 47524 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089319.1 protein_id gnl|my_center|LOCUS_13940 48331 47627 gene locus_tag LOCUS_13950 48331 47627 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129738.1 protein_id gnl|my_center|LOCUS_13950 48471 49508 gene locus_tag LOCUS_13960 48471 49508 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328363.1 protein_id gnl|my_center|LOCUS_13960 49508 49699 gene locus_tag LOCUS_13970 49508 49699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 49707 50666 gene locus_tag LOCUS_13980 49707 50666 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939508.1 protein_id gnl|my_center|LOCUS_13980 51415 50705 gene locus_tag LOCUS_13990 51415 50705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 >Feature sequence022 1064 183 gene locus_tag LOCUS_14000 1064 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 4240 1067 gene locus_tag LOCUS_14010 4240 1067 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 protein_id gnl|my_center|LOCUS_14010 5664 4237 gene locus_tag LOCUS_14020 5664 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 6398 5661 gene locus_tag LOCUS_14030 6398 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 6474 7112 gene locus_tag LOCUS_14040 6474 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 7479 7892 gene locus_tag LOCUS_14050 gene cueR 7479 7892 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261479.1 protein_id gnl|my_center|LOCUS_14050 7889 8332 gene locus_tag LOCUS_14060 7889 8332 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938935.1 protein_id gnl|my_center|LOCUS_14060 9316 9026 gene locus_tag LOCUS_14070 9316 9026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 9828 9469 gene locus_tag LOCUS_14080 9828 9469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 10345 9872 gene locus_tag LOCUS_14090 10345 9872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 11281 10505 gene locus_tag LOCUS_14100 11281 10505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 12285 11281 gene locus_tag LOCUS_14110 12285 11281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 13025 12282 gene locus_tag LOCUS_14120 13025 12282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 14323 13211 gene locus_tag LOCUS_14130 14323 13211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 15036 14539 gene locus_tag LOCUS_14140 15036 14539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 15662 15033 gene locus_tag LOCUS_14150 15662 15033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 16264 15785 gene locus_tag LOCUS_14160 16264 15785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 16599 17639 gene locus_tag LOCUS_14170 16599 17639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 17933 18157 gene locus_tag LOCUS_14180 17933 18157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 18313 21000 gene locus_tag LOCUS_14190 18313 21000 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460907.1 protein_id gnl|my_center|LOCUS_14190 21354 23501 gene locus_tag LOCUS_14200 gene rnr 21354 23501 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958002.1 protein_id gnl|my_center|LOCUS_14200 23749 24660 gene locus_tag LOCUS_14210 23749 24660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 25056 26732 gene locus_tag LOCUS_14220 25056 26732 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545510.1 protein_id gnl|my_center|LOCUS_14220 29046 26977 gene locus_tag LOCUS_14230 29046 26977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 29744 29070 gene locus_tag LOCUS_14240 29744 29070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 31307 30474 gene locus_tag LOCUS_14250 31307 30474 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_14250 32827 31982 gene locus_tag LOCUS_14260 32827 31982 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_14260 33342 33667 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34645 33914 gene locus_tag LOCUS_14270 34645 33914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 35624 34926 gene locus_tag LOCUS_14280 35624 34926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14280 36167 35658 gene locus_tag LOCUS_14290 36167 35658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14290 36778 36320 gene locus_tag LOCUS_14300 36778 36320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 37044 36856 gene locus_tag LOCUS_14310 37044 36856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 41119 36995 gene locus_tag LOCUS_14320 41119 36995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 42124 41624 gene locus_tag LOCUS_14330 42124 41624 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972020.1 protein_id gnl|my_center|LOCUS_14330 43014 42220 gene locus_tag LOCUS_14340 43014 42220 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_14340 43206 44492 gene locus_tag LOCUS_14350 43206 44492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 45030 45578 gene locus_tag LOCUS_14360 45030 45578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 46817 45591 gene locus_tag LOCUS_14370 46817 45591 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_14370 47530 46826 gene locus_tag LOCUS_14380 47530 46826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 47729 48670 gene locus_tag LOCUS_14390 47729 48670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 49004 48693 gene locus_tag LOCUS_14400 49004 48693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 49229 49888 gene locus_tag LOCUS_14410 49229 49888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 50054 50602 gene locus_tag LOCUS_14420 50054 50602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 50940 50758 gene locus_tag LOCUS_14430 50940 50758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 >Feature sequence023 771 217 gene locus_tag LOCUS_14440 771 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 3145 1022 gene locus_tag LOCUS_14450 3145 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 3920 3453 gene locus_tag LOCUS_14460 3920 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 4776 4351 gene locus_tag LOCUS_14470 4776 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 5313 4954 gene locus_tag LOCUS_14480 gene crcB 5313 4954 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465059.1 protein_id gnl|my_center|LOCUS_14480 5422 7527 gene locus_tag LOCUS_14490 5422 7527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 8981 7581 gene locus_tag LOCUS_14500 8981 7581 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_14500 11275 9575 gene locus_tag LOCUS_14510 11275 9575 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403341.1 protein_id gnl|my_center|LOCUS_14510 11640 11407 gene locus_tag LOCUS_14520 11640 11407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 11859 12785 gene locus_tag LOCUS_14530 11859 12785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 12878 12954 gene locus_tag LOCUS_t00100 12878 12954 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14199 13042 gene locus_tag LOCUS_14540 14199 13042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 14395 14201 gene locus_tag LOCUS_14550 14395 14201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 14679 14392 gene locus_tag LOCUS_14560 14679 14392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 15022 14699 gene locus_tag LOCUS_14570 15022 14699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 15213 15019 gene locus_tag LOCUS_14580 15213 15019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 15446 15210 gene locus_tag LOCUS_14590 15446 15210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 15748 15446 gene locus_tag LOCUS_14600 15748 15446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 16515 15748 gene locus_tag LOCUS_14610 16515 15748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 17312 16518 gene locus_tag LOCUS_14620 17312 16518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 17638 17429 gene locus_tag LOCUS_14630 17638 17429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 17735 18208 gene locus_tag LOCUS_14640 17735 18208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 18347 18586 gene locus_tag LOCUS_14650 18347 18586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 18746 18564 gene locus_tag LOCUS_14660 18746 18564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 18942 19100 gene locus_tag LOCUS_14670 18942 19100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 19150 19377 gene locus_tag LOCUS_14680 19150 19377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 19361 19648 gene locus_tag LOCUS_14690 19361 19648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 20067 19645 gene locus_tag LOCUS_14700 20067 19645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 20503 20171 gene locus_tag LOCUS_14710 20503 20171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 20772 20500 gene locus_tag LOCUS_14720 20772 20500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 21145 20798 gene locus_tag LOCUS_14730 21145 20798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 21440 21138 gene locus_tag LOCUS_14740 21440 21138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 23521 21455 gene locus_tag LOCUS_14750 23521 21455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 24619 23525 gene locus_tag LOCUS_14760 24619 23525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 26807 24612 gene locus_tag LOCUS_14770 26807 24612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 27897 26800 gene locus_tag LOCUS_14780 27897 26800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 28566 27907 gene locus_tag LOCUS_14790 28566 27907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 29048 28563 gene locus_tag LOCUS_14800 29048 28563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 29518 29045 gene locus_tag LOCUS_14810 29518 29045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 31083 29518 gene locus_tag LOCUS_14820 31083 29518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 31781 31080 gene locus_tag LOCUS_14830 31781 31080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 32053 31781 gene locus_tag LOCUS_14840 32053 31781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 33319 32114 gene locus_tag LOCUS_14850 33319 32114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 34308 33337 gene locus_tag LOCUS_14860 34308 33337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 36441 34312 gene locus_tag LOCUS_14870 36441 34312 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070134174.1 protein_id gnl|my_center|LOCUS_14870 38014 36503 gene locus_tag LOCUS_14880 38014 36503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939012.1 protein_id gnl|my_center|LOCUS_14880 38504 37992 gene locus_tag LOCUS_14890 38504 37992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 38594 38773 gene locus_tag LOCUS_14900 38594 38773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 39396 39196 gene locus_tag LOCUS_14910 39396 39196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072625.1 protein_id gnl|my_center|LOCUS_14910 39894 39565 gene locus_tag LOCUS_14920 39894 39565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 40162 39881 gene locus_tag LOCUS_14930 40162 39881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197790.1 protein_id gnl|my_center|LOCUS_14930 40538 40155 gene locus_tag LOCUS_14940 40538 40155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 40927 40535 gene locus_tag LOCUS_14950 40927 40535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 41372 40914 gene locus_tag LOCUS_14960 41372 40914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 41658 41365 gene locus_tag LOCUS_14970 41658 41365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 42083 41655 gene locus_tag LOCUS_14980 42083 41655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 42594 42193 gene locus_tag LOCUS_14990 42594 42193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 42949 42599 gene locus_tag LOCUS_15000 42949 42599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 43274 43038 gene locus_tag LOCUS_15010 43274 43038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 43580 43365 gene locus_tag LOCUS_15020 43580 43365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 44379 43867 gene locus_tag LOCUS_15030 44379 43867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 44688 44380 gene locus_tag LOCUS_15040 44688 44380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 45614 44688 gene locus_tag LOCUS_15050 45614 44688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 45793 45614 gene locus_tag LOCUS_15060 45793 45614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 47744 46629 gene locus_tag LOCUS_15070 47744 46629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 48211 49344 gene locus_tag LOCUS_15080 48211 49344 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699793.1 protein_id gnl|my_center|LOCUS_15080 50184 49429 gene locus_tag LOCUS_15090 50184 49429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 <50930 50351 gene locus_tag LOCUS_15100 <50930 50351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002182762.1:4'-phosphopantetheinyl transferase superfamily protein >Feature sequence024 1571 1290 gene locus_tag LOCUS_15110 1571 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1638 1919 gene locus_tag LOCUS_15120 1638 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 2350 1925 gene locus_tag LOCUS_15130 2350 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 2730 2347 gene locus_tag LOCUS_15140 2730 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 3442 2996 gene locus_tag LOCUS_15150 3442 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 3645 3959 gene locus_tag LOCUS_15160 3645 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 4012 4143 gene locus_tag LOCUS_15170 4012 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 5095 4175 gene locus_tag LOCUS_15180 5095 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 5814 5335 gene locus_tag LOCUS_15190 5814 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 6726 5893 gene locus_tag LOCUS_15200 6726 5893 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706234.1 protein_id gnl|my_center|LOCUS_15200 6807 7550 gene locus_tag LOCUS_15210 6807 7550 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090163.1 protein_id gnl|my_center|LOCUS_15210 8093 7632 gene locus_tag LOCUS_15220 gene slyD 8093 7632 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369410.1 protein_id gnl|my_center|LOCUS_15220 17078 8325 gene locus_tag LOCUS_15230 17078 8325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 18065 17307 gene locus_tag LOCUS_15240 18065 17307 CDS product DUF3750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968947.1 protein_id gnl|my_center|LOCUS_15240 18322 18828 gene locus_tag LOCUS_15250 18322 18828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 19872 18844 gene locus_tag LOCUS_15260 19872 18844 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897013.1 protein_id gnl|my_center|LOCUS_15260 21151 19865 gene locus_tag LOCUS_15270 21151 19865 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187263000.1 protein_id gnl|my_center|LOCUS_15270 22322 21279 gene locus_tag LOCUS_15280 22322 21279 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719807.1 protein_id gnl|my_center|LOCUS_15280 22829 24586 gene locus_tag LOCUS_15290 gene betT 22829 24586 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130624425.1 protein_id gnl|my_center|LOCUS_15290 24828 26078 gene locus_tag LOCUS_15300 24828 26078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 27333 26122 gene locus_tag LOCUS_15310 27333 26122 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123170.1 protein_id gnl|my_center|LOCUS_15310 28437 27463 gene locus_tag LOCUS_15320 gene rocF 28437 27463 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964372.1 protein_id gnl|my_center|LOCUS_15320 29275 28430 gene locus_tag LOCUS_15330 29275 28430 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536473.1 protein_id gnl|my_center|LOCUS_15330 29973 29212 gene locus_tag LOCUS_15340 29973 29212 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546642.1 protein_id gnl|my_center|LOCUS_15340 31748 30042 gene locus_tag LOCUS_15350 31748 30042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 32731 31745 gene locus_tag LOCUS_15360 32731 31745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 33835 32732 gene locus_tag LOCUS_15370 33835 32732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038521.1 protein_id gnl|my_center|LOCUS_15370 34733 33828 gene locus_tag LOCUS_15380 34733 33828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 35730 34741 gene locus_tag LOCUS_15390 35730 34741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 36842 35724 gene locus_tag LOCUS_15400 36842 35724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 37797 37156 gene locus_tag LOCUS_15410 37797 37156 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028708.1 protein_id gnl|my_center|LOCUS_15410 39744 37861 gene locus_tag LOCUS_15420 gene uvrC 39744 37861 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943890.1 protein_id gnl|my_center|LOCUS_15420 40040 40837 gene locus_tag LOCUS_15430 40040 40837 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070950.1 protein_id gnl|my_center|LOCUS_15430 40849 42093 gene locus_tag LOCUS_15440 40849 42093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 44332 42275 gene locus_tag LOCUS_15450 gene uvrB 44332 42275 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_15450 46437 44368 gene locus_tag LOCUS_15460 46437 44368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 46750 47484 gene locus_tag LOCUS_15470 46750 47484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 47486 48835 gene locus_tag LOCUS_15480 47486 48835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence025 405 506 gene locus_tag LOCUS_r00010 405 506 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 916 2301 gene locus_tag LOCUS_15490 916 2301 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002146066.1 protein_id gnl|my_center|LOCUS_15490 2311 3327 gene locus_tag LOCUS_15500 2311 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 4226 3345 gene locus_tag LOCUS_15510 4226 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 5303 4236 gene locus_tag LOCUS_15520 5303 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 5622 5320 gene locus_tag LOCUS_15530 5622 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 5588 5725 gene locus_tag LOCUS_15540 5588 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 6833 6099 gene locus_tag LOCUS_15550 6833 6099 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596706.1 protein_id gnl|my_center|LOCUS_15550 7750 6833 gene locus_tag LOCUS_15560 7750 6833 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115801.1 protein_id gnl|my_center|LOCUS_15560 8652 7864 gene locus_tag LOCUS_15570 8652 7864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 9772 8705 gene locus_tag LOCUS_15580 gene rfbG 9772 8705 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_15580 10016 10918 gene locus_tag LOCUS_15590 10016 10918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 11622 10915 gene locus_tag LOCUS_15600 11622 10915 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125417.1 protein_id gnl|my_center|LOCUS_15600 14132 11619 gene locus_tag LOCUS_15610 14132 11619 CDS product CotH kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891868.1 protein_id gnl|my_center|LOCUS_15610 14921 14247 gene locus_tag LOCUS_15620 14921 14247 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125415.1 protein_id gnl|my_center|LOCUS_15620 15081 16025 gene locus_tag LOCUS_15630 15081 16025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 16120 16962 gene locus_tag LOCUS_15640 gene rfbF 16120 16962 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545825.1 protein_id gnl|my_center|LOCUS_15640 17028 18362 gene locus_tag LOCUS_15650 gene rfbH 17028 18362 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 protein_id gnl|my_center|LOCUS_15650 18365 20173 gene locus_tag LOCUS_15660 gene ilvB 18365 20173 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012310511.1 protein_id gnl|my_center|LOCUS_15660 20174 20833 gene locus_tag LOCUS_15670 gene fabG 20174 20833 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099550.1 protein_id gnl|my_center|LOCUS_15670 20824 21891 gene locus_tag LOCUS_15680 20824 21891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 22965 23438 gene locus_tag LOCUS_15690 22965 23438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 24127 24762 gene locus_tag LOCUS_15700 24127 24762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 24869 26017 gene locus_tag LOCUS_15710 24869 26017 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081585.1 protein_id gnl|my_center|LOCUS_15710 26018 27403 gene locus_tag LOCUS_15720 26018 27403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 27405 28202 gene locus_tag LOCUS_15730 27405 28202 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107719.1 protein_id gnl|my_center|LOCUS_15730 29182 28199 gene locus_tag LOCUS_15740 29182 28199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 30229 29240 gene locus_tag LOCUS_15750 gene galE 30229 29240 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880665.1 protein_id gnl|my_center|LOCUS_15750 30691 30281 gene locus_tag LOCUS_15760 30691 30281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 31310 30684 gene locus_tag LOCUS_15770 31310 30684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 31475 32065 gene locus_tag LOCUS_15780 31475 32065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266513.1 protein_id gnl|my_center|LOCUS_15780 32053 32730 gene locus_tag LOCUS_15790 32053 32730 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760196.1 protein_id gnl|my_center|LOCUS_15790 32727 33692 gene locus_tag LOCUS_15800 32727 33692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 33694 35256 gene locus_tag LOCUS_15810 33694 35256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 35249 35980 gene locus_tag LOCUS_15820 35249 35980 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_15820 35980 38070 gene locus_tag LOCUS_15830 35980 38070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 38072 39019 gene locus_tag LOCUS_15840 38072 39019 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088745.1 protein_id gnl|my_center|LOCUS_15840 39051 40370 gene locus_tag LOCUS_15850 39051 40370 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_15850 40597 41049 gene locus_tag LOCUS_15860 40597 41049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 41046 41483 gene locus_tag LOCUS_15870 41046 41483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 42349 41480 gene locus_tag LOCUS_15880 gene rfbD 42349 41480 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767804.1 protein_id gnl|my_center|LOCUS_15880 43199 42351 gene locus_tag LOCUS_15890 43199 42351 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657976.1 protein_id gnl|my_center|LOCUS_15890 43381 44250 gene locus_tag LOCUS_15900 gene rfbA 43381 44250 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963425.1 protein_id gnl|my_center|LOCUS_15900 44247 44804 gene locus_tag LOCUS_15910 gene rfbC 44247 44804 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787720.1 protein_id gnl|my_center|LOCUS_15910 44797 45807 gene locus_tag LOCUS_15920 gene rfbB 44797 45807 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723092.1 protein_id gnl|my_center|LOCUS_15920 47722 45878 gene locus_tag LOCUS_15930 47722 45878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 >Feature sequence026 57 842 gene locus_tag LOCUS_15940 57 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 878 1546 gene locus_tag LOCUS_15950 878 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1543 2550 gene locus_tag LOCUS_15960 gene lpxD 1543 2550 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693262.1 protein_id gnl|my_center|LOCUS_15960 2594 3514 gene locus_tag LOCUS_15970 2594 3514 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066493.1 protein_id gnl|my_center|LOCUS_15970 3501 4139 gene locus_tag LOCUS_15980 3501 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 4196 5101 gene locus_tag LOCUS_15990 4196 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 5638 6165 gene locus_tag LOCUS_16000 5638 6165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 6165 6605 gene locus_tag LOCUS_16010 6165 6605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 6680 7483 gene locus_tag LOCUS_16020 6680 7483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 7498 8088 gene locus_tag LOCUS_16030 7498 8088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 9863 8211 gene locus_tag LOCUS_16040 9863 8211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 10331 10648 gene locus_tag LOCUS_16050 10331 10648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 11100 10969 gene locus_tag LOCUS_16060 11100 10969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 11930 11139 gene locus_tag LOCUS_16070 11930 11139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 12087 13145 gene locus_tag LOCUS_16080 gene shyA 12087 13145 CDS product peptidoglycan DD-metalloendopeptidase ShyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227341.1 protein_id gnl|my_center|LOCUS_16080 14380 13142 gene locus_tag LOCUS_16090 14380 13142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 14642 15511 gene locus_tag LOCUS_16100 gene galU 14642 15511 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048121.1 protein_id gnl|my_center|LOCUS_16100 15512 16348 gene locus_tag LOCUS_16110 15512 16348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 16348 18366 gene locus_tag LOCUS_16120 16348 18366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 18499 19356 gene locus_tag LOCUS_16130 18499 19356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 19383 20573 gene locus_tag LOCUS_16140 19383 20573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 21136 22008 gene locus_tag LOCUS_16150 gene rpsB 21136 22008 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546300.1 protein_id gnl|my_center|LOCUS_16150 22091 22738 gene locus_tag LOCUS_16160 gene tsf 22091 22738 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_16160 22765 23490 gene locus_tag LOCUS_16170 gene pyrH 22765 23490 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_16170 23487 24044 gene locus_tag LOCUS_16180 gene frr 23487 24044 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_16180 24063 24800 gene locus_tag LOCUS_16190 24063 24800 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931959.1 protein_id gnl|my_center|LOCUS_16190 24802 25614 gene locus_tag LOCUS_16200 24802 25614 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_16200 26019 27686 gene locus_tag LOCUS_16210 26019 27686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 27683 28396 gene locus_tag LOCUS_16220 gene tsaB 27683 28396 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860649.1 protein_id gnl|my_center|LOCUS_16220 28404 29369 gene locus_tag LOCUS_16230 28404 29369 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657813.1 protein_id gnl|my_center|LOCUS_16230 29374 30111 gene locus_tag LOCUS_16240 29374 30111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 30113 31099 gene locus_tag LOCUS_16250 30113 31099 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_16250 31092 31799 gene locus_tag LOCUS_16260 31092 31799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 32148 32633 gene locus_tag LOCUS_16270 32148 32633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 32637 33353 gene locus_tag LOCUS_16280 32637 33353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 34443 33400 gene locus_tag LOCUS_16290 gene mltG 34443 33400 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_16290 35933 34446 gene locus_tag LOCUS_16300 gene astD 35933 34446 CDS product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212030.1 protein_id gnl|my_center|LOCUS_16300 36956 35943 gene locus_tag LOCUS_16310 gene astA 36956 35943 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169035.1 protein_id gnl|my_center|LOCUS_16310 38277 36958 gene locus_tag LOCUS_16320 38277 36958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 39648 38278 gene locus_tag LOCUS_16330 39648 38278 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338764.1 protein_id gnl|my_center|LOCUS_16330 39801 40556 gene locus_tag LOCUS_16340 39801 40556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 40561 41142 gene locus_tag LOCUS_16350 40561 41142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 41114 42166 gene locus_tag LOCUS_16360 41114 42166 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411484.1 protein_id gnl|my_center|LOCUS_16360 44394 42562 gene locus_tag LOCUS_16370 44394 42562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 44831 45520 gene locus_tag LOCUS_16380 44831 45520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 45507 46232 gene locus_tag LOCUS_16390 45507 46232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 46243 46773 gene locus_tag LOCUS_16400 gene hpt 46243 46773 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416006.