>Feature sequence001 593 240 gene locus_tag LOCUS_00010 593 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 910 605 gene locus_tag LOCUS_00020 910 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1308 910 gene locus_tag LOCUS_00030 1308 910 CDS product DUF4176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966968.1 protein_id gnl|my_center|LOCUS_00030 5767 1301 gene locus_tag LOCUS_00040 gene essC 5767 1301 CDS product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966969.1 protein_id gnl|my_center|LOCUS_00040 6896 5772 gene locus_tag LOCUS_00050 gene essB 6896 5772 CDS product type VII secretion protein EssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966970.1 protein_id gnl|my_center|LOCUS_00050 7146 6883 gene locus_tag LOCUS_00060 7146 6883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7594 7124 gene locus_tag LOCUS_00070 7594 7124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7937 7647 gene locus_tag LOCUS_00080 7937 7647 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966973.1 protein_id gnl|my_center|LOCUS_00080 8417 8947 gene locus_tag LOCUS_00090 8417 8947 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131387.1 protein_id gnl|my_center|LOCUS_00090 8994 11690 gene locus_tag LOCUS_00100 8994 11690 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906085.1 protein_id gnl|my_center|LOCUS_00100 11942 11730 gene locus_tag LOCUS_00110 11942 11730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12408 12124 gene locus_tag LOCUS_00120 12408 12124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 12552 13502 gene locus_tag LOCUS_00130 12552 13502 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288288.1 protein_id gnl|my_center|LOCUS_00130 14281 13544 gene locus_tag LOCUS_00140 14281 13544 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357431.1 protein_id gnl|my_center|LOCUS_00140 14850 14365 gene locus_tag LOCUS_00150 14850 14365 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031472.1 protein_id gnl|my_center|LOCUS_00150 15120 16748 gene locus_tag LOCUS_00160 15120 16748 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905087.1 protein_id gnl|my_center|LOCUS_00160 16824 17633 gene locus_tag LOCUS_00170 16824 17633 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905086.1 protein_id gnl|my_center|LOCUS_00170 17749 18741 gene locus_tag LOCUS_00180 gene plsX 17749 18741 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905085.1 protein_id gnl|my_center|LOCUS_00180 21459 18862 gene locus_tag LOCUS_00190 gene mgtA 21459 18862 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002388982.1 protein_id gnl|my_center|LOCUS_00190 22286 21846 gene locus_tag LOCUS_00200 22286 21846 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905082.1 protein_id gnl|my_center|LOCUS_00200 22703 23734 gene locus_tag LOCUS_00210 gene trpS 22703 23734 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905081.1 protein_id gnl|my_center|LOCUS_00210 23751 24389 gene locus_tag LOCUS_00220 23751 24389 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905080.1 protein_id gnl|my_center|LOCUS_00220 24379 25176 gene locus_tag LOCUS_00230 24379 25176 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905079.1 protein_id gnl|my_center|LOCUS_00230 25384 26379 gene locus_tag LOCUS_00240 25384 26379 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905078.1 protein_id gnl|my_center|LOCUS_00240 26413 27537 gene locus_tag LOCUS_00250 26413 27537 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905077.1 protein_id gnl|my_center|LOCUS_00250 27540 28520 gene locus_tag LOCUS_00260 27540 28520 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905076.1 protein_id gnl|my_center|LOCUS_00260 28927 29256 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29262 30404 gene locus_tag LOCUS_00270 29262 30404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 30428 31849 gene locus_tag LOCUS_00280 gene lpdA 30428 31849 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905074.1 protein_id gnl|my_center|LOCUS_00280 32648 31881 gene locus_tag LOCUS_00290 gene recO 32648 31881 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132217.1 protein_id gnl|my_center|LOCUS_00290 33318 32926 gene locus_tag LOCUS_00300 33318 32926 CDS product RinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905708.1 protein_id gnl|my_center|LOCUS_00300 33707 33408 gene locus_tag LOCUS_00310 33707 33408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 34333 33890 gene locus_tag LOCUS_00320 34333 33890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 34944 34339 gene locus_tag LOCUS_00330 34944 34339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906211.1 protein_id gnl|my_center|LOCUS_00330 35272 35129 gene locus_tag LOCUS_00340 35272 35129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 35805 35359 gene locus_tag LOCUS_00350 35805 35359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 37789 36365 gene locus_tag LOCUS_00360 37789 36365 CDS product VapE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905412.1 protein_id gnl|my_center|LOCUS_00360 38571 37798 gene locus_tag LOCUS_00370 38571 37798 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232980.1 protein_id gnl|my_center|LOCUS_00370 38897 38568 gene locus_tag LOCUS_00380 38897 38568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905047.1 protein_id gnl|my_center|LOCUS_00380 39085 38894 gene locus_tag LOCUS_00390 39085 38894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 39558 39289 gene locus_tag LOCUS_00400 39558 39289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905051.1 protein_id gnl|my_center|LOCUS_00400 39704 39555 gene locus_tag LOCUS_00410 39704 39555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 39880 39701 gene locus_tag LOCUS_00420 39880 39701 CDS product DUF1655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906219.1 protein_id gnl|my_center|LOCUS_00420 40643 39954 gene locus_tag LOCUS_00430 40643 39954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 40916 40719 gene locus_tag LOCUS_00440 40916 40719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031366831.1 protein_id gnl|my_center|LOCUS_00440 41179 41931 gene locus_tag LOCUS_00450 41179 41931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 42046 42285 gene locus_tag LOCUS_00460 42046 42285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 42355 43227 gene locus_tag LOCUS_00470 42355 43227 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_00470 43726 43538 gene locus_tag LOCUS_00480 43726 43538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 43947 45128 gene locus_tag LOCUS_00490 43947 45128 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905063.1 protein_id gnl|my_center|LOCUS_00490 45399 46031 gene locus_tag LOCUS_00500 45399 46031 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905030.1 protein_id gnl|my_center|LOCUS_00500 46393 46321 gene locus_tag LOCUS_t00010 46393 46321 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 47120 47045 gene locus_tag LOCUS_t00020 47120 47045 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 47229 47126 gene locus_tag LOCUS_r00010 47229 47126 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence002 1231 161 gene locus_tag LOCUS_00510 gene rlmN 1231 161 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905179.1 protein_id gnl|my_center|LOCUS_00510 1929 1321 gene locus_tag LOCUS_00520 1929 1321 CDS product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905178.1 protein_id gnl|my_center|LOCUS_00520 2801 2349 gene locus_tag LOCUS_00530 2801 2349 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905176.1 protein_id gnl|my_center|LOCUS_00530 3530 2838 gene locus_tag LOCUS_00540 3530 2838 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129738.1 protein_id gnl|my_center|LOCUS_00540 4038 3520 gene locus_tag LOCUS_00550 4038 3520 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905169.1 protein_id gnl|my_center|LOCUS_00550 4151 4348 gene locus_tag LOCUS_00560 4151 4348 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129735.1 protein_id gnl|my_center|LOCUS_00560 4480 5835 gene locus_tag LOCUS_00570 4480 5835 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905168.1 protein_id gnl|my_center|LOCUS_00570 7283 5850 gene locus_tag LOCUS_00580 gene gatB 7283 5850 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905166.1 protein_id gnl|my_center|LOCUS_00580 8757 7285 gene locus_tag LOCUS_00590 gene gatA 8757 7285 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905164.1 protein_id gnl|my_center|LOCUS_00590 9062 8757 gene locus_tag LOCUS_00600 gene gatC 9062 8757 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905163.1 protein_id gnl|my_center|LOCUS_00600 10074 9283 gene locus_tag LOCUS_00610 gene codY 10074 9283 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129722.1 protein_id gnl|my_center|LOCUS_00610 11808 10210 gene locus_tag LOCUS_00620 11808 10210 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905162.1 protein_id gnl|my_center|LOCUS_00620 12269 11946 gene locus_tag LOCUS_00630 12269 11946 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894073.1 protein_id gnl|my_center|LOCUS_00630 12713 12285 gene locus_tag LOCUS_00640 gene ruvX 12713 12285 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021214669.1 protein_id gnl|my_center|LOCUS_00640 12979 12713 gene locus_tag LOCUS_00650 12979 12713 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131820.1 protein_id gnl|my_center|LOCUS_00650 14091 13180 gene locus_tag LOCUS_00660 14091 13180 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288005.1 protein_id gnl|my_center|LOCUS_00660 14500 14366 gene locus_tag LOCUS_00670 gene rpmH 14500 14366 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131818.1 protein_id gnl|my_center|LOCUS_00670 15532 14621 gene locus_tag LOCUS_00680 15532 14621 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905141.1 protein_id gnl|my_center|LOCUS_00680 16373 15558 gene locus_tag LOCUS_00690 16373 15558 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905140.1 protein_id gnl|my_center|LOCUS_00690 16738 16370 gene locus_tag LOCUS_00700 gene rnpA 16738 16370 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131815.1 protein_id gnl|my_center|LOCUS_00700 17113 18057 gene locus_tag LOCUS_00710 17113 18057 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905132.1 protein_id gnl|my_center|LOCUS_00710 18287 18372 gene locus_tag LOCUS_t00030 18287 18372 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18547 18846 gene locus_tag LOCUS_00720 18547 18846 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905131.1 protein_id gnl|my_center|LOCUS_00720 20726 18999 gene locus_tag LOCUS_00730 gene ptsP 20726 18999 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905129.1 protein_id gnl|my_center|LOCUS_00730 20992 20726 gene locus_tag LOCUS_00740 20992 20726 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905128.1 protein_id gnl|my_center|LOCUS_00740 22176 21139 gene locus_tag LOCUS_00750 22176 21139 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132289.1 protein_id gnl|my_center|LOCUS_00750 24847 22274 gene locus_tag LOCUS_00760 gene secA 24847 22274 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905127.1 protein_id gnl|my_center|LOCUS_00760 25565 24945 gene locus_tag LOCUS_00770 25565 24945 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905124.1 protein_id gnl|my_center|LOCUS_00770 26302 25688 gene locus_tag LOCUS_00780 26302 25688 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905122.1 protein_id gnl|my_center|LOCUS_00780 26771 26322 gene locus_tag LOCUS_00790 gene dtd 26771 26322 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905120.1 protein_id gnl|my_center|LOCUS_00790 29025 26833 gene locus_tag LOCUS_00800 29025 26833 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905119.1 protein_id gnl|my_center|LOCUS_00800 29939 29184 gene locus_tag LOCUS_00810 29939 29184 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905117.1 protein_id gnl|my_center|LOCUS_00810 30896 29943 gene locus_tag LOCUS_00820 gene prmA 30896 29943 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905116.1 protein_id gnl|my_center|LOCUS_00820 31389 30925 gene locus_tag LOCUS_00830 31389 30925 CDS product DUF3013 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905112.1 protein_id gnl|my_center|LOCUS_00830 31551 32024 gene locus_tag LOCUS_00840 31551 32024 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905111.1 protein_id gnl|my_center|LOCUS_00840 32048 33310 gene locus_tag LOCUS_00850 32048 33310 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905110.1 protein_id gnl|my_center|LOCUS_00850 35565 33772 gene locus_tag LOCUS_00860 35565 33772 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905108.1 protein_id gnl|my_center|LOCUS_00860 35930 36103 gene locus_tag LOCUS_00870 gene rpmF 35930 36103 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905107.1 protein_id gnl|my_center|LOCUS_00870 36134 36283 gene locus_tag LOCUS_00880 gene rpmG 36134 36283 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132258.1 protein_id gnl|my_center|LOCUS_00880 38216 38479 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38680 39558 gene locus_tag LOCUS_00890 38680 39558 CDS product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002911924.1 protein_id gnl|my_center|LOCUS_00890 43144 40187 gene locus_tag LOCUS_00900 gene esaA 43144 40187 CDS product type VII secretion protein EsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966957.1 protein_id gnl|my_center|LOCUS_00900 43647 43285 gene locus_tag LOCUS_00910 43647 43285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 43814 43674 gene locus_tag LOCUS_00920 43814 43674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 44201 43899 gene locus_tag LOCUS_00930 44201 43899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 >Feature sequence003 542 57 gene locus_tag LOCUS_00940 gene purE 542 57 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906015.1 protein_id gnl|my_center|LOCUS_00940 1777 545 gene locus_tag LOCUS_00950 gene purD 1777 545 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014570649.1 protein_id gnl|my_center|LOCUS_00950 2573 1881 gene locus_tag LOCUS_00960 2573 1881 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130060.1 protein_id gnl|my_center|LOCUS_00960 4275 2665 gene locus_tag LOCUS_00970 gene treC 4275 2665 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162367.1 protein_id gnl|my_center|LOCUS_00970 5842 4295 gene locus_tag LOCUS_00980 5842 4295 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025016545.1 protein_id gnl|my_center|LOCUS_00980 6340 5855 gene locus_tag LOCUS_00990 6340 5855 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131536.1 protein_id gnl|my_center|LOCUS_00990 6469 7185 gene locus_tag LOCUS_01000 gene treR 6469 7185 CDS product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131538.1 protein_id gnl|my_center|LOCUS_01000 8770 7220 gene locus_tag LOCUS_01010 gene purH 8770 7220 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130058.1 protein_id gnl|my_center|LOCUS_01010 9407 8811 gene locus_tag LOCUS_01020 gene purN 9407 8811 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130044.1 protein_id gnl|my_center|LOCUS_01020 10363 9350 gene locus_tag LOCUS_01030 gene purM 10363 9350 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200094842.1 protein_id gnl|my_center|LOCUS_01030 11771 10356 gene locus_tag LOCUS_01040 gene purF 11771 10356 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906019.1 protein_id gnl|my_center|LOCUS_01040 13972 11756 gene locus_tag LOCUS_01050 gene purL 13972 11756 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130033.1 protein_id gnl|my_center|LOCUS_01050 14649 13969 gene locus_tag LOCUS_01060 gene purQ 14649 13969 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130032.1 protein_id gnl|my_center|LOCUS_01060 14891 14649 gene locus_tag LOCUS_01070 gene purS 14891 14649 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906021.1 protein_id gnl|my_center|LOCUS_01070 15662 14946 gene locus_tag LOCUS_01080 15662 14946 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906022.1 protein_id gnl|my_center|LOCUS_01080 16192 15767 gene locus_tag LOCUS_01090 16192 15767 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255012.1 protein_id gnl|my_center|LOCUS_01090 17177 16338 gene locus_tag LOCUS_01100 17177 16338 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130015.1 protein_id gnl|my_center|LOCUS_01100 19213 17363 gene locus_tag LOCUS_01110 19213 17363 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130686.1 protein_id gnl|my_center|LOCUS_01110 21153 19309 gene locus_tag LOCUS_01120 21153 19309 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287775.1 protein_id gnl|my_center|LOCUS_01120 21221 21497 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22998 21604 gene locus_tag LOCUS_01130 22998 21604 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130696.1 protein_id gnl|my_center|LOCUS_01130 24191 22995 gene locus_tag LOCUS_01140 24191 22995 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130698.1 protein_id gnl|my_center|LOCUS_01140 25720 24377 gene locus_tag LOCUS_01150 25720 24377 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294399.1 protein_id gnl|my_center|LOCUS_01150 27295 25769 gene locus_tag LOCUS_01160 27295 25769 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290168.1 protein_id gnl|my_center|LOCUS_01160 28358 27513 gene locus_tag LOCUS_01170 28358 27513 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906033.1 protein_id gnl|my_center|LOCUS_01170 28780 28382 gene locus_tag LOCUS_01180 28780 28382 CDS product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130704.1 protein_id gnl|my_center|LOCUS_01180 29361 28777 gene locus_tag LOCUS_01190 29361 28777 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475976.1 protein_id gnl|my_center|LOCUS_01190 30089 29358 gene locus_tag LOCUS_01200 gene trmD 30089 29358 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130706.1 protein_id gnl|my_center|LOCUS_01200 30606 30091 gene locus_tag LOCUS_01210 gene rimM 30606 30091 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130707.1 protein_id gnl|my_center|LOCUS_01210 31340 30837 gene locus_tag LOCUS_01220 31340 30837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 31689 31387 gene locus_tag LOCUS_01230 31689 31387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 33765 31765 gene locus_tag LOCUS_01240 33765 31765 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906117.1 protein_id gnl|my_center|LOCUS_01240 34543 33758 gene locus_tag LOCUS_01250 34543 33758 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906118.1 protein_id gnl|my_center|LOCUS_01250 34995 34606 gene locus_tag LOCUS_01260 34995 34606 CDS product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130414.1 protein_id gnl|my_center|LOCUS_01260 36303 35206 gene locus_tag LOCUS_01270 36303 35206 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130405.1 protein_id gnl|my_center|LOCUS_01270 36810 36475 gene locus_tag LOCUS_01280 36810 36475 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886702.1 protein_id gnl|my_center|LOCUS_01280 39026 36825 gene locus_tag LOCUS_01290 39026 36825 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731969.1 protein_id gnl|my_center|LOCUS_01290 40024 39116 gene locus_tag LOCUS_01300 40024 39116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 41226 40510 gene locus_tag LOCUS_01310 41226 40510 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_01310 42163 41303 gene locus_tag LOCUS_01320 42163 41303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 42840 42436 gene locus_tag LOCUS_01330 42840 42436 CDS product Spx/MgsR family RNA polymerase-binding regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905585.1 protein_id gnl|my_center|LOCUS_01330 >Feature sequence004 109 1680 gene locus_tag LOCUS_01340 109 1680 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024029827.1 protein_id gnl|my_center|LOCUS_01340 1691 3109 gene locus_tag LOCUS_01350 1691 3109 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298077.1 protein_id gnl|my_center|LOCUS_01350 3475 3272 gene locus_tag LOCUS_01360 3475 3272 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906103.1 protein_id gnl|my_center|LOCUS_01360 3521 4033 gene locus_tag LOCUS_01370 3521 4033 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130901.1 protein_id gnl|my_center|LOCUS_01370 4066 4728 gene locus_tag LOCUS_01380 gene cmk 4066 4728 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130902.1 protein_id gnl|my_center|LOCUS_01380 5082 6122 gene locus_tag LOCUS_01390 5082 6122 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132781.1 protein_id gnl|my_center|LOCUS_01390 6222 6004 gene locus_tag LOCUS_01400 6222 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 6659 6504 gene locus_tag LOCUS_01410 6659 6504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 6824 8182 gene locus_tag LOCUS_01420 6824 8182 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906102.1 protein_id gnl|my_center|LOCUS_01420 8425 10050 gene locus_tag LOCUS_01430 8425 10050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 10940 10086 gene locus_tag LOCUS_01440 10940 10086 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130377.1 protein_id gnl|my_center|LOCUS_01440 12291 10942 gene locus_tag LOCUS_01450 12291 10942 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130376.1 protein_id gnl|my_center|LOCUS_01450 13597 12362 gene locus_tag LOCUS_01460 13597 12362 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130374.1 protein_id gnl|my_center|LOCUS_01460 13866 15626 gene locus_tag LOCUS_01470 13866 15626 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130373.1 protein_id gnl|my_center|LOCUS_01470 15743 16006 gene locus_tag LOCUS_01480 15743 16006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 16025 17632 gene locus_tag LOCUS_01490 16025 17632 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130367.1 protein_id gnl|my_center|LOCUS_01490 17656 19920 gene locus_tag LOCUS_01500 17656 19920 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906090.1 protein_id gnl|my_center|LOCUS_01500 19913 20578 gene locus_tag LOCUS_01510 gene pgmB 19913 20578 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905331.1 protein_id gnl|my_center|LOCUS_01510 20605 21579 gene locus_tag LOCUS_01520 20605 21579 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130365.1 protein_id gnl|my_center|LOCUS_01520 22232 22909 gene locus_tag LOCUS_01530 22232 22909 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130364.1 protein_id gnl|my_center|LOCUS_01530 22915 24315 gene locus_tag LOCUS_01540 22915 24315 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906089.1 protein_id gnl|my_center|LOCUS_01540 24383 26125 gene locus_tag LOCUS_01550 24383 26125 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906088.1 protein_id gnl|my_center|LOCUS_01550 26134 26400 gene locus_tag LOCUS_01560 gene yidD 26134 26400 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906087.1 protein_id gnl|my_center|LOCUS_01560 26602 27384 gene locus_tag LOCUS_01570 26602 27384 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861723.1 protein_id gnl|my_center|LOCUS_01570 27374 28324 gene locus_tag LOCUS_01580 27374 28324 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905286.1 protein_id gnl|my_center|LOCUS_01580 28321 29259 gene locus_tag LOCUS_01590 28321 29259 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131660.1 protein_id gnl|my_center|LOCUS_01590 29272 30213 gene locus_tag LOCUS_01600 29272 30213 CDS product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131659.1 protein_id gnl|my_center|LOCUS_01600 30747 31187 gene locus_tag LOCUS_01610 30747 31187 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132498.1 protein_id gnl|my_center|LOCUS_01610 31187 32164 gene locus_tag LOCUS_01620 31187 32164 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132499.1 protein_id gnl|my_center|LOCUS_01620 32252 32473 gene locus_tag LOCUS_01630 32252 32473 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132501.1 protein_id gnl|my_center|LOCUS_01630 32533 33492 gene locus_tag LOCUS_01640 gene fabD 32533 33492 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132502.1 protein_id gnl|my_center|LOCUS_01640 33570 34301 gene locus_tag LOCUS_01650 gene fabG 33570 34301 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132504.1 protein_id gnl|my_center|LOCUS_01650 34358 35575 gene locus_tag LOCUS_01660 gene fabF 34358 35575 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905554.1 protein_id gnl|my_center|LOCUS_01660 35668 36144 gene locus_tag LOCUS_01670 gene accB 35668 36144 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905555.1 protein_id gnl|my_center|LOCUS_01670 36159 36593 gene locus_tag LOCUS_01680 gene fabZ 36159 36593 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132511.1 protein_id gnl|my_center|LOCUS_01680 36791 38155 gene locus_tag LOCUS_01690 gene accC 36791 38155 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132515.1 protein_id gnl|my_center|LOCUS_01690 >Feature sequence005 115 510 gene locus_tag LOCUS_01700 gene spxA 115 510 CDS product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254213.1 protein_id gnl|my_center|LOCUS_01700 668 928 gene locus_tag LOCUS_01710 668 928 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015425977.1 protein_id gnl|my_center|LOCUS_01710 944 1216 gene locus_tag LOCUS_01720 944 1216 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021214922.1 protein_id gnl|my_center|LOCUS_01720 1275 2600 gene locus_tag LOCUS_01730 1275 2600 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132604.1 protein_id gnl|my_center|LOCUS_01730 3013 3249 gene locus_tag LOCUS_01740 3013 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 3655 4740 gene locus_tag LOCUS_01750 gene rsgA 3655 4740 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101507.1 protein_id gnl|my_center|LOCUS_01750 4893 5711 gene locus_tag LOCUS_01760 gene proB 4893 5711 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138929.1 protein_id gnl|my_center|LOCUS_01760 5727 6983 gene locus_tag LOCUS_01770 5727 6983 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906056.1 protein_id gnl|my_center|LOCUS_01770 7174 8673 gene locus_tag LOCUS_01780 7174 8673 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132064.1 protein_id gnl|my_center|LOCUS_01780 9078 8872 gene locus_tag LOCUS_01790 9078 8872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 10096 9326 gene locus_tag LOCUS_01800 gene iolR 10096 9326 CDS product myo-inositol utilization transcriptional regulator IolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227050.1 protein_id gnl|my_center|LOCUS_01800 10336 11796 gene locus_tag LOCUS_01810 gene iolA 10336 11796 CDS product methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989444.1 protein_id gnl|my_center|LOCUS_01810 11789 12610 gene locus_tag LOCUS_01820 gene iolB 11789 12610 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243247.1 protein_id gnl|my_center|LOCUS_01820 12622 13581 gene locus_tag LOCUS_01830 gene iolC 12622 13581 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243753.1 protein_id gnl|my_center|LOCUS_01830 13799 14680 gene locus_tag LOCUS_01840 gene iolE 13799 14680 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471986.1 protein_id gnl|my_center|LOCUS_01840 14825 16432 gene locus_tag LOCUS_01850 14825 16432 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087120.1 protein_id gnl|my_center|LOCUS_01850 16570 16911 gene locus_tag LOCUS_01860 16570 16911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 16904 18820 gene locus_tag LOCUS_01870 gene iolD 16904 18820 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242642.1 protein_id gnl|my_center|LOCUS_01870 18867 19859 gene locus_tag LOCUS_01880 gene iolG 18867 19859 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102250.1 protein_id gnl|my_center|LOCUS_01880 19934 20953 gene locus_tag LOCUS_01890 19934 20953 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102247.1 protein_id gnl|my_center|LOCUS_01890 21273 22256 gene locus_tag LOCUS_01900 21273 22256 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906073.1 protein_id gnl|my_center|LOCUS_01900 22249 23154 gene locus_tag LOCUS_01910 gene rbsK 22249 23154 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906072.1 protein_id gnl|my_center|LOCUS_01910 23129 23527 gene locus_tag LOCUS_01920 gene rbsD 23129 23527 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129436.1 protein_id gnl|my_center|LOCUS_01920 23524 24999 gene locus_tag LOCUS_01930 23524 24999 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906071.1 protein_id gnl|my_center|LOCUS_01930 25033 25974 gene locus_tag LOCUS_01940 25033 25974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978822.1 protein_id gnl|my_center|LOCUS_01940 26016 26984 gene locus_tag LOCUS_01950 26016 