COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..47262 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(240..593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(605..910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(910..1308) product DUF4176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966968.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(1301..5767) product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966969.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene essC CDS complement(5772..6896) product type VII secretion protein EssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966970.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene essB CDS complement(6883..7146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(7124..7594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(7647..7937) product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966973.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS 8417..8947 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131387.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 8994..11690 product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906085.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(11730..11942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(12124..12408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 12552..13502 product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288288.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(13544..14281) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357431.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(14365..14850) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031472.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 15120..16748 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905087.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 16824..17633 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905086.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 17749..18741 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905085.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene plsX CDS complement(18862..21459) product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002388982.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene mgtA CDS complement(21846..22286) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905082.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 22703..23734 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905081.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene trpS CDS 23751..24389 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905080.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 24379..25176 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905079.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 25384..26379 product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905078.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 26413..27537 product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905077.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 27540..28520 product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905076.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 assembly_gap 28927..29256 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 29262..30404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 30428..31849 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905074.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene lpdA CDS complement(31881..32648) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132217.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene recO CDS complement(32926..33318) product RinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905708.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(33408..33707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(33890..34333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(34339..34944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906211.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(35129..35272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(35359..35805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(36365..37789) product VapE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905412.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(37798..38571) product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232980.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(38568..38897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905047.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(38894..39085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(39289..39558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905051.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(39555..39704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(39701..39880) product DUF1655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906219.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(39954..40643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(40719..40916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031366831.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 41179..41931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 42046..42285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 42355..43227 product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(43538..43726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 43947..45128 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905063.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 45399..46031 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905030.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 tRNA complement(46321..46393) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA complement(47045..47120) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 rRNA complement(47126..47229) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence002 source 1..44835 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(161..1231) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905179.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene rlmN CDS complement(1321..1929) product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905178.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(2349..2801) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905176.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(2838..3530) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129738.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(3520..4038) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905169.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 4151..4348 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129735.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 4480..5835 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905168.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(5850..7283) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905166.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene gatB CDS complement(7285..8757) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905164.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene gatA CDS complement(8757..9062) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905163.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene gatC CDS complement(9283..10074) product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129722.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene codY CDS complement(10210..11808) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905162.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(11946..12269) product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894073.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(12285..12713) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021214669.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene ruvX CDS complement(12713..12979) product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131820.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(13180..14091) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288005.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(14366..14500) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131818.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene rpmH CDS complement(14621..15532) product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905141.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(15558..16373) product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905140.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(16370..16738) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131815.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene rnpA CDS 17113..18057 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905132.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 tRNA 18287..18372 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 18547..18846 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905131.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(18999..20726) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905129.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene ptsP CDS complement(20726..20992) product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905128.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(21139..22176) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132289.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(22274..24847) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905127.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene secA CDS complement(24945..25565) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905124.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(25688..26302) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905122.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(26322..26771) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905120.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene dtd CDS complement(26833..29025) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905119.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(29184..29939) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905117.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(29943..30896) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905116.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene prmA CDS complement(30925..31389) product DUF3013 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905112.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 31551..32024 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905111.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 32048..33310 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905110.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(33772..35565) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905108.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 35930..36103 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905107.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene rpmF CDS 36134..36283 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132258.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene rpmG assembly_gap 38216..38479 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 38680..39558 product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002911924.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(40187..43144) product type VII secretion protein EsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966957.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene esaA CDS complement(43285..43647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(43674..43814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(43899..44201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 sequence003 source 1..42917 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(57..542) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906015.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene purE CDS complement(545..1777) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014570649.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene purD CDS complement(1881..2573) product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130060.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(2665..4275) product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162367.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene treC CDS complement(4295..5842) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025016545.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(5855..6340) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131536.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 6469..7185 product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131538.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene treR CDS complement(7220..8770) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130058.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene purH CDS complement(8811..9407) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130044.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene purN CDS complement(9350..10363) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200094842.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene purM CDS complement(10356..11771) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906019.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene purF CDS complement(11756..13972) product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130033.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene purL CDS complement(13969..14649) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130032.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene purQ CDS complement(14649..14891) product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906021.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene purS CDS complement(14946..15662) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906022.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(15767..16192) product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255012.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(16338..17177) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130015.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(17363..19213) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130686.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(19309..21153) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287775.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 assembly_gap 21221..21497 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(21604..22998) product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130696.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(22995..24191) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130698.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(24377..25720) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294399.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(25769..27295) product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290168.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(27513..28358) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906033.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(28382..28780) product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130704.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(28777..29361) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475976.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(29358..30089) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130706.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene trmD CDS complement(30091..30606) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130707.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene rimM CDS complement(30837..31340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(31387..31689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(31765..33765) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906117.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(33758..34543) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906118.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(34606..34995) product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130414.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(35206..36303) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130405.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(36475..36810) product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886702.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(36825..39026) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731969.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(39116..40024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(40510..41226) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(41303..42163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(42436..42840) product Spx/MgsR family RNA polymerase-binding regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905585.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 sequence004 source 1..38593 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 109..1680 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024029827.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 1691..3109 product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298077.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(3272..3475) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906103.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 3521..4033 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130901.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 4066..4728 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130902.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene cmk CDS 5082..6122 product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132781.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(6004..6222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(6504..6659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 6824..8182 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906102.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 8425..10050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(10086..10940) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130377.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(10942..12291) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130376.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(12362..13597) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130374.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 13866..15626 product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130373.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 15743..16006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 16025..17632 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130367.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 17656..19920 product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906090.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 19913..20578 product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905331.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene pgmB CDS 20605..21579 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130365.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 22232..22909 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130364.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 22915..24315 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906089.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 24383..26125 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906088.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 26134..26400 product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906087.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene yidD CDS 26602..27384 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861723.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 27374..28324 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905286.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 28321..29259 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131660.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 29272..30213 product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131659.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 30747..31187 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132498.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 31187..32164 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132499.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 32252..32473 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132501.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 32533..33492 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132502.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene fabD CDS 33570..34301 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132504.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene fabG CDS 34358..35575 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905554.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene fabF CDS 35668..36144 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905555.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene accB CDS 36159..36593 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132511.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene fabZ CDS 36791..38155 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132515.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene accC sequence005 source 1..38286 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 115..510 product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254213.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene spxA CDS 668..928 product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015425977.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 944..1216 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021214922.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 1275..2600 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132604.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 3013..3249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 3655..4740 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101507.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene rsgA CDS 4893..5711 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138929.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene proB CDS 5727..6983 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906056.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 7174..8673 product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132064.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(8872..9078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(9326..10096) product myo-inositol utilization transcriptional regulator IolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227050.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene iolR CDS 10336..11796 product methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989444.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene iolA CDS 11789..12610 product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243247.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene iolB CDS 12622..13581 product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243753.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene iolC CDS 13799..14680 product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471986.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene iolE CDS 14825..16432 product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087120.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 16570..16911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 16904..18820 product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242642.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene iolD CDS 18867..19859 product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102250.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene iolG CDS 19934..20953 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102247.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 21273..22256 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906073.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 22249..23154 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906072.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene rbsK CDS 23129..23527 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129436.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene rbsD CDS 23524..24999 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906071.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 25033..25974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978822.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 26016..26984 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668256.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 assembly_gap 27181..27425 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 27628..28707 product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131037.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene xerS CDS complement(28904..29314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(29417..30763) product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131150.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene trmFO CDS complement(30818..32968) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131148.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene topA assembly_gap 33050..33340 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(33470..34315) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922314.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene dprA CDS complement(34401..35099) product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131140.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene budA CDS complement(35222..36946) product ABC transporter permease/substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130445.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(36939..38141) product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130443.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 sequence006 source 1..37257 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 66..1547 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129822.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene guaB CDS 1844..3490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 3711..3887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 4066..5001 product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906320.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene comGA CDS 5132..5968 product competence type IV pilus assembly protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770673.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene comGB CDS 5986..6291 product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263437.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene comGC CDS 6347..6682 product competence type IV pilus minor pilin ComGD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226319344.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene comGD CDS 6654..6956 product competence type IV pilus minor pilin ComGE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906316.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene comGE CDS 6967..7362 product competence type IV pilus minor pilin ComGF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379808.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene comGF CDS 7365..7538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 7593..8438 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906312.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(8509..9390) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906309.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 9552..11753 product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129980.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 11921..13756 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906306.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 13953..14150 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129978.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene secE CDS 14248..14808 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129977.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene nusG CDS 14854..16131 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129881172.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(16178..16558) product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906303.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene mscL CDS 16870..17178 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129973.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene rpsJ CDS 17193..17816 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129970.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene rplC CDS 17839..18465 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129968.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene rplD CDS 18465..18767 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129966.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 18783..19616 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129965.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene rplB CDS 19800..20078 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129963.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene rpsS CDS 20094..20441 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906302.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene rplV CDS 20454..21107 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906301.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene rpsC CDS 21111..21527 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960946.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene rplP CDS 21524..21733 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129957.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene rpmC CDS 21752..22012 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129955.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene rpsQ CDS 22035..22403 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129953.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene rplN CDS 22570..22875 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129951.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene rplX CDS 22895..23437 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129948.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene rplE CDS 23457..23642 product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129946.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 23867..25483 product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 25712..26665 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131609.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 27232..27630 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906299.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene rpsH CDS 27720..28256 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195502.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene rplF CDS 28399..28746 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129924.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene rplR CDS 28767..29261 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129922.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene rpsE CDS 29272..29454 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262322.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene rpmD CDS 29709..30758 product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905973.