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence027 687 286 gene locus_tag LOCUS_16410 687 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1261 875 gene locus_tag LOCUS_16420 gene gcvH 1261 875 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831963.1 protein_id gnl|my_center|LOCUS_16420 2364 1264 gene locus_tag LOCUS_16430 gene gcvT 2364 1264 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933448.1 protein_id gnl|my_center|LOCUS_16430 3273 2437 gene locus_tag LOCUS_16440 gene folD 3273 2437 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_16440 4145 3399 gene locus_tag LOCUS_16450 4145 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 4966 4142 gene locus_tag LOCUS_16460 4966 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 5771 5019 gene locus_tag LOCUS_16470 5771 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 6298 5768 gene locus_tag LOCUS_16480 6298 5768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 6517 6774 gene locus_tag LOCUS_16490 6517 6774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 8060 6864 gene locus_tag LOCUS_16500 8060 6864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 8212 8868 gene locus_tag LOCUS_16510 8212 8868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 8928 9203 gene locus_tag LOCUS_16520 8928 9203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 9203 9592 gene locus_tag LOCUS_16530 9203 9592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 10415 10936 gene locus_tag LOCUS_16540 10415 10936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 10946 11878 gene locus_tag LOCUS_16550 10946 11878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 14120 11913 gene locus_tag LOCUS_16560 14120 11913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 14560 15867 gene locus_tag LOCUS_16570 14560 15867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 15860 16948 gene locus_tag LOCUS_16580 15860 16948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 17514 17062 gene locus_tag LOCUS_16590 17514 17062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 18208 17717 gene locus_tag LOCUS_16600 18208 17717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 18393 18656 gene locus_tag LOCUS_16610 18393 18656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 18766 19257 gene locus_tag LOCUS_16620 gene msrA 18766 19257 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060839.1 protein_id gnl|my_center|LOCUS_16620 20419 19310 gene locus_tag LOCUS_16630 20419 19310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 24823 20447 gene locus_tag LOCUS_16640 24823 20447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 25571 25053 gene locus_tag LOCUS_16650 25571 25053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 27403 25613 gene locus_tag LOCUS_16660 gene aspS 27403 25613 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840895.1 protein_id gnl|my_center|LOCUS_16660 28706 27414 gene locus_tag LOCUS_16670 gene hisS 28706 27414 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460333.1 protein_id gnl|my_center|LOCUS_16670 29177 29491 gene locus_tag LOCUS_16680 29177 29491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 29495 30646 gene locus_tag LOCUS_16690 29495 30646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 30761 31654 gene locus_tag LOCUS_16700 30761 31654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 31973 32803 gene locus_tag LOCUS_16710 31973 32803 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227801.1 protein_id gnl|my_center|LOCUS_16710 32800 33159 gene locus_tag LOCUS_16720 32800 33159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 33499 34332 gene locus_tag LOCUS_16730 33499 34332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 36709 34556 gene locus_tag LOCUS_16740 36709 34556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 37265 38155 gene locus_tag LOCUS_16750 37265 38155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 39016 38216 gene locus_tag LOCUS_16760 39016 38216 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943678.1 protein_id gnl|my_center|LOCUS_16760 39871 39059 gene locus_tag LOCUS_16770 39871 39059 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943679.1 protein_id gnl|my_center|LOCUS_16770 41427 39886 gene locus_tag LOCUS_16780 41427 39886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 43516 41417 gene locus_tag LOCUS_16790 gene flhA 43516 41417 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_16790 44580 43516 gene locus_tag LOCUS_16800 44580 43516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16800 45404 44625 gene locus_tag LOCUS_16810 gene fliR 45404 44625 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852712.1 protein_id gnl|my_center|LOCUS_16810 45678 45406 gene locus_tag LOCUS_16820 gene fliQ 45678 45406 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816214.1 protein_id gnl|my_center|LOCUS_16820 46045 45689 gene locus_tag LOCUS_16830 46045 45689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence028 2428 3366 gene locus_tag LOCUS_16840 2428 3366 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383432.1 protein_id gnl|my_center|LOCUS_16840 3587 3363 gene locus_tag LOCUS_16850 3587 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 6155 3648 gene locus_tag LOCUS_16860 6155 3648 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421594.1 protein_id gnl|my_center|LOCUS_16860 6393 6980 gene locus_tag LOCUS_16870 6393 6980 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115862.1 protein_id gnl|my_center|LOCUS_16870 7112 7720 gene locus_tag LOCUS_16880 7112 7720 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964079.1 protein_id gnl|my_center|LOCUS_16880 7824 8348 gene locus_tag LOCUS_16890 7824 8348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 9388 8390 gene locus_tag LOCUS_16900 9388 8390 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_16900 10062 9799 gene locus_tag LOCUS_16910 10062 9799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 10650 10063 gene locus_tag LOCUS_16920 10650 10063 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091628.1 protein_id gnl|my_center|LOCUS_16920 11545 10664 gene locus_tag LOCUS_16930 11545 10664 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933671.1 protein_id gnl|my_center|LOCUS_16930 12030 11563 gene locus_tag LOCUS_16940 12030 11563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 12152 13525 gene locus_tag LOCUS_16950 12152 13525 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113084.1 protein_id gnl|my_center|LOCUS_16950 13745 14422 gene locus_tag LOCUS_16960 13745 14422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 14485 14880 gene locus_tag LOCUS_16970 14485 14880 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933012.1 protein_id gnl|my_center|LOCUS_16970 14881 16056 gene locus_tag LOCUS_16980 14881 16056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 16233 16829 gene locus_tag LOCUS_16990 16233 16829 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263757.1 protein_id gnl|my_center|LOCUS_16990 16981 17262 gene locus_tag LOCUS_17000 16981 17262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 18162 17263 gene locus_tag LOCUS_17010 18162 17263 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707859.1 protein_id gnl|my_center|LOCUS_17010 18679 19461 gene locus_tag LOCUS_17020 18679 19461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 19458 20696 gene locus_tag LOCUS_17030 19458 20696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 20689 21570 gene locus_tag LOCUS_17040 20689 21570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 22165 22800 gene locus_tag LOCUS_17050 22165 22800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 22775 24229 gene locus_tag LOCUS_17060 22775 24229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 24207 27767 gene locus_tag LOCUS_17070 24207 27767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 28117 29682 gene locus_tag LOCUS_17080 28117 29682 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479531.1 protein_id gnl|my_center|LOCUS_17080 31365 29743 gene locus_tag LOCUS_17090 31365 29743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 32750 31395 gene locus_tag LOCUS_17100 32750 31395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 34155 32797 gene locus_tag LOCUS_17110 34155 32797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 36130 34172 gene locus_tag LOCUS_17120 36130 34172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 36986 36357 gene locus_tag LOCUS_17130 36986 36357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 37850 38377 gene locus_tag LOCUS_17140 37850 38377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 38355 38993 gene locus_tag LOCUS_17150 38355 38993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 39648 39064 gene locus_tag LOCUS_17160 39648 39064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 40578 39823 gene locus_tag LOCUS_17170 40578 39823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 42803 40551 gene locus_tag LOCUS_17180 42803 40551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 43246 43321 gene locus_tag LOCUS_t00110 43246 43321 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 44264 43575 gene locus_tag LOCUS_17190 44264 43575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 44568 44413 gene locus_tag LOCUS_17200 44568 44413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 <45373 44609 gene locus_tag LOCUS_17210 <45373 44609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937922.1:sigma-54 dependent transcriptional regulator >Feature sequence029 858 3932 gene locus_tag LOCUS_17220 858 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 4357 3929 gene locus_tag LOCUS_17230 4357 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 4656 5765 gene locus_tag LOCUS_17240 gene bcd 4656 5765 CDS product branched-chain amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230309.1 protein_id gnl|my_center|LOCUS_17240 6738 6283 gene locus_tag LOCUS_17250 6738 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 8100 7825 gene locus_tag LOCUS_17260 8100 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 8318 8650 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10883 9372 gene locus_tag LOCUS_17270 10883 9372 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890583.1 protein_id gnl|my_center|LOCUS_17270 10993 12234 gene locus_tag LOCUS_17280 10993 12234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 12761 12336 gene locus_tag LOCUS_17290 12761 12336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111730.1 protein_id gnl|my_center|LOCUS_17290 12930 12844 gene locus_tag LOCUS_t00120 12930 12844 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13146 13508 gene locus_tag LOCUS_17300 13146 13508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 14293 13589 gene locus_tag LOCUS_17310 14293 13589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 14605 14354 gene locus_tag LOCUS_17320 14605 14354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 15085 15282 gene locus_tag LOCUS_17330 15085 15282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 17098 15284 gene locus_tag LOCUS_17340 17098 15284 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208177.1 protein_id gnl|my_center|LOCUS_17340 17353 17123 gene locus_tag LOCUS_17350 17353 17123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 17548 17760 gene locus_tag LOCUS_17360 17548 17760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 19390 18212 gene locus_tag LOCUS_17370 19390 18212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 20580 19387 gene locus_tag LOCUS_17380 20580 19387 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627649.1 protein_id gnl|my_center|LOCUS_17380 20854 21621 gene locus_tag LOCUS_17390 20854 21621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 21846 25595 gene locus_tag LOCUS_17400 21846 25595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 25595 28732 gene locus_tag LOCUS_17410 25595 28732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 28883 29929 gene locus_tag LOCUS_17420 28883 29929 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254072.1 protein_id gnl|my_center|LOCUS_17420 30222 31271 gene locus_tag LOCUS_17430 30222 31271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 31430 33682 gene locus_tag LOCUS_17440 31430 33682 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941951.1 protein_id gnl|my_center|LOCUS_17440 35111 33729 gene locus_tag LOCUS_17450 gene asnS 35111 33729 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937318.1 protein_id gnl|my_center|LOCUS_17450 35210 35836 gene locus_tag LOCUS_17460 35210 35836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 36599 35826 gene locus_tag LOCUS_17470 36599 35826 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_17470 38531 36609 gene locus_tag LOCUS_17480 38531 36609 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_17480 39214 38546 gene locus_tag LOCUS_17490 39214 38546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_17490 39836 39321 gene locus_tag LOCUS_17500 39836 39321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 41257 39989 gene locus_tag LOCUS_17510 41257 39989 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356704.1 protein_id gnl|my_center|LOCUS_17510 42304 41459 gene locus_tag LOCUS_17520 42304 41459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence030 884 69 gene locus_tag LOCUS_17530 884 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 2447 1230 gene locus_tag LOCUS_17540 2447 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 2761 3300 gene locus_tag LOCUS_17550 2761 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 5763 3349 gene locus_tag LOCUS_17560 gene lon 5763 3349 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943811.1 protein_id gnl|my_center|LOCUS_17560 6131 5925 gene locus_tag LOCUS_17570 6131 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 8163 6238 gene locus_tag LOCUS_17580 8163 6238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 9076 8165 gene locus_tag LOCUS_17590 9076 8165 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940692.1 protein_id gnl|my_center|LOCUS_17590 9684 9097 gene locus_tag LOCUS_17600 gene grpE 9684 9097 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296525.1 protein_id gnl|my_center|LOCUS_17600 11157 10009 gene locus_tag LOCUS_17610 gene hemW 11157 10009 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583471.1 protein_id gnl|my_center|LOCUS_17610 11174 13777 gene locus_tag LOCUS_17620 11174 13777 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929460.1 protein_id gnl|my_center|LOCUS_17620 13953 14555 gene locus_tag LOCUS_17630 13953 14555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 14574 15089 gene locus_tag LOCUS_17640 14574 15089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 15089 15832 gene locus_tag LOCUS_17650 15089 15832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 15967 17529 gene locus_tag LOCUS_17660 15967 17529 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762326.1 protein_id gnl|my_center|LOCUS_17660 17539 19032 gene locus_tag LOCUS_17670 gene accC 17539 19032 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790279.1 protein_id gnl|my_center|LOCUS_17670 19032 19556 gene locus_tag LOCUS_17680 19032 19556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 20950 19706 gene locus_tag LOCUS_17690 20950 19706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 21220 21510 gene locus_tag LOCUS_17700 21220 21510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 22322 21507 gene locus_tag LOCUS_17710 22322 21507 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306772.1 protein_id gnl|my_center|LOCUS_17710 23633 22332 gene locus_tag LOCUS_17720 23633 22332 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082160.1 protein_id gnl|my_center|LOCUS_17720 24416 23637 gene locus_tag LOCUS_17730 gene deoC 24416 23637 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017446.1 protein_id gnl|my_center|LOCUS_17730 24491 24781 gene locus_tag LOCUS_17740 24491 24781 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243829.1 protein_id gnl|my_center|LOCUS_17740 24762 25193 gene locus_tag LOCUS_17750 24762 25193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 26340 25195 gene locus_tag LOCUS_17760 26340 25195 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_17760 26490 27995 gene locus_tag LOCUS_17770 gene rng 26490 27995 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_17770 28444 30309 gene locus_tag LOCUS_17780 28444 30309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 30397 30735 gene locus_tag LOCUS_17790 30397 30735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 30938 31963 gene locus_tag LOCUS_17800 30938 31963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 32152 31964 gene locus_tag LOCUS_17810 32152 31964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 32432 32740 gene locus_tag LOCUS_17820 gene rplU 32432 32740 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216394.1 protein_id gnl|my_center|LOCUS_17820 32762 33016 gene locus_tag LOCUS_17830 gene rpmA 32762 33016 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943850.1 protein_id gnl|my_center|LOCUS_17830 33239 34276 gene locus_tag LOCUS_17840 gene obgE 33239 34276 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943831.1 protein_id gnl|my_center|LOCUS_17840 34269 35294 gene locus_tag LOCUS_17850 34269 35294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 35284 35754 gene locus_tag LOCUS_17860 gene rlmH 35284 35754 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966801.1 protein_id gnl|my_center|LOCUS_17860 35747 37258 gene locus_tag LOCUS_17870 gene gpmI 35747 37258 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861866.1 protein_id gnl|my_center|LOCUS_17870 37268 37990 gene locus_tag LOCUS_17880 gene lepB 37268 37990 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311536.1 protein_id gnl|my_center|LOCUS_17880 38202 39470 gene locus_tag LOCUS_17890 38202 39470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 39964 40398 gene locus_tag LOCUS_17900 39964 40398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 40395 41117 gene locus_tag LOCUS_17910 40395 41117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 41121 42509 gene locus_tag LOCUS_17920 gene rimO 41121 42509 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence031 1012 107 gene locus_tag LOCUS_17930 1012 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 1841 1014 gene locus_tag LOCUS_17940 1841 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 3350 2139 gene locus_tag LOCUS_17950 3350 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 4726 3455 gene locus_tag LOCUS_17960 4726 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 4765 6345 gene locus_tag LOCUS_17970 4765 6345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 6638 7687 gene locus_tag LOCUS_17980 6638 7687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 8409 7759 gene locus_tag LOCUS_17990 gene udk 8409 7759 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257573.1 protein_id gnl|my_center|LOCUS_17990 8738 9736 gene locus_tag LOCUS_18000 8738 9736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 10971 9733 gene locus_tag LOCUS_18010 10971 9733 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208331.1 protein_id gnl|my_center|LOCUS_18010 11852 11019 gene locus_tag LOCUS_18020 11852 11019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 13387 11909 gene locus_tag LOCUS_18030 13387 11909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965677.1 protein_id gnl|my_center|LOCUS_18030 13920 13387 gene locus_tag LOCUS_18040 13920 13387 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222951.1 protein_id gnl|my_center|LOCUS_18040 15167 14013 gene locus_tag LOCUS_18050 15167 14013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 15756 15262 gene locus_tag LOCUS_18060 15756 15262 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122280.1 protein_id gnl|my_center|LOCUS_18060 19757 15879 gene locus_tag LOCUS_18070 19757 15879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 20733 19768 gene locus_tag LOCUS_18080 20733 19768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 22460 20745 gene locus_tag LOCUS_18090 22460 20745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 22653 23006 gene locus_tag LOCUS_18100 22653 23006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 23481 23059 gene locus_tag LOCUS_18110 23481 23059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 24623 23481 gene locus_tag LOCUS_18120 24623 23481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 25362 24646 gene locus_tag LOCUS_18130 25362 24646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 25501 26289 gene locus_tag LOCUS_18140 25501 26289 CDS product rRNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039831.1 protein_id gnl|my_center|LOCUS_18140 26276 27385 gene locus_tag LOCUS_18150 26276 27385 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423769.1 protein_id gnl|my_center|LOCUS_18150 27581 28378 gene locus_tag LOCUS_18160 27581 28378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 28375 29958 gene locus_tag LOCUS_18170 28375 29958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 30674 30249 gene locus_tag LOCUS_18180 30674 30249 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021439.1 protein_id gnl|my_center|LOCUS_18180 32111 31098 gene locus_tag LOCUS_18190 32111 31098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 33045 32056 gene locus_tag LOCUS_18200 33045 32056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 33303 33142 gene locus_tag LOCUS_18210 33303 33142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 33938 33711 gene locus_tag LOCUS_18220 33938 33711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 34322 33990 gene locus_tag LOCUS_18230 34322 33990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 34750 34322 gene locus_tag LOCUS_18240 34750 34322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 35081 34794 gene locus_tag LOCUS_18250 35081 34794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 35971 35180 gene locus_tag LOCUS_18260 35971 35180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 36881 36111 gene locus_tag LOCUS_18270 36881 36111 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918403.1 protein_id gnl|my_center|LOCUS_18270 37234 36956 gene locus_tag LOCUS_18280 37234 36956 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006452256.1 protein_id gnl|my_center|LOCUS_18280 38190 37432 gene locus_tag LOCUS_18290 38190 37432 CDS product DUF1829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213043995.1 protein_id gnl|my_center|LOCUS_18290 38627 38187 gene locus_tag LOCUS_18300 38627 38187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 38695 38877 gene locus_tag LOCUS_18310 38695 38877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 39594 38896 gene locus_tag LOCUS_18320 39594 38896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 40166 39900 gene locus_tag LOCUS_18330 40166 39900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 <41554 40214 gene locus_tag LOCUS_18340 <41554 40214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099241618.1:RHS repeat-associated core domain-containing protein >Feature sequence032 800 15 gene locus_tag LOCUS_18350 800 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 2912 1533 gene locus_tag LOCUS_18360 gene ahcY 2912 1533 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117570.1 protein_id gnl|my_center|LOCUS_18360 3782 3024 gene locus_tag LOCUS_18370 gene map 3782 3024 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142406.1 protein_id gnl|my_center|LOCUS_18370 3967 5007 gene locus_tag LOCUS_18380 3967 5007 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016469.1 protein_id gnl|my_center|LOCUS_18380 5115 6053 gene locus_tag LOCUS_18390 5115 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 7049 6057 gene locus_tag LOCUS_18400 7049 6057 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_18400 7612 7148 gene locus_tag LOCUS_18410 gene greB 7612 7148 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225493.1 protein_id gnl|my_center|LOCUS_18410 7735 8472 gene locus_tag LOCUS_18420 gene lexA 7735 8472 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392634.1 protein_id gnl|my_center|LOCUS_18420 9489 8629 gene locus_tag LOCUS_18430 9489 8629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 9788 10318 gene locus_tag LOCUS_18440 9788 10318 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029425.1 protein_id gnl|my_center|LOCUS_18440 10320 12920 gene locus_tag LOCUS_18450 gene pepN 10320 12920 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003043025.1 protein_id gnl|my_center|LOCUS_18450 13029 14240 gene locus_tag LOCUS_18460 13029 14240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 15628 14237 gene locus_tag LOCUS_18470 15628 14237 CDS product Mur ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708409.1 protein_id gnl|my_center|LOCUS_18470 16708 15638 gene locus_tag LOCUS_18480 16708 15638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 17607 16693 gene locus_tag LOCUS_18490 17607 16693 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640099.1 protein_id gnl|my_center|LOCUS_18490 18922 17609 gene locus_tag LOCUS_18500 gene purB 18922 17609 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545083.1 