26984 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668256.1 protein_id gnl|my_center|LOCUS_01950 27181 27425 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27628 28707 gene locus_tag LOCUS_01960 gene xerS 27628 28707 CDS product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131037.1 protein_id gnl|my_center|LOCUS_01960 29314 28904 gene locus_tag LOCUS_01970 29314 28904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 30763 29417 gene locus_tag LOCUS_01980 gene trmFO 30763 29417 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131150.1 protein_id gnl|my_center|LOCUS_01980 32968 30818 gene locus_tag LOCUS_01990 gene topA 32968 30818 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131148.1 protein_id gnl|my_center|LOCUS_01990 33050 33340 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34315 33470 gene locus_tag LOCUS_02000 gene dprA 34315 33470 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922314.1 protein_id gnl|my_center|LOCUS_02000 35099 34401 gene locus_tag LOCUS_02010 gene budA 35099 34401 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131140.1 protein_id gnl|my_center|LOCUS_02010 36946 35222 gene locus_tag LOCUS_02020 36946 35222 CDS product ABC transporter permease/substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130445.1 protein_id gnl|my_center|LOCUS_02020 38141 36939 gene locus_tag LOCUS_02030 38141 36939 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130443.1 protein_id gnl|my_center|LOCUS_02030 >Feature sequence006 66 1547 gene locus_tag LOCUS_02040 gene guaB 66 1547 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129822.1 protein_id gnl|my_center|LOCUS_02040 1844 3490 gene locus_tag LOCUS_02050 1844 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 3711 3887 gene locus_tag LOCUS_02060 3711 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 4066 5001 gene locus_tag LOCUS_02070 gene comGA 4066 5001 CDS product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906320.1 protein_id gnl|my_center|LOCUS_02070 5132 5968 gene locus_tag LOCUS_02080 gene comGB 5132 5968 CDS product competence type IV pilus assembly protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770673.1 protein_id gnl|my_center|LOCUS_02080 5986 6291 gene locus_tag LOCUS_02090 gene comGC 5986 6291 CDS product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263437.1 protein_id gnl|my_center|LOCUS_02090 6347 6682 gene locus_tag LOCUS_02100 gene comGD 6347 6682 CDS product competence type IV pilus minor pilin ComGD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226319344.1 protein_id gnl|my_center|LOCUS_02100 6654 6956 gene locus_tag LOCUS_02110 gene comGE 6654 6956 CDS product competence type IV pilus minor pilin ComGE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906316.1 protein_id gnl|my_center|LOCUS_02110 6967 7362 gene locus_tag LOCUS_02120 gene comGF 6967 7362 CDS product competence type IV pilus minor pilin ComGF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379808.1 protein_id gnl|my_center|LOCUS_02120 7365 7538 gene locus_tag LOCUS_02130 7365 7538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 7593 8438 gene locus_tag LOCUS_02140 7593 8438 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906312.1 protein_id gnl|my_center|LOCUS_02140 9390 8509 gene locus_tag LOCUS_02150 9390 8509 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906309.1 protein_id gnl|my_center|LOCUS_02150 9552 11753 gene locus_tag LOCUS_02160 9552 11753 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129980.1 protein_id gnl|my_center|LOCUS_02160 11921 13756 gene locus_tag LOCUS_02170 11921 13756 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906306.1 protein_id gnl|my_center|LOCUS_02170 13953 14150 gene locus_tag LOCUS_02180 gene secE 13953 14150 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129978.1 protein_id gnl|my_center|LOCUS_02180 14248 14808 gene locus_tag LOCUS_02190 gene nusG 14248 14808 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129977.1 protein_id gnl|my_center|LOCUS_02190 14854 16131 gene locus_tag LOCUS_02200 14854 16131 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129881172.1 protein_id gnl|my_center|LOCUS_02200 16558 16178 gene locus_tag LOCUS_02210 gene mscL 16558 16178 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906303.1 protein_id gnl|my_center|LOCUS_02210 16870 17178 gene locus_tag LOCUS_02220 gene rpsJ 16870 17178 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129973.1 protein_id gnl|my_center|LOCUS_02220 17193 17816 gene locus_tag LOCUS_02230 gene rplC 17193 17816 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129970.1 protein_id gnl|my_center|LOCUS_02230 17839 18465 gene locus_tag LOCUS_02240 gene rplD 17839 18465 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129968.1 protein_id gnl|my_center|LOCUS_02240 18465 18767 gene locus_tag LOCUS_02250 18465 18767 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129966.1 protein_id gnl|my_center|LOCUS_02250 18783 19616 gene locus_tag LOCUS_02260 gene rplB 18783 19616 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129965.1 protein_id gnl|my_center|LOCUS_02260 19800 20078 gene locus_tag LOCUS_02270 gene rpsS 19800 20078 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129963.1 protein_id gnl|my_center|LOCUS_02270 20094 20441 gene locus_tag LOCUS_02280 gene rplV 20094 20441 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906302.1 protein_id gnl|my_center|LOCUS_02280 20454 21107 gene locus_tag LOCUS_02290 gene rpsC 20454 21107 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906301.1 protein_id gnl|my_center|LOCUS_02290 21111 21527 gene locus_tag LOCUS_02300 gene rplP 21111 21527 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960946.1 protein_id gnl|my_center|LOCUS_02300 21524 21733 gene locus_tag LOCUS_02310 gene rpmC 21524 21733 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129957.1 protein_id gnl|my_center|LOCUS_02310 21752 22012 gene locus_tag LOCUS_02320 gene rpsQ 21752 22012 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129955.1 protein_id gnl|my_center|LOCUS_02320 22035 22403 gene locus_tag LOCUS_02330 gene rplN 22035 22403 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129953.1 protein_id gnl|my_center|LOCUS_02330 22570 22875 gene locus_tag LOCUS_02340 gene rplX 22570 22875 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129951.1 protein_id gnl|my_center|LOCUS_02340 22895 23437 gene locus_tag LOCUS_02350 gene rplE 22895 23437 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129948.1 protein_id gnl|my_center|LOCUS_02350 23457 23642 gene locus_tag LOCUS_02360 23457 23642 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129946.1 protein_id gnl|my_center|LOCUS_02360 23867 25483 gene locus_tag LOCUS_02370 23867 25483 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_02370 25712 26665 gene locus_tag LOCUS_02380 25712 26665 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131609.1 protein_id gnl|my_center|LOCUS_02380 27232 27630 gene locus_tag LOCUS_02390 gene rpsH 27232 27630 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906299.1 protein_id gnl|my_center|LOCUS_02390 27720 28256 gene locus_tag LOCUS_02400 gene rplF 27720 28256 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195502.1 protein_id gnl|my_center|LOCUS_02400 28399 28746 gene locus_tag LOCUS_02410 gene rplR 28399 28746 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129924.1 protein_id gnl|my_center|LOCUS_02410 28767 29261 gene locus_tag LOCUS_02420 gene rpsE 28767 29261 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129922.1 protein_id gnl|my_center|LOCUS_02420 29272 29454 gene locus_tag LOCUS_02430 gene rpmD 29272 29454 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262322.1 protein_id gnl|my_center|LOCUS_02430 29709 30758 gene locus_tag LOCUS_02440 29709 30758 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905973.1 protein_id gnl|my_center|LOCUS_02440 30958 31410 gene locus_tag LOCUS_02450 gene rplO 30958 31410 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129920.1 protein_id gnl|my_center|LOCUS_02450 31481 32797 gene locus_tag LOCUS_02460 gene secY 31481 32797 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129919.1 protein_id gnl|my_center|LOCUS_02460 32950 36276 gene locus_tag LOCUS_02470 32950 36276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 36420 37067 gene locus_tag LOCUS_02480 36420 37067 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906298.1 protein_id gnl|my_center|LOCUS_02480 >Feature sequence007 402 1595 gene locus_tag LOCUS_02490 gene secY2 402 1595 CDS product accessory Sec system protein translocase subunit SecY2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772262.1 protein_id gnl|my_center|LOCUS_02490 1605 3167 gene locus_tag LOCUS_02500 gene asp1 1605 3167 CDS product accessory Sec system protein Asp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468347.1 protein_id gnl|my_center|LOCUS_02500 3172 4755 gene locus_tag LOCUS_02510 gene asp2 3172 4755 CDS product accessory Sec system protein Asp2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836744.1 protein_id gnl|my_center|LOCUS_02510 4752 5300 gene locus_tag LOCUS_02520 4752 5300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 5303 7690 gene locus_tag LOCUS_02530 gene secA2 5303 7690 CDS product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836745.1 protein_id gnl|my_center|LOCUS_02530 7702 9207 gene locus_tag LOCUS_02540 gene gtfA 7702 9207 CDS product accessory Sec system glycosyltransferase GtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158445.1 protein_id gnl|my_center|LOCUS_02540 9200 10516 gene locus_tag LOCUS_02550 gene gtfB 9200 10516 CDS product accessory Sec system glycosylation chaperone GtfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609042.1 protein_id gnl|my_center|LOCUS_02550 10517 10684 gene locus_tag LOCUS_02560 10517 10684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 11381 11914 gene locus_tag LOCUS_02570 11381 11914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 12246 12626 gene locus_tag LOCUS_02580 12246 12626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02580 12650 12943 gene locus_tag LOCUS_02590 12650 12943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02590 12947 13699 gene locus_tag LOCUS_02600 12947 13699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02600 13895 13823 gene locus_tag LOCUS_t00040 13895 13823 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14221 15468 gene locus_tag LOCUS_02610 gene radA 14221 15468 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130563.1 protein_id gnl|my_center|LOCUS_02610 16052 16315 gene locus_tag LOCUS_02620 16052 16315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 16561 16813 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16850 17233 gene locus_tag LOCUS_02630 16850 17233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 17281 17553 gene locus_tag LOCUS_02640 17281 17553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 17544 17723 gene locus_tag LOCUS_02650 17544 17723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 18051 19130 gene locus_tag LOCUS_02660 18051 19130 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906293.1 protein_id gnl|my_center|LOCUS_02660 19170 19799 gene locus_tag LOCUS_02670 19170 19799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129888.1 protein_id gnl|my_center|LOCUS_02670 19985 21106 gene locus_tag LOCUS_02680 gene ald 19985 21106 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869878.1 protein_id gnl|my_center|LOCUS_02680 21639 21145 gene locus_tag LOCUS_02690 21639 21145 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129897.1 protein_id gnl|my_center|LOCUS_02690 21785 23224 gene locus_tag LOCUS_02700 gene gltX 21785 23224 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906290.1 protein_id gnl|my_center|LOCUS_02700 24399 23464 gene locus_tag LOCUS_02710 24399 23464 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546076.1 protein_id gnl|my_center|LOCUS_02710 24631 29772 gene locus_tag LOCUS_02720 24631 29772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 31640 30060 gene locus_tag LOCUS_02730 31640 30060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 32303 31743 gene locus_tag LOCUS_02740 32303 31743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 34946 32649 gene locus_tag LOCUS_02750 34946 32649 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254450.1 protein_id gnl|my_center|LOCUS_02750 >Feature sequence008 3809 1248 gene locus_tag LOCUS_02760 gene pglZ 3809 1248 CDS product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459232.1 protein_id gnl|my_center|LOCUS_02760 4350 3790 gene locus_tag LOCUS_02770 4350 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 5570 4350 gene locus_tag LOCUS_02780 5570 4350 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068364.1 protein_id gnl|my_center|LOCUS_02780 6137 5742 gene locus_tag LOCUS_02790 6137 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 9546 6148 gene locus_tag LOCUS_02800 gene pglX 9546 6148 CDS product BREX-1 system adenine-specific DNA-methyltransferase PglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459230.1 protein_id gnl|my_center|LOCUS_02800 13096 9557 gene locus_tag LOCUS_02810 gene brxC 13096 9557 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459229.1 protein_id gnl|my_center|LOCUS_02810 13668 13093 gene locus_tag LOCUS_02820 13668 13093 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272229.1 protein_id gnl|my_center|LOCUS_02820 14283 13672 gene locus_tag LOCUS_02830 14283 13672 CDS product DUF1819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459228.1 protein_id gnl|my_center|LOCUS_02830 14499 14308 gene locus_tag LOCUS_02840 14499 14308 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305998.1 protein_id gnl|my_center|LOCUS_02840 15315 14701 gene locus_tag LOCUS_02850 15315 14701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02850 16065 15706 gene locus_tag LOCUS_02860 16065 15706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 17512 16175 gene locus_tag LOCUS_02870 gene asnS 17512 16175 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002376912.1 protein_id gnl|my_center|LOCUS_02870 17739 17533 gene locus_tag LOCUS_02880 17739 17533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02880 17860 17723 gene locus_tag LOCUS_02890 17860 17723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 19043 17850 gene locus_tag LOCUS_02900 19043 17850 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906157.1 protein_id gnl|my_center|LOCUS_02900 19475 19047 gene locus_tag LOCUS_02910 19475 19047 CDS product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130291.1 protein_id gnl|my_center|LOCUS_02910 22064 19710 gene locus_tag LOCUS_02920 22064 19710 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379803.1 protein_id gnl|my_center|LOCUS_02920 22436 22873 gene locus_tag LOCUS_02930 22436 22873 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906159.1 protein_id gnl|my_center|LOCUS_02930 24637 22946 gene locus_tag LOCUS_02940 24637 22946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 25954 25037 gene locus_tag LOCUS_02950 25954 25037 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905494.1 protein_id gnl|my_center|LOCUS_02950 26610 27008 gene locus_tag LOCUS_02960 26610 27008 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905884.1 protein_id gnl|my_center|LOCUS_02960 27677 27156 gene locus_tag LOCUS_02970 27677 27156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 27883 28863 gene locus_tag LOCUS_02980 27883 28863 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360063.1 protein_id gnl|my_center|LOCUS_02980 29738 29028 gene locus_tag LOCUS_02990 29738 29028 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774684.1 protein_id gnl|my_center|LOCUS_02990 31179 29878 gene locus_tag LOCUS_03000 gene eno 31179 29878 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905473.1 protein_id gnl|my_center|LOCUS_03000 31890 31531 gene locus_tag LOCUS_03010 gene rplT 31890 31531 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132352.1 protein_id gnl|my_center|LOCUS_03010 32342 32142 gene locus_tag LOCUS_03020 gene rpmI 32342 32142 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132353.1 protein_id gnl|my_center|LOCUS_03020 32868 32374 gene locus_tag LOCUS_03030 gene infC 32868 32374 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082272306.1 protein_id gnl|my_center|LOCUS_03030 33220 33516 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33641 34144 gene locus_tag LOCUS_03040 33641 34144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 34160 34342 gene locus_tag LOCUS_03050 34160 34342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 34430 34594 gene locus_tag LOCUS_03060 34430 34594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 >Feature sequence009 118 1716 gene locus_tag LOCUS_03070 118 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 3181 1814 gene locus_tag LOCUS_03080 3181 1814 CDS product DUF2142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049706.1 protein_id gnl|my_center|LOCUS_03080 4915 3191 gene locus_tag LOCUS_03090 4915 3191 CDS product SpaA isopeptide-forming pilin-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037459.1 protein_id gnl|my_center|LOCUS_03090 5356 4940 gene locus_tag LOCUS_03100 gene tagD 5356 4940 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905215.1 protein_id gnl|my_center|LOCUS_03100 6268 5381 gene locus_tag LOCUS_03110 6268 5381 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905213.1 protein_id gnl|my_center|LOCUS_03110 7271 6270 gene locus_tag LOCUS_03120 7271 6270 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905212.1 protein_id gnl|my_center|LOCUS_03120 8098 7268 gene locus_tag LOCUS_03130 8098 7268 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905211.1 protein_id gnl|my_center|LOCUS_03130 9234 8095 gene locus_tag LOCUS_03140 9234 8095 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905210.1 protein_id gnl|my_center|LOCUS_03140 10660 9227 gene locus_tag LOCUS_03150 10660 9227 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905209.1 protein_id gnl|my_center|LOCUS_03150 11601 10657 gene locus_tag LOCUS_03160 11601 10657 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905208.1 protein_id gnl|my_center|LOCUS_03160 11681 11920 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12934 12203 gene locus_tag LOCUS_03170 12934 12203 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905206.1 protein_id gnl|my_center|LOCUS_03170 13802 12927 gene locus_tag LOCUS_03180 13802 12927 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383764.1 protein_id gnl|my_center|LOCUS_03180 15049 13805 gene locus_tag LOCUS_03190 15049 13805 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837187.1 protein_id gnl|my_center|LOCUS_03190 18102 15166 gene locus_tag LOCUS_03200 18102 15166 CDS product rhamnan synthesis F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837189.1 protein_id gnl|my_center|LOCUS_03200 19452 18118 gene locus_tag LOCUS_03210 19452 18118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 20352 19462 gene locus_tag LOCUS_03220 20352 19462 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776623.1 protein_id gnl|my_center|LOCUS_03220 21509 20349 gene locus_tag LOCUS_03230 21509 20349 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905200.1 protein_id gnl|my_center|LOCUS_03230 22329 21520 gene locus_tag LOCUS_03240 22329 21520 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905199.1 protein_id gnl|my_center|LOCUS_03240 23267 22326 gene locus_tag LOCUS_03250 23267 22326 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905198.1 protein_id gnl|my_center|LOCUS_03250 24436 23291 gene locus_tag LOCUS_03260 24436 23291 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905197.1 protein_id gnl|my_center|LOCUS_03260 25390 24491 gene locus_tag LOCUS_03270 gene rfbD 25390 24491 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905196.1 protein_id gnl|my_center|LOCUS_03270 26449 25406 gene locus_tag LOCUS_03280 gene rfbB 26449 25406 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905195.1 protein_id gnl|my_center|LOCUS_03280 27204 26608 gene locus_tag LOCUS_03290 27204 26608 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264623.1 protein_id gnl|my_center|LOCUS_03290 28075 27206 gene locus_tag LOCUS_03300 gene rfbA 28075 27206 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905191.1 protein_id gnl|my_center|LOCUS_03300 30533 28215 gene locus_tag LOCUS_03310 30533 28215 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861289.1 protein_id gnl|my_center|LOCUS_03310 31285 30638 gene locus_tag LOCUS_03320 31285 30638 CDS product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905190.1 protein_id gnl|my_center|LOCUS_03320 31467 31661 gene locus_tag LOCUS_03330 gene rpmB 31467 31661 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129776.1 protein_id gnl|my_center|LOCUS_03330 32633 31881 gene locus_tag LOCUS_03340 32633 31881 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906025.1 protein_id gnl|my_center|LOCUS_03340 33118 32735 gene locus_tag LOCUS_03350 33118 32735 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130788.1 protein_id gnl|my_center|LOCUS_03350 >Feature sequence010 1011 28 gene locus_tag LOCUS_03360 1011 28 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930954.1 protein_id gnl|my_center|LOCUS_03360 1139 2533 gene locus_tag LOCUS_03370 1139 2533 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_03370 2547 3827 gene locus_tag LOCUS_03380 2547 3827 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978237.1 protein_id gnl|my_center|LOCUS_03380 3930 6062 gene locus_tag LOCUS_03390 3930 6062 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027257.1 protein_id gnl|my_center|LOCUS_03390 6088 6720 gene locus_tag LOCUS_03400 6088 6720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 6773 7645 gene locus_tag LOCUS_03410 6773 7645 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130103.1 protein_id gnl|my_center|LOCUS_03410 8538 7684 gene locus_tag LOCUS_03420 8538 7684 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868944.1 protein_id gnl|my_center|LOCUS_03420 8633 9283 gene locus_tag LOCUS_03430 8633 9283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 9680 9949 gene locus_tag LOCUS_03440 9680 9949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 10054 9969 gene locus_tag LOCUS_t00050 10054 9969 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10703 10137 gene locus_tag LOCUS_03450 10703 10137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03450 11404 10745 gene locus_tag LOCUS_03460 11404 10745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03460 13046 11544 gene locus_tag LOCUS_03470 13046 11544 CDS product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905587.1 protein_id gnl|my_center|LOCUS_03470 13881 13030 gene locus_tag LOCUS_03480 13881 13030 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905586.1 protein_id gnl|my_center|LOCUS_03480 14993 13980 gene locus_tag LOCUS_03490 14993 13980 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905252.1 protein_id gnl|my_center|LOCUS_03490 15139 14990 gene locus_tag LOCUS_03500 15139 14990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 15638 15159 gene locus_tag LOCUS_03510 15638 15159 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131187.1 protein_id gnl|my_center|LOCUS_03510 16136 16375 gene locus_tag LOCUS_03520 16136 16375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 16560 17405 gene locus_tag LOCUS_03530 16560 17405 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131189.1 protein_id gnl|my_center|LOCUS_03530 17596 18690 gene locus_tag LOCUS_03540 gene ald 17596 18690 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959424.1 protein_id gnl|my_center|LOCUS_03540 18713 19720 gene locus_tag LOCUS_03550 gene tdcB 18713 19720 CDS product bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628920.1 protein_id gnl|my_center|LOCUS_03550 19965 21155 gene locus_tag LOCUS_03560 19965 21155 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289186.1 protein_id gnl|my_center|LOCUS_03560 21222 22175 gene locus_tag LOCUS_03570 21222 22175 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289187.1 protein_id gnl|my_center|LOCUS_03570 22326 23684 gene locus_tag LOCUS_03580 22326 23684 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296108.1 protein_id gnl|my_center|LOCUS_03580 24048 23854 gene locus_tag LOCUS_03590 24048 23854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 24537 25118 gene locus_tag LOCUS_03600 24537 25118 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189990.1 protein_id gnl|my_center|LOCUS_03600 25280 27517 gene locus_tag LOCUS_03610 gene nrdD 25280 27517 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905257.1 protein_id gnl|my_center|LOCUS_03610 27825 29270 gene locus_tag LOCUS_03620 27825 29270 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905762.1 protein_id gnl|my_center|LOCUS_03620 29578 30177 gene locus_tag LOCUS_03630 gene nrdG 29578 30177 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905258.1 protein_id gnl|my_center|LOCUS_03630 30174 30665 gene locus_tag LOCUS_03640 30174 30665 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131197.1 protein_id gnl|my_center|LOCUS_03640 30730 31563 gene locus_tag LOCUS_03650 30730 31563 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255784.1 protein_id gnl|my_center|LOCUS_03650 31560 32405 gene locus_tag LOCUS_03660 31560 32405 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255782.1 protein_id gnl|my_center|LOCUS_03660 32407 33207 gene locus_tag LOCUS_03670 32407 33207 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255779.1 protein_id gnl|my_center|LOCUS_03670 33325 33398 gene locus_tag LOCUS_t00060 33325 33398 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 33400 33760 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33760 33835 gene locus_tag LOCUS_t00070 33760 33835 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 33860 33935 gene locus_tag LOCUS_t00080 33860 33935 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 33949 34024 gene locus_tag LOCUS_t00090 33949 34024 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 34109 34181 gene locus_tag LOCUS_t00100 34109 34181 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 34185 34255 gene locus_tag LOCUS_t00110 34185 34255 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 34297 34370 gene locus_tag LOCUS_t00120 34297 34370 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence011 155 916 gene locus_tag LOCUS_03680 155 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 1502 1074 gene locus_tag LOCUS_03690 1502 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 2301 1525 gene locus_tag LOCUS_03700 2301 1525 CDS product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906040.1 protein_id gnl|my_center|LOCUS_03700 2658 2341 gene locus_tag LOCUS_03710 2658 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 4246 2795 gene locus_tag LOCUS_03720 4246 2795 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317943.1 protein_id gnl|my_center|LOCUS_03720 5781 4444 gene locus_tag LOCUS_03730 5781 4444 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905313.1 protein_id gnl|my_center|LOCUS_03730 8388 6388 gene locus_tag LOCUS_03740 gene tkt 8388 6388 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129419.1 protein_id gnl|my_center|LOCUS_03740 9885 8518 gene locus_tag LOCUS_03750 9885 8518 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102215.1 protein_id gnl|my_center|LOCUS_03750 10235 9936 gene locus_tag LOCUS_03760 10235 9936 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367331.1 protein_id gnl|my_center|LOCUS_03760 12165 10237 gene locus_tag LOCUS_03770 12165 10237 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387321.1 protein_id gnl|my_center|LOCUS_03770 12975 12355 gene locus_tag LOCUS_03780 12975 12355 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905546.1 protein_id gnl|my_center|LOCUS_03780 13688 12972 gene locus_tag LOCUS_03790 13688 12972 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905545.1 protein_id gnl|my_center|LOCUS_03790 14565 13681 gene locus_tag LOCUS_03800 gene dnaI 14565 13681 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905544.1 protein_id gnl|my_center|LOCUS_03800 15731 14568 gene locus_tag LOCUS_03810 15731 14568 CDS product replication initiation and membrane attachment family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132471.1 protein_id gnl|my_center|LOCUS_03810 16150 15764 gene locus_tag LOCUS_03820 gene nrdR 16150 15764 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132469.1 protein_id gnl|my_center|LOCUS_03820 16870 16217 gene locus_tag LOCUS_03830 gene trmB 16870 16217 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132468.1 protein_id gnl|my_center|LOCUS_03830 17704 