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 30958..31410 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129920.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene rplO CDS 31481..32797 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129919.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene secY CDS 32950..36276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 36420..37067 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906298.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 sequence007 source 1..35256 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 402..1595 product accessory Sec system protein translocase subunit SecY2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772262.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene secY2 CDS 1605..3167 product accessory Sec system protein Asp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468347.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene asp1 CDS 3172..4755 product accessory Sec system protein Asp2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836744.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene asp2 CDS 4752..5300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 5303..7690 product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836745.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene secA2 CDS 7702..9207 product accessory Sec system glycosyltransferase GtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158445.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene gtfA CDS 9200..10516 product accessory Sec system glycosylation chaperone GtfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609042.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene gtfB CDS 10517..10684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 11381..11914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 12246..12626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 note possible pseudo, frameshifted CDS 12650..12943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 note possible pseudo, internal stop codon, frameshifted CDS 12947..13699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 note possible pseudo, internal stop codon tRNA complement(13823..13895) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 14221..15468 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130563.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene radA CDS 16052..16315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 assembly_gap 16561..16813 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 16850..17233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 17281..17553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 17544..17723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 18051..19130 product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906293.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 19170..19799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129888.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 19985..21106 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869878.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene ald CDS complement(21145..21639) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129897.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 21785..23224 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906290.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene gltX CDS complement(23464..24399) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546076.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 24631..29772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(30060..31640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(31743..32303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(32649..34946) product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254450.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 sequence008 source 1..34598 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1248..3809) product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459232.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene pglZ CDS complement(3790..4350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(4350..5570) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068364.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(5742..6137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(6148..9546) product BREX-1 system adenine-specific DNA-methyltransferase PglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459230.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene pglX CDS complement(9557..13096) product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459229.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene brxC CDS complement(13093..13668) product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272229.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(13672..14283) product DUF1819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459228.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(14308..14499) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305998.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(14701..15315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 note possible pseudo, internal stop codon, frameshifted CDS complement(15706..16065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(16175..17512) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002376912.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene asnS CDS complement(17533..17739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 note possible pseudo, frameshifted CDS complement(17723..17860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(17850..19043) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906157.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(19047..19475) product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130291.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(19710..22064) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379803.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 22436..22873 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906159.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(22946..24637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(25037..25954) product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905494.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 26610..27008 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905884.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(27156..27677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 27883..28863 product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360063.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(29028..29738) product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774684.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(29878..31179) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905473.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene eno CDS complement(31531..31890) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132352.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene rplT CDS complement(32142..32342) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132353.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene rpmI CDS complement(32374..32868) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082272306.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene infC assembly_gap 33220..33516 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 33641..34144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 34160..34342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 34430..34594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 sequence009 source 1..34533 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 118..1716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(1814..3181) product DUF2142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049706.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(3191..4915) product SpaA isopeptide-forming pilin-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037459.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(4940..5356) product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905215.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene tagD CDS complement(5381..6268) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905213.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(6270..7271) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905212.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(7268..8098) product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905211.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(8095..9234) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905210.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(9227..10660) product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905209.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(10657..11601) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905208.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 assembly_gap 11681..11920 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12203..12934) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905206.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(12927..13802) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383764.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(13805..15049) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837187.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(15166..18102) product rhamnan synthesis F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837189.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(18118..19452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(19462..20352) product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776623.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(20349..21509) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905200.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(21520..22329) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905199.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(22326..23267) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905198.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(23291..24436) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905197.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(24491..25390) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905196.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene rfbD CDS complement(25406..26449) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905195.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene rfbB CDS complement(26608..27204) product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264623.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(27206..28075) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905191.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene rfbA CDS complement(28215..30533) product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861289.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(30638..31285) product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905190.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 31467..31661 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129776.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene rpmB CDS complement(31881..32633) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906025.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(32735..33118) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130788.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 sequence010 source 1..34371 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(28..1011) product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930954.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 1139..2533 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 2547..3827 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978237.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 3930..6062 product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027257.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 6088..6720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 6773..7645 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130103.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(7684..8538) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868944.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 8633..9283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 9680..9949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 tRNA complement(9969..10054) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(10137..10703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03450 note possible pseudo, frameshifted CDS complement(10745..11404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03460 note possible pseudo, frameshifted CDS complement(11544..13046) product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905587.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(13030..13881) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905586.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(13980..14993) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905252.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(14990..15139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(15159..15638) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131187.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 16136..16375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 16560..17405 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131189.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 17596..18690 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959424.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene ald CDS 18713..19720 product bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628920.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene tdcB CDS 19965..21155 product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289186.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 21222..22175 product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289187.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 22326..23684 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296108.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(23854..24048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 24537..25118 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189990.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 25280..27517 product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905257.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene nrdD CDS 27825..29270 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905762.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 29578..30177 product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905258.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene nrdG CDS 30174..30665 product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131197.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 30730..31563 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255784.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 31560..32405 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255782.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 32407..33207 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255779.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 tRNA 33325..33398 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 assembly_gap 33400..33760 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA 33760..33835 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 33860..33935 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 33949..34024 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 34109..34181 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 34185..34255 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 34297..34370 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 sequence011 source 1..33039 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 155..916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(1074..1502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(1525..2301) product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906040.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(2341..2658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(2795..4246) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317943.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(4444..5781) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905313.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(6388..8388) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129419.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene tkt CDS complement(8518..9885) product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102215.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(9936..10235) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367331.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(10237..12165) product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387321.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(12355..12975) product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905546.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(12972..13688) product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905545.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(13681..14565) product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905544.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene dnaI CDS complement(14568..15731) product replication initiation and membrane attachment family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132471.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(15764..16150) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132469.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene nrdR CDS complement(16217..16870) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132468.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene trmB CDS complement(16931..17704) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132467.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(18054..18317) product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905542.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(18426..19799) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132465.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene dnaB CDS complement(19803..20255) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132464.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene rplI CDS complement(20252..22219) product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905541.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(22289..22948) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905540.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(23045..24457) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132454.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 24724..25689 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138879.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 25936..26229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(26332..27207) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130103.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(27216..29162) product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641781.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 29277..30722 product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775322.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 30722..31678 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836522.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 sequence012 source 1..32994 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1611..1814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132029.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 2155..3024 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906286.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 3484..4335 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131676.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 4356..5432 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131670.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 5433..6128 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905283.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(6361..7743) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379815.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 assembly_gap 7834..8093 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8515..8802 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905285.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 9064..9969 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131658.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 10066..10767 product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131652.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 10893..13049 product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905292.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(13097..14029) product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131606.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 14190..15008 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905309.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(14995..15915) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387471.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 16146..16799 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131648.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene recR CDS 16812..17861 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905293.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 17987..18253 product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132530.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 18546..19877 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905294.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 assembly_gap 20007..20213 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 20296..21969 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131645.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 22043..22960 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131640.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 22976..24010 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131638.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 24027..25088 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131637.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 25088..26023 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131636.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 assembly_gap 26121..26305 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 26387..26830 product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130996.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 27223..27624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(27765..28028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 assembly_gap 28189..28382 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 28758..29165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 29231..29485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 assembly_gap 29517..29743 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 29908..30141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 30113..31060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 31391..32962 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131635.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 sequence013 source 1..32551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 346..1374 product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379822.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 1376..3022 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905535.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene menD CDS 3012..3839 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905534.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene menH CDS 3873..4715 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132444.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene menB CDS 4719..6071 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905533.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene menE CDS 6061..7164 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905532.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene menC CDS 7161..7538 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905531.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 7915..8421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(8687..10078) product accessory Sec system glycosylation chaperone GtfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571763.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene gtfB CDS complement(10042..11547) product accessory Sec system glycosyltransferase GtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836746.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene gtfA CDS complement(11567..12577) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972583.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(12788..13195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 assembly_gap 13701..14075 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 14308..14704 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 15564..16652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 16774..16974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(19379..19588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(19772..20590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(20600..22192) product accessory Sec system protein Asp2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836744.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene asp2 CDS complement(22185..23702) product accessory Sec system protein Asp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836743.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene asp1 CDS complement(23723..24937) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874541.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene secY CDS complement(24958..27345) product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560050.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene secA2 CDS 27891..30869 product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399773.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 sequence014 source 1..32042 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(56..1048) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905599.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene mraY CDS complement(1139..3436) product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905598.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(3433..3813) product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131357.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(3857..4798) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905597.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene rsmH CDS complement(4920..6089) product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900648.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 tRNA complement(6150..6221) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(6674..6877) product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906074.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(7207..8427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(8428..8847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04550 assembly_gap 9581..9847 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9981..10838) product tagatose-bisphosphate aldolase subunit GatY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898685.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(10864..11793) product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604263.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(11808..12959) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922584.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(13114..13761) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905540.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(13763..15691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(15701..16633) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355534.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene pfkB CDS 16790..17548 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363162.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(17580..18419) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167627999.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(18409..19218) product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406214.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene agaW CDS complement(19341..19817) product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387360.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene agaV CDS complement(19907..20182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(20183..20605) product PTS mannose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358624.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(20756..21898) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905894.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene nagA CDS complement(22029..22781) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254700.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(22828..24750) product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905244.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 assembly_gap 24858..25082 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(25160..25303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 assembly_gap 25320..25616 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(25785..28592) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130311.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene uvrA assembly_gap 25816..26087 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 28698..29000 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906152.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(29375..29701) product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905638.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(29741..30661) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906153.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(30671..31288) product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906154.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(31285..31632) product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130302.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(31745..31894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04780 sequence015 source 1..30962 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(93..4352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 assembly_gap 122..507 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4560..4819 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5010..5447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(5458..6963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 assembly_gap 7245..7503 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7516..9564) product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129537.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 10135..10575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 10786..11427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04840 note possible pseudo, internal stop codon CDS complement(11840..12520) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905491.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(12523..13596) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129569.