protein_id gnl|my_center|LOCUS_18500 20189 18861 gene locus_tag LOCUS_18510 20189 18861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 20462 21739 gene locus_tag LOCUS_18520 20462 21739 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765419.1 protein_id gnl|my_center|LOCUS_18520 22573 21710 gene locus_tag LOCUS_18530 22573 21710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 22844 23944 gene locus_tag LOCUS_18540 22844 23944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 23961 24479 gene locus_tag LOCUS_18550 23961 24479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 24527 26551 gene locus_tag LOCUS_18560 24527 26551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 27284 27841 gene locus_tag LOCUS_18570 27284 27841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 27923 28099 gene locus_tag LOCUS_18580 gene rpmF 27923 28099 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638547.1 protein_id gnl|my_center|LOCUS_18580 28145 29134 gene locus_tag LOCUS_18590 28145 29134 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490641.1 protein_id gnl|my_center|LOCUS_18590 29149 30087 gene locus_tag LOCUS_18600 gene fabD 29149 30087 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245314.1 protein_id gnl|my_center|LOCUS_18600 30103 30849 gene locus_tag LOCUS_18610 gene fabG 30103 30849 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830161.1 protein_id gnl|my_center|LOCUS_18610 30864 31109 gene locus_tag LOCUS_18620 gene acpP 30864 31109 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280528.1 protein_id gnl|my_center|LOCUS_18620 31113 32390 gene locus_tag LOCUS_18630 gene fabF 31113 32390 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_18630 33006 32434 gene locus_tag LOCUS_18640 33006 32434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 33371 34111 gene locus_tag LOCUS_18650 gene coxK1 33371 34111 CDS product Dot/Icm T4SS effector protein kinase CoxK1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957418.1 protein_id gnl|my_center|LOCUS_18650 34092 34874 gene locus_tag LOCUS_18660 34092 34874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 35467 34937 gene locus_tag LOCUS_18670 35467 34937 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233562.1 protein_id gnl|my_center|LOCUS_18670 35919 35485 gene locus_tag LOCUS_18680 gene rpiB 35919 35485 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_18680 36223 37470 gene locus_tag LOCUS_18690 36223 37470 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_18690 37474 38793 gene locus_tag LOCUS_18700 37474 38793 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918276.1 protein_id gnl|my_center|LOCUS_18700 38846 39334 gene locus_tag LOCUS_18710 38846 39334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 39498 40400 gene locus_tag LOCUS_18720 39498 40400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 40767 40447 gene locus_tag LOCUS_18730 40767 40447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence033 170 85 gene locus_tag LOCUS_t00130 170 85 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 251 176 gene locus_tag LOCUS_t00140 251 176 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 600 1322 gene locus_tag LOCUS_18740 gene rlmB 600 1322 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706327.1 protein_id gnl|my_center|LOCUS_18740 1820 1338 gene locus_tag LOCUS_18750 1820 1338 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858683.1 protein_id gnl|my_center|LOCUS_18750 2274 1858 gene locus_tag LOCUS_18760 2274 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 3055 2543 gene locus_tag LOCUS_18770 3055 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 4298 3369 gene locus_tag LOCUS_18780 4298 3369 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949138.1 protein_id gnl|my_center|LOCUS_18780 5699 4302 gene locus_tag LOCUS_18790 gene legY 5699 4302 CDS product Dot/Icm T4SS effector LegY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946171.1 protein_id gnl|my_center|LOCUS_18790 5791 7341 gene locus_tag LOCUS_18800 5791 7341 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_18800 8831 7413 gene locus_tag LOCUS_18810 8831 7413 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963447.1 protein_id gnl|my_center|LOCUS_18810 9981 8851 gene locus_tag LOCUS_18820 9981 8851 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 protein_id gnl|my_center|LOCUS_18820 10333 11127 gene locus_tag LOCUS_18830 10333 11127 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104990.1 protein_id gnl|my_center|LOCUS_18830 12438 11179 gene locus_tag LOCUS_18840 12438 11179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 13871 12435 gene locus_tag LOCUS_18850 13871 12435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 15058 13853 gene locus_tag LOCUS_18860 15058 13853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 16443 15169 gene locus_tag LOCUS_18870 16443 15169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 18118 16820 gene locus_tag LOCUS_18880 18118 16820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 18801 19367 gene locus_tag LOCUS_18890 18801 19367 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921763.1 protein_id gnl|my_center|LOCUS_18890 19415 20143 gene locus_tag LOCUS_18900 19415 20143 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143609.1 protein_id gnl|my_center|LOCUS_18900 20156 21151 gene locus_tag LOCUS_18910 20156 21151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 23061 21355 gene locus_tag LOCUS_18920 23061 21355 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_18920 23944 23516 gene locus_tag LOCUS_18930 23944 23516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 26289 24370 gene locus_tag LOCUS_18940 26289 24370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 26669 26286 gene locus_tag LOCUS_18950 26669 26286 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444454.1 protein_id gnl|my_center|LOCUS_18950 28077 26902 gene locus_tag LOCUS_18960 28077 26902 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074216.1 protein_id gnl|my_center|LOCUS_18960 28207 28812 gene locus_tag LOCUS_18970 28207 28812 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035488.1 protein_id gnl|my_center|LOCUS_18970 30618 28906 gene locus_tag LOCUS_18980 30618 28906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 32047 30623 gene locus_tag LOCUS_18990 32047 30623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 32695 32069 gene locus_tag LOCUS_19000 32695 32069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 34710 32698 gene locus_tag LOCUS_19010 34710 32698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 36575 34713 gene locus_tag LOCUS_19020 36575 34713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 38219 36864 gene locus_tag LOCUS_19030 38219 36864 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_19030 40429 38228 gene locus_tag LOCUS_19040 40429 38228 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_19040 40908 40438 gene locus_tag LOCUS_19050 gene ribH 40908 40438 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957715.1 protein_id gnl|my_center|LOCUS_19050 >Feature sequence034 963 190 gene locus_tag LOCUS_19060 963 190 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140499.1 protein_id gnl|my_center|LOCUS_19060 1741 1361 gene locus_tag LOCUS_19070 1741 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 2124 1750 gene locus_tag LOCUS_19080 2124 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 4424 2109 gene locus_tag LOCUS_19090 4424 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 7170 4660 gene locus_tag LOCUS_19100 7170 4660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 7354 9441 gene locus_tag LOCUS_19110 7354 9441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 9489 10997 gene locus_tag LOCUS_19120 9489 10997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 11225 10998 gene locus_tag LOCUS_19130 11225 10998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 11288 11986 gene locus_tag LOCUS_19140 11288 11986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 14379 11983 gene locus_tag LOCUS_19150 14379 11983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 15576 14611 gene locus_tag LOCUS_19160 15576 14611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 16551 15814 gene locus_tag LOCUS_19170 gene pdxJ 16551 15814 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095364.1 protein_id gnl|my_center|LOCUS_19170 17928 16561 gene locus_tag LOCUS_19180 gene glmM 17928 16561 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_19180 18335 17928 gene locus_tag LOCUS_19190 18335 17928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 19091 18339 gene locus_tag LOCUS_19200 gene cdaA 19091 18339 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_19200 21176 19182 gene locus_tag LOCUS_19210 gene ftsH 21176 19182 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_19210 22247 21285 gene locus_tag LOCUS_19220 22247 21285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 23083 22244 gene locus_tag LOCUS_19230 23083 22244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 24573 23092 gene locus_tag LOCUS_19240 gene lysS 24573 23092 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809769.1 protein_id gnl|my_center|LOCUS_19240 25523 24603 gene locus_tag LOCUS_19250 25523 24603 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390262.1 protein_id gnl|my_center|LOCUS_19250 25790 26341 gene locus_tag LOCUS_19260 25790 26341 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391278.1 protein_id gnl|my_center|LOCUS_19260 28133 26406 gene locus_tag LOCUS_19270 28133 26406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 29168 28287 gene locus_tag LOCUS_19280 29168 28287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 30228 29425 gene locus_tag LOCUS_19290 30228 29425 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_19290 30902 30240 gene locus_tag LOCUS_19300 gene mpaA 30902 30240 CDS product murein tripeptide amidase MpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220315.1 protein_id gnl|my_center|LOCUS_19300 32119 30899 gene locus_tag LOCUS_19310 32119 30899 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225196.1 protein_id gnl|my_center|LOCUS_19310 32907 32344 gene locus_tag LOCUS_19320 32907 32344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 33948 32908 gene locus_tag LOCUS_19330 33948 32908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 34676 33945 gene locus_tag LOCUS_19340 34676 33945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 35500 34673 gene locus_tag LOCUS_19350 35500 34673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 35834 35622 gene locus_tag LOCUS_19360 35834 35622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 38116 35831 gene locus_tag LOCUS_19370 38116 35831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 38736 38356 gene locus_tag LOCUS_19380 38736 38356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence035 3 1148 gene locus_tag LOCUS_19390 3 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 2769 1141 gene locus_tag LOCUS_19400 2769 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 3455 2766 gene locus_tag LOCUS_19410 3455 2766 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546865.1 protein_id gnl|my_center|LOCUS_19410 4479 3481 gene locus_tag LOCUS_19420 4479 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 5088 4507 gene locus_tag LOCUS_19430 5088 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 5151 5327 gene locus_tag LOCUS_19440 5151 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 5848 5291 gene locus_tag LOCUS_19450 5848 5291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 6843 6052 gene locus_tag LOCUS_19460 6843 6052 CDS product RMD1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100934544.1 protein_id gnl|my_center|LOCUS_19460 7045 7542 gene locus_tag LOCUS_19470 7045 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 8323 7571 gene locus_tag LOCUS_19480 8323 7571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 8547 10070 gene locus_tag LOCUS_19490 8547 10070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 10071 11753 gene locus_tag LOCUS_19500 10071 11753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 11753 12490 gene locus_tag LOCUS_19510 11753 12490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 12585 12707 gene locus_tag LOCUS_19520 12585 12707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 12971 14161 gene locus_tag LOCUS_19530 gene araJ 12971 14161 CDS product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705512.1 protein_id gnl|my_center|LOCUS_19530 15249 14158 gene locus_tag LOCUS_19540 15249 14158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 15723 16124 gene locus_tag LOCUS_19550 15723 16124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 16289 17368 gene locus_tag LOCUS_19560 16289 17368 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273200.1 protein_id gnl|my_center|LOCUS_19560 17556 18200 gene locus_tag LOCUS_19570 17556 18200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 19270 18221 gene locus_tag LOCUS_19580 19270 18221 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190814.1 protein_id gnl|my_center|LOCUS_19580 19355 21259 gene locus_tag LOCUS_19590 19355 21259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 21721 21344 gene locus_tag LOCUS_19600 21721 21344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 22750 23220 gene locus_tag LOCUS_19610 22750 23220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 23486 24580 gene locus_tag LOCUS_19620 23486 24580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 24870 25220 gene locus_tag LOCUS_19630 24870 25220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 27480 25384 gene locus_tag LOCUS_19640 27480 25384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 28023 29027 gene locus_tag LOCUS_19650 28023 29027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 29455 30453 gene locus_tag LOCUS_19660 29455 30453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 30938 30774 gene locus_tag LOCUS_19670 30938 30774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 30865 31335 gene locus_tag LOCUS_19680 30865 31335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 31407 31634 gene locus_tag LOCUS_19690 31407 31634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 32152 32535 gene locus_tag LOCUS_19700 32152 32535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 32845 32582 gene locus_tag LOCUS_19710 32845 32582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 35789 33222 gene locus_tag LOCUS_19720 35789 33222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 36602 37612 gene locus_tag LOCUS_19730 36602 37612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 38986 37631 gene locus_tag LOCUS_19740 38986 37631 CDS product ISNCY family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337744.1 protein_id gnl|my_center|LOCUS_19740 >Feature sequence036 1536 808 gene locus_tag LOCUS_19750 gene fabG 1536 808 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460603.1 protein_id gnl|my_center|LOCUS_19750 1987 1529 gene locus_tag LOCUS_19760 1987 1529 CDS product 3-hydroxylacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208359.1 protein_id gnl|my_center|LOCUS_19760 3150 1984 gene locus_tag LOCUS_19770 3150 1984 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074034.1 protein_id gnl|my_center|LOCUS_19770 3715 3143 gene locus_tag LOCUS_19780 3715 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 5979 3712 gene locus_tag LOCUS_19790 5979 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 6555 5980 gene locus_tag LOCUS_19800 6555 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 8074 6548 gene locus_tag LOCUS_19810 8074 6548 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261520.1 protein_id gnl|my_center|LOCUS_19810 9729 8071 gene locus_tag LOCUS_19820 9729 8071 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261519.1 protein_id gnl|my_center|LOCUS_19820 10079 9729 gene locus_tag LOCUS_19830 10079 9729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19830 11292 10072 gene locus_tag LOCUS_19840 11292 10072 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460589.1 protein_id gnl|my_center|LOCUS_19840 11948 11361 gene locus_tag LOCUS_19850 11948 11361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418342.1 protein_id gnl|my_center|LOCUS_19850 12189 11923 gene locus_tag LOCUS_19860 12189 11923 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369303.1 protein_id gnl|my_center|LOCUS_19860 12455 12189 gene locus_tag LOCUS_19870 12455 12189 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081091609.1 protein_id gnl|my_center|LOCUS_19870 13260 12490 gene locus_tag LOCUS_19880 13260 12490 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261515.1 protein_id gnl|my_center|LOCUS_19880 13978 13250 gene locus_tag LOCUS_19890 13978 13250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 14377 13985 gene locus_tag LOCUS_19900 14377 13985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707164.1 protein_id gnl|my_center|LOCUS_19900 15702 14434 gene locus_tag LOCUS_19910 15702 14434 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460542.1 protein_id gnl|my_center|LOCUS_19910 16911 15805 gene locus_tag LOCUS_19920 16911 15805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 17049 17552 gene locus_tag LOCUS_19930 17049 17552 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854230.1 protein_id gnl|my_center|LOCUS_19930 17549 19072 gene locus_tag LOCUS_19940 17549 19072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 20279 22162 gene locus_tag LOCUS_19950 20279 22162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 22571 22164 gene locus_tag LOCUS_19960 gene queF 22571 22164 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056073.1 protein_id gnl|my_center|LOCUS_19960 22945 22598 gene locus_tag LOCUS_19970 22945 22598 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225193.1 protein_id gnl|my_center|LOCUS_19970 23084 24310 gene locus_tag LOCUS_19980 23084 24310 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_19980 24485 24811 gene locus_tag LOCUS_19990 24485 24811 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_19990 25009 26010 gene locus_tag LOCUS_20000 25009 26010 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963619.1 protein_id gnl|my_center|LOCUS_20000 27473 26007 gene locus_tag LOCUS_20010 27473 26007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 27605 28447 gene locus_tag LOCUS_20020 27605 28447 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444823.1 protein_id gnl|my_center|LOCUS_20020 29307 28444 gene locus_tag LOCUS_20030 29307 28444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 30537 29311 gene locus_tag LOCUS_20040 gene tyrS 30537 29311 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941800.1 protein_id gnl|my_center|LOCUS_20040 32134 30557 gene locus_tag LOCUS_20050 gene rny 32134 30557 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_20050 32748 32131 gene locus_tag LOCUS_20060 32748 32131 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924827.1 protein_id gnl|my_center|LOCUS_20060 33093 32767 gene locus_tag LOCUS_20070 33093 32767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 35048 33489 gene locus_tag LOCUS_20080 35048 33489 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393317.1 protein_id gnl|my_center|LOCUS_20080 36483 35230 gene locus_tag LOCUS_20090 gene ftsY 36483 35230 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_20090 38080 36740 gene locus_tag LOCUS_20100 38080 36740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 38327 38100 gene locus_tag LOCUS_20110 38327 38100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence037 415 1983 gene locus_tag LOCUS_20120 415 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 4193 2832 gene locus_tag LOCUS_20130 4193 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 4470 4267 gene locus_tag LOCUS_20140 4470 4267 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061657.1 protein_id gnl|my_center|LOCUS_20140 4677 4910 gene locus_tag LOCUS_20150 4677 4910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 7939 5030 gene locus_tag LOCUS_20160 7939 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 9268 8366 gene locus_tag LOCUS_20170 9268 8366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 10613 9456 gene locus_tag LOCUS_20180 10613 9456 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_20180 12002 10626 gene locus_tag LOCUS_20190 12002 10626 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421588.1 protein_id gnl|my_center|LOCUS_20190 12957 12136 gene locus_tag LOCUS_20200 12957 12136 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104295.1 protein_id gnl|my_center|LOCUS_20200 13862 13062 gene locus_tag LOCUS_20210 13862 13062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 14324 13908 gene locus_tag LOCUS_20220 14324 13908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 14746 14321 gene locus_tag LOCUS_20230 14746 14321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 15647 15932 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctaaaaagaaagtagctaaaaaagctactaagaa 16843 16247 gene locus_tag LOCUS_20240 16843 16247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 17648 16872 gene locus_tag LOCUS_20250 17648 16872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 18431 17658 gene locus_tag LOCUS_20260 18431 17658 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941483.1 protein_id gnl|my_center|LOCUS_20260 19201 18431 gene locus_tag LOCUS_20270 19201 18431 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815039.1 protein_id gnl|my_center|LOCUS_20270 19931 19185 gene locus_tag LOCUS_20280 19931 19185 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_20280 20748 19999 gene locus_tag LOCUS_20290 20748 19999 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433117.1 protein_id gnl|my_center|LOCUS_20290 21003 22013 gene locus_tag LOCUS_20300 21003 22013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 23315 22146 gene locus_tag LOCUS_20310 23315 22146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 23692 24855 gene locus_tag LOCUS_20320 gene sucC 23692 24855 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244732.1 protein_id gnl|my_center|LOCUS_20320 24860 25729 gene locus_tag LOCUS_20330 gene sucD 24860 25729 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597642.1 protein_id gnl|my_center|LOCUS_20330 25996 25817 gene locus_tag LOCUS_20340 25996 25817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 26260 26042 gene locus_tag LOCUS_20350 26260 26042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 27668 26346 gene locus_tag LOCUS_20360 27668 26346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 29110 27722 gene locus_tag LOCUS_20370 29110 27722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 30207 29125 gene locus_tag LOCUS_20380 30207 29125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 30998 30207 gene locus_tag LOCUS_20390 30998 30207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 31664 32083 gene locus_tag LOCUS_20400 gene ndk 31664 32083 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072285.1 protein_id gnl|my_center|LOCUS_20400 32155 33285 gene locus_tag LOCUS_20410 gene rlmD 32155 33285 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_20410 33573 34241 gene locus_tag LOCUS_20420 33573 34241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 34225 35448 gene locus_tag LOCUS_20430 34225 35448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 35452 36777 gene locus_tag LOCUS_20440 35452 36777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 36774 37991 gene locus_tag LOCUS_20450 36774 37991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 >Feature sequence038 2087 51 gene locus_tag LOCUS_20460 gene mutS 2087 51 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494923.1 protein_id gnl|my_center|LOCUS_20460 3670 2138 gene locus_tag LOCUS_20470 3670 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 4048 3677 gene locus_tag LOCUS_20480 4048 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 4237 6174 gene locus_tag LOCUS_20490 4237 6174 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388808.1 protein_id gnl|my_center|LOCUS_20490 6990 6202 gene locus_tag LOCUS_20500 6990 6202 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820328.1 protein_id gnl|my_center|LOCUS_20500 7141 7683 gene locus_tag LOCUS_20510 7141 7683 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762007.1 protein_id gnl|my_center|LOCUS_20510 8633 7680 gene locus_tag LOCUS_20520 8633 7680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 9691 8648 gene locus_tag LOCUS_20530 9691 8648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 10249 9692 gene locus_tag LOCUS_20540 10249 9692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 11301 10249 gene locus_tag LOCUS_20550 11301 10249 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545234.1 protein_id gnl|my_center|LOCUS_20550 11760 11311 gene locus_tag LOCUS_20560 11760 11311 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_20560 14561 11769 gene locus_tag LOCUS_20570 14561 11769 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388279.1 protein_id gnl|my_center|LOCUS_20570 15543 14692 gene locus_tag LOCUS_20580 15543 14692 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083222.1 protein_id gnl|my_center|LOCUS_20580 15907 15533 gene locus_tag LOCUS_20590 15907 15533 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772151.1 protein_id gnl|my_center|LOCUS_20590 16539 16063 gene locus_tag LOCUS_20600 gene greA 16539 16063 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920688.1 protein_id gnl|my_center|LOCUS_20600 16715 17992 gene locus_tag LOCUS_20610 gene mgtE 16715 17992 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392647.1 protein_id gnl|my_center|LOCUS_20610 17989 18969 gene locus_tag LOCUS_20620 17989 18969 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583238.1 protein_id gnl|my_center|LOCUS_20620 18966 19184 gene locus_tag LOCUS_20630 18966 19184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 19575 19159 gene locus_tag LOCUS_20640 19575 19159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 20303 19575 gene locus_tag LOCUS_20650 20303 19575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 20647 21573 gene locus_tag LOCUS_20660 20647 21573 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310430.1 protein_id gnl|my_center|LOCUS_20660 21642 21717 gene locus_tag LOCUS_t00150 21642 21717 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 22049 22663 gene locus_tag LOCUS_20670 22049 22663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 22688 23047 gene locus_tag LOCUS_20680 22688 23047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 23162 23527 gene locus_tag LOCUS_20690 23162 23527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 23574 24350 gene locus_tag LOCUS_20700 23574 24350 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 protein_id gnl|my_center|LOCUS_20700 24361 24714 gene locus_tag LOCUS_20710 24361 24714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 25311 25078 gene locus_tag LOCUS_20720 25311 25078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 