16931 gene locus_tag LOCUS_03840 17704 16931 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132467.1 protein_id gnl|my_center|LOCUS_03840 18317 18054 gene locus_tag LOCUS_03850 18317 18054 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905542.1 protein_id gnl|my_center|LOCUS_03850 19799 18426 gene locus_tag LOCUS_03860 gene dnaB 19799 18426 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132465.1 protein_id gnl|my_center|LOCUS_03860 20255 19803 gene locus_tag LOCUS_03870 gene rplI 20255 19803 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132464.1 protein_id gnl|my_center|LOCUS_03870 22219 20252 gene locus_tag LOCUS_03880 22219 20252 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905541.1 protein_id gnl|my_center|LOCUS_03880 22948 22289 gene locus_tag LOCUS_03890 22948 22289 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905540.1 protein_id gnl|my_center|LOCUS_03890 24457 23045 gene locus_tag LOCUS_03900 24457 23045 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132454.1 protein_id gnl|my_center|LOCUS_03900 24724 25689 gene locus_tag LOCUS_03910 24724 25689 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138879.1 protein_id gnl|my_center|LOCUS_03910 25936 26229 gene locus_tag LOCUS_03920 25936 26229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 27207 26332 gene locus_tag LOCUS_03930 27207 26332 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130103.1 protein_id gnl|my_center|LOCUS_03930 29162 27216 gene locus_tag LOCUS_03940 29162 27216 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641781.1 protein_id gnl|my_center|LOCUS_03940 29277 30722 gene locus_tag LOCUS_03950 29277 30722 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775322.1 protein_id gnl|my_center|LOCUS_03950 30722 31678 gene locus_tag LOCUS_03960 30722 31678 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836522.1 protein_id gnl|my_center|LOCUS_03960 >Feature sequence012 1611 1814 gene locus_tag LOCUS_03970 1611 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132029.1 protein_id gnl|my_center|LOCUS_03970 2155 3024 gene locus_tag LOCUS_03980 2155 3024 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906286.1 protein_id gnl|my_center|LOCUS_03980 3484 4335 gene locus_tag LOCUS_03990 3484 4335 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131676.1 protein_id gnl|my_center|LOCUS_03990 4356 5432 gene locus_tag LOCUS_04000 4356 5432 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131670.1 protein_id gnl|my_center|LOCUS_04000 5433 6128 gene locus_tag LOCUS_04010 5433 6128 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905283.1 protein_id gnl|my_center|LOCUS_04010 7743 6361 gene locus_tag LOCUS_04020 7743 6361 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379815.1 protein_id gnl|my_center|LOCUS_04020 7834 8093 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8515 8802 gene locus_tag LOCUS_04030 8515 8802 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905285.1 protein_id gnl|my_center|LOCUS_04030 9064 9969 gene locus_tag LOCUS_04040 9064 9969 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131658.1 protein_id gnl|my_center|LOCUS_04040 10066 10767 gene locus_tag LOCUS_04050 10066 10767 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131652.1 protein_id gnl|my_center|LOCUS_04050 10893 13049 gene locus_tag LOCUS_04060 10893 13049 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905292.1 protein_id gnl|my_center|LOCUS_04060 14029 13097 gene locus_tag LOCUS_04070 14029 13097 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131606.1 protein_id gnl|my_center|LOCUS_04070 14190 15008 gene locus_tag LOCUS_04080 14190 15008 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905309.1 protein_id gnl|my_center|LOCUS_04080 15915 14995 gene locus_tag LOCUS_04090 15915 14995 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387471.1 protein_id gnl|my_center|LOCUS_04090 16146 16799 gene locus_tag LOCUS_04100 gene recR 16146 16799 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131648.1 protein_id gnl|my_center|LOCUS_04100 16812 17861 gene locus_tag LOCUS_04110 16812 17861 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905293.1 protein_id gnl|my_center|LOCUS_04110 17987 18253 gene locus_tag LOCUS_04120 17987 18253 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132530.1 protein_id gnl|my_center|LOCUS_04120 18546 19877 gene locus_tag LOCUS_04130 18546 19877 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905294.1 protein_id gnl|my_center|LOCUS_04130 20007 20213 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20296 21969 gene locus_tag LOCUS_04140 20296 21969 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131645.1 protein_id gnl|my_center|LOCUS_04140 22043 22960 gene locus_tag LOCUS_04150 22043 22960 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131640.1 protein_id gnl|my_center|LOCUS_04150 22976 24010 gene locus_tag LOCUS_04160 22976 24010 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131638.1 protein_id gnl|my_center|LOCUS_04160 24027 25088 gene locus_tag LOCUS_04170 24027 25088 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131637.1 protein_id gnl|my_center|LOCUS_04170 25088 26023 gene locus_tag LOCUS_04180 25088 26023 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131636.1 protein_id gnl|my_center|LOCUS_04180 26121 26305 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26387 26830 gene locus_tag LOCUS_04190 26387 26830 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130996.1 protein_id gnl|my_center|LOCUS_04190 27223 27624 gene locus_tag LOCUS_04200 27223 27624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 28028 27765 gene locus_tag LOCUS_04210 28028 27765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 28189 28382 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28758 29165 gene locus_tag LOCUS_04220 28758 29165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 29231 29485 gene locus_tag LOCUS_04230 29231 29485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 29517 29743 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29908 30141 gene locus_tag LOCUS_04240 29908 30141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 30113 31060 gene locus_tag LOCUS_04250 30113 31060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 31391 32962 gene locus_tag LOCUS_04260 31391 32962 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131635.1 protein_id gnl|my_center|LOCUS_04260 >Feature sequence013 346 1374 gene locus_tag LOCUS_04270 346 1374 CDS product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379822.1 protein_id gnl|my_center|LOCUS_04270 1376 3022 gene locus_tag LOCUS_04280 gene menD 1376 3022 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905535.1 protein_id gnl|my_center|LOCUS_04280 3012 3839 gene locus_tag LOCUS_04290 gene menH 3012 3839 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905534.1 protein_id gnl|my_center|LOCUS_04290 3873 4715 gene locus_tag LOCUS_04300 gene menB 3873 4715 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132444.1 protein_id gnl|my_center|LOCUS_04300 4719 6071 gene locus_tag LOCUS_04310 gene menE 4719 6071 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905533.1 protein_id gnl|my_center|LOCUS_04310 6061 7164 gene locus_tag LOCUS_04320 gene menC 6061 7164 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905532.1 protein_id gnl|my_center|LOCUS_04320 7161 7538 gene locus_tag LOCUS_04330 7161 7538 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905531.1 protein_id gnl|my_center|LOCUS_04330 7915 8421 gene locus_tag LOCUS_04340 7915 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 10078 8687 gene locus_tag LOCUS_04350 gene gtfB 10078 8687 CDS product accessory Sec system glycosylation chaperone GtfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571763.1 protein_id gnl|my_center|LOCUS_04350 11547 10042 gene locus_tag LOCUS_04360 gene gtfA 11547 10042 CDS product accessory Sec system glycosyltransferase GtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836746.1 protein_id gnl|my_center|LOCUS_04360 12577 11567 gene locus_tag LOCUS_04370 12577 11567 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972583.1 protein_id gnl|my_center|LOCUS_04370 13195 12788 gene locus_tag LOCUS_04380 13195 12788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 13701 14075 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14308 14704 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15564 16652 gene locus_tag LOCUS_04390 15564 16652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 16774 16974 gene locus_tag LOCUS_04400 16774 16974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 19588 19379 gene locus_tag LOCUS_04410 19588 19379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 20590 19772 gene locus_tag LOCUS_04420 20590 19772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 22192 20600 gene locus_tag LOCUS_04430 gene asp2 22192 20600 CDS product accessory Sec system protein Asp2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836744.1 protein_id gnl|my_center|LOCUS_04430 23702 22185 gene locus_tag LOCUS_04440 gene asp1 23702 22185 CDS product accessory Sec system protein Asp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836743.1 protein_id gnl|my_center|LOCUS_04440 24937 23723 gene locus_tag LOCUS_04450 gene secY 24937 23723 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874541.1 protein_id gnl|my_center|LOCUS_04450 27345 24958 gene locus_tag LOCUS_04460 gene secA2 27345 24958 CDS product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560050.1 protein_id gnl|my_center|LOCUS_04460 27891 30869 gene locus_tag LOCUS_04470 27891 30869 CDS product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399773.1 protein_id gnl|my_center|LOCUS_04470 >Feature sequence014 1048 56 gene locus_tag LOCUS_04480 gene mraY 1048 56 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905599.1 protein_id gnl|my_center|LOCUS_04480 3436 1139 gene locus_tag LOCUS_04490 3436 1139 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905598.1 protein_id gnl|my_center|LOCUS_04490 3813 3433 gene locus_tag LOCUS_04500 3813 3433 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131357.1 protein_id gnl|my_center|LOCUS_04500 4798 3857 gene locus_tag LOCUS_04510 gene rsmH 4798 3857 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905597.1 protein_id gnl|my_center|LOCUS_04510 6089 4920 gene locus_tag LOCUS_04520 6089 4920 CDS product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900648.1 protein_id gnl|my_center|LOCUS_04520 6221 6150 gene locus_tag LOCUS_t00130 6221 6150 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6877 6674 gene locus_tag LOCUS_04530 6877 6674 CDS product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906074.1 protein_id gnl|my_center|LOCUS_04530 8427 7207 gene locus_tag LOCUS_04540 8427 7207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 8847 8428 gene locus_tag LOCUS_04550 8847 8428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 9581 9847 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10838 9981 gene locus_tag LOCUS_04560 10838 9981 CDS product tagatose-bisphosphate aldolase subunit GatY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898685.1 protein_id gnl|my_center|LOCUS_04560 11793 10864 gene locus_tag LOCUS_04570 11793 10864 CDS product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604263.1 protein_id gnl|my_center|LOCUS_04570 12959 11808 gene locus_tag LOCUS_04580 12959 11808 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922584.1 protein_id gnl|my_center|LOCUS_04580 13761 13114 gene locus_tag LOCUS_04590 13761 13114 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905540.1 protein_id gnl|my_center|LOCUS_04590 15691 13763 gene locus_tag LOCUS_04600 15691 13763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 16633 15701 gene locus_tag LOCUS_04610 gene pfkB 16633 15701 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355534.1 protein_id gnl|my_center|LOCUS_04610 16790 17548 gene locus_tag LOCUS_04620 16790 17548 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363162.1 protein_id gnl|my_center|LOCUS_04620 18419 17580 gene locus_tag LOCUS_04630 18419 17580 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167627999.1 protein_id gnl|my_center|LOCUS_04630 19218 18409 gene locus_tag LOCUS_04640 gene agaW 19218 18409 CDS product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406214.1 protein_id gnl|my_center|LOCUS_04640 19817 19341 gene locus_tag LOCUS_04650 gene agaV 19817 19341 CDS product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387360.1 protein_id gnl|my_center|LOCUS_04650 20182 19907 gene locus_tag LOCUS_04660 20182 19907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 20605 20183 gene locus_tag LOCUS_04670 20605 20183 CDS product PTS mannose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358624.1 protein_id gnl|my_center|LOCUS_04670 21898 20756 gene locus_tag LOCUS_04680 gene nagA 21898 20756 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905894.1 protein_id gnl|my_center|LOCUS_04680 22781 22029 gene locus_tag LOCUS_04690 22781 22029 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254700.1 protein_id gnl|my_center|LOCUS_04690 24750 22828 gene locus_tag LOCUS_04700 24750 22828 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905244.1 protein_id gnl|my_center|LOCUS_04700 24858 25082 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25303 25160 gene locus_tag LOCUS_04710 25303 25160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 25320 25616 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28592 25785 gene locus_tag LOCUS_04720 gene uvrA 28592 25785 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130311.1 protein_id gnl|my_center|LOCUS_04720 25816 26087 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28698 29000 gene locus_tag LOCUS_04730 28698 29000 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906152.1 protein_id gnl|my_center|LOCUS_04730 29701 29375 gene locus_tag LOCUS_04740 29701 29375 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905638.1 protein_id gnl|my_center|LOCUS_04740 30661 29741 gene locus_tag LOCUS_04750 30661 29741 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906153.1 protein_id gnl|my_center|LOCUS_04750 31288 30671 gene locus_tag LOCUS_04760 31288 30671 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906154.1 protein_id gnl|my_center|LOCUS_04760 31632 31285 gene locus_tag LOCUS_04770 31632 31285 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130302.1 protein_id gnl|my_center|LOCUS_04770 31894 31745 gene locus_tag LOCUS_04780 31894 31745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 >Feature sequence015 4352 93 gene locus_tag LOCUS_04790 4352 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 122 507 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4560 4819 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5447 5010 gene locus_tag LOCUS_04800 5447 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 6963 5458 gene locus_tag LOCUS_04810 6963 5458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 7245 7503 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9564 7516 gene locus_tag LOCUS_04820 9564 7516 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129537.1 protein_id gnl|my_center|LOCUS_04820 10135 10575 gene locus_tag LOCUS_04830 10135 10575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 10786 11427 gene locus_tag LOCUS_04840 10786 11427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04840 12520 11840 gene locus_tag LOCUS_04850 12520 11840 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905491.1 protein_id gnl|my_center|LOCUS_04850 13596 12523 gene locus_tag LOCUS_04860 13596 12523 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129569.1 protein_id gnl|my_center|LOCUS_04860 14195 13632 gene locus_tag LOCUS_04870 14195 13632 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905492.1 protein_id gnl|my_center|LOCUS_04870 14421 14624 gene locus_tag LOCUS_04880 14421 14624 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914590.1 protein_id gnl|my_center|LOCUS_04880 16743 14665 gene locus_tag LOCUS_04890 16743 14665 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986267.1 protein_id gnl|my_center|LOCUS_04890 17410 16721 gene locus_tag LOCUS_04900 17410 16721 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949146.1 protein_id gnl|my_center|LOCUS_04900 18418 17630 gene locus_tag LOCUS_04910 18418 17630 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989455.1 protein_id gnl|my_center|LOCUS_04910 18716 18477 gene locus_tag LOCUS_04920 18716 18477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 19267 18833 gene locus_tag LOCUS_04930 19267 18833 CDS product Spx/MgsR family RNA polymerase-binding regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905585.1 protein_id gnl|my_center|LOCUS_04930 20522 19410 gene locus_tag LOCUS_04940 gene alr 20522 19410 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132601.1 protein_id gnl|my_center|LOCUS_04940 20907 20545 gene locus_tag LOCUS_04950 gene acpS 20907 20545 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132600.1 protein_id gnl|my_center|LOCUS_04950 22428 21022 gene locus_tag LOCUS_04960 gene pepV 22428 21022 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132599.1 protein_id gnl|my_center|LOCUS_04960 23620 22538 gene locus_tag LOCUS_04970 gene mutY 23620 22538 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132598.1 protein_id gnl|my_center|LOCUS_04970 25519 23741 gene locus_tag LOCUS_04980 gene uvrC 25519 23741 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837033.1 protein_id gnl|my_center|LOCUS_04980 25812 26026 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26718 26056 gene locus_tag LOCUS_04990 26718 26056 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774917.1 protein_id gnl|my_center|LOCUS_04990 27521 26754 gene locus_tag LOCUS_05000 27521 26754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 28640 27975 gene locus_tag LOCUS_05010 28640 27975 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476350.1 protein_id gnl|my_center|LOCUS_05010 28699 28953 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence016 1472 1999 gene locus_tag LOCUS_05020 1472 1999 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132009.1 protein_id gnl|my_center|LOCUS_05020 3751 2264 gene locus_tag LOCUS_05030 gene zwf 3751 2264 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906393.1 protein_id gnl|my_center|LOCUS_05030 3954 3775 gene locus_tag LOCUS_05040 3954 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132007.1 protein_id gnl|my_center|LOCUS_05040 4166 3951 gene locus_tag LOCUS_05050 4166 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 4063 4908 gene locus_tag LOCUS_05060 4063 4908 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906392.1 protein_id gnl|my_center|LOCUS_05060 4905 5273 gene locus_tag LOCUS_05070 4905 5273 CDS product DUF1634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132003.1 protein_id gnl|my_center|LOCUS_05070 5320 5404 gene locus_tag LOCUS_t00140 5320 5404 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5457 5663 gene locus_tag LOCUS_05080 5457 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 5674 6558 gene locus_tag LOCUS_05090 5674 6558 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906390.1 protein_id gnl|my_center|LOCUS_05090 7939 6674 gene locus_tag LOCUS_05100 7939 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 9819 8131 gene locus_tag LOCUS_05110 gene argS 9819 8131 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906279.1 protein_id gnl|my_center|LOCUS_05110 10109 10555 gene locus_tag LOCUS_05120 gene argR 10109 10555 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254487.1 protein_id gnl|my_center|LOCUS_05120 10545 10886 gene locus_tag LOCUS_05130 10545 10886 CDS product RicAFT regulatory complex protein RicA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906386.1 protein_id gnl|my_center|LOCUS_05130 10990 13497 gene locus_tag LOCUS_05140 gene mutS 10990 13497 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906385.1 protein_id gnl|my_center|LOCUS_05140 13556 14230 gene locus_tag LOCUS_05150 13556 14230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906384.1 protein_id gnl|my_center|LOCUS_05150 14388 16286 gene locus_tag LOCUS_05160 gene mutL 14388 16286 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031297070.1 protein_id gnl|my_center|LOCUS_05160 16348 17265 gene locus_tag LOCUS_05170 16348 17265 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905676.1 protein_id gnl|my_center|LOCUS_05170 17265 17855 gene locus_tag LOCUS_05180 gene ruvA 17265 17855 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131995.1 protein_id gnl|my_center|LOCUS_05180 18298 19947 gene locus_tag LOCUS_05190 18298 19947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 20034 21275 gene locus_tag LOCUS_05200 20034 21275 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542320.1 protein_id gnl|my_center|LOCUS_05200 21319 22317 gene locus_tag LOCUS_05210 gene ruvB 21319 22317 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131994.1 protein_id gnl|my_center|LOCUS_05210 22441 22872 gene locus_tag LOCUS_05220 22441 22872 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906378.1 protein_id gnl|my_center|LOCUS_05220 22961 23326 gene locus_tag LOCUS_05230 22961 23326 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131985.1 protein_id gnl|my_center|LOCUS_05230 23379 24719 gene locus_tag LOCUS_05240 gene glnA 23379 24719 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906377.1 protein_id gnl|my_center|LOCUS_05240 24953 25384 gene locus_tag LOCUS_05250 24953 25384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131961.1 protein_id gnl|my_center|LOCUS_05250 25747 25475 gene locus_tag LOCUS_05260 25747 25475 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362440.1 protein_id gnl|my_center|LOCUS_05260 26022 26465 gene locus_tag LOCUS_05270 26022 26465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 26778 27260 gene locus_tag LOCUS_05280 26778 27260 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131959.1 protein_id gnl|my_center|LOCUS_05280 27257 27889 gene locus_tag LOCUS_05290 27257 27889 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906375.1 protein_id gnl|my_center|LOCUS_05290 27902 29566 gene locus_tag LOCUS_05300 gene dnaX 27902 29566 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906374.1 protein_id gnl|my_center|LOCUS_05300 >Feature sequence017 1252 278 gene locus_tag LOCUS_05310 gene bsh 1252 278 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287105.1 protein_id gnl|my_center|LOCUS_05310 3385 1760 gene locus_tag LOCUS_05320 gene groL 3385 1760 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131585.1 protein_id gnl|my_center|LOCUS_05320 3695 3414 gene locus_tag LOCUS_05330 gene groES 3695 3414 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131589.1 protein_id gnl|my_center|LOCUS_05330 4764 4375 gene locus_tag LOCUS_05340 4764 4375 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905314.1 protein_id gnl|my_center|LOCUS_05340 5466 4843 gene locus_tag LOCUS_05350 5466 4843 CDS product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131594.1 protein_id gnl|my_center|LOCUS_05350 5789 5463 gene locus_tag LOCUS_05360 5789 5463 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131595.1 protein_id gnl|my_center|LOCUS_05360 6073 5786 gene locus_tag LOCUS_05370 6073 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 6222 7289 gene locus_tag LOCUS_05380 gene pepA 6222 7289 CDS product glutamyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905311.1 protein_id gnl|my_center|LOCUS_05380 7413 8066 gene locus_tag LOCUS_05390 7413 8066 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905677.1 protein_id gnl|my_center|LOCUS_05390 8638 8234 gene locus_tag LOCUS_05400 8638 8234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 9092 8631 gene locus_tag LOCUS_05410 9092 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 11651 9222 gene locus_tag LOCUS_05420 11651 9222 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131598.1 protein_id gnl|my_center|LOCUS_05420 11787 13046 gene locus_tag LOCUS_05430 gene tyrS 11787 13046 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131599.1 protein_id gnl|my_center|LOCUS_05430 13175 13642 gene locus_tag LOCUS_05440 13175 13642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905310.1 protein_id gnl|my_center|LOCUS_05440 13722 15812 gene locus_tag LOCUS_05450 13722 15812 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131601.1 protein_id gnl|my_center|LOCUS_05450 17249 15846 gene locus_tag LOCUS_05460 17249 15846 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131604.1 protein_id gnl|my_center|LOCUS_05460 18538 17318 gene locus_tag LOCUS_05470 gene thiI 18538 17318 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131605.1 protein_id gnl|my_center|LOCUS_05470 19081 18620 gene locus_tag LOCUS_05480 19081 18620 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674531.1 protein_id gnl|my_center|LOCUS_05480 20152 19142 gene locus_tag LOCUS_05490 20152 19142 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905308.1 protein_id gnl|my_center|LOCUS_05490 22184 20346 gene locus_tag LOCUS_05500 22184 20346 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045634338.1 protein_id gnl|my_center|LOCUS_05500 22551 24038 gene locus_tag LOCUS_05510 gene lysS 22551 24038 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905307.1 protein_id gnl|my_center|LOCUS_05510 24108 25703 gene locus_tag LOCUS_05520 24108 25703 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_05520 26399 25815 gene locus_tag LOCUS_05530 26399 25815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 26432 26700 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27576 26890 gene locus_tag LOCUS_05540 27576 26890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 28543 28352 gene locus_tag LOCUS_05550 28543 28352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 >Feature sequence018 368 602 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 613 1458 gene locus_tag LOCUS_05560 613 1458 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005717330.1 protein_id gnl|my_center|LOCUS_05560 1449 1757 gene locus_tag LOCUS_05570 1449 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 2037 2236 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2332 3657 gene locus_tag LOCUS_05580 2332 3657 CDS product ISLre2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453221.1 protein_id gnl|my_center|LOCUS_05580 4053 4295 gene locus_tag LOCUS_05590 4053 4295 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130760.1 protein_id gnl|my_center|LOCUS_05590 4451 4999 gene locus_tag LOCUS_05600 4451 4999 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130758.1 protein_id gnl|my_center|LOCUS_05600 5097 5792 gene locus_tag LOCUS_05610 5097 5792 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130756.1 protein_id gnl|my_center|LOCUS_05610 5880 7370 gene locus_tag LOCUS_05620 5880 7370 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906048.1 protein_id gnl|my_center|LOCUS_05620 7887 9458 gene locus_tag LOCUS_05630 7887 9458 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837468.1 protein_id gnl|my_center|LOCUS_05630 9459 10196 gene locus_tag LOCUS_05640 9459 10196 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356242.1 protein_id gnl|my_center|LOCUS_05640 10321 11682 gene locus_tag LOCUS_05650 gene murD 10321 11682 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130748.1 protein_id gnl|my_center|LOCUS_05650 11684 12784 gene locus_tag LOCUS_05660 gene murG 11684 12784 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130746.1 protein_id gnl|my_center|LOCUS_05660 12777 13811 gene locus_tag LOCUS_05670 12777 13811 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130744.1 protein_id gnl|my_center|LOCUS_05670 14725 13988 gene locus_tag LOCUS_05680 14725 13988 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132766.1 protein_id gnl|my_center|LOCUS_05680 16883 14739 gene locus_tag LOCUS_05690 16883 14739 CDS product amino acid ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132767.1 protein_id gnl|my_center|LOCUS_05690 17120 17776 gene locus_tag LOCUS_05700 17120 17776 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906123.1 protein_id gnl|my_center|LOCUS_05700 17887 18729 gene locus_tag LOCUS_05710 17887 18729 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906122.1 protein_id gnl|my_center|LOCUS_05710 18713 19795 gene locus_tag LOCUS_05720 gene aroB 18713 19795 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132771.1 protein_id gnl|my_center|LOCUS_05720 19937 20863 gene locus_tag LOCUS_05730 19937 20863 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132772.1 protein_id gnl|my_center|LOCUS_05730 20870 21460 gene locus_tag LOCUS_05740 20870 21460 CDS product