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(13632..14195) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905492.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 14421..14624 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914590.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(14665..16743) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986267.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(16721..17410) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949146.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(17630..18418) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989455.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(18477..18716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(18833..19267) product Spx/MgsR family RNA polymerase-binding regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905585.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(19410..20522) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132601.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene alr CDS complement(20545..20907) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132600.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene acpS CDS complement(21022..22428) product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132599.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene pepV CDS complement(22538..23620) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132598.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene mutY CDS complement(23741..25519) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837033.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene uvrC assembly_gap 25812..26026 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(26056..26718) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774917.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(26754..27521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(27975..28640) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476350.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 assembly_gap 28699..28953 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence016 source 1..29692 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1472..1999 product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132009.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(2264..3751) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906393.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene zwf CDS complement(3775..3954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132007.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(3951..4166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 4063..4908 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906392.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 4905..5273 product DUF1634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132003.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 tRNA 5320..5404 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 5457..5663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 5674..6558 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906390.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(6674..7939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(8131..9819) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906279.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene argS CDS 10109..10555 product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254487.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene argR CDS 10545..10886 product RicAFT regulatory complex protein RicA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906386.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 10990..13497 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906385.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene mutS CDS 13556..14230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906384.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 14388..16286 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031297070.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene mutL CDS 16348..17265 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905676.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 17265..17855 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131995.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene ruvA CDS 18298..19947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 20034..21275 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542320.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 21319..22317 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131994.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene ruvB CDS 22441..22872 product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906378.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 22961..23326 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131985.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 23379..24719 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906377.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene glnA CDS 24953..25384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131961.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(25475..25747) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362440.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 26022..26465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 26778..27260 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131959.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 27257..27889 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906375.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 27902..29566 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906374.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene dnaX sequence017 source 1..28866 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(278..1252) product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287105.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene bsh CDS complement(1760..3385) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131585.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene groL CDS complement(3414..3695) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131589.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene groES CDS complement(4375..4764) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905314.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(4843..5466) product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131594.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(5463..5789) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131595.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(5786..6073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 6222..7289 product glutamyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905311.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene pepA CDS 7413..8066 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905677.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(8234..8638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(8631..9092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(9222..11651) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131598.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 11787..13046 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131599.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene tyrS CDS 13175..13642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905310.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 13722..15812 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131601.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(15846..17249) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131604.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(17318..18538) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131605.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene thiI CDS complement(18620..19081) product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674531.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(19142..20152) product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905308.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(20346..22184) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045634338.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 22551..24038 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905307.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene lysS CDS 24108..25703 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(25815..26399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 assembly_gap 26432..26700 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(26890..27576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(28352..28543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 sequence018 source 1..28598 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 368..602 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 613..1458 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005717330.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 1449..1757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 assembly_gap 2037..2236 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2332..3657 product ISLre2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453221.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 4053..4295 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130760.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 4451..4999 product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130758.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 5097..5792 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130756.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 5880..7370 product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906048.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 7887..9458 product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837468.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 9459..10196 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356242.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 10321..11682 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130748.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene murD CDS 11684..12784 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130746.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene murG CDS 12777..13811 product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130744.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(13988..14725) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132766.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(14739..16883) product amino acid ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132767.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 17120..17776 product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906123.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 17887..18729 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906122.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 18713..19795 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132771.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene aroB CDS 19937..20863 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132772.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 20870..21460 product YktB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906121.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 21462..22631 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906120.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene aroC CDS 22760..23116 product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906119.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 23147..23935 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906118.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 23928..25895 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906117.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 25896..26114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 26377..27033 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132782.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 27020..27910 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132784.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 27900..28457 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226319392.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 sequence019 source 1..26907 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(306..1073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(1086..1550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(1572..2132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(2151..3281) product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390088.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(3294..5855) product type IV secretory pathway, VirB4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003582237.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(5852..6145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(6135..8186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(8173..10920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(10930..12042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(12064..12327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(12383..12679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(12672..12881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(13293..16766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(17055..17522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(17700..18023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(18086..18361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(18418..19245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(19325..19699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(19740..20195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(20276..20428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(20431..20580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(21210..21872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(21869..22966) product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286932.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene dcm CDS complement(22953..23234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 23327..23506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 23775..24125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 24445..25188 product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262342.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 assembly_gap 26359..26661 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 26691..26900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06100 sequence020 source 1..26711 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(812..1438) product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906254.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 assembly_gap 1528..1823 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1901..2722 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906253.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(2790..3068) product DUF3270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254660.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 3276..4199 product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254664.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 4287..5576 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254683.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 5598..6473 product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906251.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 6615..7598 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906245.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene galE CDS 7778..9238 product basic amino acid/polyamine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021037906.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(9259..9480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(9473..10546) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906242.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene recF CDS complement(10549..10911) product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254746.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene yaaA CDS 11044..12288 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180259804.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 12269..13552 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058204375.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 13604..14503 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906239.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 14535..15086 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906238.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene pgsA CDS 15591..16874 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254776.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene hisS CDS 16930..18678 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254782.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene aspS CDS 18662..19552 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906234.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 19679..20560 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254791.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(20613..20855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(21025..22020) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906232.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene dusB CDS complement(22111..23655) product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130350.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(23652..24536) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906231.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene hslO CDS 24844..26133 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254838.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 sequence021 source 1..25329 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(362..601) product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130710.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(678..950) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262013.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene rpsP CDS complement(1036..2283) product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906035.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(2287..3447) product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906036.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 3552..4703 product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906037.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(4748..5542) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364009.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(5819..10078) product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379838.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(10458..12746) product RTX toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187288335.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(12816..13454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(13617..14402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(14447..15235) product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385163.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(15283..16308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(16345..17256) product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296745.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(17433..18602) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014525057.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(18660..19652) product DUF916 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132423.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 19904..20512 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906406.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(20649..21356) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130716.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 21602..22630 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130719.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene queA CDS 22631..23206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906043.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 assembly_gap 23369..23663 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 23745..24467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 sequence022 source 1..24918 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(689..1045) product DUF3397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639447.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(1162..1641) product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131680.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(1659..2195) product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162551422.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene thiT CDS complement(2387..3004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 3253..4029 product CppA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906285.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 4026..4970 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254459.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(5187..6377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 6654..7232 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896832.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 7402..10500 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906282.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 10633..11262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906281.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 11313..12644 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906280.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene murC CDS 12960..14300 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131558.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 14300..14893 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905322.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 14906..15646 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905323.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 15873..16199 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131553.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 16229..17569 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131550.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 17745..19247 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131549.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 19247..20683 product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905175.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 20912..21094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06740 note possible pseudo, internal stop codon CDS 21130..21456 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131552.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 tRNA 21765..21835 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(21960..22124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(22247..22918) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039550.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(23677..24618) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905118.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 sequence023 source 1..24846 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 79..2694 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906334.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene polA CDS complement(2817..3026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(3261..3983) product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905156.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 4118..5266 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129711.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene tgt CDS 5396..7348 product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861581.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 7383..8135 product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906333.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(8190..8414) product YkuJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130579.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(8464..9798) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906331.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(9810..10808) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906330.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(10905..12125) product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906329.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 12431..12910 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130585.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene rlmH CDS 12907..13254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 13538..13873 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130588.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene yajC CDS 14069..14806 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906326.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 14803..15597 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130590.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 15777..17024 product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906325.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene rseP CDS 17051..18901 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906324.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 19807..24690 product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031296849.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 sequence024 source 1..24628 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(73..993) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130461.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene coaA CDS 1178..1783 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130463.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 1780..3072 product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905974.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 3072..3266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 3339..4001 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130468.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene deoC CDS 3988..4380 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130469.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 4554..5606 product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905973.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 5697..6404 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130471.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(6554..8134) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905972.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(8097..8801) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130475.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 9090..9425 product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130477.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 9451..9639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 9632..10537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 10515..11264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 tmRNA 11310..11663 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(11833..12267) product DUF1398 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905247.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(12449..12604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 assembly_gap 12874..13104 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13195..13629 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130484.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 13969..14448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906139.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(14589..15188) product lipoprotein BA_5634 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905446.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(15288..16091) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836893.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(16102..16734) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355926.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 16937..19555 product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861547.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene ppdK CDS complement(19698..20096) product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905975.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene psiE CDS 20356..20535 product FaeA/PapI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813931.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 20607..20987 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130526.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 21102..21593 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_227020409.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 22036..22890 product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905873.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene ylqF CDS 22877..23638 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130174.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(23663..24409) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130180.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 sequence025 source 1..24614 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 22..1644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(1744..1938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(1962..2735) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130207.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(3058..3501) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700867.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(3504..4829) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003707114.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 5450..6331 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906200.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene rsgA CDS 6345..6509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 6518..7177 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906199.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene rpe CDS 7174..8460 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906198.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 8462..9406 product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254890.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 9421..10290 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906197.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 10380..11513 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254931.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 11583..12212 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254935.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene upp CDS 12360..12968 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906194.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 13190..13507 product ATP cone domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254946.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 assembly_gap 13695..13909 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14080..20307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 20324..20941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 21223..22170 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364185.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene hemH CDS 22537..24477 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254953.