25499 26758 gene locus_tag LOCUS_20730 25499 26758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 26755 27108 gene locus_tag LOCUS_20740 26755 27108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 27113 27685 gene locus_tag LOCUS_20750 27113 27685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20750 27682 28674 gene locus_tag LOCUS_20760 27682 28674 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970282.1 protein_id gnl|my_center|LOCUS_20760 28697 28861 gene locus_tag LOCUS_20770 28697 28861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 30779 28878 gene locus_tag LOCUS_20780 30779 28878 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086363.1 protein_id gnl|my_center|LOCUS_20780 31765 31583 gene locus_tag LOCUS_20790 31765 31583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 33225 32119 gene locus_tag LOCUS_20800 33225 32119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 33823 33230 gene locus_tag LOCUS_20810 33823 33230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 34319 34930 gene locus_tag LOCUS_20820 34319 34930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 34951 35313 gene locus_tag LOCUS_20830 34951 35313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 >Feature sequence039 460 630 gene locus_tag LOCUS_20840 gene ccoS 460 630 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008138466.1 protein_id gnl|my_center|LOCUS_20840 627 2765 gene locus_tag LOCUS_20850 gene ccoN 627 2765 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_20850 2766 2930 gene locus_tag LOCUS_20860 2766 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2935 3519 gene locus_tag LOCUS_20870 2935 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 3526 4932 gene locus_tag LOCUS_20880 gene ccoG 3526 4932 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120871.1 protein_id gnl|my_center|LOCUS_20880 5667 6788 gene locus_tag LOCUS_20890 5667 6788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 8347 7106 gene locus_tag LOCUS_20900 8347 7106 CDS product PIF1 family DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994423.1 protein_id gnl|my_center|LOCUS_20900 8554 9933 gene locus_tag LOCUS_20910 8554 9933 CDS product 5' nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945856.1 protein_id gnl|my_center|LOCUS_20910 10382 9960 gene locus_tag LOCUS_20920 10382 9960 CDS product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986776.1 protein_id gnl|my_center|LOCUS_20920 10956 10369 gene locus_tag LOCUS_20930 10956 10369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 11568 10957 gene locus_tag LOCUS_20940 11568 10957 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056046.1 protein_id gnl|my_center|LOCUS_20940 11843 13120 gene locus_tag LOCUS_20950 11843 13120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 16712 13464 gene locus_tag LOCUS_20960 16712 13464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 21994 16712 gene locus_tag LOCUS_20970 21994 16712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 24532 22070 gene locus_tag LOCUS_20980 24532 22070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 26422 24875 gene locus_tag LOCUS_20990 26422 24875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 26805 26440 gene locus_tag LOCUS_21000 26805 26440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 27150 26956 gene locus_tag LOCUS_21010 gene nqrM 27150 26956 CDS product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091359.1 protein_id gnl|my_center|LOCUS_21010 28293 27259 gene locus_tag LOCUS_21020 28293 27259 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668096.1 protein_id gnl|my_center|LOCUS_21020 29520 28297 gene locus_tag LOCUS_21030 gene nqrF 29520 28297 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951261.1 protein_id gnl|my_center|LOCUS_21030 30160 29552 gene locus_tag LOCUS_21040 gene nqrE 30160 29552 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 protein_id gnl|my_center|LOCUS_21040 30794 30174 gene locus_tag LOCUS_21050 gene nqrD 30794 30174 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648665.1 protein_id gnl|my_center|LOCUS_21050 31579 30806 gene locus_tag LOCUS_21060 31579 30806 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105182.1 protein_id gnl|my_center|LOCUS_21060 32774 31566 gene locus_tag LOCUS_21070 32774 31566 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109478.1 protein_id gnl|my_center|LOCUS_21070 34117 32774 gene locus_tag LOCUS_21080 34117 32774 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705061.1 protein_id gnl|my_center|LOCUS_21080 >Feature sequence040 2951 2169 gene locus_tag LOCUS_21090 2951 2169 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_21090 3807 2953 gene locus_tag LOCUS_21100 3807 2953 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538874.1 protein_id gnl|my_center|LOCUS_21100 4830 3817 gene locus_tag LOCUS_21110 4830 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 5130 6383 gene locus_tag LOCUS_21120 5130 6383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 7471 6380 gene locus_tag LOCUS_21130 7471 6380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 8236 7607 gene locus_tag LOCUS_21140 8236 7607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 8633 8448 gene locus_tag LOCUS_21150 8633 8448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 8992 11043 gene locus_tag LOCUS_21160 8992 11043 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_21160 11036 11374 gene locus_tag LOCUS_21170 gene arsC 11036 11374 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457719.1 protein_id gnl|my_center|LOCUS_21170 11953 11363 gene locus_tag LOCUS_21180 11953 11363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 14925 12118 gene locus_tag LOCUS_21190 14925 12118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 15909 15088 gene locus_tag LOCUS_21200 gene mutM 15909 15088 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693293.1 protein_id gnl|my_center|LOCUS_21200 16307 18196 gene locus_tag LOCUS_21210 16307 18196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 18961 18350 gene locus_tag LOCUS_21220 gene yqaB 18961 18350 CDS product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167426.1 protein_id gnl|my_center|LOCUS_21220 20246 19062 gene locus_tag LOCUS_21230 20246 19062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 21674 20277 gene locus_tag LOCUS_21240 21674 20277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 23083 21671 gene locus_tag LOCUS_21250 23083 21671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 23858 23070 gene locus_tag LOCUS_21260 23858 23070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 24310 25065 gene locus_tag LOCUS_21270 24310 25065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 26321 25062 gene locus_tag LOCUS_21280 26321 25062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 27172 26558 gene locus_tag LOCUS_21290 gene udk 27172 26558 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403303.1 protein_id gnl|my_center|LOCUS_21290 27719 28456 gene locus_tag LOCUS_21300 27719 28456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 28957 28457 gene locus_tag LOCUS_21310 28957 28457 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937552.1 protein_id gnl|my_center|LOCUS_21310 29734 30930 gene locus_tag LOCUS_21320 29734 30930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 31043 33637 gene locus_tag LOCUS_21330 31043 33637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 33995 34477 gene locus_tag LOCUS_21340 33995 34477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 >Feature sequence041 1756 677 gene locus_tag LOCUS_21350 gene lptG 1756 677 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942568.1 protein_id gnl|my_center|LOCUS_21350 1847 3172 gene locus_tag LOCUS_21360 1847 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 3159 4025 gene locus_tag LOCUS_21370 gene nadC 3159 4025 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360683.1 protein_id gnl|my_center|LOCUS_21370 4025 4696 gene locus_tag LOCUS_21380 4025 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 4696 5250 gene locus_tag LOCUS_21390 4696 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 5325 5672 gene locus_tag LOCUS_21400 5325 5672 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262420.1 protein_id gnl|my_center|LOCUS_21400 6582 5674 gene locus_tag LOCUS_21410 6582 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 8054 7008 gene locus_tag LOCUS_21420 8054 7008 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946349.1 protein_id gnl|my_center|LOCUS_21420 8284 9084 gene locus_tag LOCUS_21430 8284 9084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 11399 9141 gene locus_tag LOCUS_21440 11399 9141 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_21440 12765 11839 gene locus_tag LOCUS_21450 12765 11839 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412005.1 protein_id gnl|my_center|LOCUS_21450 13777 12836 gene locus_tag LOCUS_21460 13777 12836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 14014 14589 gene locus_tag LOCUS_21470 14014 14589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 14593 15477 gene locus_tag LOCUS_21480 14593 15477 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034812.1 protein_id gnl|my_center|LOCUS_21480 16720 15554 gene locus_tag LOCUS_21490 16720 15554 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869868.1 protein_id gnl|my_center|LOCUS_21490 18592 16733 gene locus_tag LOCUS_21500 gene top6B 18592 16733 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878155.1 protein_id gnl|my_center|LOCUS_21500 19092 18793 gene locus_tag LOCUS_21510 19092 18793 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545366.1 protein_id gnl|my_center|LOCUS_21510 19486 19716 gene locus_tag LOCUS_21520 19486 19716 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640511.1 protein_id gnl|my_center|LOCUS_21520 19734 20042 gene locus_tag LOCUS_21530 gene grxD 19734 20042 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687762.1 protein_id gnl|my_center|LOCUS_21530 20230 21612 gene locus_tag LOCUS_21540 20230 21612 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004789757.1 protein_id gnl|my_center|LOCUS_21540 21802 22161 gene locus_tag LOCUS_21550 21802 22161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 23386 22190 gene locus_tag LOCUS_21560 gene serA 23386 22190 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982325.1 protein_id gnl|my_center|LOCUS_21560 23637 24980 gene locus_tag LOCUS_21570 23637 24980 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_21570 24982 25905 gene locus_tag LOCUS_21580 24982 25905 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209769.1 protein_id gnl|my_center|LOCUS_21580 25916 26695 gene locus_tag LOCUS_21590 25916 26695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 27822 26692 gene locus_tag LOCUS_21600 gene rlmD 27822 26692 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482575.1 protein_id gnl|my_center|LOCUS_21600 28136 28531 gene locus_tag LOCUS_21610 28136 28531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 29782 28760 gene locus_tag LOCUS_21620 29782 28760 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256159.1 protein_id gnl|my_center|LOCUS_21620 31572 29782 gene locus_tag LOCUS_21630 31572 29782 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256158.1 protein_id gnl|my_center|LOCUS_21630 31843 32194 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32371 33180 gene locus_tag LOCUS_21640 32371 33180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 >Feature sequence042 2328 2726 gene locus_tag LOCUS_21650 2328 2726 CDS product DUF3307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083514136.1 protein_id gnl|my_center|LOCUS_21650 2719 3732 gene locus_tag LOCUS_21660 2719 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 5205 3736 gene locus_tag LOCUS_21670 gene pyk 5205 3736 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943944.1 protein_id gnl|my_center|LOCUS_21670 6881 5223 gene locus_tag LOCUS_21680 6881 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 10417 7136 gene locus_tag LOCUS_21690 10417 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 11697 10414 gene locus_tag LOCUS_21700 11697 10414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 12663 11893 gene locus_tag LOCUS_21710 12663 11893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 13334 12663 gene locus_tag LOCUS_21720 13334 12663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 15077 13545 gene locus_tag LOCUS_21730 15077 13545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 15537 16577 gene locus_tag LOCUS_21740 15537 16577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 17174 16578 gene locus_tag LOCUS_21750 17174 16578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 17351 18832 gene locus_tag LOCUS_21760 17351 18832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 19779 18829 gene locus_tag LOCUS_21770 19779 18829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 20322 19819 gene locus_tag LOCUS_21780 20322 19819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 20463 21320 gene locus_tag LOCUS_21790 gene rsmI 20463 21320 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947928.1 protein_id gnl|my_center|LOCUS_21790 21382 24063 gene locus_tag LOCUS_21800 21382 24063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 24163 24930 gene locus_tag LOCUS_21810 24163 24930 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_21810 25052 27262 gene locus_tag LOCUS_21820 gene lptD 25052 27262 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943003.1 protein_id gnl|my_center|LOCUS_21820 27314 27721 gene locus_tag LOCUS_21830 27314 27721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 29355 27946 gene locus_tag LOCUS_21840 29355 27946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 30196 29357 gene locus_tag LOCUS_21850 gene mtnP 30196 29357 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_21850 31230 30211 gene locus_tag LOCUS_21860 gene arsS 31230 30211 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121078.1 protein_id gnl|my_center|LOCUS_21860 <32554 31360 gene locus_tag LOCUS_21870 <32554 31360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205226061.1:methyl-accepting chemotaxis protein >Feature sequence043 454 678 gene locus_tag LOCUS_21880 gene rpmE 454 678 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966172.1 protein_id gnl|my_center|LOCUS_21880 1052 2122 gene locus_tag LOCUS_21890 gene prfA 1052 2122 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940174.1 protein_id gnl|my_center|LOCUS_21890 2119 3441 gene locus_tag LOCUS_21900 2119 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 3444 4703 gene locus_tag LOCUS_21910 gene murA 3444 4703 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_21910 4816 5151 gene locus_tag LOCUS_21920 4816 5151 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131883.1 protein_id gnl|my_center|LOCUS_21920 5959 5312 gene locus_tag LOCUS_21930 5959 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 6236 9400 gene locus_tag LOCUS_21940 6236 9400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 9403 9699 gene locus_tag LOCUS_21950 9403 9699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 9709 10989 gene locus_tag LOCUS_21960 gene serS 9709 10989 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837449.1 protein_id gnl|my_center|LOCUS_21960 11030 11638 gene locus_tag LOCUS_21970 11030 11638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 12790 11642 gene locus_tag LOCUS_21980 12790 11642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 13074 14072 gene locus_tag LOCUS_21990 13074 14072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 14265 15563 gene locus_tag LOCUS_22000 14265 15563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 15560 16273 gene locus_tag LOCUS_22010 15560 16273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 16270 19326 gene locus_tag LOCUS_22020 16270 19326 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207561.1 protein_id gnl|my_center|LOCUS_22020 19328 19960 gene locus_tag LOCUS_22030 19328 19960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 20048 21259 gene locus_tag LOCUS_22040 20048 21259 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075798.1 protein_id gnl|my_center|LOCUS_22040 21399 21310 gene locus_tag LOCUS_t00160 21399 21310 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 21484 22212 gene locus_tag LOCUS_22050 21484 22212 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881424.1 protein_id gnl|my_center|LOCUS_22050 22312 23625 gene locus_tag LOCUS_22060 22312 23625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 24385 23732 gene locus_tag LOCUS_22070 24385 23732 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963240.1 protein_id gnl|my_center|LOCUS_22070 24463 26502 gene locus_tag LOCUS_22080 24463 26502 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 protein_id gnl|my_center|LOCUS_22080 27208 26534 gene locus_tag LOCUS_22090 27208 26534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 28255 27362 gene locus_tag LOCUS_22100 28255 27362 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042007654.1 protein_id gnl|my_center|LOCUS_22100 28589 30127 gene locus_tag LOCUS_22110 28589 30127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 31109 30780 gene locus_tag LOCUS_22120 31109 30780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 31217 31930 gene locus_tag LOCUS_22130 31217 31930 CDS product putative folate metabolism gamma-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873943.1 protein_id gnl|my_center|LOCUS_22130 >Feature sequence044 385 3612 gene locus_tag LOCUS_22140 385 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 5055 3856 gene locus_tag LOCUS_22150 5055 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 5377 6198 gene locus_tag LOCUS_22160 5377 6198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 7612 6392 gene locus_tag LOCUS_22170 gene grrM 7612 6392 CDS product GRRM system radical SAM/SPASM domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970460.1 protein_id gnl|my_center|LOCUS_22170 8011 7688 gene locus_tag LOCUS_22180 8011 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 8196 8951 gene locus_tag LOCUS_22190 8196 8951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 9291 10280 gene locus_tag LOCUS_22200 gene lipA 9291 10280 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903644.1 protein_id gnl|my_center|LOCUS_22200 10293 11579 gene locus_tag LOCUS_22210 gene pdhC 10293 11579 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232311.1 protein_id gnl|my_center|LOCUS_22210 11595 13001 gene locus_tag LOCUS_22220 gene lpdA 11595 13001 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232309.1 protein_id gnl|my_center|LOCUS_22220 13272 13880 gene locus_tag LOCUS_22230 13272 13880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 13870 14739 gene locus_tag LOCUS_22240 13870 14739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 14742 15290 gene locus_tag LOCUS_22250 14742 15290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 15283 16041 gene locus_tag LOCUS_22260 15283 16041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 16268 16050 gene locus_tag LOCUS_22270 16268 16050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 16867 16259 gene locus_tag LOCUS_22280 gene lipB 16867 16259 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943071.1 protein_id gnl|my_center|LOCUS_22280 16946 17197 gene locus_tag LOCUS_22290 16946 17197 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403995.1 protein_id gnl|my_center|LOCUS_22290 17215 17505 gene locus_tag LOCUS_22300 17215 17505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 18149 17502 gene locus_tag LOCUS_22310 18149 17502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 19530 18142 gene locus_tag LOCUS_22320 19530 18142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332558.1 protein_id gnl|my_center|LOCUS_22320 19939 19538 gene locus_tag LOCUS_22330 gene tolR 19939 19538 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546534.1 protein_id gnl|my_center|LOCUS_22330 20565 19942 gene locus_tag LOCUS_22340 gene tolQ 20565 19942 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924836.1 protein_id gnl|my_center|LOCUS_22340 20788 22515 gene locus_tag LOCUS_22350 20788 22515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 23195 22512 gene locus_tag LOCUS_22360 23195 22512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 25248 23200 gene locus_tag LOCUS_22370 25248 23200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 25978 25250 gene locus_tag LOCUS_22380 25978 25250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 27795 26176 gene locus_tag LOCUS_22390 27795 26176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 28123 27782 gene locus_tag LOCUS_22400 28123 27782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 29031 28138 gene locus_tag LOCUS_22410 29031 28138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 29055 29642 gene locus_tag LOCUS_22420 29055 29642 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816795.1 protein_id gnl|my_center|LOCUS_22420 29639 30313 gene locus_tag LOCUS_22430 29639 30313 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880129.1 protein_id gnl|my_center|LOCUS_22430 30404 31249 gene locus_tag LOCUS_22440 gene proC 30404 31249 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437941.1 protein_id gnl|my_center|LOCUS_22440 32299 31265 gene locus_tag LOCUS_22450 32299 31265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 >Feature sequence045 2176 1550 gene locus_tag LOCUS_22460 2176 1550 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668264.1 protein_id gnl|my_center|LOCUS_22460 2278 2652 gene locus_tag LOCUS_22470 2278 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 3417 2722 gene locus_tag LOCUS_22480 3417 2722 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124929.1 protein_id gnl|my_center|LOCUS_22480 4234 3428 gene locus_tag LOCUS_22490 4234 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 4911 4249 gene locus_tag LOCUS_22500 4911 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 5196 6560 gene locus_tag LOCUS_22510 5196 6560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 8523 6562 gene locus_tag LOCUS_22520 8523 6562 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036903.1 protein_id gnl|my_center|LOCUS_22520 10920 8707 gene locus_tag LOCUS_22530 10920 8707 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_22530 11217 10978 gene locus_tag LOCUS_22540 gene rpoZ 11217 10978 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942877.1 protein_id gnl|my_center|LOCUS_22540 11803 11246 gene locus_tag LOCUS_22550 gene gmk 11803 11246 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070724.1 protein_id gnl|my_center|LOCUS_22550 12677 11805 gene locus_tag LOCUS_22560 12677 11805 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811868.1 protein_id gnl|my_center|LOCUS_22560 13207 13413 gene locus_tag LOCUS_22570 13207 13413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 14302 13397 gene locus_tag LOCUS_22580 gene miaA 14302 13397 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_22580 16320 14302 gene locus_tag LOCUS_22590 gene mutL 16320 14302 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222285.1 protein_id gnl|my_center|LOCUS_22590 16594 17406 gene locus_tag LOCUS_22600 16594 17406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 17443 18489 gene locus_tag LOCUS_22610 17443 18489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 19300 18527 gene locus_tag LOCUS_22620 19300 18527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 19958 19374 gene locus_tag LOCUS_22630 19958 19374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 21037 20462 gene locus_tag LOCUS_22640 21037 20462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 21392 21595 gene locus_tag LOCUS_22650 21392 21595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 23125 22343 gene locus_tag LOCUS_22660 23125 22343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 23882 23181 gene locus_tag LOCUS_22670 23882 23181 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_22670 24479 23946 gene locus_tag LOCUS_22680 24479 23946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 24583 25254 gene locus_tag LOCUS_22690 24583 25254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 25241 25828 gene locus_tag LOCUS_22700 25241 25828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 25825 26391 gene locus_tag LOCUS_22710 25825 26391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 27435 26437 gene locus_tag LOCUS_22720 27435 26437 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852597.1 protein_id gnl|my_center|LOCUS_22720 27480 28241 gene locus_tag LOCUS_22730 gene gloB 27480 28241 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066773.1 protein_id gnl|my_center|LOCUS_22730 28627 29526 gene locus_tag LOCUS_22740 28627 29526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 >Feature sequence046 138 428 gene locus_tag LOCUS_22750 138 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 721 425 gene locus_tag LOCUS_22760 721 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 1019 711 gene locus_tag LOCUS_22770 1019 711 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_22770 1241 1540 gene locus_tag LOCUS_22780 1241 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 1544 1858 gene locus_tag LOCUS_22790 1544 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 1897 2352 gene locus_tag LOCUS_22800 1897 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 2650 3024 gene locus_tag LOCUS_22810 2650 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 3036 3905 gene locus_tag LOCUS_22820 3036 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 3997 4431 gene locus_tag LOCUS_22830 3997 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 4477 4755 gene locus_tag LOCUS_22840 4477 4755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 4815 6479 gene locus_tag LOCUS_22850 4815 6479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 9100 6491 gene locus_tag LOCUS_22860 9100 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 10144 9212 gene locus_tag LOCUS_22870 10144 9212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 10456 11535 gene locus_tag LOCUS_22880 10456 11535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 11564 13231 gene locus_tag LOCUS_22890 11564 13231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 13221 13985 gene locus_tag LOCUS_22900 13221 13985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 14831 14076 gene locus_tag LOCUS_22910 14831 14076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 15118 14960 gene locus_tag LOCUS_22920 15118 14960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 15660 15118 gene locus_tag LOCUS_22930 15660 15118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 16057 15680 gene locus_tag LOCUS_22940 16057 15680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 16388 17155 gene locus_tag LOCUS_22950 16388 17155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 17163 17684 gene locus_tag LOCUS_22960 17163 17684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 17819 18028 gene locus_tag