YktB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906121.1 protein_id gnl|my_center|LOCUS_05740 21462 22631 gene locus_tag LOCUS_05750 gene aroC 21462 22631 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906120.1 protein_id gnl|my_center|LOCUS_05750 22760 23116 gene locus_tag LOCUS_05760 22760 23116 CDS product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906119.1 protein_id gnl|my_center|LOCUS_05760 23147 23935 gene locus_tag LOCUS_05770 23147 23935 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906118.1 protein_id gnl|my_center|LOCUS_05770 23928 25895 gene locus_tag LOCUS_05780 23928 25895 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906117.1 protein_id gnl|my_center|LOCUS_05780 25896 26114 gene locus_tag LOCUS_05790 25896 26114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 26377 27033 gene locus_tag LOCUS_05800 26377 27033 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132782.1 protein_id gnl|my_center|LOCUS_05800 27020 27910 gene locus_tag LOCUS_05810 27020 27910 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132784.1 protein_id gnl|my_center|LOCUS_05810 27900 28457 gene locus_tag LOCUS_05820 27900 28457 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226319392.1 protein_id gnl|my_center|LOCUS_05820 >Feature sequence019 1073 306 gene locus_tag LOCUS_05830 1073 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 1550 1086 gene locus_tag LOCUS_05840 1550 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 2132 1572 gene locus_tag LOCUS_05850 2132 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 3281 2151 gene locus_tag LOCUS_05860 3281 2151 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390088.1 protein_id gnl|my_center|LOCUS_05860 5855 3294 gene locus_tag LOCUS_05870 5855 3294 CDS product type IV secretory pathway, VirB4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003582237.1 protein_id gnl|my_center|LOCUS_05870 6145 5852 gene locus_tag LOCUS_05880 6145 5852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 8186 6135 gene locus_tag LOCUS_05890 8186 6135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 10920 8173 gene locus_tag LOCUS_05900 10920 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 12042 10930 gene locus_tag LOCUS_05910 12042 10930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 12327 12064 gene locus_tag LOCUS_05920 12327 12064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 12679 12383 gene locus_tag LOCUS_05930 12679 12383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 12881 12672 gene locus_tag LOCUS_05940 12881 12672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 16766 13293 gene locus_tag LOCUS_05950 16766 13293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 17522 17055 gene locus_tag LOCUS_05960 17522 17055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 18023 17700 gene locus_tag LOCUS_05970 18023 17700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 18361 18086 gene locus_tag LOCUS_05980 18361 18086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 19245 18418 gene locus_tag LOCUS_05990 19245 18418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 19699 19325 gene locus_tag LOCUS_06000 19699 19325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 20195 19740 gene locus_tag LOCUS_06010 20195 19740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 20428 20276 gene locus_tag LOCUS_06020 20428 20276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 20580 20431 gene locus_tag LOCUS_06030 20580 20431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 21872 21210 gene locus_tag LOCUS_06040 21872 21210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 22966 21869 gene locus_tag LOCUS_06050 gene dcm 22966 21869 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286932.1 protein_id gnl|my_center|LOCUS_06050 23234 22953 gene locus_tag LOCUS_06060 23234 22953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 23327 23506 gene locus_tag LOCUS_06070 23327 23506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 23775 24125 gene locus_tag LOCUS_06080 23775 24125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 24445 25188 gene locus_tag LOCUS_06090 24445 25188 CDS product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262342.1 protein_id gnl|my_center|LOCUS_06090 26359 26661 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26691 26900 gene locus_tag LOCUS_06100 26691 26900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 >Feature sequence020 1438 812 gene locus_tag LOCUS_06110 1438 812 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906254.1 protein_id gnl|my_center|LOCUS_06110 1528 1823 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1901 2722 gene locus_tag LOCUS_06120 1901 2722 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906253.1 protein_id gnl|my_center|LOCUS_06120 3068 2790 gene locus_tag LOCUS_06130 3068 2790 CDS product DUF3270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254660.1 protein_id gnl|my_center|LOCUS_06130 3276 4199 gene locus_tag LOCUS_06140 3276 4199 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254664.1 protein_id gnl|my_center|LOCUS_06140 4287 5576 gene locus_tag LOCUS_06150 4287 5576 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254683.1 protein_id gnl|my_center|LOCUS_06150 5598 6473 gene locus_tag LOCUS_06160 5598 6473 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906251.1 protein_id gnl|my_center|LOCUS_06160 6615 7598 gene locus_tag LOCUS_06170 gene galE 6615 7598 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906245.1 protein_id gnl|my_center|LOCUS_06170 7778 9238 gene locus_tag LOCUS_06180 7778 9238 CDS product basic amino acid/polyamine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021037906.1 protein_id gnl|my_center|LOCUS_06180 9480 9259 gene locus_tag LOCUS_06190 9480 9259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 10546 9473 gene locus_tag LOCUS_06200 gene recF 10546 9473 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906242.1 protein_id gnl|my_center|LOCUS_06200 10911 10549 gene locus_tag LOCUS_06210 gene yaaA 10911 10549 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254746.1 protein_id gnl|my_center|LOCUS_06210 11044 12288 gene locus_tag LOCUS_06220 11044 12288 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180259804.1 protein_id gnl|my_center|LOCUS_06220 12269 13552 gene locus_tag LOCUS_06230 12269 13552 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058204375.1 protein_id gnl|my_center|LOCUS_06230 13604 14503 gene locus_tag LOCUS_06240 13604 14503 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906239.1 protein_id gnl|my_center|LOCUS_06240 14535 15086 gene locus_tag LOCUS_06250 gene pgsA 14535 15086 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906238.1 protein_id gnl|my_center|LOCUS_06250 15591 16874 gene locus_tag LOCUS_06260 gene hisS 15591 16874 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254776.1 protein_id gnl|my_center|LOCUS_06260 16930 18678 gene locus_tag LOCUS_06270 gene aspS 16930 18678 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254782.1 protein_id gnl|my_center|LOCUS_06270 18662 19552 gene locus_tag LOCUS_06280 18662 19552 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906234.1 protein_id gnl|my_center|LOCUS_06280 19679 20560 gene locus_tag LOCUS_06290 19679 20560 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254791.1 protein_id gnl|my_center|LOCUS_06290 20855 20613 gene locus_tag LOCUS_06300 20855 20613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 22020 21025 gene locus_tag LOCUS_06310 gene dusB 22020 21025 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906232.1 protein_id gnl|my_center|LOCUS_06310 23655 22111 gene locus_tag LOCUS_06320 23655 22111 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130350.1 protein_id gnl|my_center|LOCUS_06320 24536 23652 gene locus_tag LOCUS_06330 gene hslO 24536 23652 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906231.1 protein_id gnl|my_center|LOCUS_06330 24844 26133 gene locus_tag LOCUS_06340 24844 26133 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254838.1 protein_id gnl|my_center|LOCUS_06340 >Feature sequence021 601 362 gene locus_tag LOCUS_06350 601 362 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130710.1 protein_id gnl|my_center|LOCUS_06350 950 678 gene locus_tag LOCUS_06360 gene rpsP 950 678 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262013.1 protein_id gnl|my_center|LOCUS_06360 2283 1036 gene locus_tag LOCUS_06370 2283 1036 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906035.1 protein_id gnl|my_center|LOCUS_06370 3447 2287 gene locus_tag LOCUS_06380 3447 2287 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906036.1 protein_id gnl|my_center|LOCUS_06380 3552 4703 gene locus_tag LOCUS_06390 3552 4703 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906037.1 protein_id gnl|my_center|LOCUS_06390 5542 4748 gene locus_tag LOCUS_06400 5542 4748 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364009.1 protein_id gnl|my_center|LOCUS_06400 10078 5819 gene locus_tag LOCUS_06410 10078 5819 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379838.1 protein_id gnl|my_center|LOCUS_06410 12746 10458 gene locus_tag LOCUS_06420 12746 10458 CDS product RTX toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187288335.1 protein_id gnl|my_center|LOCUS_06420 13454 12816 gene locus_tag LOCUS_06430 13454 12816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 14402 13617 gene locus_tag LOCUS_06440 14402 13617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 15235 14447 gene locus_tag LOCUS_06450 15235 14447 CDS product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385163.1 protein_id gnl|my_center|LOCUS_06450 16308 15283 gene locus_tag LOCUS_06460 16308 15283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 17256 16345 gene locus_tag LOCUS_06470 17256 16345 CDS product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296745.1 protein_id gnl|my_center|LOCUS_06470 18602 17433 gene locus_tag LOCUS_06480 18602 17433 CDS product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014525057.1 protein_id gnl|my_center|LOCUS_06480 19652 18660 gene locus_tag LOCUS_06490 19652 18660 CDS product DUF916 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132423.1 protein_id gnl|my_center|LOCUS_06490 19904 20512 gene locus_tag LOCUS_06500 19904 20512 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906406.1 protein_id gnl|my_center|LOCUS_06500 21356 20649 gene locus_tag LOCUS_06510 21356 20649 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130716.1 protein_id gnl|my_center|LOCUS_06510 21602 22630 gene locus_tag LOCUS_06520 gene queA 21602 22630 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130719.1 protein_id gnl|my_center|LOCUS_06520 22631 23206 gene locus_tag LOCUS_06530 22631 23206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906043.1 protein_id gnl|my_center|LOCUS_06530 23369 23663 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23745 24467 gene locus_tag LOCUS_06540 23745 24467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 >Feature sequence022 1 531 gene locus_tag LOCUS_06550 1 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 1045 689 gene locus_tag LOCUS_06560 1045 689 CDS product DUF3397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639447.1 protein_id gnl|my_center|LOCUS_06560 1641 1162 gene locus_tag LOCUS_06570 1641 1162 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131680.1 protein_id gnl|my_center|LOCUS_06570 2195 1659 gene locus_tag LOCUS_06580 gene thiT 2195 1659 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162551422.1 protein_id gnl|my_center|LOCUS_06580 3004 2387 gene locus_tag LOCUS_06590 3004 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 3253 4029 gene locus_tag LOCUS_06600 3253 4029 CDS product CppA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906285.1 protein_id gnl|my_center|LOCUS_06600 4026 4970 gene locus_tag LOCUS_06610 4026 4970 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254459.1 protein_id gnl|my_center|LOCUS_06610 6377 5187 gene locus_tag LOCUS_06620 6377 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 6654 7232 gene locus_tag LOCUS_06630 6654 7232 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896832.1 protein_id gnl|my_center|LOCUS_06630 7402 10500 gene locus_tag LOCUS_06640 7402 10500 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906282.1 protein_id gnl|my_center|LOCUS_06640 10633 11262 gene locus_tag LOCUS_06650 10633 11262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906281.1 protein_id gnl|my_center|LOCUS_06650 11313 12644 gene locus_tag LOCUS_06660 gene murC 11313 12644 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906280.1 protein_id gnl|my_center|LOCUS_06660 12960 14300 gene locus_tag LOCUS_06670 12960 14300 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131558.1 protein_id gnl|my_center|LOCUS_06670 14300 14893 gene locus_tag LOCUS_06680 14300 14893 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905322.1 protein_id gnl|my_center|LOCUS_06680 14906 15646 gene locus_tag LOCUS_06690 14906 15646 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905323.1 protein_id gnl|my_center|LOCUS_06690 15873 16199 gene locus_tag LOCUS_06700 15873 16199 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131553.1 protein_id gnl|my_center|LOCUS_06700 16229 17569 gene locus_tag LOCUS_06710 16229 17569 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131550.1 protein_id gnl|my_center|LOCUS_06710 17745 19247 gene locus_tag LOCUS_06720 17745 19247 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131549.1 protein_id gnl|my_center|LOCUS_06720 19247 20683 gene locus_tag LOCUS_06730 19247 20683 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905175.1 protein_id gnl|my_center|LOCUS_06730 20912 21094 gene locus_tag LOCUS_06740 20912 21094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06740 21130 21456 gene locus_tag LOCUS_06750 21130 21456 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131552.1 protein_id gnl|my_center|LOCUS_06750 21765 21835 gene locus_tag LOCUS_t00150 21765 21835 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 22124 21960 gene locus_tag LOCUS_06760 22124 21960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 22918 22247 gene locus_tag LOCUS_06770 22918 22247 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039550.1 protein_id gnl|my_center|LOCUS_06770 24618 23677 gene locus_tag LOCUS_06780 24618 23677 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905118.1 protein_id gnl|my_center|LOCUS_06780 >Feature sequence023 79 2694 gene locus_tag LOCUS_06790 gene polA 79 2694 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906334.1 protein_id gnl|my_center|LOCUS_06790 3026 2817 gene locus_tag LOCUS_06800 3026 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 3983 3261 gene locus_tag LOCUS_06810 3983 3261 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905156.1 protein_id gnl|my_center|LOCUS_06810 4118 5266 gene locus_tag LOCUS_06820 gene tgt 4118 5266 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129711.1 protein_id gnl|my_center|LOCUS_06820 5396 7348 gene locus_tag LOCUS_06830 5396 7348 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861581.1 protein_id gnl|my_center|LOCUS_06830 7383 8135 gene locus_tag LOCUS_06840 7383 8135 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906333.1 protein_id gnl|my_center|LOCUS_06840 8414 8190 gene locus_tag LOCUS_06850 8414 8190 CDS product YkuJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130579.1 protein_id gnl|my_center|LOCUS_06850 9798 8464 gene locus_tag LOCUS_06860 9798 8464 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906331.1 protein_id gnl|my_center|LOCUS_06860 10808 9810 gene locus_tag LOCUS_06870 10808 9810 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906330.1 protein_id gnl|my_center|LOCUS_06870 12125 10905 gene locus_tag LOCUS_06880 12125 10905 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906329.1 protein_id gnl|my_center|LOCUS_06880 12431 12910 gene locus_tag LOCUS_06890 gene rlmH 12431 12910 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130585.1 protein_id gnl|my_center|LOCUS_06890 12907 13254 gene locus_tag LOCUS_06900 12907 13254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 13538 13873 gene locus_tag LOCUS_06910 gene yajC 13538 13873 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130588.1 protein_id gnl|my_center|LOCUS_06910 14069 14806 gene locus_tag LOCUS_06920 14069 14806 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906326.1 protein_id gnl|my_center|LOCUS_06920 14803 15597 gene locus_tag LOCUS_06930 14803 15597 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130590.1 protein_id gnl|my_center|LOCUS_06930 15777 17024 gene locus_tag LOCUS_06940 gene rseP 15777 17024 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906325.1 protein_id gnl|my_center|LOCUS_06940 17051 18901 gene locus_tag LOCUS_06950 17051 18901 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906324.1 protein_id gnl|my_center|LOCUS_06950 19807 24690 gene locus_tag LOCUS_06960 19807 24690 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031296849.1 protein_id gnl|my_center|LOCUS_06960 >Feature sequence024 993 73 gene locus_tag LOCUS_06970 gene coaA 993 73 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130461.1 protein_id gnl|my_center|LOCUS_06970 1178 1783 gene locus_tag LOCUS_06980 1178 1783 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130463.1 protein_id gnl|my_center|LOCUS_06980 1780 3072 gene locus_tag LOCUS_06990 1780 3072 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905974.1 protein_id gnl|my_center|LOCUS_06990 3072 3266 gene locus_tag LOCUS_07000 3072 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 3339 4001 gene locus_tag LOCUS_07010 gene deoC 3339 4001 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130468.1 protein_id gnl|my_center|LOCUS_07010 3988 4380 gene locus_tag LOCUS_07020 3988 4380 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130469.1 protein_id gnl|my_center|LOCUS_07020 4554 5606 gene locus_tag LOCUS_07030 4554 5606 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905973.1 protein_id gnl|my_center|LOCUS_07030 5697 6404 gene locus_tag LOCUS_07040 5697 6404 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130471.1 protein_id gnl|my_center|LOCUS_07040 8134 6554 gene locus_tag LOCUS_07050 8134 6554 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905972.1 protein_id gnl|my_center|LOCUS_07050 8801 8097 gene locus_tag LOCUS_07060 8801 8097 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130475.1 protein_id gnl|my_center|LOCUS_07060 9090 9425 gene locus_tag LOCUS_07070 9090 9425 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130477.1 protein_id gnl|my_center|LOCUS_07070 9451 9639 gene locus_tag LOCUS_07080 9451 9639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 9632 10537 gene locus_tag LOCUS_07090 9632 10537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 10515 11264 gene locus_tag LOCUS_07100 10515 11264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 11310 11663 gene locus_tag LOCUS_tm00010 11310 11663 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 12267 11833 gene locus_tag LOCUS_07110 12267 11833 CDS product DUF1398 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905247.1 protein_id gnl|my_center|LOCUS_07110 12604 12449 gene locus_tag LOCUS_07120 12604 12449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 12874 13104 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13195 13629 gene locus_tag LOCUS_07130 13195 13629 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130484.1 protein_id gnl|my_center|LOCUS_07130 13969 14448 gene locus_tag LOCUS_07140 13969 14448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906139.1 protein_id gnl|my_center|LOCUS_07140 15188 14589 gene locus_tag LOCUS_07150 15188 14589 CDS product lipoprotein BA_5634 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905446.1 protein_id gnl|my_center|LOCUS_07150 16091 15288 gene locus_tag LOCUS_07160 16091 15288 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836893.1 protein_id gnl|my_center|LOCUS_07160 16734 16102 gene locus_tag LOCUS_07170 16734 16102 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355926.1 protein_id gnl|my_center|LOCUS_07170 16937 19555 gene locus_tag LOCUS_07180 gene ppdK 16937 19555 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861547.1 protein_id gnl|my_center|LOCUS_07180 20096 19698 gene locus_tag LOCUS_07190 gene psiE 20096 19698 CDS product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905975.1 protein_id gnl|my_center|LOCUS_07190 20356 20535 gene locus_tag LOCUS_07200 20356 20535 CDS product FaeA/PapI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813931.1 protein_id gnl|my_center|LOCUS_07200 20607 20987 gene locus_tag LOCUS_07210 20607 20987 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130526.1 protein_id gnl|my_center|LOCUS_07210 21102 21593 gene locus_tag LOCUS_07220 21102 21593 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_227020409.1 protein_id gnl|my_center|LOCUS_07220 22036 22890 gene locus_tag LOCUS_07230 gene ylqF 22036 22890 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905873.1 protein_id gnl|my_center|LOCUS_07230 22877 23638 gene locus_tag LOCUS_07240 22877 23638 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130174.1 protein_id gnl|my_center|LOCUS_07240 24409 23663 gene locus_tag LOCUS_07250 24409 23663 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130180.1 protein_id gnl|my_center|LOCUS_07250 >Feature sequence025 22 1644 gene locus_tag LOCUS_07260 22 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 1938 1744 gene locus_tag LOCUS_07270 1938 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 2735 1962 gene locus_tag LOCUS_07280 2735 1962 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130207.1 protein_id gnl|my_center|LOCUS_07280 3501 3058 gene locus_tag LOCUS_07290 3501 3058 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700867.1 protein_id gnl|my_center|LOCUS_07290 4829 3504 gene locus_tag LOCUS_07300 4829 3504 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003707114.1 protein_id gnl|my_center|LOCUS_07300 5450 6331 gene locus_tag LOCUS_07310 gene rsgA 5450 6331 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906200.1 protein_id gnl|my_center|LOCUS_07310 6345 6509 gene locus_tag LOCUS_07320 6345 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 6518 7177 gene locus_tag LOCUS_07330 gene rpe 6518 7177 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906199.1 protein_id gnl|my_center|LOCUS_07330 7174 8460 gene locus_tag LOCUS_07340 7174 8460 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906198.1 protein_id gnl|my_center|LOCUS_07340 8462 9406 gene locus_tag LOCUS_07350 8462 9406 CDS product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254890.1 protein_id gnl|my_center|LOCUS_07350 9421 10290 gene locus_tag LOCUS_07360 9421 10290 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906197.1 protein_id gnl|my_center|LOCUS_07360 10380 11513 gene locus_tag LOCUS_07370 10380 11513 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254931.1 protein_id gnl|my_center|LOCUS_07370 11583 12212 gene locus_tag LOCUS_07380 gene upp 11583 12212 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254935.1 protein_id gnl|my_center|LOCUS_07380 12360 12968 gene locus_tag LOCUS_07390 12360 12968 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906194.1 protein_id gnl|my_center|LOCUS_07390 13190 13507 gene locus_tag LOCUS_07400 13190 13507 CDS product ATP cone domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254946.1 protein_id gnl|my_center|LOCUS_07400 13695 13909 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14080 20307 gene locus_tag LOCUS_07410 14080 20307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 20324 20941 gene locus_tag LOCUS_07420 20324 20941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 21223 22170 gene locus_tag LOCUS_07430 gene hemH 21223 22170 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364185.1 protein_id gnl|my_center|LOCUS_07430 22537 24477 gene locus_tag LOCUS_07440 gene thrS 22537 24477 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254953.1 protein_id gnl|my_center|LOCUS_07440 >Feature sequence026 178 1152 gene locus_tag LOCUS_07450 178 1152 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_07450 1160 1419 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1656 1967 gene locus_tag LOCUS_07460 1656 1967 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359293.1 protein_id gnl|my_center|LOCUS_07460 1964 2353 gene locus_tag LOCUS_07470 1964 2353 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257561.1 protein_id gnl|my_center|LOCUS_07470 2554 2766 gene locus_tag LOCUS_07480 2554 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 3194 3421 gene locus_tag LOCUS_07490 3194 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 3619 3834 gene locus_tag LOCUS_07500 3619 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 3879 4691 gene locus_tag LOCUS_07510 3879 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 4818 5663 gene locus_tag LOCUS_07520 4818 5663 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131344.1 protein_id gnl|my_center|LOCUS_07520 5708 6961 gene locus_tag LOCUS_07530 gene xseA 5708 6961 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905593.1 protein_id gnl|my_center|LOCUS_07530 6971 7195 gene locus_tag LOCUS_07540 6971 7195 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131346.1 protein_id gnl|my_center|LOCUS_07540 7307 8359 gene locus_tag LOCUS_07550 7307 8359 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023609967.1 protein_id gnl|my_center|LOCUS_07550 8787 9638 gene locus_tag LOCUS_07560 8787 9638 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131348.1 protein_id gnl|my_center|LOCUS_07560 9635 10444 gene locus_tag LOCUS_07570 9635 10444 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015426159.1 protein_id gnl|my_center|LOCUS_07570 10441 10887 gene locus_tag LOCUS_07580 10441 10887 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131351.1 protein_id gnl|my_center|LOCUS_07580 10899 12563 gene locus_tag LOCUS_07590 gene recN 10899 12563 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131352.1 protein_id gnl|my_center|LOCUS_07590 12571 13530 gene locus_tag LOCUS_07600 12571 13530 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131355.1 protein_id gnl|my_center|LOCUS_07600 13588 14805 gene locus_tag LOCUS_07610 gene murN 13588 14805 CDS product peptidoglycan bridge formation alanyltransferase MurN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229509.1 protein_id gnl|my_center|LOCUS_07610 14805 15851 gene locus_tag LOCUS_07620 14805 15851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 16014 17027 gene locus_tag LOCUS_07630 16014 17027 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129446.1 protein_id gnl|my_center|LOCUS_07630 17088 17642 gene locus_tag LOCUS_07640 17088 17642 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129445.1 protein_id gnl|my_center|LOCUS_07640 17648 19984 gene locus_tag LOCUS_07650 17648 19984 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129443.1 protein_id gnl|my_center|LOCUS_07650 20071 20385 gene locus_tag LOCUS_07660 gene trxA 20071 20385 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129442.1 protein_id gnl|my_center|LOCUS_07660 20533 21582 gene locus_tag LOCUS_07670 20533 21582 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129622.1 protein_id gnl|my_center|LOCUS_07670 21738 22295 gene locus_tag LOCUS_07680 gene efp 21738 22295 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129623.1 protein_id gnl|my_center|LOCUS_07680 22383 22784 gene locus_tag LOCUS_07690 22383 22784 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021722362.1 protein_id gnl|my_center|LOCUS_07690 22777 23751 gene locus_tag LOCUS_07700 gene nusB 22777 23751 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129881492.1 protein_id gnl|my_center|LOCUS_07700 >Feature sequence027 810 1103 gene locus_tag LOCUS_07710 810 1103 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129881512.1 protein_id gnl|my_center|LOCUS_07710 1107 1412 gene locus_tag LOCUS_07720 1107 1412 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905560.1 protein_id gnl|my_center|LOCUS_07720 1415 3868 gene locus_tag LOCUS_07730 1415 3868 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948003.1 protein_id gnl|my_center|LOCUS_07730 3908 4174 gene locus_tag LOCUS_07740 3908 4174 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132530.1 protein_id gnl|my_center|LOCUS_07740 4507 6000 gene locus_tag LOCUS_07750 4507 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 6551 7228 gene locus_tag LOCUS_07760 6551 7228 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263187.1 protein_id gnl|my_center|LOCUS_07760 7221 7385 gene locus_tag LOCUS_07770 7221 