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene thrS sequence026 source 1..23806 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 178..1152 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 assembly_gap 1160..1419 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1656..1967 product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359293.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 1964..2353 product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257561.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 2554..2766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 3194..3421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 3619..3834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 3879..4691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 4818..5663 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131344.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 5708..6961 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905593.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene xseA CDS 6971..7195 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131346.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 7307..8359 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023609967.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 8787..9638 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131348.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 9635..10444 product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015426159.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 10441..10887 product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131351.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 10899..12563 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131352.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene recN CDS 12571..13530 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131355.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 13588..14805 product peptidoglycan bridge formation alanyltransferase MurN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229509.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene murN CDS 14805..15851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 16014..17027 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129446.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 17088..17642 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129445.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 17648..19984 product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129443.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 20071..20385 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129442.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene trxA CDS 20533..21582 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129622.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 21738..22295 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129623.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene efp CDS 22383..22784 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021722362.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 22777..23751 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129881492.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene nusB sequence027 source 1..23691 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 810..1103 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129881512.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 1107..1412 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905560.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 1415..3868 product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948003.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 3908..4174 product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132530.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 4507..6000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 6551..7228 product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263187.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 7221..7385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298811.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 7532..7696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 7874..10444 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261981.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 10672..11250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 11304..11438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 11505..12086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 14124..15143 product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 15379..15774 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130994.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene lspA CDS 15775..16680 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130995.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 16774..17682 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905790.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene murB CDS 17693..18595 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633102.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 19659..20930 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132123.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 20927..21721 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132125.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 21721..22521 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905791.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 22537..23604 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905792.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 sequence028 source 1..22656 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(274..456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 assembly_gap 597..804 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1397..1543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(1705..3528) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132048.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene lepA CDS complement(3612..3824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(4365..5156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(5166..5402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(5392..5664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(5654..6073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(6080..7393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(7395..8522) product siphovirus ReqiPepy6 Gp37-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714199.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(8527..9426) product phage tail family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714198.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(9440..11827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922453.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(11827..12195) product DUF5361 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916438.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(12207..12482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(12491..13105) product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226354.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(13119..13454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573598.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(13455..13691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922457.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(13684..14022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093651380.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(14009..14407) product phage Gp19/Gp15/Gp42 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922459.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(14412..14711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(14711..15319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(15319..15831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(15832..16068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(16136..17026) product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922461.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(17030..17512) product DUF4355 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922462.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(17583..18992) product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011285619.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(19085..19306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(19303..20313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(20315..21607) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108668.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 assembly_gap 21672..21977 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(22084..22416) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922469.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 sequence029 source 1..21801 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(698..937) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131476.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 1078..1428 product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132532.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(1457..2317) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021722957.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 2547..4535 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905562.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene metG CDS 4803..5183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 5180..6439 product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930426.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 6617..6877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(7280..8125) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905089.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 8247..8486 product DUF2829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141918.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 8479..9198 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132542.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 9640..10149 product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058204173.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(10185..10970) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129459.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(11158..11499) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263275.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 11678..12103 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131384.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 12476..14785 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129457.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 14782..15783 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129455.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene holA CDS 15896..16285 product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129453.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene gpsB CDS 16744..17925 product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906078.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 17922..19679 product cell division site-positioning protein MapZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906077.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 19859..20113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 20136..20525 product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462027.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(20600..21685) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906076.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 sequence030 source 1..21778 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 452..700 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1568..1765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 2173..2439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 2576..3304 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132395.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene rlmB CDS 3315..4190 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906175.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 4311..5675 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132393.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene ftsA CDS 5703..6977 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132392.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene ftsZ CDS 6977..7648 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132391.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 7688..8266 product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132390.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 8273..8518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 8515..9312 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906173.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 9339..10166 product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132384.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 10507..13293 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906172.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene ileS CDS complement(13545..13727) product SPJ_0845 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132378.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 13910..15097 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132374.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene tuf CDS complement(15426..15770) product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132372.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(15773..16834) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906171.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 17365..18048 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129540.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(18213..18593) product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130895.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(18699..19796) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130896.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(19819..20622) product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130897.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(20653..21642) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130898.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 sequence031 source 1..21658 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(246..734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132169.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(738..1205) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129664.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene tadA CDS complement(1202..1951) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129661.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(1948..2628) product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129657.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(2907..3284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(3793..5778) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129655.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(5865..6503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(6604..8322) product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905523.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene cydC CDS complement(8345..10060) product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905522.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene cydD CDS complement(10279..11274) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905521.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene cydB CDS complement(11276..12712) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905520.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(13383..15200) product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905518.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(15311..17719) product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905517.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(17801..18877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 note possible pseudo, internal stop codon CDS complement(18995..19240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 note possible pseudo, internal stop codon CDS complement(19294..20439) product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905516.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene glgD CDS complement(20429..21571) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129630.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 sequence032 source 1..21595 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 137..838 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905758.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 843..3500 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905759.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(3645..4424) product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905760.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(4424..5773) product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132046.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 6036..6737 product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189145.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 6759..7439 product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132047.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 assembly_gap 7783..7890 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7981..12279 product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040087.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene cas9 CDS 12522..13412 product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929489.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene cas1 CDS 13409..13738 product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122196.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene cas2 CDS 13743..14423 product type II-A CRISPR-associated protein Csn2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590705.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene csn2 repeat_region 14516..14947 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttagagtcgtgttaaattgaatggttctcaaac CDS 15305..15619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 15648..15995 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420747.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 15988..17241 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721483.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 17263..18717 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930652.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 18787..20637 product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989614.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 sequence033 source 1..21213 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(168..1331) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131629.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene recA CDS complement(1433..2269) product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905298.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene mutM CDS complement(2433..3167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 3591..3752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 3721..4518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 4521..5819 product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene celB CDS complement(6324..7235) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131632.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene era CDS 7132..7446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(8264..11221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(11269..12258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(12361..13377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(13364..14632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(15437..16288) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900455.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(17050..17616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 note possible pseudo, frameshifted CDS complement(17664..18113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 note possible pseudo, frameshifted CDS complement(18260..19270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(19309..20379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(20617..21105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 sequence034 source 1..20588 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(440..2479) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132177.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene ftsH CDS complement(2576..3130) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905038.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene hpt CDS complement(3123..4373) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905037.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene tilS CDS complement(4370..5671) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905036.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(5858..6139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132172.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(6136..6507) product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905035.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(6535..6807) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132170.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(6931..10416) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905033.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene mfd CDS complement(10413..10985) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905032.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene pth CDS complement(11095..12210) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905026.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene ychF CDS complement(12329..12532) product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132155.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(12535..16098) product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905024.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene addA CDS complement(16098..19415) product ATP-dependent nuclease subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905023.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene rexB misc_feature complement(19459..>20588) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003130856.1:DNA polymerase III subunit beta locus_tag LOCUS_09280 sequence035 source 1..20410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 54..902 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255024.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 947..2365 product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905167.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(2722..3297) product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288651.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(3328..3525) product DUF4649 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905091.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(3515..4411) product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355746.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(4613..4780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 assembly_gap 5027..5286 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5356..6057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 6072..6551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(7423..7788) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130214.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene rplL CDS complement(7867..8382) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130213.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene rplJ CDS complement(8650..9234) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185820.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(9659..10351) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485259.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(10488..11477) product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905784.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene guaC CDS complement(11649..12284) product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850639.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(12286..13056) product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905782.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(13063..13815) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263557.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(13932..14375) product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721810.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(14377..14712) product arsenic metallochaperone ArsD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130254.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(14920..16569) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132529.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(16945..17082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(17085..17291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905174.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(17311..18792) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905173.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(18839..19936) product DUF871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905172.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(19967..20290) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131553.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 sequence036 source 1..20126 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..774 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001092618.1:aminomethyltransferase family protein locus_tag LOCUS_09530 CDS 774..2981 product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118223.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 2992..4182 product glycosyltransferase CylJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033002.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene cylJ CDS 4175..4747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 4772..5107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 6109..7737 product transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837538.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 7841..8932 product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902226.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene ulaG CDS 8950..10455 product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899076.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 10449..10727 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009910950.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 10765..11256 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262725.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 11321..11986 product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837547.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 11989..12852 product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027939.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 12853..13551 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837546.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 13572..14282 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922674.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 14410..16437 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905590.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 16599..17438 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963823.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 17649..18221 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286813.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 18241..18600 product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905743.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 18602..19960 product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286818.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 sequence037 source 1..20110 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(208..2190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650743.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(2180..3067) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462408.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(3069..3977) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403526.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(3974..4459) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164166.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene fabZ CDS complement(4456..4755) product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611493.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(4748..5470) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861303.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene fabG CDS complement(5484..6317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859501.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 assembly_gap 6508..6794 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7153..9201) product DUF262 and DUF1524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094324403.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(9589..11256) product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905806.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene alsS CDS complement(11457..12698) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905805.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(12698..13879) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130134.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 14220..14483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 14580..15215 product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262444.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(15466..16926) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931832.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(16942..18801) product PTS beta-glucoside transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242943.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene bglP CDS complement(18934..19779) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219862.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 sequence038 source 1..19711 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 140..1522 product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065247.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 1913..2821 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906107.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 3070..5694 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130876.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene alaS CDS 5946..6743 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905323.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 7427..8860 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906086.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 9039..9506 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130878.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene smpB CDS 9759..10646 product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130880.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 10846..11679 product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130881.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 11695..12618 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130883.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene pstC CDS 12618..13505 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130884.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene pstA CDS 13524..14327 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130885.