LOCUS_22970 17819 18028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 18075 18422 gene locus_tag LOCUS_22980 18075 18422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 18412 19707 gene locus_tag LOCUS_22990 18412 19707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 19704 20204 gene locus_tag LOCUS_23000 19704 20204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 20216 20482 gene locus_tag LOCUS_23010 20216 20482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 20733 22931 gene locus_tag LOCUS_23020 20733 22931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 22928 23500 gene locus_tag LOCUS_23030 22928 23500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 23484 24800 gene locus_tag LOCUS_23040 23484 24800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 24797 25360 gene locus_tag LOCUS_23050 24797 25360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 25338 25739 gene locus_tag LOCUS_23060 25338 25739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 25736 26593 gene locus_tag LOCUS_23070 25736 26593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 26603 26896 gene locus_tag LOCUS_23080 26603 26896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 26877 27683 gene locus_tag LOCUS_23090 26877 27683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 28003 29484 gene locus_tag LOCUS_23100 28003 29484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence047 585 886 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1378 1779 gene locus_tag LOCUS_23110 1378 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 1772 2833 gene locus_tag LOCUS_23120 1772 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 3558 2830 gene locus_tag LOCUS_23130 3558 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 4812 4150 gene locus_tag LOCUS_23140 4812 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 5605 5129 gene locus_tag LOCUS_23150 gene gloA 5605 5129 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101793.1 protein_id gnl|my_center|LOCUS_23150 6672 5608 gene locus_tag LOCUS_23160 6672 5608 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103810.1 protein_id gnl|my_center|LOCUS_23160 7229 6825 gene locus_tag LOCUS_23170 7229 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 7354 7983 gene locus_tag LOCUS_23180 7354 7983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 8119 8043 gene locus_tag LOCUS_t00170 8119 8043 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9553 8240 gene locus_tag LOCUS_23190 9553 8240 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_23190 10368 9550 gene locus_tag LOCUS_23200 10368 9550 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444615.1 protein_id gnl|my_center|LOCUS_23200 11605 10829 gene locus_tag LOCUS_23210 11605 10829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 12389 12691 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15800 13950 gene locus_tag LOCUS_23220 gene dnaG 15800 13950 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528223.1 protein_id gnl|my_center|LOCUS_23220 16302 15856 gene locus_tag LOCUS_23230 16302 15856 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090104.1 protein_id gnl|my_center|LOCUS_23230 16516 16316 gene locus_tag LOCUS_23240 gene rpsU 16516 16316 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943714.1 protein_id gnl|my_center|LOCUS_23240 16921 18003 gene locus_tag LOCUS_23250 16921 18003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 18093 18608 gene locus_tag LOCUS_23260 gene tadA 18093 18608 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370298.1 protein_id gnl|my_center|LOCUS_23260 19096 18767 gene locus_tag LOCUS_23270 19096 18767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 19850 19008 gene locus_tag LOCUS_23280 19850 19008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 20596 19859 gene locus_tag LOCUS_23290 20596 19859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 20704 21729 gene locus_tag LOCUS_23300 20704 21729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 21729 22178 gene locus_tag LOCUS_23310 21729 22178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 22273 24504 gene locus_tag LOCUS_23320 22273 24504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 25472 24672 gene locus_tag LOCUS_23330 25472 24672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 25691 26212 gene locus_tag LOCUS_23340 25691 26212 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 protein_id gnl|my_center|LOCUS_23340 26302 27018 gene locus_tag LOCUS_23350 26302 27018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 27345 27668 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence048 1440 154 gene locus_tag LOCUS_23360 1440 154 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207047.1 protein_id gnl|my_center|LOCUS_23360 2949 1615 gene locus_tag LOCUS_23370 2949 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 4298 3111 gene locus_tag LOCUS_23380 4298 3111 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202093.1 protein_id gnl|my_center|LOCUS_23380 4483 5370 gene locus_tag LOCUS_23390 gene rnhC 4483 5370 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485123.1 protein_id gnl|my_center|LOCUS_23390 5370 6185 gene locus_tag LOCUS_23400 gene rsmG 5370 6185 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183558.1 protein_id gnl|my_center|LOCUS_23400 6172 6915 gene locus_tag LOCUS_23410 6172 6915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 7446 6952 gene locus_tag LOCUS_23420 7446 6952 CDS product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099189.1 protein_id gnl|my_center|LOCUS_23420 7780 8040 gene locus_tag LOCUS_23430 7780 8040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 8435 8734 gene locus_tag LOCUS_23440 8435 8734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 9808 8915 gene locus_tag LOCUS_23450 9808 8915 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444329.1 protein_id gnl|my_center|LOCUS_23450 10779 9805 gene locus_tag LOCUS_23460 10779 9805 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014844311.1 protein_id gnl|my_center|LOCUS_23460 11747 10776 gene locus_tag LOCUS_23470 11747 10776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947769.1 protein_id gnl|my_center|LOCUS_23470 13041 11722 gene locus_tag LOCUS_23480 13041 11722 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947768.1 protein_id gnl|my_center|LOCUS_23480 14075 13026 gene locus_tag LOCUS_23490 gene fni 14075 13026 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947767.1 protein_id gnl|my_center|LOCUS_23490 15270 14338 gene locus_tag LOCUS_23500 15270 14338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 15485 15892 gene locus_tag LOCUS_23510 15485 15892 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814993.1 protein_id gnl|my_center|LOCUS_23510 16598 16218 gene locus_tag LOCUS_23520 16598 16218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 17873 16653 gene locus_tag LOCUS_23530 17873 16653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 18774 17836 gene locus_tag LOCUS_23540 18774 17836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 19645 18767 gene locus_tag LOCUS_23550 19645 18767 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256005.1 protein_id gnl|my_center|LOCUS_23550 20408 19647 gene locus_tag LOCUS_23560 20408 19647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 21937 20408 gene locus_tag LOCUS_23570 gene menD 21937 20408 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078087.1 protein_id gnl|my_center|LOCUS_23570 22881 21934 gene locus_tag LOCUS_23580 22881 21934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 23452 24222 gene locus_tag LOCUS_23590 23452 24222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 24234 24953 gene locus_tag LOCUS_23600 gene ubiE 24234 24953 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889031.1 protein_id gnl|my_center|LOCUS_23600 25093 25473 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26065 25691 gene locus_tag LOCUS_23610 26065 25691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 26319 27575 gene locus_tag LOCUS_23620 26319 27575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 >Feature sequence049 367 2169 gene locus_tag LOCUS_23630 gene lepA 367 2169 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941921.1 protein_id gnl|my_center|LOCUS_23630 2162 2830 gene locus_tag LOCUS_23640 2162 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 2852 3544 gene locus_tag LOCUS_23650 2852 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 3606 4265 gene locus_tag LOCUS_23660 3606 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 4274 5143 gene locus_tag LOCUS_23670 4274 5143 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057738.1 protein_id gnl|my_center|LOCUS_23670 5152 5928 gene locus_tag LOCUS_23680 5152 5928 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142866.1 protein_id gnl|my_center|LOCUS_23680 5921 6715 gene locus_tag LOCUS_23690 5921 6715 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_23690 6830 7879 gene locus_tag LOCUS_23700 gene pilM 6830 7879 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_23700 7879 8481 gene locus_tag LOCUS_23710 7879 8481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 8485 9066 gene locus_tag LOCUS_23720 8485 9066 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942673.1 protein_id gnl|my_center|LOCUS_23720 9067 9768 gene locus_tag LOCUS_23730 9067 9768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 9796 12075 gene locus_tag LOCUS_23740 9796 12075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 13299 12070 gene locus_tag LOCUS_23750 13299 12070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 13446 15035 gene locus_tag LOCUS_23760 13446 15035 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958070.1 protein_id gnl|my_center|LOCUS_23760 16933 15026 gene locus_tag LOCUS_23770 16933 15026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 17153 18478 gene locus_tag LOCUS_23780 17153 18478 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_23780 18743 18501 gene locus_tag LOCUS_23790 18743 18501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 19195 18890 gene locus_tag LOCUS_23800 19195 18890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 19922 19416 gene locus_tag LOCUS_23810 19922 19416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 20750 20052 gene locus_tag LOCUS_23820 20750 20052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 21102 20752 gene locus_tag LOCUS_23830 21102 20752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 21455 22087 gene locus_tag LOCUS_23840 21455 22087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 22225 23844 gene locus_tag LOCUS_23850 22225 23844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 25217 24255 gene locus_tag LOCUS_23860 25217 24255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 26836 26911 gene locus_tag LOCUS_t00180 26836 26911 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence050 <1 693 gene locus_tag LOCUS_23870 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403915.1:PLP-dependent aspartate aminotransferase family protein 1691 837 gene locus_tag LOCUS_23880 1691 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 1966 2039 gene locus_tag LOCUS_t00190 1966 2039 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 4546 2234 gene locus_tag LOCUS_23890 4546 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 5481 4861 gene locus_tag LOCUS_23900 5481 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 5678 5842 gene locus_tag LOCUS_23910 5678 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 6450 5920 gene locus_tag LOCUS_23920 6450 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 6970 7698 gene locus_tag LOCUS_23930 6970 7698 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114186.1 protein_id gnl|my_center|LOCUS_23930 8549 7884 gene locus_tag LOCUS_23940 8549 7884 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920683.1 protein_id gnl|my_center|LOCUS_23940 9500 8601 gene locus_tag LOCUS_23950 9500 8601 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256898.1 protein_id gnl|my_center|LOCUS_23950 9882 11036 gene locus_tag LOCUS_23960 9882 11036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 11168 12241 gene locus_tag LOCUS_23970 11168 12241 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812925.1 protein_id gnl|my_center|LOCUS_23970 13087 12323 gene locus_tag LOCUS_23980 gene pstB 13087 12323 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061132.1 protein_id gnl|my_center|LOCUS_23980 13932 13084 gene locus_tag LOCUS_23990 gene pstA 13932 13084 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001912363.1 protein_id gnl|my_center|LOCUS_23990 14695 13916 gene locus_tag LOCUS_24000 gene pstC 14695 13916 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877335.1 protein_id gnl|my_center|LOCUS_24000 15548 14754 gene locus_tag LOCUS_24010 15548 14754 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754393.1 protein_id gnl|my_center|LOCUS_24010 16109 15684 gene locus_tag LOCUS_24020 16109 15684 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938935.1 protein_id gnl|my_center|LOCUS_24020 18204 16174 gene locus_tag LOCUS_24030 gene tgpA 18204 16174 CDS product protein-glutamine gamma-glutamyltransferase TgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114743.1 protein_id gnl|my_center|LOCUS_24030 19099 18191 gene locus_tag LOCUS_24040 19099 18191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 20034 19096 gene locus_tag LOCUS_24050 20034 19096 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738027.1 protein_id gnl|my_center|LOCUS_24050 20180 20800 gene locus_tag LOCUS_24060 20180 20800 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208259.1 protein_id gnl|my_center|LOCUS_24060 22230 20797 gene locus_tag LOCUS_24070 22230 20797 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047860.1 protein_id gnl|my_center|LOCUS_24070 22469 23260 gene locus_tag LOCUS_24080 22469 23260 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065489.1 protein_id gnl|my_center|LOCUS_24080 23979 23272 gene locus_tag LOCUS_24090 23979 23272 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_24090 24341 25012 gene locus_tag LOCUS_24100 24341 25012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 25969 25409 gene locus_tag LOCUS_24110 25969 25409 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031781.1 protein_id gnl|my_center|LOCUS_24110 >Feature sequence051 1119 370 gene locus_tag LOCUS_24120 1119 370 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658321.1 protein_id gnl|my_center|LOCUS_24120 1352 1741 gene locus_tag LOCUS_24130 gene hemJ 1352 1741 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 protein_id gnl|my_center|LOCUS_24130 1986 3629 gene locus_tag LOCUS_24140 1986 3629 CDS product aromatic amino acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163226.1 protein_id gnl|my_center|LOCUS_24140 4539 3730 gene locus_tag LOCUS_24150 4539 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 4825 5658 gene locus_tag LOCUS_24160 4825 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 6206 6544 gene locus_tag LOCUS_24170 6206 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 6618 7211 gene locus_tag LOCUS_24180 gene cynT 6618 7211 CDS product carbonic anhydrase CynT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658640.1 protein_id gnl|my_center|LOCUS_24180 7221 8696 gene locus_tag LOCUS_24190 7221 8696 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105392.1 protein_id gnl|my_center|LOCUS_24190 9555 8776 gene locus_tag LOCUS_24200 9555 8776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 9874 10698 gene locus_tag LOCUS_24210 9874 10698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 11209 11649 gene locus_tag LOCUS_24220 11209 11649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 12534 11665 gene locus_tag LOCUS_24230 gene lgt 12534 11665 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545160.1 protein_id gnl|my_center|LOCUS_24230 13096 12554 gene locus_tag LOCUS_24240 gene lspA 13096 12554 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_24240 15858 13096 gene locus_tag LOCUS_24250 gene ileS 15858 13096 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_24250 16737 15946 gene locus_tag LOCUS_24260 16737 15946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 17137 17898 gene locus_tag LOCUS_24270 17137 17898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 18027 19469 gene locus_tag LOCUS_24280 18027 19469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 21154 19466 gene locus_tag LOCUS_24290 21154 19466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 22050 21277 gene locus_tag LOCUS_24300 gene truA 22050 21277 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_24300 22257 22787 gene locus_tag LOCUS_24310 22257 22787 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262936.1 protein_id gnl|my_center|LOCUS_24310 22797 23417 gene locus_tag LOCUS_24320 22797 23417 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245344.1 protein_id gnl|my_center|LOCUS_24320 24256 23468 gene locus_tag LOCUS_24330 24256 23468 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147802.1 protein_id gnl|my_center|LOCUS_24330 25000 25311 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence052 1038 715 gene locus_tag LOCUS_24340 1038 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 1460 2356 gene locus_tag LOCUS_24350 1460 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 2919 4379 gene locus_tag LOCUS_24360 2919 4379 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021902.1 protein_id gnl|my_center|LOCUS_24360 5295 4462 gene locus_tag LOCUS_24370 5295 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 5461 5964 gene locus_tag LOCUS_24380 5461 5964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 6379 7317 gene locus_tag LOCUS_24390 6379 7317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 7997 7314 gene locus_tag LOCUS_24400 7997 7314 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873009.1 protein_id gnl|my_center|LOCUS_24400 8682 7999 gene locus_tag LOCUS_24410 8682 7999 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019283.1 protein_id gnl|my_center|LOCUS_24410 9404 8694 gene locus_tag LOCUS_24420 9404 8694 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249137.1 protein_id gnl|my_center|LOCUS_24420 10537 9401 gene locus_tag LOCUS_24430 10537 9401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 11294 10608 gene locus_tag LOCUS_24440 11294 10608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 12783 12076 gene locus_tag LOCUS_24450 12783 12076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 13291 12797 gene locus_tag LOCUS_24460 13291 12797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 14183 13431 gene locus_tag LOCUS_24470 14183 13431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 14500 15066 gene locus_tag LOCUS_24480 14500 15066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 15351 15845 gene locus_tag LOCUS_24490 15351 15845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 17255 15903 gene locus_tag LOCUS_24500 17255 15903 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883480.1 protein_id gnl|my_center|LOCUS_24500 17797 17279 gene locus_tag LOCUS_24510 17797 17279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 17833 18771 gene locus_tag LOCUS_24520 17833 18771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 19211 18768 gene locus_tag LOCUS_24530 19211 18768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 19285 20028 gene locus_tag LOCUS_24540 19285 20028 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124419.1 protein_id gnl|my_center|LOCUS_24540 20018 20947 gene locus_tag LOCUS_24550 gene hutG 20018 20947 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207977.1 protein_id gnl|my_center|LOCUS_24550 21075 21680 gene locus_tag LOCUS_24560 21075 21680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 22659 21673 gene locus_tag LOCUS_24570 22659 21673 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037251612.1 protein_id gnl|my_center|LOCUS_24570 23450 22893 gene locus_tag LOCUS_24580 23450 22893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 24647 23463 gene locus_tag LOCUS_24590 24647 23463 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760004.1 protein_id gnl|my_center|LOCUS_24590 24888 24595 gene locus_tag LOCUS_24600 24888 24595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 25118 25194 gene locus_tag LOCUS_t00200 25118 25194 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence053 39 1256 gene locus_tag LOCUS_24610 gene odhB 39 1256 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083283.1 protein_id gnl|my_center|LOCUS_24610 1270 2664 gene locus_tag LOCUS_24620 gene lpdA 1270 2664 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338629.1 protein_id gnl|my_center|LOCUS_24620 2851 3582 gene locus_tag LOCUS_24630 2851 3582 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904152.1 protein_id gnl|my_center|LOCUS_24630 3584 4462 gene locus_tag LOCUS_24640 gene hemF 3584 4462 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172630.1 protein_id gnl|my_center|LOCUS_24640 4886 4584 gene locus_tag LOCUS_24650 4886 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 5501 5031 gene locus_tag LOCUS_24660 5501 5031 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300417.1 protein_id gnl|my_center|LOCUS_24660 6160 5504 gene locus_tag LOCUS_24670 6160 5504 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366933.1 protein_id gnl|my_center|LOCUS_24670 6865 6170 gene locus_tag LOCUS_24680 6865 6170 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206697.1 protein_id gnl|my_center|LOCUS_24680 8046 6874 gene locus_tag LOCUS_24690 8046 6874 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815952.1 protein_id gnl|my_center|LOCUS_24690 8515 9465 gene locus_tag LOCUS_24700 8515 9465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 9537 10607 gene locus_tag LOCUS_24710 9537 10607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 11212 10679 gene locus_tag LOCUS_24720 11212 10679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 11550 12878 gene locus_tag LOCUS_24730 gene miaB 11550 12878 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_24730 12875 13495 gene locus_tag LOCUS_24740 12875 13495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 13545 14084 gene locus_tag LOCUS_24750 13545 14084 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881079.1 protein_id gnl|my_center|LOCUS_24750 14081 15535 gene locus_tag LOCUS_24760 gene guaB 14081 15535 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541542.1 protein_id gnl|my_center|LOCUS_24760 16190 15504 gene locus_tag LOCUS_24770 16190 15504 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998217.1 protein_id gnl|my_center|LOCUS_24770 16510 17655 gene locus_tag LOCUS_24780 gene proB 16510 17655 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546492.1 protein_id gnl|my_center|LOCUS_24780 17639 18880 gene locus_tag LOCUS_24790 17639 18880 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943829.1 protein_id gnl|my_center|LOCUS_24790 18883 19695 gene locus_tag LOCUS_24800 gene proC 18883 19695 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880051.1 protein_id gnl|my_center|LOCUS_24800 19733 21154 gene locus_tag LOCUS_24810 gene putP 19733 21154 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_24810 21193 22224 gene locus_tag LOCUS_24820 21193 22224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 23134 22229 gene locus_tag LOCUS_24830 23134 22229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 23222 23653 gene locus_tag LOCUS_24840 23222 23653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 24398 23796 gene locus_tag LOCUS_24850 24398 23796 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287847.1 protein_id gnl|my_center|LOCUS_24850 24565 24641 gene locus_tag LOCUS_t00210 24565 24641 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence054 577 3402 gene locus_tag LOCUS_24860 577 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 4047 3409 gene locus_tag LOCUS_24870 4047 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 5254 4031 gene locus_tag LOCUS_24880 5254 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 6164 5367 gene locus_tag LOCUS_24890 6164 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 6302 7123 gene locus_tag LOCUS_24900 6302 7123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 7248 7757 gene locus_tag LOCUS_24910 7248 7757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 7891 8355 gene locus_tag LOCUS_24920 7891 8355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 9140 8352 gene locus_tag LOCUS_24930 9140 8352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 10337 9360 gene locus_tag LOCUS_24940 10337 9360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 10730 11389 gene locus_tag LOCUS_24950 10730 11389 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930731.1 protein_id gnl|my_center|LOCUS_24950 11422 12366 gene locus_tag LOCUS_24960 11422 12366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 12789 14531 gene locus_tag LOCUS_24970 12789 14531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 14532 16385 gene locus_tag LOCUS_24980 14532 16385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 16729 17736 gene locus_tag LOCUS_24990 gene asd 16729 17736 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244674.1 protein_id gnl|my_center|LOCUS_24990 17752 19083 gene locus_tag LOCUS_25000 17752 19083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 19080 19961 gene locus_tag LOCUS_25010 19080 19961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 20262 22106 gene locus_tag LOCUS_25020 20262 22106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 22484 24268 gene locus_tag LOCUS_25030 22484 24268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 >Feature sequence055 570 40 gene locus_tag LOCUS_25040 570 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 1105 572 gene locus_tag LOCUS_25050 gene orn 1105 572 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021796.1 protein_id gnl|my_center|LOCUS_25050 1461 2795 gene locus_tag LOCUS_25060 1461 2795 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_25060 3621 3118 gene locus_tag LOCUS_25070 3621 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 3904 5454 gene locus_tag LOCUS_25080 3904 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 6439 5492 gene locus_tag LOCUS_25090 gene purM 6439 5492 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 protein_id gnl|my_center|LOCUS_25090 8011 6449 gene locus_tag LOCUS_25100 gene purH 8011 6449 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385254.1 protein_id gnl|my_center|LOCUS_25100 8748 8023 gene locus_tag LOCUS_25110 8748 8023 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922163.1 protein_id gnl|my_center|LOCUS_25110 11752 8741 gene locus_tag LOCUS_25120 11752 8741 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940439.1 protein_id gnl|my_center|LOCUS_25120 12350 11736 gene locus_tag LOCUS_25130 gene purN 12350 11736 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238669.1 protein_id gnl|my_center|LOCUS_25130 14535 12340 gene locus_tag LOCUS_25140 14535 