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298811.1 protein_id gnl|my_center|LOCUS_07770 7532 7696 gene locus_tag LOCUS_07780 7532 7696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 7874 10444 gene locus_tag LOCUS_07790 7874 10444 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261981.1 protein_id gnl|my_center|LOCUS_07790 10672 11250 gene locus_tag LOCUS_07800 10672 11250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 11304 11438 gene locus_tag LOCUS_07810 11304 11438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 11505 12086 gene locus_tag LOCUS_07820 11505 12086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 14124 15143 gene locus_tag LOCUS_07830 14124 15143 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 protein_id gnl|my_center|LOCUS_07830 15379 15774 gene locus_tag LOCUS_07840 gene lspA 15379 15774 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130994.1 protein_id gnl|my_center|LOCUS_07840 15775 16680 gene locus_tag LOCUS_07850 15775 16680 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130995.1 protein_id gnl|my_center|LOCUS_07850 16774 17682 gene locus_tag LOCUS_07860 gene murB 16774 17682 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905790.1 protein_id gnl|my_center|LOCUS_07860 17693 18595 gene locus_tag LOCUS_07870 17693 18595 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633102.1 protein_id gnl|my_center|LOCUS_07870 19659 20930 gene locus_tag LOCUS_07880 19659 20930 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132123.1 protein_id gnl|my_center|LOCUS_07880 20927 21721 gene locus_tag LOCUS_07890 20927 21721 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132125.1 protein_id gnl|my_center|LOCUS_07890 21721 22521 gene locus_tag LOCUS_07900 21721 22521 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905791.1 protein_id gnl|my_center|LOCUS_07900 22537 23604 gene locus_tag LOCUS_07910 22537 23604 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905792.1 protein_id gnl|my_center|LOCUS_07910 >Feature sequence028 456 274 gene locus_tag LOCUS_07920 456 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 597 804 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1543 1397 gene locus_tag LOCUS_07930 1543 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 3528 1705 gene locus_tag LOCUS_07940 gene lepA 3528 1705 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132048.1 protein_id gnl|my_center|LOCUS_07940 3824 3612 gene locus_tag LOCUS_07950 3824 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 5156 4365 gene locus_tag LOCUS_07960 5156 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 5402 5166 gene locus_tag LOCUS_07970 5402 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 5664 5392 gene locus_tag LOCUS_07980 5664 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 6073 5654 gene locus_tag LOCUS_07990 6073 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 7393 6080 gene locus_tag LOCUS_08000 7393 6080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 8522 7395 gene locus_tag LOCUS_08010 8522 7395 CDS product siphovirus ReqiPepy6 Gp37-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714199.1 protein_id gnl|my_center|LOCUS_08010 9426 8527 gene locus_tag LOCUS_08020 9426 8527 CDS product phage tail family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714198.1 protein_id gnl|my_center|LOCUS_08020 11827 9440 gene locus_tag LOCUS_08030 11827 9440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922453.1 protein_id gnl|my_center|LOCUS_08030 12195 11827 gene locus_tag LOCUS_08040 12195 11827 CDS product DUF5361 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916438.1 protein_id gnl|my_center|LOCUS_08040 12482 12207 gene locus_tag LOCUS_08050 12482 12207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 13105 12491 gene locus_tag LOCUS_08060 13105 12491 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226354.1 protein_id gnl|my_center|LOCUS_08060 13454 13119 gene locus_tag LOCUS_08070 13454 13119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573598.1 protein_id gnl|my_center|LOCUS_08070 13691 13455 gene locus_tag LOCUS_08080 13691 13455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922457.1 protein_id gnl|my_center|LOCUS_08080 14022 13684 gene locus_tag LOCUS_08090 14022 13684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093651380.1 protein_id gnl|my_center|LOCUS_08090 14407 14009 gene locus_tag LOCUS_08100 14407 14009 CDS product phage Gp19/Gp15/Gp42 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922459.1 protein_id gnl|my_center|LOCUS_08100 14711 14412 gene locus_tag LOCUS_08110 14711 14412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 15319 14711 gene locus_tag LOCUS_08120 15319 14711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 15831 15319 gene locus_tag LOCUS_08130 15831 15319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 16068 15832 gene locus_tag LOCUS_08140 16068 15832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 17026 16136 gene locus_tag LOCUS_08150 17026 16136 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922461.1 protein_id gnl|my_center|LOCUS_08150 17512 17030 gene locus_tag LOCUS_08160 17512 17030 CDS product DUF4355 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922462.1 protein_id gnl|my_center|LOCUS_08160 18992 17583 gene locus_tag LOCUS_08170 18992 17583 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011285619.1 protein_id gnl|my_center|LOCUS_08170 19306 19085 gene locus_tag LOCUS_08180 19306 19085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 20313 19303 gene locus_tag LOCUS_08190 20313 19303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 21607 20315 gene locus_tag LOCUS_08200 21607 20315 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108668.1 protein_id gnl|my_center|LOCUS_08200 21672 21977 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22416 22084 gene locus_tag LOCUS_08210 22416 22084 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922469.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence029 937 698 gene locus_tag LOCUS_08220 937 698 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131476.1 protein_id gnl|my_center|LOCUS_08220 1078 1428 gene locus_tag LOCUS_08230 1078 1428 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132532.1 protein_id gnl|my_center|LOCUS_08230 2317 1457 gene locus_tag LOCUS_08240 2317 1457 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021722957.1 protein_id gnl|my_center|LOCUS_08240 2547 4535 gene locus_tag LOCUS_08250 gene metG 2547 4535 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905562.1 protein_id gnl|my_center|LOCUS_08250 4803 5183 gene locus_tag LOCUS_08260 4803 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 5180 6439 gene locus_tag LOCUS_08270 5180 6439 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930426.1 protein_id gnl|my_center|LOCUS_08270 6617 6877 gene locus_tag LOCUS_08280 6617 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 8125 7280 gene locus_tag LOCUS_08290 8125 7280 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905089.1 protein_id gnl|my_center|LOCUS_08290 8247 8486 gene locus_tag LOCUS_08300 8247 8486 CDS product DUF2829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141918.1 protein_id gnl|my_center|LOCUS_08300 8479 9198 gene locus_tag LOCUS_08310 8479 9198 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132542.1 protein_id gnl|my_center|LOCUS_08310 9640 10149 gene locus_tag LOCUS_08320 9640 10149 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058204173.1 protein_id gnl|my_center|LOCUS_08320 10970 10185 gene locus_tag LOCUS_08330 10970 10185 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129459.1 protein_id gnl|my_center|LOCUS_08330 11499 11158 gene locus_tag LOCUS_08340 11499 11158 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263275.1 protein_id gnl|my_center|LOCUS_08340 11678 12103 gene locus_tag LOCUS_08350 11678 12103 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131384.1 protein_id gnl|my_center|LOCUS_08350 12476 14785 gene locus_tag LOCUS_08360 12476 14785 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129457.1 protein_id gnl|my_center|LOCUS_08360 14782 15783 gene locus_tag LOCUS_08370 gene holA 14782 15783 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129455.1 protein_id gnl|my_center|LOCUS_08370 15896 16285 gene locus_tag LOCUS_08380 gene gpsB 15896 16285 CDS product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129453.1 protein_id gnl|my_center|LOCUS_08380 16744 17925 gene locus_tag LOCUS_08390 16744 17925 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906078.1 protein_id gnl|my_center|LOCUS_08390 17922 19679 gene locus_tag LOCUS_08400 17922 19679 CDS product cell division site-positioning protein MapZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906077.1 protein_id gnl|my_center|LOCUS_08400 19859 20113 gene locus_tag LOCUS_08410 19859 20113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 20136 20525 gene locus_tag LOCUS_08420 20136 20525 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462027.1 protein_id gnl|my_center|LOCUS_08420 21685 20600 gene locus_tag LOCUS_08430 21685 20600 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906076.1 protein_id gnl|my_center|LOCUS_08430 >Feature sequence030 452 700 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1568 1765 gene locus_tag LOCUS_08440 1568 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 2173 2439 gene locus_tag LOCUS_08450 2173 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 2576 3304 gene locus_tag LOCUS_08460 gene rlmB 2576 3304 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132395.1 protein_id gnl|my_center|LOCUS_08460 3315 4190 gene locus_tag LOCUS_08470 3315 4190 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906175.1 protein_id gnl|my_center|LOCUS_08470 4311 5675 gene locus_tag LOCUS_08480 gene ftsA 4311 5675 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132393.1 protein_id gnl|my_center|LOCUS_08480 5703 6977 gene locus_tag LOCUS_08490 gene ftsZ 5703 6977 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132392.1 protein_id gnl|my_center|LOCUS_08490 6977 7648 gene locus_tag LOCUS_08500 6977 7648 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132391.1 protein_id gnl|my_center|LOCUS_08500 7688 8266 gene locus_tag LOCUS_08510 7688 8266 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132390.1 protein_id gnl|my_center|LOCUS_08510 8273 8518 gene locus_tag LOCUS_08520 8273 8518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 8515 9312 gene locus_tag LOCUS_08530 8515 9312 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906173.1 protein_id gnl|my_center|LOCUS_08530 9339 10166 gene locus_tag LOCUS_08540 9339 10166 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132384.1 protein_id gnl|my_center|LOCUS_08540 10507 13293 gene locus_tag LOCUS_08550 gene ileS 10507 13293 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906172.1 protein_id gnl|my_center|LOCUS_08550 13727 13545 gene locus_tag LOCUS_08560 13727 13545 CDS product SPJ_0845 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132378.1 protein_id gnl|my_center|LOCUS_08560 13910 15097 gene locus_tag LOCUS_08570 gene tuf 13910 15097 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132374.1 protein_id gnl|my_center|LOCUS_08570 15770 15426 gene locus_tag LOCUS_08580 15770 15426 CDS product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132372.1 protein_id gnl|my_center|LOCUS_08580 16834 15773 gene locus_tag LOCUS_08590 16834 15773 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906171.1 protein_id gnl|my_center|LOCUS_08590 17365 18048 gene locus_tag LOCUS_08600 17365 18048 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129540.1 protein_id gnl|my_center|LOCUS_08600 18593 18213 gene locus_tag LOCUS_08610 18593 18213 CDS product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130895.1 protein_id gnl|my_center|LOCUS_08610 19796 18699 gene locus_tag LOCUS_08620 19796 18699 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130896.1 protein_id gnl|my_center|LOCUS_08620 20622 19819 gene locus_tag LOCUS_08630 20622 19819 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130897.1 protein_id gnl|my_center|LOCUS_08630 21642 20653 gene locus_tag LOCUS_08640 21642 20653 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130898.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence031 734 246 gene locus_tag LOCUS_08650 734 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132169.1 protein_id gnl|my_center|LOCUS_08650 1205 738 gene locus_tag LOCUS_08660 gene tadA 1205 738 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129664.1 protein_id gnl|my_center|LOCUS_08660 1951 1202 gene locus_tag LOCUS_08670 1951 1202 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129661.1 protein_id gnl|my_center|LOCUS_08670 2628 1948 gene locus_tag LOCUS_08680 2628 1948 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129657.1 protein_id gnl|my_center|LOCUS_08680 3284 2907 gene locus_tag LOCUS_08690 3284 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 5778 3793 gene locus_tag LOCUS_08700 5778 3793 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129655.1 protein_id gnl|my_center|LOCUS_08700 6503 5865 gene locus_tag LOCUS_08710 6503 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 8322 6604 gene locus_tag LOCUS_08720 gene cydC 8322 6604 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905523.1 protein_id gnl|my_center|LOCUS_08720 10060 8345 gene locus_tag LOCUS_08730 gene cydD 10060 8345 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905522.1 protein_id gnl|my_center|LOCUS_08730 11274 10279 gene locus_tag LOCUS_08740 gene cydB 11274 10279 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905521.1 protein_id gnl|my_center|LOCUS_08740 12712 11276 gene locus_tag LOCUS_08750 12712 11276 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905520.1 protein_id gnl|my_center|LOCUS_08750 15200 13383 gene locus_tag LOCUS_08760 15200 13383 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905518.1 protein_id gnl|my_center|LOCUS_08760 17719 15311 gene locus_tag LOCUS_08770 17719 15311 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905517.1 protein_id gnl|my_center|LOCUS_08770 18877 17801 gene locus_tag LOCUS_08780 18877 17801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08780 19240 18995 gene locus_tag LOCUS_08790 19240 18995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08790 20439 19294 gene locus_tag LOCUS_08800 gene glgD 20439 19294 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905516.1 protein_id gnl|my_center|LOCUS_08800 21571 20429 gene locus_tag LOCUS_08810 21571 20429 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129630.1 protein_id gnl|my_center|LOCUS_08810 >Feature sequence032 137 838 gene locus_tag LOCUS_08820 137 838 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905758.1 protein_id gnl|my_center|LOCUS_08820 843 3500 gene locus_tag LOCUS_08830 843 3500 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905759.1 protein_id gnl|my_center|LOCUS_08830 4424 3645 gene locus_tag LOCUS_08840 4424 3645 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905760.1 protein_id gnl|my_center|LOCUS_08840 5773 4424 gene locus_tag LOCUS_08850 5773 4424 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132046.1 protein_id gnl|my_center|LOCUS_08850 6036 6737 gene locus_tag LOCUS_08860 6036 6737 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189145.1 protein_id gnl|my_center|LOCUS_08860 6759 7439 gene locus_tag LOCUS_08870 6759 7439 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132047.1 protein_id gnl|my_center|LOCUS_08870 7783 7890 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7981 12279 gene locus_tag LOCUS_08880 gene cas9 7981 12279 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040087.1 protein_id gnl|my_center|LOCUS_08880 12522 13412 gene locus_tag LOCUS_08890 gene cas1 12522 13412 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929489.1 protein_id gnl|my_center|LOCUS_08890 13409 13738 gene locus_tag LOCUS_08900 gene cas2 13409 13738 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122196.1 protein_id gnl|my_center|LOCUS_08900 13743 14423 gene locus_tag LOCUS_08910 gene csn2 13743 14423 CDS product type II-A CRISPR-associated protein Csn2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590705.1 protein_id gnl|my_center|LOCUS_08910 14516 14947 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttagagtcgtgttaaattgaatggttctcaaac 15305 15619 gene locus_tag LOCUS_08920 15305 15619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 15648 15995 gene locus_tag LOCUS_08930 15648 15995 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420747.1 protein_id gnl|my_center|LOCUS_08930 15988 17241 gene locus_tag LOCUS_08940 15988 17241 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721483.1 protein_id gnl|my_center|LOCUS_08940 17263 18717 gene locus_tag LOCUS_08950 17263 18717 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930652.1 protein_id gnl|my_center|LOCUS_08950 18787 20637 gene locus_tag LOCUS_08960 18787 20637 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989614.1 protein_id gnl|my_center|LOCUS_08960 >Feature sequence033 1331 168 gene locus_tag LOCUS_08970 gene recA 1331 168 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131629.1 protein_id gnl|my_center|LOCUS_08970 2269 1433 gene locus_tag LOCUS_08980 gene mutM 2269 1433 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905298.1 protein_id gnl|my_center|LOCUS_08980 3167 2433 gene locus_tag LOCUS_08990 3167 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 3591 3752 gene locus_tag LOCUS_09000 3591 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 3721 4518 gene locus_tag LOCUS_09010 3721 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 4521 5819 gene locus_tag LOCUS_09020 gene celB 4521 5819 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 protein_id gnl|my_center|LOCUS_09020 7235 6324 gene locus_tag LOCUS_09030 gene era 7235 6324 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131632.1 protein_id gnl|my_center|LOCUS_09030 7132 7446 gene locus_tag LOCUS_09040 7132 7446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 11221 8264 gene locus_tag LOCUS_09050 11221 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 12258 11269 gene locus_tag LOCUS_09060 12258 11269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 13377 12361 gene locus_tag LOCUS_09070 13377 12361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 14632 13364 gene locus_tag LOCUS_09080 14632 13364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 16288 15437 gene locus_tag LOCUS_09090 16288 15437 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900455.1 protein_id gnl|my_center|LOCUS_09090 17616 17050 gene locus_tag LOCUS_09100 17616 17050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09100 18113 17664 gene locus_tag LOCUS_09110 18113 17664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09110 19270 18260 gene locus_tag LOCUS_09120 19270 18260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 20379 19309 gene locus_tag LOCUS_09130 20379 19309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 21105 20617 gene locus_tag LOCUS_09140 21105 20617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 >Feature sequence034 2479 440 gene locus_tag LOCUS_09150 gene ftsH 2479 440 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132177.1 protein_id gnl|my_center|LOCUS_09150 3130 2576 gene locus_tag LOCUS_09160 gene hpt 3130 2576 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905038.1 protein_id gnl|my_center|LOCUS_09160 4373 3123 gene locus_tag LOCUS_09170 gene tilS 4373 3123 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905037.1 protein_id gnl|my_center|LOCUS_09170 5671 4370 gene locus_tag LOCUS_09180 5671 4370 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905036.1 protein_id gnl|my_center|LOCUS_09180 6139 5858 gene locus_tag LOCUS_09190 6139 5858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132172.1 protein_id gnl|my_center|LOCUS_09190 6507 6136 gene locus_tag LOCUS_09200 6507 6136 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905035.1 protein_id gnl|my_center|LOCUS_09200 6807 6535 gene locus_tag LOCUS_09210 6807 6535 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132170.1 protein_id gnl|my_center|LOCUS_09210 10416 6931 gene locus_tag LOCUS_09220 gene mfd 10416 6931 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905033.1 protein_id gnl|my_center|LOCUS_09220 10985 10413 gene locus_tag LOCUS_09230 gene pth 10985 10413 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905032.1 protein_id gnl|my_center|LOCUS_09230 12210 11095 gene locus_tag LOCUS_09240 gene ychF 12210 11095 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905026.1 protein_id gnl|my_center|LOCUS_09240 12532 12329 gene locus_tag LOCUS_09250 12532 12329 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132155.1 protein_id gnl|my_center|LOCUS_09250 16098 12535 gene locus_tag LOCUS_09260 gene addA 16098 12535 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905024.1 protein_id gnl|my_center|LOCUS_09260 19415 16098 gene locus_tag LOCUS_09270 gene rexB 19415 16098 CDS product ATP-dependent nuclease subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905023.1 protein_id gnl|my_center|LOCUS_09270 <20588 19459 gene locus_tag LOCUS_09280 <20588 19459 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003130856.1:DNA polymerase III subunit beta >Feature sequence035 54 902 gene locus_tag LOCUS_09290 54 902 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255024.1 protein_id gnl|my_center|LOCUS_09290 947 2365 gene locus_tag LOCUS_09300 947 2365 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905167.1 protein_id gnl|my_center|LOCUS_09300 3297 2722 gene locus_tag LOCUS_09310 3297 2722 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288651.1 protein_id gnl|my_center|LOCUS_09310 3525 3328 gene locus_tag LOCUS_09320 3525 3328 CDS product DUF4649 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905091.1 protein_id gnl|my_center|LOCUS_09320 4411 3515 gene locus_tag LOCUS_09330 4411 3515 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355746.1 protein_id gnl|my_center|LOCUS_09330 4780 4613 gene locus_tag LOCUS_09340 4780 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 5027 5286 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5356 6057 gene locus_tag LOCUS_09350 5356 6057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 6072 6551 gene locus_tag LOCUS_09360 6072 6551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 7788 7423 gene locus_tag LOCUS_09370 gene rplL 7788 7423 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130214.1 protein_id gnl|my_center|LOCUS_09370 8382 7867 gene locus_tag LOCUS_09380 gene rplJ 8382 7867 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130213.1 protein_id gnl|my_center|LOCUS_09380 9234 8650 gene locus_tag LOCUS_09390 9234 8650 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185820.1 protein_id gnl|my_center|LOCUS_09390 10351 9659 gene locus_tag LOCUS_09400 10351 9659 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485259.1 protein_id gnl|my_center|LOCUS_09400 11477 10488 gene locus_tag LOCUS_09410 gene guaC 11477 10488 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905784.1 protein_id gnl|my_center|LOCUS_09410 12284 11649 gene locus_tag LOCUS_09420 12284 11649 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850639.1 protein_id gnl|my_center|LOCUS_09420 13056 12286 gene locus_tag LOCUS_09430 13056 12286 CDS product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905782.1 protein_id gnl|my_center|LOCUS_09430 13815 13063 gene locus_tag LOCUS_09440 13815 13063 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263557.1 protein_id gnl|my_center|LOCUS_09440 14375 13932 gene locus_tag LOCUS_09450 14375 13932 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721810.1 protein_id gnl|my_center|LOCUS_09450 14712 14377 gene locus_tag LOCUS_09460 14712 14377 CDS product arsenic metallochaperone ArsD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130254.1 protein_id gnl|my_center|LOCUS_09460 16569 14920 gene locus_tag LOCUS_09470 16569 14920 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132529.1 protein_id gnl|my_center|LOCUS_09470 17082 16945 gene locus_tag LOCUS_09480 17082 16945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 17291 17085 gene locus_tag LOCUS_09490 17291 17085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905174.1 protein_id gnl|my_center|LOCUS_09490 18792 17311 gene locus_tag LOCUS_09500 18792 17311 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905173.1 protein_id gnl|my_center|LOCUS_09500 19936 18839 gene locus_tag LOCUS_09510 19936 18839 CDS product DUF871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905172.1 protein_id gnl|my_center|LOCUS_09510 20290 19967 gene locus_tag LOCUS_09520 20290 19967 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131553.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence036 <1 774 gene locus_tag LOCUS_09530 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001092618.1:aminomethyltransferase family protein 774 2981 gene locus_tag LOCUS_09540 774 2981 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118223.1 protein_id gnl|my_center|LOCUS_09540 2992 4182 gene locus_tag LOCUS_09550 gene cylJ 2992 4182 CDS product glycosyltransferase CylJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033002.1 protein_id gnl|my_center|LOCUS_09550 4175 4747 gene locus_tag LOCUS_09560 4175 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 4772 5107 gene locus_tag LOCUS_09570 4772 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 6109 7737 gene locus_tag LOCUS_09580 6109 7737 CDS product transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837538.1 protein_id gnl|my_center|LOCUS_09580 7841 8932 gene locus_tag LOCUS_09590 gene ulaG 7841 8932 CDS product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902226.1 protein_id gnl|my_center|LOCUS_09590 8950 10455 gene locus_tag LOCUS_09600 8950 10455 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899076.1 protein_id gnl|my_center|LOCUS_09600 10449 10727 gene locus_tag LOCUS_09610 10449 10727 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009910950.1 protein_id gnl|my_center|LOCUS_09610 10765 11256 gene locus_tag LOCUS_09620 10765 11256 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262725.1 protein_id gnl|my_center|LOCUS_09620 11321 11986 gene locus_tag LOCUS_09630 11321 11986 CDS product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837547.1 protein_id gnl|my_center|LOCUS_09630 11989 12852 gene locus_tag LOCUS_09640 11989 12852 CDS product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027939.1 protein_id gnl|my_center|LOCUS_09640 12853 13551 gene locus_tag LOCUS_09650 12853 13551 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837546.1 protein_id gnl|my_center|LOCUS_09650 13572 14282 gene locus_tag LOCUS_09660 13572 14282 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922674.1 protein_id gnl|my_center|LOCUS_09660 14410 16437 gene locus_tag LOCUS_09670 14410 16437 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905590.1 protein_id gnl|my_center|LOCUS_09670 16599 17438 gene locus_tag LOCUS_09680 16599 17438 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963823.1 protein_id gnl|my_center|LOCUS_09680 17649 18221 gene locus_tag LOCUS_09690 17649 18221 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286813.1 protein_id gnl|my_center|LOCUS_09690 18241 18600 gene locus_tag LOCUS_09700 18241 18600 CDS product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905743.1 protein_id gnl|my_center|LOCUS_09700 18602 19960 gene locus_tag LOCUS_09710 18602 19960 CDS product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286818.