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene pstB CDS 14341..15102 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906105.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene pstB CDS 15158..15811 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130887.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene phoU CDS complement(15972..17243) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130891.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene serS CDS complement(18329..19294) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132369.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 sequence039 source 1..19375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 1207..1428 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2144..2438 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2486..3130 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291166.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 3245..3694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288545.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 3852..4100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 note possible pseudo, internal stop codon, frameshifted CDS 4491..5852 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002328947.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 6067..6678 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255752.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene rpsD CDS 7056..7265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 7691..7870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 8066..9007 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002397331.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 9024..10073 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355369.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(10579..11280) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002325086.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 11501..12346 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377923.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 12339..13175 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196782459.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 13214..13693 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355337.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 13709..14557 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387686.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 14570..15472 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355340.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene murQ CDS 15483..16418 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387687.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 16706..18838 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905263.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 18828..19283 product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905264.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 sequence040 source 1..19137 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(107..1324) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254593.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(1386..2321) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254589.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(2364..2594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(2669..4579) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025016832.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene typA CDS 4798..5010 product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906270.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 5003..5971 product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254542.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 5988..6368 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906271.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(6402..6848) product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254538.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(8014..9111) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906272.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene dinB CDS complement(9416..10024) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387688.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(10078..11133) product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905320.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene fni CDS complement(11126..12067) product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131562.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(12054..13001) product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905319.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene mvaD CDS complement(13267..13683) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131384.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(13904..14836) product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131564.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene mvk CDS 14997..15176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131566.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(15289..16155) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905318.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene rsmI CDS complement(16152..16481) product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905317.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene yabA CDS complement(16518..17291) product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905316.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(17304..18167) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131573.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(18194..18823) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131575.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene tmk sequence041 source 1..18668 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 844..1293 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296478.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 1638..2321 product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379250.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 2658..3281 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131468.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene gmk CDS 3368..3727 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906189.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene rpoZ CDS 3872..6199 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131470.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 6460..7116 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905398.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 7389..8342 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906187.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene fmt CDS 8332..9603 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906185.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene rsmB CDS 9624..10397 product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130802.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 10397..12301 product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130801.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene pknB CDS complement(12458..12727) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906184.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene rpsO CDS complement(13002..13793) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906183.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene proC CDS 13940..15316 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130798.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene glmU CDS 15349..15933 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906182.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 15926..16204 product cell wall synthase accessory phosphoprotein MacP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130796.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene macP CDS 16315..16995 product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130794.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 17072..18382 product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906180.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene pepC sequence042 source 1..18608 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(111..1466) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379844.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene rlmD CDS complement(1572..2342) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905742.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(2339..3016) product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130628.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(3009..3677) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130627.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene nth CDS complement(3655..4326) product DnaD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905741.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 4490..5143 product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011835356.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(5363..6046) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131898.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene radC CDS complement(6326..8143) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905678.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene glmS CDS complement(8295..8933) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132114.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(8978..10270) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132113.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(10260..10757) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132112.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(10757..11830) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132109.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene folP CDS complement(11832..12881) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905789.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene folE CDS complement(12954..13301) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132106.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene folB CDS complement(13294..13881) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905788.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene yihA CDS complement(13966..15204) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905787.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene clpX CDS complement(15406..15921) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905786.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 16425..16928 product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905785.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 sequence043 source 1..17977 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 171..1454 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131738.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene tig CDS 1611..2297 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132358.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 2664..2858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 note possible pseudo, internal stop codon, frameshifted CDS 2984..3277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 note possible pseudo, internal stop codon, frameshifted tRNA 3483..3554 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 3723..4655 product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129545.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene rnz CDS 4648..5283 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905467.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 5322..7556 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905468.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene recJ CDS 7540..8058 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012897343.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 8216..8776 product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129551.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene rpoE CDS 8882..10984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 11008..11481 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129554.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene greA CDS 11729..12181 product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905471.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 12168..14621 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905472.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 14745..15302 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129564.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene raiA CDS 15547..17880 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129579.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene pflB sequence044 source 1..17910 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 328..963 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906307.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 1468..4110 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906358.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 4259..5608 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906353.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 5682..6239 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015427191.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene rsmD CDS 6229..6726 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906348.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene coaD CDS 6716..7759 product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906347.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(7922..10621) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906342.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene adhE CDS complement(10777..11817) product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906341.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 12086..12859 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906340.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene rpsB CDS 12937..13965 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906339.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene tsf CDS 14186..15916 product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132670.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene ezrA CDS 16289..17047 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705555.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 17136..17330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 sequence045 source 1..17798 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 177..986 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906335.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 983..1906 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101849.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 assembly_gap 2137..2355 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2387..3529 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905503.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(3627..3869) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131025.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 4054..4545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(4609..5724) product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905635.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(5737..6150) product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905633.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene tagD CDS complement(6380..7327) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390188.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(7516..8703) product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905634.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(8765..9910) product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002376666.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene glf CDS complement(10005..10928) product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225116.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(11072..11581) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016229.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(11578..12555) product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544949.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(12558..13343) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041482.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene kdsA CDS complement(13348..14013) product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465710.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(14060..14722) product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097862.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene pseF CDS complement(14722..15282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(15484..17133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11220 misc_feature complement(17137..>17798) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002387129.1:glycosyltransferase locus_tag LOCUS_11230 sequence046 source 1..17531 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(207..596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(761..2875) product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701298.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(2879..3604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(3558..3947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 assembly_gap 3948..4202 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4532..4738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(4769..4948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(5022..8042) product type 2 lanthipeptide synthetase LanM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370929.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 8600..9100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(9210..9947) product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378063.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(9960..11057) product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706791.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(11059..12168) product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774176.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(12180..12842) product DUF4310 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361314.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(12859..13635) product DUF4311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288309.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(13654..13995) product DUF4312 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288312.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(13998..14354) product glycine-rich SFCGS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288314.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(14376..14714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(14711..16531) product transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706696.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 sequence047 source 1..17450 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(200..3844) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014570699.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene rpoC CDS complement(4131..7718) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130544.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene rpoB CDS complement(8111..8428) product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130332.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(8422..10305) product endopeptidase PepO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906145.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene pepO CDS complement(10890..12608) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906146.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(13034..13303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 15150..16601 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130330.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 sequence048 source 1..17435 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 454..724 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1760..2578 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 2639..3607 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836414.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 3805..4605 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132563.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 4614..5921 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905575.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene ftsY CDS 6188..7159 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905576.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 7194..7895 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132570.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 8099..10579 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132571.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene leuS CDS 11080..11877 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132575.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(11989..12834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(13303..13656) product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905743.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 assembly_gap 13795..14079 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14190..16172 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132579.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 16346..17305 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130349.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene menA sequence049 source 1..16796 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 147..740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(912..2690) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906147.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene recQ CDS complement(3044..4066) product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130663.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(4078..4701) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905752.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 4758..6011 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905751.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 6257..6658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(6662..7123) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130653.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(7107..7595) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130652.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene ybeY CDS complement(7617..8090) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130650.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(8083..9051) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130649.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(9174..10280) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959424.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene ald CDS 10538..10822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 10892..12064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 12071..12703 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906379.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(12803..13087) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905747.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene rpmA CDS complement(13080..13424) product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130645.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(13428..13742) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905746.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene rplU CDS complement(14032..14940) product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132796.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 assembly_gap 14984..15213 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15242..16408) product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905745.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 sequence050 source 1..16772 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1315..1701) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479566.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 2016..2384 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025016601.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 2384..4054 product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905189.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 4327..4800 product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129762.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 4801..6906 product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905186.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene feoB CDS 6893..7063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129760.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(7153..8055) product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905182.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(8058..9038) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905181.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(9145..9756) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905180.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(9834..10964) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906275.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(10983..11474) product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906273.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(11527..12477) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906276.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene arcC CDS complement(12573..14036) product basic amino acid/polyamine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021037906.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(14238..15281) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254507.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene argF CDS complement(15418..16647) product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254504.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene arcA sequence051 source 1..16563 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 36..2300 product bifunctional glutamate--cysteine ligase/glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399785.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene gshAB assembly_gap 2453..2719 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2736..3902 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905134.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(3990..4520) product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905603.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 assembly_gap 4594..4834 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4889..5329 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166793.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 5422..6051 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068494.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 6202..8805 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130040.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene clpB CDS 9035..9451 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438298.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene ndk CDS 9567..10784 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132654.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(10891..12456) product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002326755.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(12524..13219) product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130230.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 assembly_gap 13482..13832 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14004..15548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 15811..16440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132036.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 sequence052 source 1..16551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(24..1286) product multidrug efflux MFS transporter EfmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291207.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene efmA CDS 1718..3046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(3485..4246) product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132559.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(4243..5346) product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015426122.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(5336..7429) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674970.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(7413..8984) product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905675.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(8941..9363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(9370..11490) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132555.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(11688..15206) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775578.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene smc CDS complement(15196..15891) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905569.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene rnc CDS complement(15996..16385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130340.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 sequence053 source 1..16521 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 113..1708 product bifunctional aspartate transaminase/aspartate 4-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549954.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(1787..2497) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674084.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(2494..3870) product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009880550.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(3908..4195) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982644.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(4199..4657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(4672..6297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 assembly_gap 6363..6639 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6790..8073) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131380.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(8066..8584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002315963.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(8608..9273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(9443..10201) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132078.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene tpiA CDS complement(10328..11233) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132069.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(11235..12140) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905772.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene truB CDS complement(12496..12948) product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132063.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(13040..14494) product ABC-F type ribosomal protection protein Msr(C) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287458.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene msr(C) CDS complement(14773..15708) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100868.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 15794..16450 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100869.