12340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 16015 14522 gene locus_tag LOCUS_25150 gene purF 16015 14522 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334221.1 protein_id gnl|my_center|LOCUS_25150 16158 17249 gene locus_tag LOCUS_25160 gene purK 16158 17249 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196775.1 protein_id gnl|my_center|LOCUS_25160 17246 17713 gene locus_tag LOCUS_25170 gene purE 17246 17713 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249787.1 protein_id gnl|my_center|LOCUS_25170 19494 17722 gene locus_tag LOCUS_25180 19494 17722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 21029 19641 gene locus_tag LOCUS_25190 21029 19641 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189099273.1 protein_id gnl|my_center|LOCUS_25190 21241 21753 gene locus_tag LOCUS_25200 21241 21753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 21773 23509 gene locus_tag LOCUS_25210 21773 23509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 23513 24103 gene locus_tag LOCUS_25220 23513 24103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 >Feature sequence056 <1 1695 gene locus_tag LOCUS_25230 <1 1695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943489.1:elongation factor G 1696 1995 gene locus_tag LOCUS_25240 1696 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 2011 2301 gene locus_tag LOCUS_25250 2011 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 2874 2428 gene locus_tag LOCUS_25260 2874 2428 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208362.1 protein_id gnl|my_center|LOCUS_25260 3039 5228 gene locus_tag LOCUS_25270 3039 5228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 6153 6806 gene locus_tag LOCUS_25280 6153 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 7361 7678 gene locus_tag LOCUS_25290 gene rpsJ 7361 7678 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_25290 7690 8379 gene locus_tag LOCUS_25300 gene rplC 7690 8379 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545966.1 protein_id gnl|my_center|LOCUS_25300 8381 9004 gene locus_tag LOCUS_25310 gene rplD 8381 9004 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_25310 9006 9284 gene locus_tag LOCUS_25320 9006 9284 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_25320 9290 10117 gene locus_tag LOCUS_25330 gene rplB 9290 10117 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_25330 10127 10399 gene locus_tag LOCUS_25340 gene rpsS 10127 10399 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943482.1 protein_id gnl|my_center|LOCUS_25340 10410 10742 gene locus_tag LOCUS_25350 gene rplV 10410 10742 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625897.1 protein_id gnl|my_center|LOCUS_25350 10747 11412 gene locus_tag LOCUS_25360 gene rpsC 10747 11412 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531426.1 protein_id gnl|my_center|LOCUS_25360 11405 11812 gene locus_tag LOCUS_25370 gene rplP 11405 11812 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393930.1 protein_id gnl|my_center|LOCUS_25370 11816 12010 gene locus_tag LOCUS_25380 gene rpmC 11816 12010 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495193.1 protein_id gnl|my_center|LOCUS_25380 12022 12291 gene locus_tag LOCUS_25390 gene rpsQ 12022 12291 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943477.1 protein_id gnl|my_center|LOCUS_25390 12302 12670 gene locus_tag LOCUS_25400 gene rplN 12302 12670 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205457.1 protein_id gnl|my_center|LOCUS_25400 12697 13242 gene locus_tag LOCUS_25410 gene rplE 12697 13242 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_25410 13256 13645 gene locus_tag LOCUS_25420 gene rpsH 13256 13645 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894501.1 protein_id gnl|my_center|LOCUS_25420 13653 14195 gene locus_tag LOCUS_25430 gene rplF 13653 14195 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904134.1 protein_id gnl|my_center|LOCUS_25430 14208 14576 gene locus_tag LOCUS_25440 gene rplR 14208 14576 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765430.1 protein_id gnl|my_center|LOCUS_25440 14586 15062 gene locus_tag LOCUS_25450 gene rpsE 14586 15062 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938615.1 protein_id gnl|my_center|LOCUS_25450 15072 15257 gene locus_tag LOCUS_25460 gene rpmD 15072 15257 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938616.1 protein_id gnl|my_center|LOCUS_25460 15259 15696 gene locus_tag LOCUS_25470 gene rplO 15259 15696 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225819.1 protein_id gnl|my_center|LOCUS_25470 15724 17043 gene locus_tag LOCUS_25480 gene secY 15724 17043 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_25480 17043 17681 gene locus_tag LOCUS_25490 17043 17681 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357697.1 protein_id gnl|my_center|LOCUS_25490 17961 18329 gene locus_tag LOCUS_25500 gene rpsM 17961 18329 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_25500 18346 18735 gene locus_tag LOCUS_25510 gene rpsK 18346 18735 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101798.1 protein_id gnl|my_center|LOCUS_25510 18746 19366 gene locus_tag LOCUS_25520 gene rpsD 18746 19366 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938623.1 protein_id gnl|my_center|LOCUS_25520 19382 20398 gene locus_tag LOCUS_25530 19382 20398 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_25530 20412 21014 gene locus_tag LOCUS_25540 20412 21014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 22429 21878 gene locus_tag LOCUS_25550 22429 21878 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_25550 22928 23830 gene locus_tag LOCUS_25560 22928 23830 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062784820.1 protein_id gnl|my_center|LOCUS_25560 >Feature sequence057 388 692 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 834 1808 gene locus_tag LOCUS_25570 834 1808 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544949.1 protein_id gnl|my_center|LOCUS_25570 2013 2519 gene locus_tag LOCUS_25580 2013 2519 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689546.1 protein_id gnl|my_center|LOCUS_25580 2516 3241 gene locus_tag LOCUS_25590 2516 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 3450 4217 gene locus_tag LOCUS_25600 3450 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 4217 5836 gene locus_tag LOCUS_25610 4217 5836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 5854 9054 gene locus_tag LOCUS_25620 5854 9054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 9051 9941 gene locus_tag LOCUS_25630 9051 9941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 9938 10198 gene locus_tag LOCUS_25640 9938 10198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 10195 12393 gene locus_tag LOCUS_25650 10195 12393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 12409 13074 gene locus_tag LOCUS_25660 12409 13074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 13081 13539 gene locus_tag LOCUS_25670 13081 13539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 13548 14156 gene locus_tag LOCUS_25680 13548 14156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 14857 14153 gene locus_tag LOCUS_25690 14857 14153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 15303 16646 gene locus_tag LOCUS_25700 15303 16646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 16643 17617 gene locus_tag LOCUS_25710 16643 17617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 17690 18673 gene locus_tag LOCUS_25720 17690 18673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 18666 19388 gene locus_tag LOCUS_25730 gene lptB 18666 19388 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467801.1 protein_id gnl|my_center|LOCUS_25730 19400 20845 gene locus_tag LOCUS_25740 gene rpoN 19400 20845 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_25740 21623 20847 gene locus_tag LOCUS_25750 21623 20847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 21673 21831 gene locus_tag LOCUS_25760 21673 21831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 22400 22789 gene locus_tag LOCUS_25770 22400 22789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 >Feature sequence058 <1 985 gene locus_tag LOCUS_25780 <1 985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071036.1:catalase/peroxidase HPI 4207 1067 gene locus_tag LOCUS_25790 4207 1067 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941986.1 protein_id gnl|my_center|LOCUS_25790 5679 4216 gene locus_tag LOCUS_25800 5679 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 6527 5682 gene locus_tag LOCUS_25810 6527 5682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 6914 6600 gene locus_tag LOCUS_25820 6914 6600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 7087 7614 gene locus_tag LOCUS_25830 7087 7614 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_25830 7616 8128 gene locus_tag LOCUS_25840 7616 8128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 9671 8211 gene locus_tag LOCUS_25850 gene cysS 9671 8211 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943976.1 protein_id gnl|my_center|LOCUS_25850 11337 9868 gene locus_tag LOCUS_25860 gene gltX 11337 9868 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081547.1 protein_id gnl|my_center|LOCUS_25860 11650 12771 gene locus_tag LOCUS_25870 11650 12771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 14211 12997 gene locus_tag LOCUS_25880 14211 12997 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021070980.1 protein_id gnl|my_center|LOCUS_25880 15309 14326 gene locus_tag LOCUS_25890 15309 14326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 16552 15566 gene locus_tag LOCUS_25900 gene egtD 16552 15566 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088429091.1 protein_id gnl|my_center|LOCUS_25900 17643 16552 gene locus_tag LOCUS_25910 gene egtB 17643 16552 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551490.1 protein_id gnl|my_center|LOCUS_25910 18607 18083 gene locus_tag LOCUS_25920 18607 18083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 19499 19113 gene locus_tag LOCUS_25930 19499 19113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 21647 19533 gene locus_tag LOCUS_25940 21647 19533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 22323 22640 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23075 22650 gene locus_tag LOCUS_25950 23075 22650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 >Feature sequence059 2017 1154 gene locus_tag LOCUS_25960 gene atpG 2017 1154 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940788.1 protein_id gnl|my_center|LOCUS_25960 2506 2030 gene locus_tag LOCUS_25970 2506 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 2540 2856 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4407 3862 gene locus_tag LOCUS_25980 gene atpH 4407 3862 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016338.1 protein_id gnl|my_center|LOCUS_25980 4949 4410 gene locus_tag LOCUS_25990 gene atpF 4949 4410 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545851.1 protein_id gnl|my_center|LOCUS_25990 5389 4949 gene locus_tag LOCUS_26000 5389 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 6109 5720 gene locus_tag LOCUS_26010 6109 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 7407 6100 gene locus_tag LOCUS_26020 7407 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 8350 7400 gene locus_tag LOCUS_26030 8350 7400 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_26030 8480 8902 gene locus_tag LOCUS_26040 8480 8902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 11164 9287 gene locus_tag LOCUS_26050 gene mnmG 11164 9287 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_26050 12588 11164 gene locus_tag LOCUS_26060 gene mnmE 12588 11164 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109330.1 protein_id gnl|my_center|LOCUS_26060 13139 12594 gene locus_tag LOCUS_26070 13139 12594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 14757 13156 gene locus_tag LOCUS_26080 gene yidC 14757 13156 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021785.1 protein_id gnl|my_center|LOCUS_26080 15311 14982 gene locus_tag LOCUS_26090 gene rnpA 15311 14982 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081756.1 protein_id gnl|my_center|LOCUS_26090 15464 15315 gene locus_tag LOCUS_26100 gene rpmH 15464 15315 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958535.1 protein_id gnl|my_center|LOCUS_26100 16271 16567 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17282 17581 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18010 19122 gene locus_tag LOCUS_26110 gene dnaN 18010 19122 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_26110 19122 20312 gene locus_tag LOCUS_26120 gene recF 19122 20312 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723768.1 protein_id gnl|my_center|LOCUS_26120 20287 22695 gene locus_tag LOCUS_26130 gene gyrB 20287 22695 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070427.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence060 836 66 gene locus_tag LOCUS_26140 gene tcdA 836 66 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406281.1 protein_id gnl|my_center|LOCUS_26140 945 1703 gene locus_tag LOCUS_26150 945 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 2434 1889 gene locus_tag LOCUS_26160 2434 1889 CDS product TIGR02466 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265868.1 protein_id gnl|my_center|LOCUS_26160 2577 2930 gene locus_tag LOCUS_26170 2577 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 3703 2927 gene locus_tag LOCUS_26180 3703 2927 CDS product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262283.1 protein_id gnl|my_center|LOCUS_26180 3957 4721 gene locus_tag LOCUS_26190 gene pomA 3957 4721 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071707.1 protein_id gnl|my_center|LOCUS_26190 4738 5583 gene locus_tag LOCUS_26200 4738 5583 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707084.1 protein_id gnl|my_center|LOCUS_26200 6438 6061 gene locus_tag LOCUS_26210 6438 6061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 6501 7832 gene locus_tag LOCUS_26220 6501 7832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 7842 8123 gene locus_tag LOCUS_26230 7842 8123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 8120 10309 gene locus_tag LOCUS_26240 8120 10309 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902898.1 protein_id gnl|my_center|LOCUS_26240 11625 10306 gene locus_tag LOCUS_26250 11625 10306 CDS product DUF5690 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918537.1 protein_id gnl|my_center|LOCUS_26250 11870 12478 gene locus_tag LOCUS_26260 11870 12478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 12540 14930 gene locus_tag LOCUS_26270 gene leuS 12540 14930 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246072.1 protein_id gnl|my_center|LOCUS_26270 14941 15222 gene locus_tag LOCUS_26280 14941 15222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 15219 15881 gene locus_tag LOCUS_26290 15219 15881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 15887 16297 gene locus_tag LOCUS_26300 15887 16297 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668728.1 protein_id gnl|my_center|LOCUS_26300 17945 16308 gene locus_tag LOCUS_26310 17945 16308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 19610 17955 gene locus_tag LOCUS_26320 19610 17955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 19970 19680 gene locus_tag LOCUS_26330 19970 19680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 20717 20148 gene locus_tag LOCUS_26340 20717 20148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 21176 20745 gene locus_tag LOCUS_26350 21176 20745 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_26350 21218 21958 gene locus_tag LOCUS_26360 21218 21958 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074252.1 protein_id gnl|my_center|LOCUS_26360 >Feature sequence061 1526 195 gene locus_tag LOCUS_26370 1526 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 2073 2825 gene locus_tag LOCUS_26380 2073 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 2818 4128 gene locus_tag LOCUS_26390 2818 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 4125 4841 gene locus_tag LOCUS_26400 4125 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 5401 4946 gene locus_tag LOCUS_26410 5401 4946 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268542.1 protein_id gnl|my_center|LOCUS_26410 7594 5474 gene locus_tag LOCUS_26420 7594 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 9063 8434 gene locus_tag LOCUS_26430 9063 8434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 9128 9901 gene locus_tag LOCUS_26440 9128 9901 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129903.1 protein_id gnl|my_center|LOCUS_26440 11537 9942 gene locus_tag LOCUS_26450 11537 9942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 12432 13796 gene locus_tag LOCUS_26460 12432 13796 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054746.1 protein_id gnl|my_center|LOCUS_26460 13789 15027 gene locus_tag LOCUS_26470 13789 15027 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123082.1 protein_id gnl|my_center|LOCUS_26470 15037 15819 gene locus_tag LOCUS_26480 15037 15819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 15995 17332 gene locus_tag LOCUS_26490 15995 17332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 18104 17367 gene locus_tag LOCUS_26500 18104 17367 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582973.1 protein_id gnl|my_center|LOCUS_26500 19062 18097 gene locus_tag LOCUS_26510 19062 18097 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072067.1 protein_id gnl|my_center|LOCUS_26510 19670 19254 gene locus_tag LOCUS_26520 19670 19254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 20331 19654 gene locus_tag LOCUS_26530 20331 19654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 20693 20514 gene locus_tag LOCUS_26540 20693 20514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 20941 20690 gene locus_tag LOCUS_26550 20941 20690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 >Feature sequence062 250 663 gene locus_tag LOCUS_26560 250 663 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545870.1 protein_id gnl|my_center|LOCUS_26560 2297 666 gene locus_tag LOCUS_26570 2297 666 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889781.1 protein_id gnl|my_center|LOCUS_26570 2376 3110 gene locus_tag LOCUS_26580 2376 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 4554 3334 gene locus_tag LOCUS_26590 4554 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 8448 4978 gene locus_tag LOCUS_26600 gene mfd 8448 4978 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048383.1 protein_id gnl|my_center|LOCUS_26600 8534 8839 gene locus_tag LOCUS_26610 8534 8839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 8836 9645 gene locus_tag LOCUS_26620 8836 9645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 9638 9976 gene locus_tag LOCUS_26630 9638 9976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 10189 11298 gene locus_tag LOCUS_26640 10189 11298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 11280 12314 gene locus_tag LOCUS_26650 11280 12314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 13193 13600 gene locus_tag LOCUS_26660 13193 13600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 13628 14005 gene locus_tag LOCUS_26670 13628 14005 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416417.1 protein_id gnl|my_center|LOCUS_26670 14009 15160 gene locus_tag LOCUS_26680 gene nuoH 14009 15160 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964314.1 protein_id gnl|my_center|LOCUS_26680 15161 15685 gene locus_tag LOCUS_26690 15161 15685 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392498.1 protein_id gnl|my_center|LOCUS_26690 15678 16001 gene locus_tag LOCUS_26700 gene nuoK 15678 16001 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941016.1 protein_id gnl|my_center|LOCUS_26700 16005 17933 gene locus_tag LOCUS_26710 gene nuoL 16005 17933 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_26710 17938 19494 gene locus_tag LOCUS_26720 17938 19494 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_26720 19502 20968 gene locus_tag LOCUS_26730 gene nuoN 19502 20968 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537945.1 protein_id gnl|my_center|LOCUS_26730 >Feature sequence063 593 210 gene locus_tag LOCUS_26740 593 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 215 247 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1798 605 gene locus_tag LOCUS_26750 1798 605 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_26750 2867 1860 gene locus_tag LOCUS_26760 gene gap 2867 1860 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161236.1 protein_id gnl|my_center|LOCUS_26760 3234 5558 gene locus_tag LOCUS_26770 3234 5558 CDS product fatty acid cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451094.1 protein_id gnl|my_center|LOCUS_26770 5859 5563 gene locus_tag LOCUS_26780 5859 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 6068 7201 gene locus_tag LOCUS_26790 6068 7201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 7198 9414 gene locus_tag LOCUS_26800 7198 9414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 11047 9428 gene locus_tag LOCUS_26810 11047 9428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 11899 11114 gene locus_tag LOCUS_26820 11899 11114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 13004 11910 gene locus_tag LOCUS_26830 13004 11910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 13989 13012 gene locus_tag LOCUS_26840 gene holB 13989 13012 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_26840 14620 13982 gene locus_tag LOCUS_26850 gene tmk 14620 13982 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715592.1 protein_id gnl|my_center|LOCUS_26850 14775 15773 gene locus_tag LOCUS_26860 14775 15773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 15878 16828 gene locus_tag LOCUS_26870 15878 16828 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665638.1 protein_id gnl|my_center|LOCUS_26870 16829 18238 gene locus_tag LOCUS_26880 16829 18238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 18235 20481 gene locus_tag LOCUS_26890 18235 20481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 20625 20849 gene locus_tag LOCUS_26900 20625 20849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 >Feature sequence064 1059 277 gene locus_tag LOCUS_26910 1059 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 1230 2726 gene locus_tag LOCUS_26920 gene glpK 1230 2726 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732584.1 protein_id gnl|my_center|LOCUS_26920 2968 2723 gene locus_tag LOCUS_26930 2968 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 2995 3537 gene locus_tag LOCUS_26940 2995 3537 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070643.1 protein_id gnl|my_center|LOCUS_26940 4854 3589 gene locus_tag LOCUS_26950 gene hutI 4854 3589 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244327.1 protein_id gnl|my_center|LOCUS_26950 5026 5478 gene locus_tag LOCUS_26960 5026 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 5497 6447 gene locus_tag LOCUS_26970 5497 6447 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437173.1 protein_id gnl|my_center|LOCUS_26970 6598 7446 gene locus_tag LOCUS_26980 6598 7446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707800.1 protein_id gnl|my_center|LOCUS_26980 9167 7515 gene locus_tag LOCUS_26990 gene hutU 9167 7515 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416948.1 protein_id gnl|my_center|LOCUS_26990 10687 9161 gene locus_tag LOCUS_27000 gene hutH 10687 9161 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 protein_id gnl|my_center|LOCUS_27000 11049 11312 gene locus_tag LOCUS_27010 11049 11312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 11316 11813 gene locus_tag LOCUS_27020 11316 11813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 11834 12376 gene locus_tag LOCUS_27030 11834 12376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 13053 12532 gene locus_tag LOCUS_27040 13053 12532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 14851 13307 gene locus_tag LOCUS_27050 14851 13307 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675527.1 protein_id gnl|my_center|LOCUS_27050 16046 15228 gene locus_tag LOCUS_27060 16046 15228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 16592 17272 gene locus_tag LOCUS_27070 16592 17272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 17968 17318 gene locus_tag LOCUS_27080 gene rpe 17968 17318 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902077.1 protein_id gnl|my_center|LOCUS_27080 18872 17961 gene locus_tag LOCUS_27090 gene fmt 18872 17961 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_27090 19466 18900 gene locus_tag LOCUS_27100 gene def 19466 18900 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114101.1 protein_id gnl|my_center|LOCUS_27100 >Feature sequence065 697 257 gene locus_tag LOCUS_27110 697 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 1457 906 gene locus_tag LOCUS_27120 1457 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 2793 2005 gene locus_tag LOCUS_27130 2793 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 3610 3335 gene locus_tag LOCUS_27140 3610 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 3933 4229 gene locus_tag LOCUS_27150 gene rpmB 3933 4229 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918547.1 protein_id gnl|my_center|LOCUS_27150 4243 4533 gene locus_tag LOCUS_27160 4243 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 5294 4758 gene locus_tag LOCUS_27170 5294 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 5617 6360 gene locus_tag LOCUS_27180 5617 6360 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921213.1 protein_id gnl|my_center|LOCUS_27180 6468 7241 gene locus_tag LOCUS_27190 6468 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 8757 7390 gene locus_tag LOCUS_27200 8757 7390 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022819390.1 protein_id gnl|my_center|LOCUS_27200 9049 9390 gene locus_tag LOCUS_27210 9049 9390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 9383 10174 gene locus_tag LOCUS_27220 9383 10174 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083043.1 protein_id gnl|my_center|LOCUS_27220 10494 10363 gene locus_tag LOCUS_27230 10494 10363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 10958 10503 gene locus_tag LOCUS_27240 10958 10503 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466989.1 protein_id gnl|my_center|LOCUS_27240 12130 11069 gene locus_tag LOCUS_27250 12130 11069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 14084 12255 gene locus_tag LOCUS_27260 14084 12255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 14488 15270 gene locus_tag LOCUS_27270 14488 15270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 15545 15736 gene locus_tag LOCUS_27280 15545 15736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 15922 17631 gene locus_tag LOCUS_27290 15922 17631 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193882.1 protein_id gnl|my_center|LOCUS_27290 17912 18904 gene locus_tag LOCUS_27300 17912 18904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 19083 19250 gene locus_tag LOCUS_27310 19083 19250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 