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence037 2190 208 gene locus_tag LOCUS_09720 2190 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650743.1 protein_id gnl|my_center|LOCUS_09720 3067 2180 gene locus_tag LOCUS_09730 3067 2180 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462408.1 protein_id gnl|my_center|LOCUS_09730 3977 3069 gene locus_tag LOCUS_09740 3977 3069 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403526.1 protein_id gnl|my_center|LOCUS_09740 4459 3974 gene locus_tag LOCUS_09750 gene fabZ 4459 3974 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164166.1 protein_id gnl|my_center|LOCUS_09750 4755 4456 gene locus_tag LOCUS_09760 4755 4456 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611493.1 protein_id gnl|my_center|LOCUS_09760 5470 4748 gene locus_tag LOCUS_09770 gene fabG 5470 4748 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861303.1 protein_id gnl|my_center|LOCUS_09770 6317 5484 gene locus_tag LOCUS_09780 6317 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859501.1 protein_id gnl|my_center|LOCUS_09780 6508 6794 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9201 7153 gene locus_tag LOCUS_09790 9201 7153 CDS product DUF262 and DUF1524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094324403.1 protein_id gnl|my_center|LOCUS_09790 11256 9589 gene locus_tag LOCUS_09800 gene alsS 11256 9589 CDS product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905806.1 protein_id gnl|my_center|LOCUS_09800 12698 11457 gene locus_tag LOCUS_09810 12698 11457 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905805.1 protein_id gnl|my_center|LOCUS_09810 13879 12698 gene locus_tag LOCUS_09820 13879 12698 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130134.1 protein_id gnl|my_center|LOCUS_09820 14220 14483 gene locus_tag LOCUS_09830 14220 14483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 14580 15215 gene locus_tag LOCUS_09840 14580 15215 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262444.1 protein_id gnl|my_center|LOCUS_09840 16926 15466 gene locus_tag LOCUS_09850 16926 15466 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931832.1 protein_id gnl|my_center|LOCUS_09850 18801 16942 gene locus_tag LOCUS_09860 gene bglP 18801 16942 CDS product PTS beta-glucoside transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242943.1 protein_id gnl|my_center|LOCUS_09860 19779 18934 gene locus_tag LOCUS_09870 19779 18934 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219862.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence038 140 1522 gene locus_tag LOCUS_09880 140 1522 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065247.1 protein_id gnl|my_center|LOCUS_09880 1913 2821 gene locus_tag LOCUS_09890 1913 2821 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906107.1 protein_id gnl|my_center|LOCUS_09890 3070 5694 gene locus_tag LOCUS_09900 gene alaS 3070 5694 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130876.1 protein_id gnl|my_center|LOCUS_09900 5946 6743 gene locus_tag LOCUS_09910 5946 6743 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905323.1 protein_id gnl|my_center|LOCUS_09910 7427 8860 gene locus_tag LOCUS_09920 7427 8860 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906086.1 protein_id gnl|my_center|LOCUS_09920 9039 9506 gene locus_tag LOCUS_09930 gene smpB 9039 9506 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130878.1 protein_id gnl|my_center|LOCUS_09930 9759 10646 gene locus_tag LOCUS_09940 9759 10646 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130880.1 protein_id gnl|my_center|LOCUS_09940 10846 11679 gene locus_tag LOCUS_09950 10846 11679 CDS product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130881.1 protein_id gnl|my_center|LOCUS_09950 11695 12618 gene locus_tag LOCUS_09960 gene pstC 11695 12618 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130883.1 protein_id gnl|my_center|LOCUS_09960 12618 13505 gene locus_tag LOCUS_09970 gene pstA 12618 13505 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130884.1 protein_id gnl|my_center|LOCUS_09970 13524 14327 gene locus_tag LOCUS_09980 gene pstB 13524 14327 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130885.1 protein_id gnl|my_center|LOCUS_09980 14341 15102 gene locus_tag LOCUS_09990 gene pstB 14341 15102 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906105.1 protein_id gnl|my_center|LOCUS_09990 15158 15811 gene locus_tag LOCUS_10000 gene phoU 15158 15811 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130887.1 protein_id gnl|my_center|LOCUS_10000 17243 15972 gene locus_tag LOCUS_10010 gene serS 17243 15972 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130891.1 protein_id gnl|my_center|LOCUS_10010 19294 18329 gene locus_tag LOCUS_10020 19294 18329 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132369.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence039 1207 1428 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2144 2438 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2486 3130 gene locus_tag LOCUS_10030 2486 3130 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291166.1 protein_id gnl|my_center|LOCUS_10030 3245 3694 gene locus_tag LOCUS_10040 3245 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288545.1 protein_id gnl|my_center|LOCUS_10040 3852 4100 gene locus_tag LOCUS_10050 3852 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10050 4491 5852 gene locus_tag LOCUS_10060 4491 5852 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002328947.1 protein_id gnl|my_center|LOCUS_10060 6067 6678 gene locus_tag LOCUS_10070 gene rpsD 6067 6678 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255752.1 protein_id gnl|my_center|LOCUS_10070 7056 7265 gene locus_tag LOCUS_10080 7056 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 7691 7870 gene locus_tag LOCUS_10090 7691 7870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 8066 9007 gene locus_tag LOCUS_10100 8066 9007 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002397331.1 protein_id gnl|my_center|LOCUS_10100 9024 10073 gene locus_tag LOCUS_10110 9024 10073 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355369.1 protein_id gnl|my_center|LOCUS_10110 11280 10579 gene locus_tag LOCUS_10120 11280 10579 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002325086.1 protein_id gnl|my_center|LOCUS_10120 11501 12346 gene locus_tag LOCUS_10130 11501 12346 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377923.1 protein_id gnl|my_center|LOCUS_10130 12339 13175 gene locus_tag LOCUS_10140 12339 13175 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196782459.1 protein_id gnl|my_center|LOCUS_10140 13214 13693 gene locus_tag LOCUS_10150 13214 13693 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355337.1 protein_id gnl|my_center|LOCUS_10150 13709 14557 gene locus_tag LOCUS_10160 13709 14557 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387686.1 protein_id gnl|my_center|LOCUS_10160 14570 15472 gene locus_tag LOCUS_10170 gene murQ 14570 15472 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355340.1 protein_id gnl|my_center|LOCUS_10170 15483 16418 gene locus_tag LOCUS_10180 15483 16418 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387687.1 protein_id gnl|my_center|LOCUS_10180 16706 18838 gene locus_tag LOCUS_10190 16706 18838 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905263.1 protein_id gnl|my_center|LOCUS_10190 18828 19283 gene locus_tag LOCUS_10200 18828 19283 CDS product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905264.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence040 1324 107 gene locus_tag LOCUS_10210 1324 107 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254593.1 protein_id gnl|my_center|LOCUS_10210 2321 1386 gene locus_tag LOCUS_10220 2321 1386 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254589.1 protein_id gnl|my_center|LOCUS_10220 2594 2364 gene locus_tag LOCUS_10230 2594 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 4579 2669 gene locus_tag LOCUS_10240 gene typA 4579 2669 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025016832.1 protein_id gnl|my_center|LOCUS_10240 4798 5010 gene locus_tag LOCUS_10250 4798 5010 CDS product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906270.1 protein_id gnl|my_center|LOCUS_10250 5003 5971 gene locus_tag LOCUS_10260 5003 5971 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254542.1 protein_id gnl|my_center|LOCUS_10260 5988 6368 gene locus_tag LOCUS_10270 5988 6368 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906271.1 protein_id gnl|my_center|LOCUS_10270 6848 6402 gene locus_tag LOCUS_10280 6848 6402 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254538.1 protein_id gnl|my_center|LOCUS_10280 9111 8014 gene locus_tag LOCUS_10290 gene dinB 9111 8014 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906272.1 protein_id gnl|my_center|LOCUS_10290 10024 9416 gene locus_tag LOCUS_10300 10024 9416 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387688.1 protein_id gnl|my_center|LOCUS_10300 11133 10078 gene locus_tag LOCUS_10310 gene fni 11133 10078 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905320.1 protein_id gnl|my_center|LOCUS_10310 12067 11126 gene locus_tag LOCUS_10320 12067 11126 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131562.1 protein_id gnl|my_center|LOCUS_10320 13001 12054 gene locus_tag LOCUS_10330 gene mvaD 13001 12054 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905319.1 protein_id gnl|my_center|LOCUS_10330 13683 13267 gene locus_tag LOCUS_10340 13683 13267 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131384.1 protein_id gnl|my_center|LOCUS_10340 14836 13904 gene locus_tag LOCUS_10350 gene mvk 14836 13904 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131564.1 protein_id gnl|my_center|LOCUS_10350 14997 15176 gene locus_tag LOCUS_10360 14997 15176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131566.1 protein_id gnl|my_center|LOCUS_10360 16155 15289 gene locus_tag LOCUS_10370 gene rsmI 16155 15289 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905318.1 protein_id gnl|my_center|LOCUS_10370 16481 16152 gene locus_tag LOCUS_10380 gene yabA 16481 16152 CDS product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905317.1 protein_id gnl|my_center|LOCUS_10380 17291 16518 gene locus_tag LOCUS_10390 17291 16518 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905316.1 protein_id gnl|my_center|LOCUS_10390 18167 17304 gene locus_tag LOCUS_10400 18167 17304 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131573.1 protein_id gnl|my_center|LOCUS_10400 18823 18194 gene locus_tag LOCUS_10410 gene tmk 18823 18194 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131575.1 protein_id gnl|my_center|LOCUS_10410 >Feature sequence041 844 1293 gene locus_tag LOCUS_10420 844 1293 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296478.1 protein_id gnl|my_center|LOCUS_10420 1638 2321 gene locus_tag LOCUS_10430 1638 2321 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379250.1 protein_id gnl|my_center|LOCUS_10430 2658 3281 gene locus_tag LOCUS_10440 gene gmk 2658 3281 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131468.1 protein_id gnl|my_center|LOCUS_10440 3368 3727 gene locus_tag LOCUS_10450 gene rpoZ 3368 3727 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906189.1 protein_id gnl|my_center|LOCUS_10450 3872 6199 gene locus_tag LOCUS_10460 3872 6199 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131470.1 protein_id gnl|my_center|LOCUS_10460 6460 7116 gene locus_tag LOCUS_10470 6460 7116 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905398.1 protein_id gnl|my_center|LOCUS_10470 7389 8342 gene locus_tag LOCUS_10480 gene fmt 7389 8342 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906187.1 protein_id gnl|my_center|LOCUS_10480 8332 9603 gene locus_tag LOCUS_10490 gene rsmB 8332 9603 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906185.1 protein_id gnl|my_center|LOCUS_10490 9624 10397 gene locus_tag LOCUS_10500 9624 10397 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130802.1 protein_id gnl|my_center|LOCUS_10500 10397 12301 gene locus_tag LOCUS_10510 gene pknB 10397 12301 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130801.1 protein_id gnl|my_center|LOCUS_10510 12727 12458 gene locus_tag LOCUS_10520 gene rpsO 12727 12458 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906184.1 protein_id gnl|my_center|LOCUS_10520 13793 13002 gene locus_tag LOCUS_10530 gene proC 13793 13002 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906183.1 protein_id gnl|my_center|LOCUS_10530 13940 15316 gene locus_tag LOCUS_10540 gene glmU 13940 15316 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130798.1 protein_id gnl|my_center|LOCUS_10540 15349 15933 gene locus_tag LOCUS_10550 15349 15933 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906182.1 protein_id gnl|my_center|LOCUS_10550 15926 16204 gene locus_tag LOCUS_10560 gene macP 15926 16204 CDS product cell wall synthase accessory phosphoprotein MacP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130796.1 protein_id gnl|my_center|LOCUS_10560 16315 16995 gene locus_tag LOCUS_10570 16315 16995 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130794.1 protein_id gnl|my_center|LOCUS_10570 17072 18382 gene locus_tag LOCUS_10580 gene pepC 17072 18382 CDS product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906180.1 protein_id gnl|my_center|LOCUS_10580 >Feature sequence042 1466 111 gene locus_tag LOCUS_10590 gene rlmD 1466 111 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379844.1 protein_id gnl|my_center|LOCUS_10590 2342 1572 gene locus_tag LOCUS_10600 2342 1572 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905742.1 protein_id gnl|my_center|LOCUS_10600 3016 2339 gene locus_tag LOCUS_10610 3016 2339 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130628.1 protein_id gnl|my_center|LOCUS_10610 3677 3009 gene locus_tag LOCUS_10620 gene nth 3677 3009 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130627.1 protein_id gnl|my_center|LOCUS_10620 4326 3655 gene locus_tag LOCUS_10630 4326 3655 CDS product DnaD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905741.1 protein_id gnl|my_center|LOCUS_10630 4490 5143 gene locus_tag LOCUS_10640 4490 5143 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011835356.1 protein_id gnl|my_center|LOCUS_10640 6046 5363 gene locus_tag LOCUS_10650 gene radC 6046 5363 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131898.1 protein_id gnl|my_center|LOCUS_10650 8143 6326 gene locus_tag LOCUS_10660 gene glmS 8143 6326 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905678.1 protein_id gnl|my_center|LOCUS_10660 8933 8295 gene locus_tag LOCUS_10670 8933 8295 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132114.1 protein_id gnl|my_center|LOCUS_10670 10270 8978 gene locus_tag LOCUS_10680 10270 8978 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132113.1 protein_id gnl|my_center|LOCUS_10680 10757 10260 gene locus_tag LOCUS_10690 10757 10260 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132112.1 protein_id gnl|my_center|LOCUS_10690 11830 10757 gene locus_tag LOCUS_10700 gene folP 11830 10757 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132109.1 protein_id gnl|my_center|LOCUS_10700 12881 11832 gene locus_tag LOCUS_10710 gene folE 12881 11832 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905789.1 protein_id gnl|my_center|LOCUS_10710 13301 12954 gene locus_tag LOCUS_10720 gene folB 13301 12954 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132106.1 protein_id gnl|my_center|LOCUS_10720 13881 13294 gene locus_tag LOCUS_10730 gene yihA 13881 13294 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905788.1 protein_id gnl|my_center|LOCUS_10730 15204 13966 gene locus_tag LOCUS_10740 gene clpX 15204 13966 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905787.1 protein_id gnl|my_center|LOCUS_10740 15921 15406 gene locus_tag LOCUS_10750 15921 15406 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905786.1 protein_id gnl|my_center|LOCUS_10750 16425 16928 gene locus_tag LOCUS_10760 16425 16928 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905785.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence043 171 1454 gene locus_tag LOCUS_10770 gene tig 171 1454 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131738.1 protein_id gnl|my_center|LOCUS_10770 1611 2297 gene locus_tag LOCUS_10780 1611 2297 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132358.1 protein_id gnl|my_center|LOCUS_10780 2664 2858 gene locus_tag LOCUS_10790 2664 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10790 2984 3277 gene locus_tag LOCUS_10800 2984 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10800 3483 3554 gene locus_tag LOCUS_t00160 3483 3554 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3723 4655 gene locus_tag LOCUS_10810 gene rnz 3723 4655 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129545.1 protein_id gnl|my_center|LOCUS_10810 4648 5283 gene locus_tag LOCUS_10820 4648 5283 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905467.1 protein_id gnl|my_center|LOCUS_10820 5322 7556 gene locus_tag LOCUS_10830 gene recJ 5322 7556 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905468.1 protein_id gnl|my_center|LOCUS_10830 7540 8058 gene locus_tag LOCUS_10840 7540 8058 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012897343.1 protein_id gnl|my_center|LOCUS_10840 8216 8776 gene locus_tag LOCUS_10850 gene rpoE 8216 8776 CDS product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129551.1 protein_id gnl|my_center|LOCUS_10850 8882 10984 gene locus_tag LOCUS_10860 8882 10984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 11008 11481 gene locus_tag LOCUS_10870 gene greA 11008 11481 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129554.1 protein_id gnl|my_center|LOCUS_10870 11729 12181 gene locus_tag LOCUS_10880 11729 12181 CDS product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905471.1 protein_id gnl|my_center|LOCUS_10880 12168 14621 gene locus_tag LOCUS_10890 12168 14621 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905472.1 protein_id gnl|my_center|LOCUS_10890 14745 15302 gene locus_tag LOCUS_10900 gene raiA 14745 15302 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129564.1 protein_id gnl|my_center|LOCUS_10900 15547 17880 gene locus_tag LOCUS_10910 gene pflB 15547 17880 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129579.1 protein_id gnl|my_center|LOCUS_10910 >Feature sequence044 328 963 gene locus_tag LOCUS_10920 328 963 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906307.1 protein_id gnl|my_center|LOCUS_10920 1468 4110 gene locus_tag LOCUS_10930 1468 4110 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906358.1 protein_id gnl|my_center|LOCUS_10930 4259 5608 gene locus_tag LOCUS_10940 4259 5608 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906353.1 protein_id gnl|my_center|LOCUS_10940 5682 6239 gene locus_tag LOCUS_10950 gene rsmD 5682 6239 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015427191.1 protein_id gnl|my_center|LOCUS_10950 6229 6726 gene locus_tag LOCUS_10960 gene coaD 6229 6726 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906348.1 protein_id gnl|my_center|LOCUS_10960 6716 7759 gene locus_tag LOCUS_10970 6716 7759 CDS product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906347.1 protein_id gnl|my_center|LOCUS_10970 10621 7922 gene locus_tag LOCUS_10980 gene adhE 10621 7922 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906342.1 protein_id gnl|my_center|LOCUS_10980 11817 10777 gene locus_tag LOCUS_10990 11817 10777 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906341.1 protein_id gnl|my_center|LOCUS_10990 12086 12859 gene locus_tag LOCUS_11000 gene rpsB 12086 12859 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906340.1 protein_id gnl|my_center|LOCUS_11000 12937 13965 gene locus_tag LOCUS_11010 gene tsf 12937 13965 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906339.1 protein_id gnl|my_center|LOCUS_11010 14186 15916 gene locus_tag LOCUS_11020 gene ezrA 14186 15916 CDS product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132670.1 protein_id gnl|my_center|LOCUS_11020 16289 17047 gene locus_tag LOCUS_11030 16289 17047 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705555.1 protein_id gnl|my_center|LOCUS_11030 17136 17330 gene locus_tag LOCUS_11040 17136 17330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 >Feature sequence045 177 986 gene locus_tag LOCUS_11050 177 986 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906335.1 protein_id gnl|my_center|LOCUS_11050 983 1906 gene locus_tag LOCUS_11060 983 1906 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101849.1 protein_id gnl|my_center|LOCUS_11060 2137 2355 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2387 3529 gene locus_tag LOCUS_11070 2387 3529 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905503.1 protein_id gnl|my_center|LOCUS_11070 3869 3627 gene locus_tag LOCUS_11080 3869 3627 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131025.1 protein_id gnl|my_center|LOCUS_11080 4054 4545 gene locus_tag LOCUS_11090 4054 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 5724 4609 gene locus_tag LOCUS_11100 5724 4609 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905635.1 protein_id gnl|my_center|LOCUS_11100 6150 5737 gene locus_tag LOCUS_11110 gene tagD 6150 5737 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905633.1 protein_id gnl|my_center|LOCUS_11110 7327 6380 gene locus_tag LOCUS_11120 7327 6380 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390188.1 protein_id gnl|my_center|LOCUS_11120 8703 7516 gene locus_tag LOCUS_11130 8703 7516 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905634.1 protein_id gnl|my_center|LOCUS_11130 9910 8765 gene locus_tag LOCUS_11140 gene glf 9910 8765 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002376666.1 protein_id gnl|my_center|LOCUS_11140 10928 10005 gene locus_tag LOCUS_11150 10928 10005 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225116.1 protein_id gnl|my_center|LOCUS_11150 11581 11072 gene locus_tag LOCUS_11160 11581 11072 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016229.1 protein_id gnl|my_center|LOCUS_11160 12555 11578 gene locus_tag LOCUS_11170 12555 11578 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544949.1 protein_id gnl|my_center|LOCUS_11170 13343 12558 gene locus_tag LOCUS_11180 gene kdsA 13343 12558 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041482.1 protein_id gnl|my_center|LOCUS_11180 14013 13348 gene locus_tag LOCUS_11190 14013 13348 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465710.1 protein_id gnl|my_center|LOCUS_11190 14722 14060 gene locus_tag LOCUS_11200 gene pseF 14722 14060 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097862.1 protein_id gnl|my_center|LOCUS_11200 15282 14722 gene locus_tag LOCUS_11210 15282 14722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 17133 15484 gene locus_tag LOCUS_11220 17133 15484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 <17798 17137 gene locus_tag LOCUS_11230 <17798 17137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002387129.1:glycosyltransferase >Feature sequence046 596 207 gene locus_tag LOCUS_11240 596 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 2875 761 gene locus_tag LOCUS_11250 2875 761 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701298.1 protein_id gnl|my_center|LOCUS_11250 3604 2879 gene locus_tag LOCUS_11260 3604 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 3947 3558 gene locus_tag LOCUS_11270 3947 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 3948 4202 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4738 4532 gene locus_tag LOCUS_11280 4738 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 4948 4769 gene locus_tag LOCUS_11290 4948 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 8042 5022 gene locus_tag LOCUS_11300 8042 5022 CDS product type 2 lanthipeptide synthetase LanM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370929.1 protein_id gnl|my_center|LOCUS_11300 8600 9100 gene locus_tag LOCUS_11310 8600 9100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 9947 9210 gene locus_tag LOCUS_11320 9947 9210 CDS product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378063.1 protein_id gnl|my_center|LOCUS_11320 11057 9960 gene locus_tag LOCUS_11330 11057 9960 CDS product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706791.1 protein_id gnl|my_center|LOCUS_11330 12168 11059 gene locus_tag LOCUS_11340 12168 11059 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774176.1 protein_id gnl|my_center|LOCUS_11340 12842 12180 gene locus_tag LOCUS_11350 12842 12180 CDS product DUF4310 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361314.1 protein_id gnl|my_center|LOCUS_11350 13635 12859 gene locus_tag LOCUS_11360 13635 12859 CDS product DUF4311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288309.1 protein_id gnl|my_center|LOCUS_11360 13995 13654 gene locus_tag LOCUS_11370 13995 13654 CDS product DUF4312 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288312.1 protein_id gnl|my_center|LOCUS_11370 14354 13998 gene locus_tag LOCUS_11380 14354 13998 CDS product glycine-rich SFCGS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288314.1 protein_id gnl|my_center|LOCUS_11380 14714 14376 gene locus_tag LOCUS_11390 14714 14376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 16531 14711 gene locus_tag LOCUS_11400 16531 14711 CDS product transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706696.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence047 3844 200 gene locus_tag LOCUS_11410 gene rpoC 3844 200 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014570699.1 protein_id gnl|my_center|LOCUS_11410 7718 4131 gene locus_tag LOCUS_11420 gene rpoB 7718 4131 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130544.1 protein_id gnl|my_center|LOCUS_11420 8428 8111 gene locus_tag LOCUS_11430 8428 8111 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130332.1 protein_id gnl|my_center|LOCUS_11430 10305 8422 gene locus_tag LOCUS_11440 gene pepO 10305 8422 CDS product endopeptidase PepO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906145.1 protein_id gnl|my_center|LOCUS_11440 12608 10890 gene locus_tag LOCUS_11450 12608 10890 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906146.1 protein_id gnl|my_center|LOCUS_11450 13303 13034 gene locus_tag LOCUS_11460 13303 13034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 15150 16601 gene locus_tag LOCUS_11470 15150 16601 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130330.1 protein_id gnl|my_center|LOCUS_11470 >Feature sequence048 454 724 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1760 2578 gene locus_tag LOCUS_11480 1760 2578 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 protein_id gnl|my_center|LOCUS_11480 2639 3607 gene locus_tag LOCUS_11490 2639 3607 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836414.1 protein_id gnl|my_center|LOCUS_11490 3805 4605 gene locus_tag LOCUS_11500 3805 4605 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132563.1 protein_id gnl|my_center|LOCUS_11500 4614 5921 gene locus_tag LOCUS_11510 gene ftsY 4614 5921 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905575.1 protein_id gnl|my_center|LOCUS_11510 6188 7159 gene locus_tag LOCUS_11520 6188 7159 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905576.1 protein_id gnl|my_center|LOCUS_11520 7194 7895 gene locus_tag LOCUS_11530 7194 7895 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132570.1 protein_id gnl|my_center|LOCUS_11530 8099 10579 gene locus_tag LOCUS_11540 gene leuS 8099 10579 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132571.1 protein_id gnl|my_center|LOCUS_11540 11080 11877 gene locus_tag LOCUS_11550 11080 11877 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132575.1 protein_id gnl|my_center|LOCUS_11550 12834 11989 gene locus_tag LOCUS_11560 12834 11989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 13656 13303 gene locus_tag LOCUS_11570 13656 13303 CDS product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905743.1 protein_id gnl|my_center|LOCUS_11570 13795 14079 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14190 16172 gene locus_tag LOCUS_11580 14190 16172 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132579.1 protein_id gnl|my_center|LOCUS_11580 16346 17305 gene locus_tag LOCUS_11590 gene menA 16346 17305 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130349.1 protein_id gnl|my_center|LOCUS_11590 >Feature sequence049 147 740 gene locus_tag LOCUS_11600 147 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 2690 912 gene locus_tag LOCUS_11610 gene recQ 2690 912 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906147.1 protein_id gnl|my_center|LOCUS_11610 4066 3044 gene locus_tag LOCUS_11620 4066 3044 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130663.1 protein_id gnl|my_center|LOCUS_11620 4701 4078 gene locus_tag LOCUS_11630 4701 4078 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905752.1 protein_id gnl|my_center|LOCUS_11630 4758 6011 gene locus_tag LOCUS_11640 4758 6011 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905751.1 protein_id gnl|my_center|LOCUS_11640 6257 6658 gene locus_tag LOCUS_11650 6257 6658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 7123 6662 gene locus_tag LOCUS_11660 7123 6662 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130653.1 protein_id gnl|my_center|LOCUS_11660 7595 7107 gene locus_tag LOCUS_11670 gene ybeY 7595 7107 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130652.1 protein_id gnl|my_center|LOCUS_11670 8090 7617 gene locus_tag LOCUS_11680 8090 7617 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130650.1 protein_id gnl|my_center|LOCUS_11680 9051 8083 gene locus_tag LOCUS_11690 9051 8083 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130649.1 protein_id gnl|my_center|LOCUS_11690 10280 9174 gene locus_tag LOCUS_11700 gene ald 10280 9174 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959424.1 protein_id gnl|my_center|LOCUS_11700 10538 10822 gene locus_tag LOCUS_11710 10538 10822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 10892 12064 gene locus_tag LOCUS_11720 10892 12064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 12071 12703 gene locus_tag LOCUS_11730 12071 12703 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906379.1 protein_id gnl|my_center|LOCUS_11730 13087 12803 gene locus_tag LOCUS_11740 gene rpmA 13087 12803 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905747.1 protein_id gnl|my_center|LOCUS_11740 13424 13080 gene locus_tag LOCUS_11750 13424 13080 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130645.1 protein_id gnl|my_center|LOCUS_11750 13742 13428 gene locus_tag LOCUS_11760 gene rplU 13742 13428 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905746.1 protein_id gnl|my_center|LOCUS_11760 14940 14032 gene locus_tag LOCUS_11770 14940 14032 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132796.1 protein_id gnl|my_center|LOCUS_11770 14984 15213 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16408 15242 gene locus_tag LOCUS_11780 16408 15242 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905745.