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 sequence054 source 1..16375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 162..1190 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131080.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene pfkA CDS 1298..2806 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131076.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene pyk CDS 3069..4565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12350 assembly_gap 4686..4921 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4933..5961 product XRE/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130357.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(6473..7426) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131070.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(7426..8496) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131068.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(8480..10009) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905892.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(10289..11914) product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905891.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 12018..13076 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901079.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene queG CDS 13285..14382 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130963.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene prfB CDS 14588..15280 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130964.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene ftsE CDS 15273..16208 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905664.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene ftsX sequence055 source 1..16301 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(766..1752) product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130966.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene nrdF CDS complement(1767..3935) product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130967.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene nrdE CDS complement(3992..4408) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130968.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene nrdI CDS complement(4405..4623) product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012897612.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(4744..5382) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905665.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene plsY CDS 5603..7540 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905666.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene parE CDS 7583..8407 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130976.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 8412..8873 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130977.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 8922..11405 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130980.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene parC CDS 11717..14188 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905763.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene gyrA CDS 14190..15260 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132052.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 15273..16004 product sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379825.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 sequence056 source 1..16190 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..682 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836297.1:HEPN domain-containing protein note possible pseudo, frameshifted locus_tag LOCUS_12570 CDS 694..894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12580 note possible pseudo, frameshifted CDS complement(1430..1594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(1625..2173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 note possible pseudo, internal stop codon, frameshifted CDS complement(2175..2390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(2572..4458) product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439865.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(4448..5329) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732924.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(5338..6414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(6483..9092) product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989460.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(9095..9550) product fructose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263697.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(9566..11059) product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167004.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(11310..11876) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905771.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(11879..14173) product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132060.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene pcrA assembly_gap 14283..14570 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14595..15221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 note possible pseudo, frameshifted sequence057 source 1..16159 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(276..674) product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101690.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene spxA CDS complement(931..2754) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905652.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene dnaK CDS complement(2830..3390) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905651.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 gene grpE CDS complement(3427..4464) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905650.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene hrcA CDS complement(4610..5014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(5047..5832) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905648.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(5816..6520) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130927.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(6761..7687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(7777..8457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906125.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(8658..9083) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255278.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(9101..10510) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906126.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene atpD CDS complement(10570..11445) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255268.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(11457..12965) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255265.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene atpA CDS complement(13032..13559) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906127.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(13574..14080) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906128.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene atpF CDS complement(14094..14807) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255255.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene atpB CDS complement(14862..15077) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255250.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(15292..16068) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255244.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 sequence058 source 1..16097 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1793..3271) product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370472.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(3281..4093) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131434.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(4193..5740) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131432.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 6156..6485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(6707..9079) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905644.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene rnr CDS complement(9329..9958) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206301.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(10358..10558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(10709..12232) product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130322.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene yjeM CDS 12452..13438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(13734..14900) product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905093.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(14978..15589) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905092.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 sequence059 source 1..16068 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 114..1607 product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167004.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 1622..2074 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167001.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 2132..4750 product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861811.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene mngB CDS 4760..5557 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948062.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 5570..6949 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035027539.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 6933..7823 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360061.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 7825..8220 product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721726.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 8641..11316 product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905909.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene yoaB CDS 11798..13111 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379794.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene obgE CDS 13129..13296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906044.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 13528..14304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 14342..14515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 14568..15347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 15456..15977 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254803.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 sequence060 source 1..15896 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(168..944) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905438.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(1021..1566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132120.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(1730..2446) product DUF4811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905623.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(2446..3972) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905622.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(3969..4418) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905621.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 assembly_gap 5549..5770 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5884..6909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(7004..8962) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131421.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene gyrB CDS complement(9126..9527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(9524..9787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(9796..10395) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131420.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 11115..11810 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129540.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 12058..12579 product glycoside hydrolase family 73 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905908.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(12652..13545) product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709392.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(13654..14466) product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132087.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(14537..15661) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132086.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene hemW sequence061 source 1..15875 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(117..187) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 assembly_gap 819..1087 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1315..1719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(1795..1929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(1945..2190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(2187..2588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(2663..3019) product DUF1064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905958.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(3009..3269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(3223..3471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(3768..6038) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922066.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(6041..7636) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922064.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(7626..7877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(7880..8443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(8459..9478) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922060.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(9480..9734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(9744..11000) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922059.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(11060..11278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(11292..11528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 11643..11858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933333.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(11883..12077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(12095..12301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13470 assembly_gap 12571..12811 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12850..13191 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131489.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 13200..13640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 13737..14384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13500 assembly_gap 14726..15021 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence062 source 1..15743 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 26..976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 1715..2179 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023188979.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene tsaE CDS 2176..2691 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131525.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 2951..4300 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905336.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 tRNA 4363..4438 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 4723..5253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 5280..5495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 6061..6876 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131523.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene truA CDS 6869..7702 product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 7699..8181 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131521.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 8162..8704 product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905395.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 9166..10770 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131516.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 10879..11496 product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379801.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(11533..11709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 11817..14933 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131504.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(15006..15656) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131502.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 sequence063 source 1..15420 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 247..488 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(534..845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 assembly_gap 862..1094 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1141..1323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 tRNA complement(1406..1493) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(2056..2316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(2316..2957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(3216..4172) product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905553.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene manA CDS complement(4439..4795) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132494.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene rbfA CDS complement(4834..7533) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132492.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene infB CDS complement(7552..7857) product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132491.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(7859..8185) product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132489.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(8190..9317) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905552.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene nusA CDS complement(9386..9862) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905551.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene rimP CDS 10138..10533 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132486.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 10533..11231 product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132485.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(11299..12609) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132476.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene der CDS complement(12781..13806) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357754.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 assembly_gap 14405..14631 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence064 source 1..14988 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(167..706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(1010..3550) product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131692.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 3685..4485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905270.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 4495..4971 product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295999.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(5297..6316) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131705.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene tsaD CDS complement(6318..6758) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905269.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene rimI CDS complement(6742..7308) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905268.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene rimI CDS complement(7262..7972) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131710.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene tsaB CDS complement(8519..9919) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905123.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 10355..10585 product RNA polymerase epsilon subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131711.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 10720..12408 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131712.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(12428..12631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 12530..12994 product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130662.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(13010..14041) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905265.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene add sequence065 source 1..14724 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 146..467 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 739..1095 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1271..1632 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1763..2398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(2622..4763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(4760..5854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 6109..8076 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131547.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene ligA CDS 8073..9077 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905327.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 9310..10446 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131545.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene ugpC CDS 10585..11568 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 11679..12071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 12061..12312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 12360..14660 product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990086.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 sequence066 source 1..14272 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 25..330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 340..1284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 note possible pseudo, internal stop codon CDS 1368..2282 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257890.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 2269..3114 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229020.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 3134..5125 product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102206.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 5118..5795 product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905331.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene pgmB CDS 6257..9913 product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129881427.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene nifJ CDS 10097..10924 product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131542.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene cdaA CDS 10924..11877 product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263113.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 11904..13265 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131539.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene glmM CDS 13539..14048 product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131536.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 sequence067 source 1..13268 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(78..479) product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132362.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(472..1824) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906168.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene cysS CDS complement(1808..2407) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132365.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene cysE CDS complement(2573..4861) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132367.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene pnp CDS 5206..6726 product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101306.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(6797..8050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(8063..9013) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241104.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(9010..9840) product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905211.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(10183..10959) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357498.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(10961..11908) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360246.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(11958..12896) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391812.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 sequence068 source 1..13108 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 150..620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 617..880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 867..1994 product type VII secretion protein EssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966970.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene essB CDS 2000..6478 product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966969.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene essC CDS 6480..6926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 6948..7226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 7230..7586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 7577..8923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 8917..9591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 9602..9892 product DUF4176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926393.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 10197..12983 product type VII secretion protein EsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966957.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene esaA sequence069 source 1..13089 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(93..830) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131021.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(881..2710) product type 1 glycerol-3-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905845.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene glpO CDS complement(2752..4248) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131019.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene glpK CDS complement(4372..5838) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905846.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(5996..7207) product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905754.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(7364..7603) product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255340.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(7614..9647) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130669.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene glyS CDS complement(9647..10615) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130667.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene glyQ CDS complement(10629..11408) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905662.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(11687..11881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14470 sequence070 source 1..12199 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2072 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010906410.1:ATP-dependent DNA helicase RecG locus_tag LOCUS_14480 CDS 2109..2363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(2404..3768) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131240.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene mnmE CDS 3887..4624 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025017062.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 4773..5435 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906402.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene rpiA CDS complement(5485..5937) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132021.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 6057..6914 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132018.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene mreC CDS 6917..7423 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906401.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene mreD CDS 7559..8833 product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906400.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 9576..10754 product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906400.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 10975..12102 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906396.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene dnaJ sequence071 source 1..11834 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 120..821 product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358533.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 1114..1572 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130498.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene fabZ CDS complement(1601..3589) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837078.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene uvrB CDS complement(3586..4041) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130814.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 4146..4772 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130816.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene def CDS complement(4806..5060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(5063..5623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(5803..8049) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130823.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(8312..9691) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138868.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene rpoD CDS complement(9728..11614) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130831.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene dnaG tRNA complement(11686..11773) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 sequence072 source 1..11800 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(53..301) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905643.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene secG CDS complement(325..471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(458..1378) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905642.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene trxB CDS complement(1443..1676) product DUF4059 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905641.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(1669..2430) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255031.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(2427..3236) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255026.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(3490..4347) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255024.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(4513..4923) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009912224.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(4937..6607) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905639.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(6740..7438) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255010.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene deoD CDS complement(7523..8338) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356180.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(8407..9642) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905637.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(9723..11114) product tetracycline efflux MFS transporter Tet(38) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100299.