19460 19639 gene locus_tag LOCUS_27320 19460 19639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 >Feature sequence066 1312 2799 gene locus_tag LOCUS_27330 1312 2799 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_27330 3801 3370 gene locus_tag LOCUS_27340 3801 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 3943 4647 gene locus_tag LOCUS_27350 3943 4647 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401395.1 protein_id gnl|my_center|LOCUS_27350 4640 5911 gene locus_tag LOCUS_27360 4640 5911 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824532.1 protein_id gnl|my_center|LOCUS_27360 6653 5901 gene locus_tag LOCUS_27370 6653 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 7242 6877 gene locus_tag LOCUS_27380 7242 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 8154 7579 gene locus_tag LOCUS_27390 8154 7579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 8372 8542 gene locus_tag LOCUS_27400 8372 8542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 9489 10514 gene locus_tag LOCUS_27410 9489 10514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 13168 10511 gene locus_tag LOCUS_27420 13168 10511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 14093 13635 gene locus_tag LOCUS_27430 14093 13635 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948556.1 protein_id gnl|my_center|LOCUS_27430 14532 14086 gene locus_tag LOCUS_27440 14532 14086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 15027 14764 gene locus_tag LOCUS_27450 15027 14764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 16191 16009 gene locus_tag LOCUS_27460 16191 16009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 16115 17293 gene locus_tag LOCUS_27470 16115 17293 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404993.1 protein_id gnl|my_center|LOCUS_27470 17304 17972 gene locus_tag LOCUS_27480 17304 17972 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773049.1 protein_id gnl|my_center|LOCUS_27480 17969 18640 gene locus_tag LOCUS_27490 17969 18640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 >Feature sequence067 177 362 gene locus_tag LOCUS_27500 177 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 870 301 gene locus_tag LOCUS_27510 870 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 1002 1214 gene locus_tag LOCUS_27520 1002 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 1306 2298 gene locus_tag LOCUS_27530 1306 2298 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_27530 2308 3996 gene locus_tag LOCUS_27540 gene recN 2308 3996 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286651.1 protein_id gnl|my_center|LOCUS_27540 4196 5056 gene locus_tag LOCUS_27550 4196 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 5221 6198 gene locus_tag LOCUS_27560 5221 6198 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527120.1 protein_id gnl|my_center|LOCUS_27560 6967 6233 gene locus_tag LOCUS_27570 6967 6233 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943095.1 protein_id gnl|my_center|LOCUS_27570 7269 8015 gene locus_tag LOCUS_27580 7269 8015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 9498 8323 gene locus_tag LOCUS_27590 9498 8323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 10555 10124 gene locus_tag LOCUS_27600 10555 10124 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_27600 10935 12035 gene locus_tag LOCUS_27610 10935 12035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 14044 12680 gene locus_tag LOCUS_27620 14044 12680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 15331 14057 gene locus_tag LOCUS_27630 gene ftsA 15331 14057 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_27630 16195 15461 gene locus_tag LOCUS_27640 16195 15461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 17093 16179 gene locus_tag LOCUS_27650 17093 16179 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546449.1 protein_id gnl|my_center|LOCUS_27650 18305 17331 gene locus_tag LOCUS_27660 18305 17331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 >Feature sequence068 147 459 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1345 1118 gene locus_tag LOCUS_27670 1345 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 1532 2812 gene locus_tag LOCUS_27680 1532 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 4172 2817 gene locus_tag LOCUS_27690 4172 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 7249 4169 gene locus_tag LOCUS_27700 7249 4169 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 protein_id gnl|my_center|LOCUS_27700 8260 7649 gene locus_tag LOCUS_27710 8260 7649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 9233 8760 gene locus_tag LOCUS_27720 gene rpsG 9233 8760 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417210.1 protein_id gnl|my_center|LOCUS_27720 9656 9246 gene locus_tag LOCUS_27730 gene rpsL 9656 9246 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143913.1 protein_id gnl|my_center|LOCUS_27730 10504 10043 gene locus_tag LOCUS_27740 10504 10043 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096735.1 protein_id gnl|my_center|LOCUS_27740 11034 12236 gene locus_tag LOCUS_27750 11034 12236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 12965 12306 gene locus_tag LOCUS_27760 12965 12306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 14421 13276 gene locus_tag LOCUS_27770 14421 13276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 15275 14418 gene locus_tag LOCUS_27780 15275 14418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 <18501 15747 gene locus_tag LOCUS_27790 <18501 15747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943492.1:DNA-directed RNA polymerase subunit beta' >Feature sequence069 <1 509 gene locus_tag LOCUS_27800 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760849.1:triose-phosphate isomerase 641 1009 gene locus_tag LOCUS_27810 641 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 1526 1083 gene locus_tag LOCUS_27820 1526 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 3936 1528 gene locus_tag LOCUS_27830 3936 1528 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942922.1 protein_id gnl|my_center|LOCUS_27830 4261 5091 gene locus_tag LOCUS_27840 4261 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 5820 5092 gene locus_tag LOCUS_27850 5820 5092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 6262 5924 gene locus_tag LOCUS_27860 6262 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 6471 6265 gene locus_tag LOCUS_27870 6471 6265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 6873 6583 gene locus_tag LOCUS_27880 6873 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 7171 6830 gene locus_tag LOCUS_27890 7171 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 8982 7402 gene locus_tag LOCUS_27900 gene murJ 8982 7402 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689904.1 protein_id gnl|my_center|LOCUS_27900 9080 9340 gene locus_tag LOCUS_27910 gene rpsT 9080 9340 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939182.1 protein_id gnl|my_center|LOCUS_27910 9728 9399 gene locus_tag LOCUS_27920 9728 9399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 10872 9868 gene locus_tag LOCUS_27930 gene holA 10872 9868 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583467.1 protein_id gnl|my_center|LOCUS_27930 11429 10872 gene locus_tag LOCUS_27940 11429 10872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 11692 12834 gene locus_tag LOCUS_27950 11692 12834 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545576.1 protein_id gnl|my_center|LOCUS_27950 12831 13814 gene locus_tag LOCUS_27960 12831 13814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 13984 15276 gene locus_tag LOCUS_27970 13984 15276 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_27970 16709 15345 gene locus_tag LOCUS_27980 16709 15345 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064374.1 protein_id gnl|my_center|LOCUS_27980 17305 16706 gene locus_tag LOCUS_27990 17305 16706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 >Feature sequence070 513 935 gene locus_tag LOCUS_28000 513 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 3336 982 gene locus_tag LOCUS_28010 3336 982 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940909.1 protein_id gnl|my_center|LOCUS_28010 3493 3711 gene locus_tag LOCUS_28020 gene infA 3493 3711 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939491.1 protein_id gnl|my_center|LOCUS_28020 4763 3972 gene locus_tag LOCUS_28030 4763 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 6049 4973 gene locus_tag LOCUS_28040 6049 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 7775 6195 gene locus_tag LOCUS_28050 7775 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 8002 8979 gene locus_tag LOCUS_28060 gene glpQ 8002 8979 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779113.1 protein_id gnl|my_center|LOCUS_28060 10007 8976 gene locus_tag LOCUS_28070 10007 8976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 11301 10051 gene locus_tag LOCUS_28080 11301 10051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 12501 11308 gene locus_tag LOCUS_28090 12501 11308 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705473.1 protein_id gnl|my_center|LOCUS_28090 13924 12782 gene locus_tag LOCUS_28100 13924 12782 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_28100 14768 14136 gene locus_tag LOCUS_28110 14768 14136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 15320 14883 gene locus_tag LOCUS_28120 15320 14883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 15480 16169 gene locus_tag LOCUS_28130 15480 16169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 16302 17024 gene locus_tag LOCUS_28140 gene rph 16302 17024 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120794.1 protein_id gnl|my_center|LOCUS_28140 17028 17609 gene locus_tag LOCUS_28150 17028 17609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28150 >Feature sequence071 264 1031 gene locus_tag LOCUS_28160 264 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 1033 2244 gene locus_tag LOCUS_28170 1033 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 2366 3982 gene locus_tag LOCUS_28180 2366 3982 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942735.1 protein_id gnl|my_center|LOCUS_28180 4334 5227 gene locus_tag LOCUS_28190 4334 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 5403 6293 gene locus_tag LOCUS_28200 5403 6293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 6633 7652 gene locus_tag LOCUS_28210 6633 7652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 7794 8057 gene locus_tag LOCUS_28220 7794 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 8407 9456 gene locus_tag LOCUS_28230 8407 9456 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769604.1 protein_id gnl|my_center|LOCUS_28230 9594 9430 gene locus_tag LOCUS_28240 9594 9430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 9727 10044 gene locus_tag LOCUS_28250 gene yajC 9727 10044 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943256.1 protein_id gnl|my_center|LOCUS_28250 10041 11738 gene locus_tag LOCUS_28260 gene secD 10041 11738 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546364.1 protein_id gnl|my_center|LOCUS_28260 11749 12654 gene locus_tag LOCUS_28270 gene secF 11749 12654 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085009790.1 protein_id gnl|my_center|LOCUS_28270 12732 14372 gene locus_tag LOCUS_28280 12732 14372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 14384 15244 gene locus_tag LOCUS_28290 14384 15244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 15247 15894 gene locus_tag LOCUS_28300 gene queC 15247 15894 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024084.1 protein_id gnl|my_center|LOCUS_28300 15895 16446 gene locus_tag LOCUS_28310 15895 16446 CDS product DUF366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496630.1 protein_id gnl|my_center|LOCUS_28310 16727 16443 gene locus_tag LOCUS_28320 16727 16443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 17082 17427 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence072 1743 61 gene locus_tag LOCUS_28330 1743 61 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267206.1 protein_id gnl|my_center|LOCUS_28330 2059 2829 gene locus_tag LOCUS_28340 2059 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 3195 2863 gene locus_tag LOCUS_28350 3195 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 3540 3208 gene locus_tag LOCUS_28360 3540 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 4694 3804 gene locus_tag LOCUS_28370 4694 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 4829 5356 gene locus_tag LOCUS_28380 4829 5356 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457571.1 protein_id gnl|my_center|LOCUS_28380 5378 5674 gene locus_tag LOCUS_28390 5378 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 5678 5962 gene locus_tag LOCUS_28400 5678 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 9873 5992 gene locus_tag LOCUS_28410 9873 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 10774 10046 gene locus_tag LOCUS_28420 10774 10046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 11051 11758 gene locus_tag LOCUS_28430 11051 11758 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356704.1 protein_id gnl|my_center|LOCUS_28430 11762 13213 gene locus_tag LOCUS_28440 11762 13213 CDS product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946128.1 protein_id gnl|my_center|LOCUS_28440 13218 14432 gene locus_tag LOCUS_28450 13218 14432 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444859.1 protein_id gnl|my_center|LOCUS_28450 14422 15099 gene locus_tag LOCUS_28460 14422 15099 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946126.1 protein_id gnl|my_center|LOCUS_28460 15357 16028 gene locus_tag LOCUS_28470 15357 16028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 >Feature sequence073 322 846 gene locus_tag LOCUS_28480 gene nuoI 322 846 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886374.1 protein_id gnl|my_center|LOCUS_28480 907 1338 gene locus_tag LOCUS_28490 907 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 1355 1609 gene locus_tag LOCUS_28500 1355 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 1596 2597 gene locus_tag LOCUS_28510 1596 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 2581 3048 gene locus_tag LOCUS_28520 2581 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 3029 3985 gene locus_tag LOCUS_28530 3029 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 4157 4948 gene locus_tag LOCUS_28540 4157 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 5509 5084 gene locus_tag LOCUS_28550 5509 5084 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025263.1 protein_id gnl|my_center|LOCUS_28550 6338 7327 gene locus_tag LOCUS_28560 6338 7327 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545040.1 protein_id gnl|my_center|LOCUS_28560 7320 8651 gene locus_tag LOCUS_28570 gene mgtE 7320 8651 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432938.1 protein_id gnl|my_center|LOCUS_28570 8652 9251 gene locus_tag LOCUS_28580 8652 9251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 11362 9269 gene locus_tag LOCUS_28590 11362 9269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 12799 11567 gene locus_tag LOCUS_28600 12799 11567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 13610 13059 gene locus_tag LOCUS_28610 13610 13059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 14848 14315 gene locus_tag LOCUS_28620 14848 14315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 15571 15200 gene locus_tag LOCUS_28630 15571 15200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 >Feature sequence074 3 572 gene locus_tag LOCUS_28640 3 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 545 2770 gene locus_tag LOCUS_28650 545 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 4179 2767 gene locus_tag LOCUS_28660 4179 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 4679 4185 gene locus_tag LOCUS_28670 4679 4185 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073661.1 protein_id gnl|my_center|LOCUS_28670 5114 4704 gene locus_tag LOCUS_28680 5114 4704 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083073.1 protein_id gnl|my_center|LOCUS_28680 5388 5804 gene locus_tag LOCUS_28690 5388 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 5841 6320 gene locus_tag LOCUS_28700 5841 6320 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 protein_id gnl|my_center|LOCUS_28700 6515 7327 gene locus_tag LOCUS_28710 6515 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 7603 9153 gene locus_tag LOCUS_28720 7603 9153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 9221 10582 gene locus_tag LOCUS_28730 gene mltF 9221 10582 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705651.1 protein_id gnl|my_center|LOCUS_28730 12406 10571 gene locus_tag LOCUS_28740 12406 10571 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332595.1 protein_id gnl|my_center|LOCUS_28740 12823 14883 gene locus_tag LOCUS_28750 12823 14883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 >Feature sequence075 1023 2138 gene locus_tag LOCUS_28760 1023 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 2702 2148 gene locus_tag LOCUS_28770 2702 2148 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895679.1 protein_id gnl|my_center|LOCUS_28770 4388 2757 gene locus_tag LOCUS_28780 4388 2757 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450939.1 protein_id gnl|my_center|LOCUS_28780 5472 4528 gene locus_tag LOCUS_28790 5472 4528 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_28790 6455 5634 gene locus_tag LOCUS_28800 6455 5634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 6617 7450 gene locus_tag LOCUS_28810 6617 7450 CDS product intradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013494.1 protein_id gnl|my_center|LOCUS_28810 8314 7547 gene locus_tag LOCUS_28820 8314 7547 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144264.1 protein_id gnl|my_center|LOCUS_28820 8785 8414 gene locus_tag LOCUS_28830 8785 8414 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086810.1 protein_id gnl|my_center|LOCUS_28830 9710 8841 gene locus_tag LOCUS_28840 gene ygiD 9710 8841 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174107.1 protein_id gnl|my_center|LOCUS_28840 10292 9756 gene locus_tag LOCUS_28850 10292 9756 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_28850 10394 11272 gene locus_tag LOCUS_28860 10394 11272 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040477.1 protein_id gnl|my_center|LOCUS_28860 11398 12117 gene locus_tag LOCUS_28870 11398 12117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 12558 12100 gene locus_tag LOCUS_28880 12558 12100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 12789 14579 gene locus_tag LOCUS_28890 12789 14579 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227541.1 protein_id gnl|my_center|LOCUS_28890 >Feature sequence076 163 87 gene locus_tag LOCUS_t00220 163 87 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1785 403 gene locus_tag LOCUS_28900 1785 403 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114106.1 protein_id gnl|my_center|LOCUS_28900 2897 1791 gene locus_tag LOCUS_28910 gene wlbC 2897 1791 CDS product O-antigen biosynthesis protein WlbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807112.1 protein_id gnl|my_center|LOCUS_28910 3088 3396 gene locus_tag LOCUS_28920 3088 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 3533 7021 gene locus_tag LOCUS_28930 gene metH 3533 7021 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271582.1 protein_id gnl|my_center|LOCUS_28930 7023 7997 gene locus_tag LOCUS_28940 7023 7997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546406.1 protein_id gnl|my_center|LOCUS_28940 8176 9750 gene locus_tag LOCUS_28950 8176 9750 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484923.1 protein_id gnl|my_center|LOCUS_28950 9949 10320 gene locus_tag LOCUS_28960 9949 10320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 11822 10383 gene locus_tag LOCUS_28970 11822 10383 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088214.1 protein_id gnl|my_center|LOCUS_28970 12343 11819 gene locus_tag LOCUS_28980 12343 11819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 13705 12593 gene locus_tag LOCUS_28990 13705 12593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 >Feature sequence077 433 1941 gene locus_tag LOCUS_29000 433 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 1931 3760 gene locus_tag LOCUS_29010 1931 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 4104 3898 gene locus_tag LOCUS_29020 4104 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 4308 4580 gene locus_tag LOCUS_29030 4308 4580 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195781.1 protein_id gnl|my_center|LOCUS_29030 4863 5828 gene locus_tag LOCUS_29040 gene pfkA 4863 5828 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173968.1 protein_id gnl|my_center|LOCUS_29040 8695 5888 gene locus_tag LOCUS_29050 8695 5888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 12086 8916 gene locus_tag LOCUS_29060 12086 8916 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131708.1 protein_id gnl|my_center|LOCUS_29060 >Feature sequence078 967 596 gene locus_tag LOCUS_29070 gene rplL 967 596 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650892.1 protein_id gnl|my_center|LOCUS_29070 1562 1038 gene locus_tag LOCUS_29080 gene rplJ 1562 1038 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943495.1 protein_id gnl|my_center|LOCUS_29080 2593 1892 gene locus_tag LOCUS_29090 gene rplA 2593 1892 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_29090 3024 2593 gene locus_tag LOCUS_29100 gene rplK 3024 2593 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931845.1 protein_id gnl|my_center|LOCUS_29100 3614 3075 gene locus_tag LOCUS_29110 gene nusG 3614 3075 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_29110 4015 3632 gene locus_tag LOCUS_29120 4015 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 4117 4041 gene locus_tag LOCUS_t00230 4117 4041 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 5485 4667 gene locus_tag LOCUS_29130 5485 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 7036 5783 gene locus_tag LOCUS_29140 7036 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 7062 7354 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8249 8615 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9723 10052 gene locus_tag LOCUS_29150 9723 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 10077 10409 gene locus_tag LOCUS_29160 10077 10409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 11389 10430 gene locus_tag LOCUS_29170 11389 10430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 >Feature sequence079 1631 375 gene locus_tag LOCUS_29180 1631 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 2074 1670 gene locus_tag LOCUS_29190 2074 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 3132 2098 gene locus_tag LOCUS_29200 gene fliM 3132 2098 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938209.1 protein_id gnl|my_center|LOCUS_29200 3689 3147 gene locus_tag LOCUS_29210 3689 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 4216 5073 gene locus_tag LOCUS_29220 4216 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 5759 5175 gene locus_tag LOCUS_29230 5759 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 6408 5845 gene locus_tag LOCUS_29240 6408 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 7525 6398 gene locus_tag LOCUS_29250 7525 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 7746 10100 gene locus_tag LOCUS_29260 7746 10100 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944022.1 protein_id gnl|my_center|LOCUS_29260 11390 10209 gene locus_tag LOCUS_29270 gene ablA 11390 10209 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_29270 >Feature sequence080 167 494 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 872 1165 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1200 1409 gene locus_tag LOCUS_29280 1200 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 1410 1787 gene locus_tag LOCUS_29290 1410 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 1840 2142 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2275 3012 gene locus_tag LOCUS_29300 2275 3012 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947556.1 protein_id gnl|my_center|LOCUS_29300 3050 3238 gene locus_tag LOCUS_29310 3050 3238 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941452.1 protein_id gnl|my_center|LOCUS_29310 3364 3662 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3702 5015 gene locus_tag LOCUS_29320 gene lysC 3702 5015 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480997.1 protein_id gnl|my_center|LOCUS_29320 5708 6003 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6054 6593 gene locus_tag LOCUS_29330 6054 6593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 6756 7058 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8279 8615 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10752 11057 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence081 551 234 gene locus_tag LOCUS_29340 551 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 1405 632 gene locus_tag LOCUS_29350 1405 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 1718 2650 gene locus_tag LOCUS_29360 1718 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 4617 2716 gene locus_tag LOCUS_29370 4617 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 4985 5872 gene locus_tag LOCUS_29380 4985 5872 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225975.1 protein_id gnl|my_center|LOCUS_29380 6129 5932 gene locus_tag LOCUS_29390 6129 5932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 6175 7935 gene locus_tag LOCUS_29400 6175 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 7936 8361 gene locus_tag LOCUS_29410 7936 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 8549 10033 gene locus_tag LOCUS_29420 8549 10033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 10226 11158 gene locus_tag LOCUS_29430 10226 11158 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104496.1 protein_id gnl|my_center|LOCUS_29430 >Feature sequence082 465 52 gene locus_tag LOCUS_29440 465 52 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455485.1 protein_id gnl|my_center|LOCUS_29440 743 1072 gene locus_tag LOCUS_29450 743 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 1203 1418 gene locus_tag LOCUS_29460 1203 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 1963 1442 gene locus_tag LOCUS_29470 1963 1442 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 protein_id gnl|my_center|LOCUS_29470 2261 2929 gene locus_tag LOCUS_29480 2261 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 2931 3296 gene locus_tag LOCUS_29490 2931 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 4268 3417 gene locus_tag LOCUS_29500 4268 3417 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986202.1 protein_id gnl|my_center|LOCUS_29500 5553 4657 gene locus_tag LOCUS_29510 5553 4657 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261697.1 protein_id gnl|my_center|LOCUS_29510 5642 6481 gene locus_tag LOCUS_29520 5642 6481 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971279.1 protein_id gnl|my_center|LOCUS_29520 6822 7721 gene locus_tag