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence050 1701 1315 gene locus_tag LOCUS_11790 1701 1315 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479566.1 protein_id gnl|my_center|LOCUS_11790 2016 2384 gene locus_tag LOCUS_11800 2016 2384 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025016601.1 protein_id gnl|my_center|LOCUS_11800 2384 4054 gene locus_tag LOCUS_11810 2384 4054 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905189.1 protein_id gnl|my_center|LOCUS_11810 4327 4800 gene locus_tag LOCUS_11820 4327 4800 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129762.1 protein_id gnl|my_center|LOCUS_11820 4801 6906 gene locus_tag LOCUS_11830 gene feoB 4801 6906 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905186.1 protein_id gnl|my_center|LOCUS_11830 6893 7063 gene locus_tag LOCUS_11840 6893 7063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129760.1 protein_id gnl|my_center|LOCUS_11840 8055 7153 gene locus_tag LOCUS_11850 8055 7153 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905182.1 protein_id gnl|my_center|LOCUS_11850 9038 8058 gene locus_tag LOCUS_11860 9038 8058 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905181.1 protein_id gnl|my_center|LOCUS_11860 9756 9145 gene locus_tag LOCUS_11870 9756 9145 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905180.1 protein_id gnl|my_center|LOCUS_11870 10964 9834 gene locus_tag LOCUS_11880 10964 9834 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906275.1 protein_id gnl|my_center|LOCUS_11880 11474 10983 gene locus_tag LOCUS_11890 11474 10983 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906273.1 protein_id gnl|my_center|LOCUS_11890 12477 11527 gene locus_tag LOCUS_11900 gene arcC 12477 11527 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906276.1 protein_id gnl|my_center|LOCUS_11900 14036 12573 gene locus_tag LOCUS_11910 14036 12573 CDS product basic amino acid/polyamine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021037906.1 protein_id gnl|my_center|LOCUS_11910 15281 14238 gene locus_tag LOCUS_11920 gene argF 15281 14238 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254507.1 protein_id gnl|my_center|LOCUS_11920 16647 15418 gene locus_tag LOCUS_11930 gene arcA 16647 15418 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254504.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence051 36 2300 gene locus_tag LOCUS_11940 gene gshAB 36 2300 CDS product bifunctional glutamate--cysteine ligase/glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399785.1 protein_id gnl|my_center|LOCUS_11940 2453 2719 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2736 3902 gene locus_tag LOCUS_11950 2736 3902 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905134.1 protein_id gnl|my_center|LOCUS_11950 4520 3990 gene locus_tag LOCUS_11960 4520 3990 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905603.1 protein_id gnl|my_center|LOCUS_11960 4594 4834 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4889 5329 gene locus_tag LOCUS_11970 4889 5329 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166793.1 protein_id gnl|my_center|LOCUS_11970 5422 6051 gene locus_tag LOCUS_11980 5422 6051 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068494.1 protein_id gnl|my_center|LOCUS_11980 6202 8805 gene locus_tag LOCUS_11990 gene clpB 6202 8805 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130040.1 protein_id gnl|my_center|LOCUS_11990 9035 9451 gene locus_tag LOCUS_12000 gene ndk 9035 9451 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438298.1 protein_id gnl|my_center|LOCUS_12000 9567 10784 gene locus_tag LOCUS_12010 9567 10784 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132654.1 protein_id gnl|my_center|LOCUS_12010 12456 10891 gene locus_tag LOCUS_12020 12456 10891 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002326755.1 protein_id gnl|my_center|LOCUS_12020 13219 12524 gene locus_tag LOCUS_12030 13219 12524 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130230.1 protein_id gnl|my_center|LOCUS_12030 13482 13832 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14004 15548 gene locus_tag LOCUS_12040 14004 15548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 15811 16440 gene locus_tag LOCUS_12050 15811 16440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132036.1 protein_id gnl|my_center|LOCUS_12050 >Feature sequence052 1286 24 gene locus_tag LOCUS_12060 gene efmA 1286 24 CDS product multidrug efflux MFS transporter EfmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291207.1 protein_id gnl|my_center|LOCUS_12060 1718 3046 gene locus_tag LOCUS_12070 1718 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 4246 3485 gene locus_tag LOCUS_12080 4246 3485 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132559.1 protein_id gnl|my_center|LOCUS_12080 5346 4243 gene locus_tag LOCUS_12090 5346 4243 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015426122.1 protein_id gnl|my_center|LOCUS_12090 7429 5336 gene locus_tag LOCUS_12100 7429 5336 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674970.1 protein_id gnl|my_center|LOCUS_12100 8984 7413 gene locus_tag LOCUS_12110 8984 7413 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905675.1 protein_id gnl|my_center|LOCUS_12110 9363 8941 gene locus_tag LOCUS_12120 9363 8941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 11490 9370 gene locus_tag LOCUS_12130 11490 9370 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132555.1 protein_id gnl|my_center|LOCUS_12130 15206 11688 gene locus_tag LOCUS_12140 gene smc 15206 11688 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775578.1 protein_id gnl|my_center|LOCUS_12140 15891 15196 gene locus_tag LOCUS_12150 gene rnc 15891 15196 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905569.1 protein_id gnl|my_center|LOCUS_12150 16385 15996 gene locus_tag LOCUS_12160 16385 15996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130340.1 protein_id gnl|my_center|LOCUS_12160 >Feature sequence053 113 1708 gene locus_tag LOCUS_12170 113 1708 CDS product bifunctional aspartate transaminase/aspartate 4-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549954.1 protein_id gnl|my_center|LOCUS_12170 2497 1787 gene locus_tag LOCUS_12180 2497 1787 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674084.1 protein_id gnl|my_center|LOCUS_12180 3870 2494 gene locus_tag LOCUS_12190 3870 2494 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009880550.1 protein_id gnl|my_center|LOCUS_12190 4195 3908 gene locus_tag LOCUS_12200 4195 3908 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982644.1 protein_id gnl|my_center|LOCUS_12200 4657 4199 gene locus_tag LOCUS_12210 4657 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 6297 4672 gene locus_tag LOCUS_12220 6297 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 6363 6639 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8073 6790 gene locus_tag LOCUS_12230 8073 6790 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131380.1 protein_id gnl|my_center|LOCUS_12230 8584 8066 gene locus_tag LOCUS_12240 8584 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002315963.1 protein_id gnl|my_center|LOCUS_12240 9273 8608 gene locus_tag LOCUS_12250 9273 8608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 10201 9443 gene locus_tag LOCUS_12260 gene tpiA 10201 9443 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132078.1 protein_id gnl|my_center|LOCUS_12260 11233 10328 gene locus_tag LOCUS_12270 11233 10328 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132069.1 protein_id gnl|my_center|LOCUS_12270 12140 11235 gene locus_tag LOCUS_12280 gene truB 12140 11235 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905772.1 protein_id gnl|my_center|LOCUS_12280 12948 12496 gene locus_tag LOCUS_12290 12948 12496 CDS product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132063.1 protein_id gnl|my_center|LOCUS_12290 14494 13040 gene locus_tag LOCUS_12300 gene msr(C) 14494 13040 CDS product ABC-F type ribosomal protection protein Msr(C) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287458.1 protein_id gnl|my_center|LOCUS_12300 15708 14773 gene locus_tag LOCUS_12310 15708 14773 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100868.1 protein_id gnl|my_center|LOCUS_12310 15794 16450 gene locus_tag LOCUS_12320 15794 16450 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100869.1 protein_id gnl|my_center|LOCUS_12320 >Feature sequence054 162 1190 gene locus_tag LOCUS_12330 gene pfkA 162 1190 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131080.1 protein_id gnl|my_center|LOCUS_12330 1298 2806 gene locus_tag LOCUS_12340 gene pyk 1298 2806 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131076.1 protein_id gnl|my_center|LOCUS_12340 3069 4565 gene locus_tag LOCUS_12350 3069 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 4686 4921 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4933 5961 gene locus_tag LOCUS_12360 4933 5961 CDS product XRE/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130357.1 protein_id gnl|my_center|LOCUS_12360 7426 6473 gene locus_tag LOCUS_12370 7426 6473 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131070.1 protein_id gnl|my_center|LOCUS_12370 8496 7426 gene locus_tag LOCUS_12380 8496 7426 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131068.1 protein_id gnl|my_center|LOCUS_12380 10009 8480 gene locus_tag LOCUS_12390 10009 8480 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905892.1 protein_id gnl|my_center|LOCUS_12390 11914 10289 gene locus_tag LOCUS_12400 11914 10289 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905891.1 protein_id gnl|my_center|LOCUS_12400 12018 13076 gene locus_tag LOCUS_12410 gene queG 12018 13076 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901079.1 protein_id gnl|my_center|LOCUS_12410 13285 14382 gene locus_tag LOCUS_12420 gene prfB 13285 14382 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130963.1 protein_id gnl|my_center|LOCUS_12420 14588 15280 gene locus_tag LOCUS_12430 gene ftsE 14588 15280 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130964.1 protein_id gnl|my_center|LOCUS_12430 15273 16208 gene locus_tag LOCUS_12440 gene ftsX 15273 16208 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905664.1 protein_id gnl|my_center|LOCUS_12440 >Feature sequence055 1752 766 gene locus_tag LOCUS_12450 gene nrdF 1752 766 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130966.1 protein_id gnl|my_center|LOCUS_12450 3935 1767 gene locus_tag LOCUS_12460 gene nrdE 3935 1767 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130967.1 protein_id gnl|my_center|LOCUS_12460 4408 3992 gene locus_tag LOCUS_12470 gene nrdI 4408 3992 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130968.1 protein_id gnl|my_center|LOCUS_12470 4623 4405 gene locus_tag LOCUS_12480 4623 4405 CDS product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012897612.1 protein_id gnl|my_center|LOCUS_12480 5382 4744 gene locus_tag LOCUS_12490 gene plsY 5382 4744 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905665.1 protein_id gnl|my_center|LOCUS_12490 5603 7540 gene locus_tag LOCUS_12500 gene parE 5603 7540 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905666.1 protein_id gnl|my_center|LOCUS_12500 7583 8407 gene locus_tag LOCUS_12510 7583 8407 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130976.1 protein_id gnl|my_center|LOCUS_12510 8412 8873 gene locus_tag LOCUS_12520 8412 8873 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130977.1 protein_id gnl|my_center|LOCUS_12520 8922 11405 gene locus_tag LOCUS_12530 gene parC 8922 11405 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130980.1 protein_id gnl|my_center|LOCUS_12530 11717 14188 gene locus_tag LOCUS_12540 gene gyrA 11717 14188 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905763.1 protein_id gnl|my_center|LOCUS_12540 14190 15260 gene locus_tag LOCUS_12550 14190 15260 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132052.1 protein_id gnl|my_center|LOCUS_12550 15273 16004 gene locus_tag LOCUS_12560 15273 16004 CDS product sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379825.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence056 <1 682 gene locus_tag LOCUS_12570 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836297.1:HEPN domain-containing protein note possible pseudo, frameshifted 694 894 gene locus_tag LOCUS_12580 694 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12580 1594 1430 gene locus_tag LOCUS_12590 1594 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 2173 1625 gene locus_tag LOCUS_12600 2173 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12600 2390 2175 gene locus_tag LOCUS_12610 2390 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 4458 2572 gene locus_tag LOCUS_12620 4458 2572 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439865.1 protein_id gnl|my_center|LOCUS_12620 5329 4448 gene locus_tag LOCUS_12630 5329 4448 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732924.1 protein_id gnl|my_center|LOCUS_12630 6414 5338 gene locus_tag LOCUS_12640 6414 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 9092 6483 gene locus_tag LOCUS_12650 9092 6483 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989460.1 protein_id gnl|my_center|LOCUS_12650 9550 9095 gene locus_tag LOCUS_12660 9550 9095 CDS product fructose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263697.1 protein_id gnl|my_center|LOCUS_12660 11059 9566 gene locus_tag LOCUS_12670 11059 9566 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167004.1 protein_id gnl|my_center|LOCUS_12670 11876 11310 gene locus_tag LOCUS_12680 11876 11310 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905771.1 protein_id gnl|my_center|LOCUS_12680 14173 11879 gene locus_tag LOCUS_12690 gene pcrA 14173 11879 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132060.1 protein_id gnl|my_center|LOCUS_12690 14283 14570 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15221 14595 gene locus_tag LOCUS_12700 15221 14595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12700 >Feature sequence057 674 276 gene locus_tag LOCUS_12710 gene spxA 674 276 CDS product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101690.1 protein_id gnl|my_center|LOCUS_12710 2754 931 gene locus_tag LOCUS_12720 gene dnaK 2754 931 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905652.1 protein_id gnl|my_center|LOCUS_12720 3390 2830 gene locus_tag LOCUS_12730 gene grpE 3390 2830 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905651.1 protein_id gnl|my_center|LOCUS_12730 4464 3427 gene locus_tag LOCUS_12740 gene hrcA 4464 3427 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905650.1 protein_id gnl|my_center|LOCUS_12740 5014 4610 gene locus_tag LOCUS_12750 5014 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 5832 5047 gene locus_tag LOCUS_12760 5832 5047 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905648.1 protein_id gnl|my_center|LOCUS_12760 6520 5816 gene locus_tag LOCUS_12770 6520 5816 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130927.1 protein_id gnl|my_center|LOCUS_12770 7687 6761 gene locus_tag LOCUS_12780 7687 6761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 8457 7777 gene locus_tag LOCUS_12790 8457 7777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906125.1 protein_id gnl|my_center|LOCUS_12790 9083 8658 gene locus_tag LOCUS_12800 9083 8658 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255278.1 protein_id gnl|my_center|LOCUS_12800 10510 9101 gene locus_tag LOCUS_12810 gene atpD 10510 9101 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906126.1 protein_id gnl|my_center|LOCUS_12810 11445 10570 gene locus_tag LOCUS_12820 11445 10570 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255268.1 protein_id gnl|my_center|LOCUS_12820 12965 11457 gene locus_tag LOCUS_12830 gene atpA 12965 11457 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255265.1 protein_id gnl|my_center|LOCUS_12830 13559 13032 gene locus_tag LOCUS_12840 13559 13032 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906127.1 protein_id gnl|my_center|LOCUS_12840 14080 13574 gene locus_tag LOCUS_12850 gene atpF 14080 13574 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906128.1 protein_id gnl|my_center|LOCUS_12850 14807 14094 gene locus_tag LOCUS_12860 gene atpB 14807 14094 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255255.1 protein_id gnl|my_center|LOCUS_12860 15077 14862 gene locus_tag LOCUS_12870 15077 14862 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255250.1 protein_id gnl|my_center|LOCUS_12870 16068 15292 gene locus_tag LOCUS_12880 16068 15292 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255244.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence058 3271 1793 gene locus_tag LOCUS_12890 3271 1793 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370472.1 protein_id gnl|my_center|LOCUS_12890 4093 3281 gene locus_tag LOCUS_12900 4093 3281 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131434.1 protein_id gnl|my_center|LOCUS_12900 5740 4193 gene locus_tag LOCUS_12910 5740 4193 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131432.1 protein_id gnl|my_center|LOCUS_12910 6156 6485 gene locus_tag LOCUS_12920 6156 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 9079 6707 gene locus_tag LOCUS_12930 gene rnr 9079 6707 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905644.1 protein_id gnl|my_center|LOCUS_12930 9958 9329 gene locus_tag LOCUS_12940 9958 9329 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206301.1 protein_id gnl|my_center|LOCUS_12940 10558 10358 gene locus_tag LOCUS_12950 10558 10358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 12232 10709 gene locus_tag LOCUS_12960 gene yjeM 12232 10709 CDS product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130322.1 protein_id gnl|my_center|LOCUS_12960 12452 13438 gene locus_tag LOCUS_12970 12452 13438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 14900 13734 gene locus_tag LOCUS_12980 14900 13734 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905093.1 protein_id gnl|my_center|LOCUS_12980 15589 14978 gene locus_tag LOCUS_12990 15589 14978 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905092.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence059 114 1607 gene locus_tag LOCUS_13000 114 1607 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167004.1 protein_id gnl|my_center|LOCUS_13000 1622 2074 gene locus_tag LOCUS_13010 1622 2074 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167001.1 protein_id gnl|my_center|LOCUS_13010 2132 4750 gene locus_tag LOCUS_13020 gene mngB 2132 4750 CDS product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861811.1 protein_id gnl|my_center|LOCUS_13020 4760 5557 gene locus_tag LOCUS_13030 4760 5557 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948062.1 protein_id gnl|my_center|LOCUS_13030 5570 6949 gene locus_tag LOCUS_13040 5570 6949 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035027539.1 protein_id gnl|my_center|LOCUS_13040 6933 7823 gene locus_tag LOCUS_13050 6933 7823 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360061.1 protein_id gnl|my_center|LOCUS_13050 7825 8220 gene locus_tag LOCUS_13060 7825 8220 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721726.1 protein_id gnl|my_center|LOCUS_13060 8641 11316 gene locus_tag LOCUS_13070 gene yoaB 8641 11316 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905909.1 protein_id gnl|my_center|LOCUS_13070 11798 13111 gene locus_tag LOCUS_13080 gene obgE 11798 13111 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379794.1 protein_id gnl|my_center|LOCUS_13080 13129 13296 gene locus_tag LOCUS_13090 13129 13296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906044.1 protein_id gnl|my_center|LOCUS_13090 13528 14304 gene locus_tag LOCUS_13100 13528 14304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 14342 14515 gene locus_tag LOCUS_13110 14342 14515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 14568 15347 gene locus_tag LOCUS_13120 14568 15347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 15456 15977 gene locus_tag LOCUS_13130 15456 15977 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254803.1 protein_id gnl|my_center|LOCUS_13130 >Feature sequence060 944 168 gene locus_tag LOCUS_13140 944 168 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905438.1 protein_id gnl|my_center|LOCUS_13140 1566 1021 gene locus_tag LOCUS_13150 1566 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132120.1 protein_id gnl|my_center|LOCUS_13150 2446 1730 gene locus_tag LOCUS_13160 2446 1730 CDS product DUF4811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905623.1 protein_id gnl|my_center|LOCUS_13160 3972 2446 gene locus_tag LOCUS_13170 3972 2446 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905622.1 protein_id gnl|my_center|LOCUS_13170 4418 3969 gene locus_tag LOCUS_13180 4418 3969 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905621.1 protein_id gnl|my_center|LOCUS_13180 5549 5770 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5884 6909 gene locus_tag LOCUS_13190 5884 6909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 8962 7004 gene locus_tag LOCUS_13200 gene gyrB 8962 7004 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131421.1 protein_id gnl|my_center|LOCUS_13200 9527 9126 gene locus_tag LOCUS_13210 9527 9126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 9787 9524 gene locus_tag LOCUS_13220 9787 9524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 10395 9796 gene locus_tag LOCUS_13230 10395 9796 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131420.1 protein_id gnl|my_center|LOCUS_13230 11115 11810 gene locus_tag LOCUS_13240 11115 11810 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129540.1 protein_id gnl|my_center|LOCUS_13240 12058 12579 gene locus_tag LOCUS_13250 12058 12579 CDS product glycoside hydrolase family 73 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905908.1 protein_id gnl|my_center|LOCUS_13250 13545 12652 gene locus_tag LOCUS_13260 13545 12652 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709392.1 protein_id gnl|my_center|LOCUS_13260 14466 13654 gene locus_tag LOCUS_13270 14466 13654 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132087.1 protein_id gnl|my_center|LOCUS_13270 15661 14537 gene locus_tag LOCUS_13280 gene hemW 15661 14537 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132086.1 protein_id gnl|my_center|LOCUS_13280 >Feature sequence061 187 117 gene locus_tag LOCUS_t00170 187 117 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 819 1087 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1719 1315 gene locus_tag LOCUS_13290 1719 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1929 1795 gene locus_tag LOCUS_13300 1929 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 2190 1945 gene locus_tag LOCUS_13310 2190 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 2588 2187 gene locus_tag LOCUS_13320 2588 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 3019 2663 gene locus_tag LOCUS_13330 3019 2663 CDS product DUF1064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905958.1 protein_id gnl|my_center|LOCUS_13330 3269 3009 gene locus_tag LOCUS_13340 3269 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 3471 3223 gene locus_tag LOCUS_13350 3471 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 6038 3768 gene locus_tag LOCUS_13360 6038 3768 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922066.1 protein_id gnl|my_center|LOCUS_13360 7636 6041 gene locus_tag LOCUS_13370 7636 6041 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922064.1 protein_id gnl|my_center|LOCUS_13370 7877 7626 gene locus_tag LOCUS_13380 7877 7626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 8443 7880 gene locus_tag LOCUS_13390 8443 7880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 9478 8459 gene locus_tag LOCUS_13400 9478 8459 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922060.1 protein_id gnl|my_center|LOCUS_13400 9734 9480 gene locus_tag LOCUS_13410 9734 9480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 11000 9744 gene locus_tag LOCUS_13420 11000 9744 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922059.1 protein_id gnl|my_center|LOCUS_13420 11278 11060 gene locus_tag LOCUS_13430 11278 11060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 11528 11292 gene locus_tag LOCUS_13440 11528 11292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 11643 11858 gene locus_tag LOCUS_13450 11643 11858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933333.1 protein_id gnl|my_center|LOCUS_13450 12077 11883 gene locus_tag LOCUS_13460 12077 11883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 12301 12095 gene locus_tag LOCUS_13470 12301 12095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 12571 12811 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12850 13191 gene locus_tag LOCUS_13480 12850 13191 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131489.1 protein_id gnl|my_center|LOCUS_13480 13200 13640 gene locus_tag LOCUS_13490 13200 13640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 13737 14384 gene locus_tag LOCUS_13500 13737 14384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 14726 15021 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence062 26 976 gene locus_tag LOCUS_13510 26 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 1715 2179 gene locus_tag LOCUS_13520 gene tsaE 1715 2179 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023188979.1 protein_id gnl|my_center|LOCUS_13520 2176 2691 gene locus_tag LOCUS_13530 2176 2691 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131525.1 protein_id gnl|my_center|LOCUS_13530 2951 4300 gene locus_tag LOCUS_13540 2951 4300 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905336.1 protein_id gnl|my_center|LOCUS_13540 4363 4438 gene locus_tag LOCUS_t00180 4363 4438 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4723 5253 gene locus_tag LOCUS_13550 4723 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 5280 5495 gene locus_tag LOCUS_13560 5280 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 6061 6876 gene locus_tag LOCUS_13570 gene truA 6061 6876 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131523.1 protein_id gnl|my_center|LOCUS_13570 6869 7702 gene locus_tag LOCUS_13580 6869 7702 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_13580 7699 8181 gene locus_tag LOCUS_13590 7699 8181 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131521.1 protein_id gnl|my_center|LOCUS_13590 8162 8704 gene locus_tag LOCUS_13600 8162 8704 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905395.1 protein_id gnl|my_center|LOCUS_13600 9166 10770 gene locus_tag LOCUS_13610 9166 10770 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131516.1 protein_id gnl|my_center|LOCUS_13610 10879 11496 gene locus_tag LOCUS_13620 10879 11496 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379801.1 protein_id gnl|my_center|LOCUS_13620 11709 11533 gene locus_tag LOCUS_13630 11709 11533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 11817 14933 gene locus_tag LOCUS_13640 11817 14933 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131504.1 protein_id gnl|my_center|LOCUS_13640 15656 15006 gene locus_tag LOCUS_13650 15656 15006 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131502.