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene tet(38) sequence073 source 1..11795 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 869..3625 product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905505.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 3700..3906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 4013..4771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 4843..5325 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922028.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 5463..7367 product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905735.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene abc-f CDS 7407..7913 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129897.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 8167..8796 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132758.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene pyrE CDS 8835..10100 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031296484.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 10184..10609 product DUF3284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905170.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 10614..11621 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905171.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 sequence074 source 1..11792 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1061..2371 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132786.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene aroA CDS 2362..2847 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132788.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 2844..3440 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906114.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 3437..5869 product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132792.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(5910..6419) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132795.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 6571..6804 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906113.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene rpsT CDS 6978..7412 product Spx/MgsR family RNA polymerase-binding regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905585.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 7705..8361 product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905224.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 8806..9465 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129839.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 9567..10274 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129881038.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(10704..11528) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130402.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 sequence075 source 1..11752 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(130..1731) product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130322.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene yjeM CDS complement(2048..3295) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130321.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene pepT CDS complement(3298..4062) product DUF1803 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906148.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(4062..5006) product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130319.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(5162..5956) product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130318.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene pflA CDS complement(6221..7549) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906149.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(7598..8716) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906150.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 8824..9276 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130314.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(9350..9934) product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906151.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(9939..10826) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129621.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene rsmA sequence076 source 1..11534 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(149..1096) product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130947.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene whiA CDS complement(1093..2079) product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905658.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(2076..2966) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130943.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene rapZ CDS complement(3011..4456) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905657.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene cls CDS complement(4833..5246) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035052264.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(5240..5881) product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861300.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene pcp CDS complement(5902..6834) product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433654.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(6838..7512) product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889567.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(7809..9302) product ABC-F type ribosomal protection-like protein Eat(A) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296175.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene eat(A) CDS complement(9355..9666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(9878..11224) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130306.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 sequence077 source 1..11113 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 333..2810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 3171..3761 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905755.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 assembly_gap 3993..4268 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4412..5035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15260 assembly_gap 5041..5326 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5735..6232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 note possible pseudo, internal stop codon CDS complement(6242..7027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 note possible pseudo, internal stop codon CDS complement(7180..9180) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905825.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene rnr CDS complement(9242..10360) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906176.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 sequence078 source 1..11083 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(83..268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(261..1544) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379841.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene murA CDS complement(1617..2405) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058204115.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(2371..2652) product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131743.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(2679..2975) product transcriptional regulator Spx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905435.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene spx CDS complement(3209..3736) product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905434.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 3817..4467 product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131746.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene recU CDS 4547..6583 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131747.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 6587..7213 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131748.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(7438..8349) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905433.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 8535..9455 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905432.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene cysK sequence079 source 1..10609 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 177..1814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(1926..3158) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131689.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 3498..5231 product multidrug efflux ABC transporter LmrCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905278.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene lmrC CDS 5286..7379 product multidrug efflux ABC transporter LmrCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131686.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene lmrD CDS complement(7816..8535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 assembly_gap 8574..8837 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9028..10293 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131684.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 10341..10556 product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131683.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 sequence080 source 1..10373 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(147..1166) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906255.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(1159..1899) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254655.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(2445..2624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(2645..3286) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703424.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 3607..4002 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254651.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 3999..4226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(4382..4681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(4976..5665) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254644.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene rplA CDS complement(5755..6180) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935890.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene rplK CDS complement(6307..6936) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905030.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(6943..9003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(9007..9294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 assembly_gap 9337..9587 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9855..10129 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence081 source 1..10222 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 80..688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 note possible pseudo, frameshifted CDS 760..1485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15620 note possible pseudo, frameshifted CDS 1673..3934 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964235.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 4105..4449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 4436..5047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 5109..7040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896809.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS 7040..8263 product phage tail tip lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310786.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 8275..9141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 9131..9736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 9979..10194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 sequence082 source 1..9936 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(697..1263) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905659.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 1400..2278 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905660.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 2291..3931 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905661.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(3953..4525) product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130958.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(4556..5434) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836763.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 5795..6256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905890.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 6412..7425 product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211854.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(7624..8436) product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130632.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene yidA CDS complement(8463..9761) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130634.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 sequence083 source 1..9783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(94..1053) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131614.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(1046..1642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(1698..2504) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272547.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(2517..3896) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905304.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 4272..5024 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131617.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(5525..6403) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905303.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(6717..7529) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131619.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(7516..8208) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131620.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 8498..9094 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905301.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 9225..9743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 sequence084 source 1..9595 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(57..1454) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255207.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene sufB CDS complement(1479..1934) product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255197.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(1959..3170) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255189.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(3170..4426) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159648.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene sufD CDS complement(4500..5270) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255181.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene sufC CDS complement(5843..7096) product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906141.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(7100..7783) product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255173.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 8030..8938 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130548.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 sequence085 source 1..9495 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 333..644 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 655..1842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 1989..2912 product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129528.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene hprK CDS 2923..3708 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129530.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene lgt CDS 3840..4259 product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129531.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 4261..4827 product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905465.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 4951..6372 product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129534.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene gndA CDS complement(6629..7561) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724071.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(7558..8412) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567411.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(8419..9153) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286846.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 sequence086 source 1..9474 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(51..278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(351..587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(587..1216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 1700..2794 product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922179.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(2988..4520) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905493.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 4798..5469 product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132581.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene sdaAB CDS 5479..6351 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905579.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene sdaAA CDS 6494..6934 product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132584.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 6950..7159 product copper ion binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132585.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 7231..9318 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905580.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 sequence087 source 1..9444 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 402..551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 567..1016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 1147..1383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 1380..1847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 2214..2825 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033899639.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene coaE CDS 2926..4062 product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905496.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 4327..5550 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905497.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 5857..9270 product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905498.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 sequence088 source 1..9245 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(195..1301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(1316..3343) product RTX toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187288335.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(3356..3928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905905.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(3925..4893) product DUF916 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132423.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(5013..6149) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014525057.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(6346..7074) product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355609.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(7102..7872) product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906040.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(7918..8739) product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012898201.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 sequence089 source 1..9234 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(60..1070) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131244.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene gap CDS complement(1280..1756) product DUF536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131246.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 1887..4493 product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906412.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(4606..6006) product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905870.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(6028..7539) product glutamate:gamma-aminobutyrate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905871.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene gadC assembly_gap 7735..7936 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA complement(9096..9181) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 sequence090 source 1..9192 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 76..1098 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217780.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 1418..1657 product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130191.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 1673..3085 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674284.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene racE CDS 3115..3624 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130196.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 3644..4108 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905865.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 4083..4793 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905864.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene xerD CDS 4790..5524 product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130199.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 5508..6086 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905863.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene scpB CDS 6073..6789 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905862.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 7129..7722 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132093.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 7741..9045 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132095.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 sequence091 source 1..9075 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 368..1804 product DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905452.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 1801..1935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 2270..2584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 2584..2874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 3210..3428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 3429..6653 product type I restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122926.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene hsdR CDS 6703..8142 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122925.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 sequence092 source 1..8855 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 817..1713 product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131457.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 1988..2518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 2832..3698 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021722748.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS 3695..4420 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131466.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 4457..6352 product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905984.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 6482..7915 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964714.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(8088..8792) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289461.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 sequence093 source 1..8435 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 125..655 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131387.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(701..1870) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399716.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(1921..3972) product maltose/glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387436.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene malX CDS complement(4078..4806) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898159.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(5370..5720) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012897519.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene rplS CDS complement(5808..7199) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437034.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(7209..7604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(7604..8293) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131377.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 sequence094 source 1..8432 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 89..1120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 1223..2848 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382265.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 3242..3766 product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906054.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene pyrR CDS 3769..5055 product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906053.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 5169..6092 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129382.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 6116..7198 product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906052.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 sequence095 source 1..8295 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 828..2021 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906264.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 2112..2828 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254608.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene pyrH CDS 2858..3415 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254618.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene frr CDS 3508..4371 product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906261.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 4595..5026 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438899.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene msrA CDS 5023..5238 product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906259.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 5256..5627 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002327753.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 5855..6253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 sequence096 source 1..8247 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(548..1264) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905223.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(1304..2389) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129834.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(2377..3108) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905221.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(3109..3468) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129832.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene rsfS CDS complement(3491..4084) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129830.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene yqeK CDS complement(4077..4670) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905220.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(4674..4982) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129828.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene yhbY CDS complement(4997..6232) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905219.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene hflX CDS complement(6235..7362) product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014571938.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene yqeH sequence097 source 1..8204 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(61..774) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131091.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene rsmG CDS complement(774..1733) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131090.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(1724..2254) product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131089.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(2251..2637) product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131088.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(2744..3670) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905896.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene galU CDS complement(3696..4715) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131086.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 5029..5607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 5617..6783 product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131084.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 6885..8036 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905894.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene nagA sequence098 source 1..8196 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(48..1541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(1870..2553) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906108.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(2553..4358) product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906109.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene pepF CDS complement(4342..5373) product competence protein CoiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906110.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(5441..6541) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130405.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(6613..8034) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130403.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 sequence099 source 1..8114 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(88..981) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129543.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(1043..1711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129542.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(1701..2594) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129541.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene miaA CDS complement(2697..4118) product peptidoglycan-N-acetylmuramic acid deacetylase PdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245023.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene pdaC CDS 4316..4495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 4520..4690 product DUF3042 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356337.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(5394..5645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(5763..6035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(6037..6396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(6393..6716) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129889.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 6880..7812 product dihydroorotate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130679.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 sequence100 source 1..7945 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(681..2237) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129408.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene ffh CDS complement(2349..3002) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289151.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(3004..4326) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304549.