LOCUS_29530 6822 7721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 8407 7751 gene locus_tag LOCUS_29540 8407 7751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 8614 9975 gene locus_tag LOCUS_29550 8614 9975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 10236 10015 gene locus_tag LOCUS_29560 10236 10015 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964002.1 protein_id gnl|my_center|LOCUS_29560 11069 10353 gene locus_tag LOCUS_29570 11069 10353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 >Feature sequence083 1221 49 gene locus_tag LOCUS_29580 1221 49 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599197.1 protein_id gnl|my_center|LOCUS_29580 2309 1509 gene locus_tag LOCUS_29590 2309 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 2450 3724 gene locus_tag LOCUS_29600 2450 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 3775 4350 gene locus_tag LOCUS_29610 3775 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 4705 4418 gene locus_tag LOCUS_29620 4705 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 5093 6046 gene locus_tag LOCUS_29630 5093 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 6352 10014 gene locus_tag LOCUS_29640 6352 10014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 9016 9318 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10110 10425 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence084 <1 727 gene locus_tag LOCUS_29650 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943665.1:flagellin 152 181 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1291 2037 gene locus_tag LOCUS_29660 1291 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 2379 3248 gene locus_tag LOCUS_29670 2379 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 4793 3345 gene locus_tag LOCUS_29680 4793 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 5900 4872 gene locus_tag LOCUS_29690 5900 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 6057 7028 gene locus_tag LOCUS_29700 gene xerC 6057 7028 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460421.1 protein_id gnl|my_center|LOCUS_29700 7132 7944 gene locus_tag LOCUS_29710 7132 7944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 8029 8871 gene locus_tag LOCUS_29720 8029 8871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 10064 9162 gene locus_tag LOCUS_29730 10064 9162 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099205.1 protein_id gnl|my_center|LOCUS_29730 >Feature sequence085 906 64 gene locus_tag LOCUS_29740 906 64 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002268260.1 protein_id gnl|my_center|LOCUS_29740 1403 1221 gene locus_tag LOCUS_29750 1403 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 4346 1797 gene locus_tag LOCUS_29760 4346 1797 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943051.1 protein_id gnl|my_center|LOCUS_29760 5001 4333 gene locus_tag LOCUS_29770 5001 4333 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083291.1 protein_id gnl|my_center|LOCUS_29770 5663 4998 gene locus_tag LOCUS_29780 5663 4998 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005129345.1 protein_id gnl|my_center|LOCUS_29780 5956 6648 gene locus_tag LOCUS_29790 5956 6648 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191981.1 protein_id gnl|my_center|LOCUS_29790 6925 7335 gene locus_tag LOCUS_29800 6925 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 7676 7401 gene locus_tag LOCUS_29810 7676 7401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 7941 7669 gene locus_tag LOCUS_29820 7941 7669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 8063 8758 gene locus_tag LOCUS_29830 8063 8758 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770450.1 protein_id gnl|my_center|LOCUS_29830 8975 10483 gene locus_tag LOCUS_29840 8975 10483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 >Feature sequence086 187 500 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 906 2462 gene locus_tag LOCUS_29850 906 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 2565 2882 gene locus_tag LOCUS_29860 2565 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 3168 4721 gene locus_tag LOCUS_29870 3168 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 5326 7131 gene locus_tag LOCUS_29880 5326 7131 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_29880 7521 8438 gene locus_tag LOCUS_29890 gene sppA 7521 8438 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941890.1 protein_id gnl|my_center|LOCUS_29890 8459 9334 gene locus_tag LOCUS_29900 8459 9334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 9344 10099 gene locus_tag LOCUS_29910 9344 10099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 10125 10415 gene locus_tag LOCUS_29920 10125 10415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 >Feature sequence087 149 760 gene locus_tag LOCUS_29930 149 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 1685 2563 gene locus_tag LOCUS_29940 1685 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 2737 3939 gene locus_tag LOCUS_29950 2737 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 4375 5544 gene locus_tag LOCUS_29960 4375 5544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 5931 6110 gene locus_tag LOCUS_29970 5931 6110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 6711 6932 gene locus_tag LOCUS_29980 gene cspB 6711 6932 CDS product cold-shock protein CspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723180.1 protein_id gnl|my_center|LOCUS_29980 6946 7242 gene locus_tag LOCUS_29990 6946 7242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 7252 9804 gene locus_tag LOCUS_30000 gene polA 7252 9804 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964413.1 protein_id gnl|my_center|LOCUS_30000 >Feature sequence088 1061 186 gene locus_tag LOCUS_30010 1061 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 1298 2167 gene locus_tag LOCUS_30020 1298 2167 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787777.1 protein_id gnl|my_center|LOCUS_30020 2861 2187 gene locus_tag LOCUS_30030 2861 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 3668 2952 gene locus_tag LOCUS_30040 3668 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 7000 4418 gene locus_tag LOCUS_30050 gene clpB 7000 4418 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680241.1 protein_id gnl|my_center|LOCUS_30050 8066 7104 gene locus_tag LOCUS_30060 8066 7104 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228858.1 protein_id gnl|my_center|LOCUS_30060 8444 9277 gene locus_tag LOCUS_30070 8444 9277 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_30070 >Feature sequence089 <1 612 gene locus_tag LOCUS_30080 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707887.1:glycine C-acetyltransferase 609 1634 gene locus_tag LOCUS_30090 gene tdh 609 1634 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074264.1 protein_id gnl|my_center|LOCUS_30090 4689 2158 gene locus_tag LOCUS_30100 4689 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 5137 6180 gene locus_tag LOCUS_30110 gene hemH 5137 6180 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768824.1 protein_id gnl|my_center|LOCUS_30110 6633 7607 gene locus_tag LOCUS_30120 6633 7607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 8014 9069 gene locus_tag LOCUS_30130 8014 9069 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108001.1 protein_id gnl|my_center|LOCUS_30130 >Feature sequence090 237 1100 gene locus_tag LOCUS_30140 237 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 1120 1467 gene locus_tag LOCUS_30150 1120 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 2143 1580 gene locus_tag LOCUS_30160 2143 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 2949 3857 gene locus_tag LOCUS_30170 2949 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 3850 4308 gene locus_tag LOCUS_30180 3850 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 4325 5092 gene locus_tag LOCUS_30190 4325 5092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 5745 5158 gene locus_tag LOCUS_30200 5745 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 5989 6984 gene locus_tag LOCUS_30210 5989 6984 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_30210 7007 7300 gene locus_tag LOCUS_30220 7007 7300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 8440 7352 gene locus_tag LOCUS_30230 8440 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 >Feature sequence091 309 136 gene locus_tag LOCUS_30240 309 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 801 1277 gene locus_tag LOCUS_30250 801 1277 CDS product lpg2434 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948137.1 protein_id gnl|my_center|LOCUS_30250 1713 3638 gene locus_tag LOCUS_30260 1713 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 3667 4632 gene locus_tag LOCUS_30270 3667 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 5369 4710 gene locus_tag LOCUS_30280 5369 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 6127 5369 gene locus_tag LOCUS_30290 6127 5369 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705670.1 protein_id gnl|my_center|LOCUS_30290 6689 6114 gene locus_tag LOCUS_30300 6689 6114 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528992.1 protein_id gnl|my_center|LOCUS_30300 7315 6779 gene locus_tag LOCUS_30310 7315 6779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 7600 8205 gene locus_tag LOCUS_30320 7600 8205 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881107.1 protein_id gnl|my_center|LOCUS_30320 >Feature sequence092 1444 359 gene locus_tag LOCUS_30330 1444 359 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976365.1 protein_id gnl|my_center|LOCUS_30330 2603 1650 gene locus_tag LOCUS_30340 2603 1650 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048144.1 protein_id gnl|my_center|LOCUS_30340 3631 2615 gene locus_tag LOCUS_30350 3631 2615 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966892.1 protein_id gnl|my_center|LOCUS_30350 5104 3635 gene locus_tag LOCUS_30360 5104 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 6036 5101 gene locus_tag LOCUS_30370 gene oppB 6036 5101 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245554.1 protein_id gnl|my_center|LOCUS_30370 7779 6181 gene locus_tag LOCUS_30380 7779 6181 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823441.1 protein_id gnl|my_center|LOCUS_30380 8290 8490 gene locus_tag LOCUS_30390 8290 8490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 >Feature sequence093 2649 1231 gene locus_tag LOCUS_30400 2649 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 3098 2853 gene locus_tag LOCUS_30410 3098 2853 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_30410 3432 3187 gene locus_tag LOCUS_30420 gene rpsP 3432 3187 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379962.1 protein_id gnl|my_center|LOCUS_30420 5044 3584 gene locus_tag LOCUS_30430 gene ffh 5044 3584 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938141.1 protein_id gnl|my_center|LOCUS_30430 5190 5981 gene locus_tag LOCUS_30440 5190 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 6766 5978 gene locus_tag LOCUS_30450 6766 5978 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199919.1 protein_id gnl|my_center|LOCUS_30450 7674 6766 gene locus_tag LOCUS_30460 7674 6766 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 protein_id gnl|my_center|LOCUS_30460 >Feature sequence094 87 162 gene locus_tag LOCUS_t00240 87 162 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 429 3674 gene locus_tag LOCUS_30470 429 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 3813 5435 gene locus_tag LOCUS_30480 3813 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 6717 5479 gene locus_tag LOCUS_30490 6717 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 6784 7497 gene locus_tag LOCUS_30500 6784 7497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 >Feature sequence095 630 445 gene locus_tag LOCUS_30510 630 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 1179 640 gene locus_tag LOCUS_30520 1179 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 1841 1176 gene locus_tag LOCUS_30530 1841 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 2465 2100 gene locus_tag LOCUS_30540 2465 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626856.1 protein_id gnl|my_center|LOCUS_30540 2665 3177 gene locus_tag LOCUS_30550 2665 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 3290 3892 gene locus_tag LOCUS_30560 3290 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 4612 3887 gene locus_tag LOCUS_30570 4612 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 4939 5928 gene locus_tag LOCUS_30580 4939 5928 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948058.1 protein_id gnl|my_center|LOCUS_30580 6119 6667 gene locus_tag LOCUS_30590 6119 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 6761 7621 gene locus_tag LOCUS_30600 6761 7621 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057754.1 protein_id gnl|my_center|LOCUS_30600 >Feature sequence096 2034 46 gene locus_tag LOCUS_30610 2034 46 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329904.1 protein_id gnl|my_center|LOCUS_30610 3746 2814 gene locus_tag LOCUS_30620 3746 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 5588 4221 gene locus_tag LOCUS_30630 5588 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 6409 5582 gene locus_tag LOCUS_30640 6409 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 7054 6413 gene locus_tag LOCUS_30650 7054 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 >Feature sequence097 673 50 gene locus_tag LOCUS_30660 673 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 733 1035 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1234 2232 gene locus_tag LOCUS_30670 1234 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 2458 2243 gene locus_tag LOCUS_30680 2458 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 2553 2855 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3203 3502 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4572 5168 gene locus_tag LOCUS_30690 gene ysxC 4572 5168 CDS product ribosome biogenesis GTP-binding protein YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869116.1 protein_id gnl|my_center|LOCUS_30690 6008 6318 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6803 7180 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence098 155 634 gene locus_tag LOCUS_30700 155 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 1651 641 gene locus_tag LOCUS_30710 1651 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 1902 3092 gene locus_tag LOCUS_30720 1902 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 4720 3122 gene locus_tag LOCUS_30730 4720 3122 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940814.1 protein_id gnl|my_center|LOCUS_30730 5083 5991 gene locus_tag LOCUS_30740 gene folE2 5083 5991 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408083.1 protein_id gnl|my_center|LOCUS_30740 6106 6645 gene locus_tag LOCUS_30750 6106 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 >Feature sequence099 1521 955 gene locus_tag LOCUS_30760 gene pth 1521 955 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687802.1 protein_id gnl|my_center|LOCUS_30760 2260 1571 gene locus_tag LOCUS_30770 2260 1571 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768871.1 protein_id gnl|my_center|LOCUS_30770 3753 2386 gene locus_tag LOCUS_30780 3753 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 4509 3994 gene locus_tag LOCUS_30790 4509 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 5255 4515 gene locus_tag LOCUS_30800 gene ubiE 5255 4515 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227959.1 protein_id gnl|my_center|LOCUS_30800 6394 5258 gene locus_tag LOCUS_30810 6394 5258 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143005.1 protein_id gnl|my_center|LOCUS_30810 >Feature sequence100 253 1014 gene locus_tag LOCUS_30820 253 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 1027 2400 gene locus_tag LOCUS_30830 1027 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 3402 2788 gene locus_tag LOCUS_30840 3402 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 3930 3403 gene locus_tag LOCUS_30850 3930 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 4417 3983 gene locus_tag LOCUS_30860 4417 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 5840 4638 gene locus_tag LOCUS_30870 5840 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 >Feature sequence101 886 233 gene locus_tag LOCUS_30880 gene cmk 886 233 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072382.1 protein_id gnl|my_center|LOCUS_30880 1986 886 gene locus_tag LOCUS_30890 gene hisC 1986 886 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_30890 2363 3730 gene locus_tag LOCUS_30900 2363 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 3731 5188 gene locus_tag LOCUS_30910 3731 5188 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_30910 5904 5185 gene locus_tag LOCUS_30920 5904 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 >Feature sequence102 1424 264 gene locus_tag LOCUS_30930 1424 264 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678909.1 protein_id gnl|my_center|LOCUS_30930 1648 1427 gene locus_tag LOCUS_30940 1648 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 2985 1702 gene locus_tag LOCUS_30950 2985 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 3404 3057 gene locus_tag LOCUS_30960 3404 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 4263 4676 gene locus_tag LOCUS_30970 gene zntR 4263 4676 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285607.1 protein_id gnl|my_center|LOCUS_30970 4669 5016 gene locus_tag LOCUS_30980 4669 5016 CDS product mercuric transport protein MerT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294663.1 protein_id gnl|my_center|LOCUS_30980 5025 5348 gene locus_tag LOCUS_30990 5025 5348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 5357 5830 gene locus_tag LOCUS_31000 5357 5830 CDS product copper chaperone Copz family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057722.1 protein_id gnl|my_center|LOCUS_31000 >Feature sequence103 355 549 gene locus_tag LOCUS_31010 355 549 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358646.1 protein_id gnl|my_center|LOCUS_31010 800 1582 gene locus_tag LOCUS_31020 800 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 1839 3107 gene locus_tag LOCUS_31030 1839 3107 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_31030 3482 3087 gene locus_tag LOCUS_31040 gene arfB 3482 3087 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_31040 3576 3953 gene locus_tag LOCUS_31050 3576 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 4997 4338 gene locus_tag LOCUS_31060 4997 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 5061 5543 gene locus_tag LOCUS_31070 5061 5543 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704946.1 protein_id gnl|my_center|LOCUS_31070 5648 6016 gene locus_tag LOCUS_31080 5648 6016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 >Feature sequence104 1 1392 gene locus_tag LOCUS_31090 1 1392 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489009.1 protein_id gnl|my_center|LOCUS_31090 1416 2210 gene locus_tag LOCUS_31100 1416 2210 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451066.1 protein_id gnl|my_center|LOCUS_31100 2335 2823 gene locus_tag LOCUS_31110 2335 2823 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464913.1 protein_id gnl|my_center|LOCUS_31110 2992 3141 gene locus_tag LOCUS_31120 2992 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 3579 3145 gene locus_tag LOCUS_31130 3579 3145 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133916.1 protein_id gnl|my_center|LOCUS_31130 4288 3806 gene locus_tag LOCUS_31140 4288 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 >Feature sequence105 1349 855 gene locus_tag LOCUS_31150 1349 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 1563 2588 gene locus_tag LOCUS_31160 1563 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 2799 2566 gene locus_tag LOCUS_31170 2799 2566 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764038.1 protein_id gnl|my_center|LOCUS_31170 2997 4094 gene locus_tag LOCUS_31180 2997 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 4251 4553 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence106 1632 52 gene locus_tag LOCUS_31190 1632 52 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913630.1 protein_id gnl|my_center|LOCUS_31190 2844 2047 gene locus_tag LOCUS_31200 2844 2047 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144110.1 protein_id gnl|my_center|LOCUS_31200 3974 2943 gene locus_tag LOCUS_31210 3974 2943 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966901.1 protein_id gnl|my_center|LOCUS_31210 >Feature sequence107 1502 120 gene locus_tag LOCUS_31220 1502 120 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074151.1 protein_id gnl|my_center|LOCUS_31220 2833 1502 gene locus_tag LOCUS_31230 2833 1502 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074152.1 protein_id gnl|my_center|LOCUS_31230 3567 3064 gene locus_tag LOCUS_31240 gene fliL 3567 3064 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780442.1 protein_id gnl|my_center|LOCUS_31240 3734 4738 gene locus_tag LOCUS_31250 3734 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 >Feature sequence108 172 1461 gene locus_tag LOCUS_31260 172 1461 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103434.1 protein_id gnl|my_center|LOCUS_31260 1504 2502 gene locus_tag LOCUS_31270 1504 2502 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044885.1 protein_id gnl|my_center|LOCUS_31270 2499 3377 gene locus_tag LOCUS_31280 2499 3377 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905448.1 protein_id gnl|my_center|LOCUS_31280 3393 3914 gene locus_tag LOCUS_31290 3393 3914 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875754.1 protein_id gnl|my_center|LOCUS_31290 >Feature sequence109 2327 1482 gene locus_tag LOCUS_31300 2327 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 3788 2361 gene locus_tag LOCUS_31310 3788 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 >Feature sequence110 49 555 gene locus_tag LOCUS_31320 49 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 974 612 gene locus_tag LOCUS_31330 974 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 2038 1046 gene locus_tag LOCUS_31340 2038 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 2629 3630 gene locus_tag LOCUS_31350 2629 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 >Feature sequence111 89 1099 gene locus_tag LOCUS_31360 89 1099 CDS product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 protein_id gnl|my_center|LOCUS_31360 1349 1693 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2010 4142 gene locus_tag LOCUS_31370 2010 4142 CDS product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_31370 >Feature sequence112 1421 84 gene locus_tag LOCUS_31380 1421 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 2838 1447 gene locus_tag LOCUS_31390 2838 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 3743 3045 gene locus_tag LOCUS_31400 3743 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 >Feature sequence113 863 72 gene locus_tag LOCUS_31410 863 72 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931500.1 protein_id gnl|my_center|LOCUS_31410 1070 3787 gene locus_tag LOCUS_31420 gene topA 1070 3787 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057718.1 protein_id gnl|my_center|LOCUS_31420 >Feature sequence114 577 887 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2104 1070 gene locus_tag LOCUS_31430 gene queA 2104 1070 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081288.1 protein_id gnl|my_center|LOCUS_31430 3597 2248 gene locus_tag LOCUS_31440 3597 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 >Feature sequence115 229 2667 gene locus_tag LOCUS_31450 229 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 <3767 2742 gene locus_tag LOCUS_31460 <3767 2742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943729.1:transcription termination factor Rho >Feature sequence116 511 128 gene locus_tag LOCUS_31470 511 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 1749 511 gene locus_tag LOCUS_31480 1749 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 2199 3356 gene locus_tag LOCUS_31490 2199 3356 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011186.1 protein_id gnl|my_center|LOCUS_31490 >Feature sequence117 328 1671 gene locus_tag LOCUS_31500 328 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31500 1699 3459 gene locus_tag LOCUS_31510 1699 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31510 >Feature sequence118 <1 2088 gene locus_tag LOCUS_31520 <1 2088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016588.1:alanine--tRNA ligase 2858 2283 gene locus_tag LOCUS_31530 2858 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 >Feature sequence119 222 486 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1469 666 gene locus_tag LOCUS_31540 1469 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 1800 1967 gene locus_tag LOCUS_31550 1800 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 2015 3109 gene locus_tag LOCUS_31560 2015 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 >Feature sequence120 1747 2364 gene locus_tag LOCUS_31570 1747 2364 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185693707.1 protein_id gnl|my_center|LOCUS_31570 >Feature sequence121 1095 415 gene locus_tag LOCUS_31580 gene lolD 1095 415 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367168.1 protein_id gnl|my_center|LOCUS_31580 2359 1088 gene locus_tag LOCUS_31590 2359 1088 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_31590 2804 3210 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence122 1287 691 gene locus_tag LOCUS_31600 1287 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31600 1759 1451 gene locus_tag LOCUS_31610 1759 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 2454 2023 gene locus_tag LOCUS_31620 2454 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 >Feature sequence123 1109 51 gene locus_tag LOCUS_31630 1109 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 1479 1159 gene locus_tag LOCUS_31640 1479 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 2351 1740 gene locus_tag LOCUS_31650 2351 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 2732 2415 gene locus_tag LOCUS_31660 2732 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 2928 3050 gene locus_tag LOCUS_31670 2928 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 >Feature sequence124 233 1342 gene locus_tag LOCUS_31680 233 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 1679 2290 gene locus_tag LOCUS_31690 1679 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 2389 2691 gene locus_tag LOCUS_31700 2389 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 >Feature sequence125 1769 150 gene locus_tag LOCUS_31710 1769 150 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_31710 2347 1778 gene locus_tag LOCUS_31720 2347 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 >Feature sequence126 235 574 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 796 1099 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2155 1382 gene locus_tag LOCUS_31730 2155 1382 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201022.1 protein_id gnl|my_center|LOCUS_31730