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(4468..6204) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129410.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(6322..6723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(6759..7493) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289735.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 sequence101 source 1..7844 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 373..738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 731..2377 product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836834.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 2374..2685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836835.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 2710..3009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 3260..4135 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836406.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 4135..5121 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836741.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 5114..6868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 6861..7730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 sequence102 source 1..7791 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 397..852 product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129522.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(1062..1964) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905463.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(2000..2857) product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631543.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 3016..3459 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162136.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(3497..4225) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129512.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 4319..4594 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897016.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(4935..5546) product lysozyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905458.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(5716..6957) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129504.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(7068..7670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 sequence103 source 1..7577 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(114..1730) product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131467.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene rny CDS complement(1975..3168) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906191.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene metK CDS 3315..4064 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906192.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(4126..4476) product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131461.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(4508..4711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(4748..5836) product DUF4097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131459.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(5985..7484) product amidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379804.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 sequence104 source 1..7444 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1438 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548049.1:YSIRK-type signal peptide-containing protein locus_tag LOCUS_17510 CDS complement(1702..2178) product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295999.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(2237..2716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 2822..3796 product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755047.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 4269..4871 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129492.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 4896..5969 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129495.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene prfA CDS 6250..7062 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905456.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene prmC sequence105 source 1..7383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 91..357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 330..635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 1219..1815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 2292..2594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 2980..3543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 3787..4344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(4455..4853) product transcriptional regulator Spx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129597.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene spx CDS complement(5030..5560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129594.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(5621..6001) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112904553.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 6119..6718 product ATP-dependent Clp protease proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613477.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene clpP sequence106 source 1..7240 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(139..756) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131603.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(920..2449) product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905291.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene ahpF CDS complement(2509..3072) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131651.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene ahpC assembly_gap 3337..3610 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5029..5310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131192.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(5311..5859) product DUF6036 family nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905255.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(5966..7111) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905558.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 sequence107 source 1..6974 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(235..1248) product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906201.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(1545..3953) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906202.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene pheT CDS complement(4000..5040) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254858.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene pheS assembly_gap 5335..5642 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5847..6488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(6614..6793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 sequence108 source 1..6847 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(129..1373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(1364..1720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837108.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(1724..2005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(2098..2622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(2810..3652) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110164.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(4180..4431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17840 note possible pseudo, frameshifted CDS complement(4452..5345) product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704871.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene ugd note possible pseudo, frameshifted CDS complement(5379..6704) product hyaluronan synthase HasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038431685.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 gene hasA sequence109 source 1..6779 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 102..440 product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131392.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 693..1124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 1121..2128 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905610.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 2121..2753 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131402.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 3072..3662 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131404.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 3664..4059 product CvfD/Ygs/GSP13 family RNA-binding post-transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905611.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 4078..4683 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131406.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 4789..6111 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905612.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 6258..6689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 sequence110 source 1..6741 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 627..1661 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382358.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(1860..3029) product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905243.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(3295..4491) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896645.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(4728..5216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012898637.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 tRNA complement(6035..6123) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 assembly_gap 6183..6472 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA complement(6475..6546) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 sequence111 source 1..6720 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 157..705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(773..1084) product DUF960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906371.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(1116..1964) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906370.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(2274..3107) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906366.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene recX CDS complement(3306..4124) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905288.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 4264..4617 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905289.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 4648..5040 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905290.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 5142..6647 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906363.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene rlmD sequence112 source 1..6561 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 289..1845 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233752.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 2075..3250 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906133.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 3299..3949 product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906131.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 assembly_gap 5283..5556 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence113 source 1..6360 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 351..660 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(825..1205) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130558.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene rplQ CDS complement(1221..2159) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906296.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(2211..2594) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906297.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene rpsK CDS complement(2612..2977) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130555.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene rpsM CDS complement(3165..3383) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130554.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene infA CDS 3588..4031 product zinc-dependent MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906313.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 4052..4774 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906311.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 4767..5576 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906310.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 sequence114 source 1..6143 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(272..835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(1556..1801) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131952.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene rpsR CDS complement(1937..2428) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131953.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(2466..2759) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131954.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene rpsF CDS complement(3144..3356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 3812..5275 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641236.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 sequence115 source 1..5768 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(108..1820) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836987.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(1976..2557) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130510.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(2561..3112) product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130511.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene coaC CDS complement(3105..3803) product phosphopantothenate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130512.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 3945..5234 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479508.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(5348..5527) product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897588.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 sequence116 source 1..5656 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 57..884 product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906422.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene purR CDS complement(1103..1777) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906421.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene lepB CDS complement(1780..2667) product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906420.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene rnhC CDS 2848..3294 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906417.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene rplM CDS 3311..3703 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254378.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene rpsI CDS 4082..5530 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379827.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene cls sequence117 source 1..5475 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 124..471 product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(725..1840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(1840..3051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(3065..3421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(3443..5125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 sequence118 source 1..5465 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(74..409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 734..1690 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904591.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(2612..3751) product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836412.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(3820..4476) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167493974.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(4479..5393) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254327.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 sequence119 source 1..5429 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 101..997 product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906424.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 1016..2404 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262635.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(2442..3641) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906423.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 4029..4442 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893867.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene rpsL assembly_gap 4925..5242 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence120 source 1..5250 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(748..1431) product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130398.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(1434..2906) product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130400.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(2920..3687) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906112.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(3971..4129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(4165..4311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(4326..4880) product alkaline shock response membrane anchor protein AmaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131026.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene amaP CDS complement(4907..5146) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131025.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 sequence121 source 1..5004 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 513..1169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 1173..4232 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 assembly_gap 4473..4719 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence122 source 1..4704 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(747..3356) product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905581.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 3469..3801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 3996..4679 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156294863.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 sequence123 source 1..4578 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 734..2158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 2494..4272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18650 sequence124 source 1..4569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 111..1106 product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906075.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene ccpA CDS 1470..1670 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293303.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 1673..1912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 1923..2612 product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129440.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene aroD CDS 2724..4019 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129439.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene purB CDS 4072..4452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 sequence125 source 1..4544 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(98..901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(917..1714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(1704..4499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 sequence126 source 1..4431 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 145..1326 product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906400.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 1621..2520 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357699.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 2513..3784 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357698.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(3824..4258) product Spx/MgsR family RNA polymerase-binding regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905585.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 sequence127 source 1..4344 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(225..1289) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131754.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(1654..1929) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905402.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(2047..2628) product YpmS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905401.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(2618..3442) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131499.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(3435..4271) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014570388.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 sequence128 source 1..4336 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 57..1520 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138892.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 1525..2013 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905757.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 2016..2840 product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255352.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene nadE CDS 2964..4256 product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748796.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 sequence129 source 1..4191 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 405..1634 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132414.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 1655..2755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132415.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 2752..3552 product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132416.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(3581..4114) product rRNA large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025017118.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 sequence130 source 1..4177 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(15..140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(332..1612) product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930426.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(1623..2012) product DUF1310 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930429.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 assembly_gap 2188..2526 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2888..3250 product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130423.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 3480..3800 product SugE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021723289.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 sequence131 source 1..3993 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 468..2339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 2336..3388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 sequence132 source 1..3837 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 84..452 product DUF1033 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906167.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 601..1161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 assembly_gap 1698..1964 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2748..3041 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3111..3782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 sequence133 source 1..3829 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(40..819) product DUF4931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905582.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS 983..2104 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132592.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene mnmA CDS 2432..3655 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132594.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene rpsA sequence134 source 1..3819 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 134..430 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(578..1390) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131583.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(1387..2766) product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905315.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(2798..3136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19070 assembly_gap 3215..3457 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence135 source 1..3790 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 450..1607 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165992825.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 assembly_gap 1472..1583 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1763..1783 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2243..3469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 sequence136 source 1..3775 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence137 source 1..3483 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 75..1187 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906014.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene purK CDS 1218..2021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 2294..2638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19120 note possible pseudo, internal stop codon CDS 2729..2887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 2999..3424 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131384.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 sequence138 source 1..3452 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(492..1427) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132278.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 1718..2584 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905556.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene accD CDS 2577..3332 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905557.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene accA sequence139 source 1..3315 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 26..1567 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130105.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene guaA assembly_gap 1679..1941 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2125..2505) product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813029.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(2544..2732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 assembly_gap 2846..3152 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence140 source 1..3263 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 123..893 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129618.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 890..1438 product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129620.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene rnmV CDS 1435..2361 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287494.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 2354..3124 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721786.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 sequence141 source 1..3237 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1196..1549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 1555..2772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 2832..3170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19270 sequence142 source 1..3224 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 804..1523 product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548691.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(1623..2087) product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703269.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene tnpA sequence143 source 1..3130 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 67..594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 594..1352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 1380..3014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19320 sequence144 source 1..3118 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(281..1204) product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132452.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(1216..2496) product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132450.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(2489..3052) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132449.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 sequence145 source 1..3113 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 155..544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 541..1788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 1800..2117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 2127..2387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19390 sequence146 source 1..3102 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1..1473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(1492..2409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(2469..3038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 sequence147 source 1..3021 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence148 source 1..2944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(3..78) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(85..159) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(474..1634) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(1925..2149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 2367..2840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 sequence149 source 1..2871 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 838..1043 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1349..2707 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905022.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene dnaA sequence150 source 1..2854 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(142..498) product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131624.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(482..856) product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905299.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 1396..2760 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131627.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 sequence151 source 1..2787 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 1043..1319 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence152 source 1..2777 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(941..2521) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905296.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 sequence153 source 1..2751 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(729..2543) product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918506.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 sequence154 source 1..2740 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1194..1388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(1397..1858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 assembly_gap 2016..2306 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence155 source 1..2534 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(71..2098) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(2111..2434) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083485680.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550