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence063 247 488 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 845 534 gene locus_tag LOCUS_13660 845 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 862 1094 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1141 1323 gene locus_tag LOCUS_13670 1141 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 1493 1406 gene locus_tag LOCUS_t00190 1493 1406 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2316 2056 gene locus_tag LOCUS_13680 2316 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 2957 2316 gene locus_tag LOCUS_13690 2957 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 4172 3216 gene locus_tag LOCUS_13700 gene manA 4172 3216 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905553.1 protein_id gnl|my_center|LOCUS_13700 4795 4439 gene locus_tag LOCUS_13710 gene rbfA 4795 4439 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132494.1 protein_id gnl|my_center|LOCUS_13710 7533 4834 gene locus_tag LOCUS_13720 gene infB 7533 4834 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132492.1 protein_id gnl|my_center|LOCUS_13720 7857 7552 gene locus_tag LOCUS_13730 7857 7552 CDS product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132491.1 protein_id gnl|my_center|LOCUS_13730 8185 7859 gene locus_tag LOCUS_13740 8185 7859 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132489.1 protein_id gnl|my_center|LOCUS_13740 9317 8190 gene locus_tag LOCUS_13750 gene nusA 9317 8190 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905552.1 protein_id gnl|my_center|LOCUS_13750 9862 9386 gene locus_tag LOCUS_13760 gene rimP 9862 9386 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905551.1 protein_id gnl|my_center|LOCUS_13760 10138 10533 gene locus_tag LOCUS_13770 10138 10533 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132486.1 protein_id gnl|my_center|LOCUS_13770 10533 11231 gene locus_tag LOCUS_13780 10533 11231 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132485.1 protein_id gnl|my_center|LOCUS_13780 12609 11299 gene locus_tag LOCUS_13790 gene der 12609 11299 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132476.1 protein_id gnl|my_center|LOCUS_13790 13806 12781 gene locus_tag LOCUS_13800 13806 12781 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357754.1 protein_id gnl|my_center|LOCUS_13800 14405 14631 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence064 706 167 gene locus_tag LOCUS_13810 706 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 3550 1010 gene locus_tag LOCUS_13820 3550 1010 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131692.1 protein_id gnl|my_center|LOCUS_13820 3685 4485 gene locus_tag LOCUS_13830 3685 4485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905270.1 protein_id gnl|my_center|LOCUS_13830 4495 4971 gene locus_tag LOCUS_13840 4495 4971 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295999.1 protein_id gnl|my_center|LOCUS_13840 6316 5297 gene locus_tag LOCUS_13850 gene tsaD 6316 5297 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131705.1 protein_id gnl|my_center|LOCUS_13850 6758 6318 gene locus_tag LOCUS_13860 gene rimI 6758 6318 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905269.1 protein_id gnl|my_center|LOCUS_13860 7308 6742 gene locus_tag LOCUS_13870 gene rimI 7308 6742 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905268.1 protein_id gnl|my_center|LOCUS_13870 7972 7262 gene locus_tag LOCUS_13880 gene tsaB 7972 7262 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131710.1 protein_id gnl|my_center|LOCUS_13880 9919 8519 gene locus_tag LOCUS_13890 9919 8519 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905123.1 protein_id gnl|my_center|LOCUS_13890 10355 10585 gene locus_tag LOCUS_13900 10355 10585 CDS product RNA polymerase epsilon subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131711.1 protein_id gnl|my_center|LOCUS_13900 10720 12408 gene locus_tag LOCUS_13910 10720 12408 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131712.1 protein_id gnl|my_center|LOCUS_13910 12631 12428 gene locus_tag LOCUS_13920 12631 12428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 12530 12994 gene locus_tag LOCUS_13930 12530 12994 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130662.1 protein_id gnl|my_center|LOCUS_13930 14041 13010 gene locus_tag LOCUS_13940 gene add 14041 13010 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905265.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence065 146 467 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 739 1095 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1271 1632 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1763 2398 gene locus_tag LOCUS_13950 1763 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 4763 2622 gene locus_tag LOCUS_13960 4763 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 5854 4760 gene locus_tag LOCUS_13970 5854 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 6109 8076 gene locus_tag LOCUS_13980 gene ligA 6109 8076 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131547.1 protein_id gnl|my_center|LOCUS_13980 8073 9077 gene locus_tag LOCUS_13990 8073 9077 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905327.1 protein_id gnl|my_center|LOCUS_13990 9310 10446 gene locus_tag LOCUS_14000 gene ugpC 9310 10446 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131545.1 protein_id gnl|my_center|LOCUS_14000 10585 11568 gene locus_tag LOCUS_14010 10585 11568 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_14010 11679 12071 gene locus_tag LOCUS_14020 11679 12071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 12061 12312 gene locus_tag LOCUS_14030 12061 12312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 12360 14660 gene locus_tag LOCUS_14040 12360 14660 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990086.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence066 25 330 gene locus_tag LOCUS_14050 25 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 340 1284 gene locus_tag LOCUS_14060 340 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14060 1368 2282 gene locus_tag LOCUS_14070 1368 2282 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257890.1 protein_id gnl|my_center|LOCUS_14070 2269 3114 gene locus_tag LOCUS_14080 2269 3114 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229020.1 protein_id gnl|my_center|LOCUS_14080 3134 5125 gene locus_tag LOCUS_14090 3134 5125 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102206.1 protein_id gnl|my_center|LOCUS_14090 5118 5795 gene locus_tag LOCUS_14100 gene pgmB 5118 5795 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905331.1 protein_id gnl|my_center|LOCUS_14100 6257 9913 gene locus_tag LOCUS_14110 gene nifJ 6257 9913 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129881427.1 protein_id gnl|my_center|LOCUS_14110 10097 10924 gene locus_tag LOCUS_14120 gene cdaA 10097 10924 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131542.1 protein_id gnl|my_center|LOCUS_14120 10924 11877 gene locus_tag LOCUS_14130 10924 11877 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263113.1 protein_id gnl|my_center|LOCUS_14130 11904 13265 gene locus_tag LOCUS_14140 gene glmM 11904 13265 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131539.1 protein_id gnl|my_center|LOCUS_14140 13539 14048 gene locus_tag LOCUS_14150 13539 14048 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131536.1 protein_id gnl|my_center|LOCUS_14150 >Feature sequence067 479 78 gene locus_tag LOCUS_14160 479 78 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132362.1 protein_id gnl|my_center|LOCUS_14160 1824 472 gene locus_tag LOCUS_14170 gene cysS 1824 472 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906168.1 protein_id gnl|my_center|LOCUS_14170 2407 1808 gene locus_tag LOCUS_14180 gene cysE 2407 1808 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132365.1 protein_id gnl|my_center|LOCUS_14180 4861 2573 gene locus_tag LOCUS_14190 gene pnp 4861 2573 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132367.1 protein_id gnl|my_center|LOCUS_14190 5206 6726 gene locus_tag LOCUS_14200 5206 6726 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101306.1 protein_id gnl|my_center|LOCUS_14200 8050 6797 gene locus_tag LOCUS_14210 8050 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 9013 8063 gene locus_tag LOCUS_14220 9013 8063 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241104.1 protein_id gnl|my_center|LOCUS_14220 9840 9010 gene locus_tag LOCUS_14230 9840 9010 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905211.1 protein_id gnl|my_center|LOCUS_14230 10959 10183 gene locus_tag LOCUS_14240 10959 10183 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357498.1 protein_id gnl|my_center|LOCUS_14240 11908 10961 gene locus_tag LOCUS_14250 11908 10961 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360246.1 protein_id gnl|my_center|LOCUS_14250 12896 11958 gene locus_tag LOCUS_14260 12896 11958 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391812.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence068 150 620 gene locus_tag LOCUS_14270 150 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 617 880 gene locus_tag LOCUS_14280 617 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 867 1994 gene locus_tag LOCUS_14290 gene essB 867 1994 CDS product type VII secretion protein EssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966970.1 protein_id gnl|my_center|LOCUS_14290 2000 6478 gene locus_tag LOCUS_14300 gene essC 2000 6478 CDS product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966969.1 protein_id gnl|my_center|LOCUS_14300 6480 6926 gene locus_tag LOCUS_14310 6480 6926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 6948 7226 gene locus_tag LOCUS_14320 6948 7226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 7230 7586 gene locus_tag LOCUS_14330 7230 7586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 7577 8923 gene locus_tag LOCUS_14340 7577 8923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 8917 9591 gene locus_tag LOCUS_14350 8917 9591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 9602 9892 gene locus_tag LOCUS_14360 9602 9892 CDS product DUF4176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926393.1 protein_id gnl|my_center|LOCUS_14360 10197 12983 gene locus_tag LOCUS_14370 gene esaA 10197 12983 CDS product type VII secretion protein EsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966957.1 protein_id gnl|my_center|LOCUS_14370 >Feature sequence069 830 93 gene locus_tag LOCUS_14380 830 93 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131021.1 protein_id gnl|my_center|LOCUS_14380 2710 881 gene locus_tag LOCUS_14390 gene glpO 2710 881 CDS product type 1 glycerol-3-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905845.1 protein_id gnl|my_center|LOCUS_14390 4248 2752 gene locus_tag LOCUS_14400 gene glpK 4248 2752 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131019.1 protein_id gnl|my_center|LOCUS_14400 5838 4372 gene locus_tag LOCUS_14410 5838 4372 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905846.1 protein_id gnl|my_center|LOCUS_14410 7207 5996 gene locus_tag LOCUS_14420 7207 5996 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905754.1 protein_id gnl|my_center|LOCUS_14420 7603 7364 gene locus_tag LOCUS_14430 7603 7364 CDS product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255340.1 protein_id gnl|my_center|LOCUS_14430 9647 7614 gene locus_tag LOCUS_14440 gene glyS 9647 7614 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130669.1 protein_id gnl|my_center|LOCUS_14440 10615 9647 gene locus_tag LOCUS_14450 gene glyQ 10615 9647 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130667.1 protein_id gnl|my_center|LOCUS_14450 11408 10629 gene locus_tag LOCUS_14460 11408 10629 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905662.1 protein_id gnl|my_center|LOCUS_14460 11881 11687 gene locus_tag LOCUS_14470 11881 11687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 >Feature sequence070 <1 2072 gene locus_tag LOCUS_14480 <1 2072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010906410.1:ATP-dependent DNA helicase RecG 2109 2363 gene locus_tag LOCUS_14490 2109 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 3768 2404 gene locus_tag LOCUS_14500 gene mnmE 3768 2404 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131240.1 protein_id gnl|my_center|LOCUS_14500 3887 4624 gene locus_tag LOCUS_14510 3887 4624 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025017062.1 protein_id gnl|my_center|LOCUS_14510 4773 5435 gene locus_tag LOCUS_14520 gene rpiA 4773 5435 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906402.1 protein_id gnl|my_center|LOCUS_14520 5937 5485 gene locus_tag LOCUS_14530 5937 5485 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132021.1 protein_id gnl|my_center|LOCUS_14530 6057 6914 gene locus_tag LOCUS_14540 gene mreC 6057 6914 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132018.1 protein_id gnl|my_center|LOCUS_14540 6917 7423 gene locus_tag LOCUS_14550 gene mreD 6917 7423 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906401.1 protein_id gnl|my_center|LOCUS_14550 7559 8833 gene locus_tag LOCUS_14560 7559 8833 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906400.1 protein_id gnl|my_center|LOCUS_14560 9576 10754 gene locus_tag LOCUS_14570 9576 10754 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906400.1 protein_id gnl|my_center|LOCUS_14570 10975 12102 gene locus_tag LOCUS_14580 gene dnaJ 10975 12102 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906396.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence071 120 821 gene locus_tag LOCUS_14590 120 821 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358533.1 protein_id gnl|my_center|LOCUS_14590 1114 1572 gene locus_tag LOCUS_14600 gene fabZ 1114 1572 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130498.1 protein_id gnl|my_center|LOCUS_14600 3589 1601 gene locus_tag LOCUS_14610 gene uvrB 3589 1601 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837078.1 protein_id gnl|my_center|LOCUS_14610 4041 3586 gene locus_tag LOCUS_14620 4041 3586 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130814.1 protein_id gnl|my_center|LOCUS_14620 4146 4772 gene locus_tag LOCUS_14630 gene def 4146 4772 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130816.1 protein_id gnl|my_center|LOCUS_14630 5060 4806 gene locus_tag LOCUS_14640 5060 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 5623 5063 gene locus_tag LOCUS_14650 5623 5063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 8049 5803 gene locus_tag LOCUS_14660 8049 5803 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130823.1 protein_id gnl|my_center|LOCUS_14660 9691 8312 gene locus_tag LOCUS_14670 gene rpoD 9691 8312 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138868.1 protein_id gnl|my_center|LOCUS_14670 11614 9728 gene locus_tag LOCUS_14680 gene dnaG 11614 9728 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130831.1 protein_id gnl|my_center|LOCUS_14680 11773 11686 gene locus_tag LOCUS_t00200 11773 11686 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence072 301 53 gene locus_tag LOCUS_14690 gene secG 301 53 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905643.1 protein_id gnl|my_center|LOCUS_14690 471 325 gene locus_tag LOCUS_14700 471 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1378 458 gene locus_tag LOCUS_14710 gene trxB 1378 458 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905642.1 protein_id gnl|my_center|LOCUS_14710 1676 1443 gene locus_tag LOCUS_14720 1676 1443 CDS product DUF4059 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905641.1 protein_id gnl|my_center|LOCUS_14720 2430 1669 gene locus_tag LOCUS_14730 2430 1669 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255031.1 protein_id gnl|my_center|LOCUS_14730 3236 2427 gene locus_tag LOCUS_14740 3236 2427 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255026.1 protein_id gnl|my_center|LOCUS_14740 4347 3490 gene locus_tag LOCUS_14750 4347 3490 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255024.1 protein_id gnl|my_center|LOCUS_14750 4923 4513 gene locus_tag LOCUS_14760 4923 4513 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009912224.1 protein_id gnl|my_center|LOCUS_14760 6607 4937 gene locus_tag LOCUS_14770 6607 4937 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905639.1 protein_id gnl|my_center|LOCUS_14770 7438 6740 gene locus_tag LOCUS_14780 gene deoD 7438 6740 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255010.1 protein_id gnl|my_center|LOCUS_14780 8338 7523 gene locus_tag LOCUS_14790 8338 7523 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356180.1 protein_id gnl|my_center|LOCUS_14790 9642 8407 gene locus_tag LOCUS_14800 9642 8407 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905637.1 protein_id gnl|my_center|LOCUS_14800 11114 9723 gene locus_tag LOCUS_14810 gene tet(38) 11114 9723 CDS product tetracycline efflux MFS transporter Tet(38) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100299.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence073 869 3625 gene locus_tag LOCUS_14820 869 3625 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905505.1 protein_id gnl|my_center|LOCUS_14820 3700 3906 gene locus_tag LOCUS_14830 3700 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 4013 4771 gene locus_tag LOCUS_14840 4013 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 4843 5325 gene locus_tag LOCUS_14850 4843 5325 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922028.1 protein_id gnl|my_center|LOCUS_14850 5463 7367 gene locus_tag LOCUS_14860 gene abc-f 5463 7367 CDS product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905735.1 protein_id gnl|my_center|LOCUS_14860 7407 7913 gene locus_tag LOCUS_14870 7407 7913 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129897.1 protein_id gnl|my_center|LOCUS_14870 8167 8796 gene locus_tag LOCUS_14880 gene pyrE 8167 8796 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132758.1 protein_id gnl|my_center|LOCUS_14880 8835 10100 gene locus_tag LOCUS_14890 8835 10100 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031296484.1 protein_id gnl|my_center|LOCUS_14890 10184 10609 gene locus_tag LOCUS_14900 10184 10609 CDS product DUF3284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905170.1 protein_id gnl|my_center|LOCUS_14900 10614 11621 gene locus_tag LOCUS_14910 10614 11621 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905171.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence074 1061 2371 gene locus_tag LOCUS_14920 gene aroA 1061 2371 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132786.1 protein_id gnl|my_center|LOCUS_14920 2362 2847 gene locus_tag LOCUS_14930 2362 2847 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132788.1 protein_id gnl|my_center|LOCUS_14930 2844 3440 gene locus_tag LOCUS_14940 2844 3440 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906114.1 protein_id gnl|my_center|LOCUS_14940 3437 5869 gene locus_tag LOCUS_14950 3437 5869 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132792.1 protein_id gnl|my_center|LOCUS_14950 6419 5910 gene locus_tag LOCUS_14960 6419 5910 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132795.1 protein_id gnl|my_center|LOCUS_14960 6571 6804 gene locus_tag LOCUS_14970 gene rpsT 6571 6804 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906113.1 protein_id gnl|my_center|LOCUS_14970 6978 7412 gene locus_tag LOCUS_14980 6978 7412 CDS product Spx/MgsR family RNA polymerase-binding regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905585.1 protein_id gnl|my_center|LOCUS_14980 7705 8361 gene locus_tag LOCUS_14990 7705 8361 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905224.1 protein_id gnl|my_center|LOCUS_14990 8806 9465 gene locus_tag LOCUS_15000 8806 9465 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129839.1 protein_id gnl|my_center|LOCUS_15000 9567 10274 gene locus_tag LOCUS_15010 9567 10274 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129881038.1 protein_id gnl|my_center|LOCUS_15010 11528 10704 gene locus_tag LOCUS_15020 11528 10704 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130402.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence075 1731 130 gene locus_tag LOCUS_15030 gene yjeM 1731 130 CDS product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130322.1 protein_id gnl|my_center|LOCUS_15030 3295 2048 gene locus_tag LOCUS_15040 gene pepT 3295 2048 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130321.1 protein_id gnl|my_center|LOCUS_15040 4062 3298 gene locus_tag LOCUS_15050 4062 3298 CDS product DUF1803 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906148.1 protein_id gnl|my_center|LOCUS_15050 5006 4062 gene locus_tag LOCUS_15060 5006 4062 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130319.1 protein_id gnl|my_center|LOCUS_15060 5956 5162 gene locus_tag LOCUS_15070 gene pflA 5956 5162 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130318.1 protein_id gnl|my_center|LOCUS_15070 7549 6221 gene locus_tag LOCUS_15080 7549 6221 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906149.1 protein_id gnl|my_center|LOCUS_15080 8716 7598 gene locus_tag LOCUS_15090 8716 7598 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906150.1 protein_id gnl|my_center|LOCUS_15090 8824 9276 gene locus_tag LOCUS_15100 8824 9276 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130314.1 protein_id gnl|my_center|LOCUS_15100 9934 9350 gene locus_tag LOCUS_15110 9934 9350 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906151.1 protein_id gnl|my_center|LOCUS_15110 10826 9939 gene locus_tag LOCUS_15120 gene rsmA 10826 9939 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129621.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence076 1096 149 gene locus_tag LOCUS_15130 gene whiA 1096 149 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130947.1 protein_id gnl|my_center|LOCUS_15130 2079 1093 gene locus_tag LOCUS_15140 2079 1093 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905658.1 protein_id gnl|my_center|LOCUS_15140 2966 2076 gene locus_tag LOCUS_15150 gene rapZ 2966 2076 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130943.1 protein_id gnl|my_center|LOCUS_15150 4456 3011 gene locus_tag LOCUS_15160 gene cls 4456 3011 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905657.1 protein_id gnl|my_center|LOCUS_15160 5246 4833 gene locus_tag LOCUS_15170 5246 4833 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035052264.1 protein_id gnl|my_center|LOCUS_15170 5881 5240 gene locus_tag LOCUS_15180 gene pcp 5881 5240 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861300.1 protein_id gnl|my_center|LOCUS_15180 6834 5902 gene locus_tag LOCUS_15190 6834 5902 CDS product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433654.1 protein_id gnl|my_center|LOCUS_15190 7512 6838 gene locus_tag LOCUS_15200 7512 6838 CDS product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889567.1 protein_id gnl|my_center|LOCUS_15200 9302 7809 gene locus_tag LOCUS_15210 gene eat(A) 9302 7809 CDS product ABC-F type ribosomal protection-like protein Eat(A) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296175.1 protein_id gnl|my_center|LOCUS_15210 9666 9355 gene locus_tag LOCUS_15220 9666 9355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 11224 9878 gene locus_tag LOCUS_15230 11224 9878 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130306.1 protein_id gnl|my_center|LOCUS_15230 >Feature sequence077 333 2810 gene locus_tag LOCUS_15240 333 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 3171 3761 gene locus_tag LOCUS_15250 3171 3761 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905755.1 protein_id gnl|my_center|LOCUS_15250 3993 4268 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5035 4412 gene locus_tag LOCUS_15260 5035 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 5041 5326 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6232 5735 gene locus_tag LOCUS_15270 6232 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15270 7027 6242 gene locus_tag LOCUS_15280 7027 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15280 9180 7180 gene locus_tag LOCUS_15290 gene rnr 9180 7180 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905825.1 protein_id gnl|my_center|LOCUS_15290 10360 9242 gene locus_tag LOCUS_15300 10360 9242 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906176.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence078 268 83 gene locus_tag LOCUS_15310 268 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1544 261 gene locus_tag LOCUS_15320 gene murA 1544 261 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379841.1 protein_id gnl|my_center|LOCUS_15320 2405 1617 gene locus_tag LOCUS_15330 2405 1617 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058204115.1 protein_id gnl|my_center|LOCUS_15330 2652 2371 gene locus_tag LOCUS_15340 2652 2371 CDS product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131743.1 protein_id gnl|my_center|LOCUS_15340 2975 2679 gene locus_tag LOCUS_15350 gene spx 2975 2679 CDS product transcriptional regulator Spx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905435.1 protein_id gnl|my_center|LOCUS_15350 3736 3209 gene locus_tag LOCUS_15360 3736 3209 CDS product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905434.1 protein_id gnl|my_center|LOCUS_15360 3817 4467 gene locus_tag LOCUS_15370 gene recU 3817 4467 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131746.1 protein_id gnl|my_center|LOCUS_15370 4547 6583 gene locus_tag LOCUS_15380 4547 6583 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131747.1 protein_id gnl|my_center|LOCUS_15380 6587 7213 gene locus_tag LOCUS_15390 6587 7213 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131748.1 protein_id gnl|my_center|LOCUS_15390 8349 7438 gene locus_tag LOCUS_15400 8349 7438 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905433.1 protein_id gnl|my_center|LOCUS_15400 8535 9455 gene locus_tag LOCUS_15410 gene cysK 8535 9455 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905432.1 protein_id gnl|my_center|LOCUS_15410 >Feature sequence079 177 1814 gene locus_tag LOCUS_15420 177 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 3158 1926 gene locus_tag LOCUS_15430 3158 1926 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131689.1 protein_id gnl|my_center|LOCUS_15430 3498 5231 gene locus_tag LOCUS_15440 gene lmrC 3498 5231 CDS product multidrug efflux ABC transporter LmrCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905278.1 protein_id gnl|my_center|LOCUS_15440 5286 7379 gene locus_tag LOCUS_15450 gene lmrD 5286 7379 CDS product multidrug efflux ABC transporter LmrCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131686.1 protein_id gnl|my_center|LOCUS_15450 8535 7816 gene locus_tag LOCUS_15460 8535 7816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 8574 8837 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9028 10293 gene locus_tag LOCUS_15470 9028 10293 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131684.1 protein_id gnl|my_center|LOCUS_15470 10341 10556 gene locus_tag LOCUS_15480 10341 10556 CDS product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131683.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence080 1166 147 gene locus_tag LOCUS_15490 1166 147 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906255.1 protein_id gnl|my_center|LOCUS_15490 1899 1159 gene locus_tag LOCUS_15500 1899 1159 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254655.1 protein_id gnl|my_center|LOCUS_15500 2624 2445 gene locus_tag LOCUS_15510 2624 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 3286 2645 gene locus_tag LOCUS_15520 3286 2645 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703424.1 protein_id gnl|my_center|LOCUS_15520 3607 4002 gene locus_tag LOCUS_15530 3607 4002 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254651.1 protein_id gnl|my_center|LOCUS_15530 3999 4226 gene locus_tag LOCUS_15540 3999 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 4681 4382 gene locus_tag LOCUS_15550 4681 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 5665 4976 gene locus_tag LOCUS_15560 gene rplA 5665 4976 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254644.1 protein_id gnl|my_center|LOCUS_15560 6180 5755 gene locus_tag LOCUS_15570 gene rplK 6180 5755 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935890.1 protein_id gnl|my_center|LOCUS_15570 6936 6307 gene locus_tag LOCUS_15580 6936 6307 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905030.1 protein_id gnl|my_center|LOCUS_15580 9003 6943 gene locus_tag LOCUS_15590 9003 6943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 9294 9007 gene locus_tag LOCUS_15600 9294 9007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 9337 9587 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9855 10129 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence081 80 688 gene locus_tag LOCUS_15610 80 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15610 760 1485 gene locus_tag LOCUS_15620 760 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15620 1673 3934 gene locus_tag LOCUS_15630 1673 3934 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964235.1 protein_id gnl|my_center|LOCUS_15630 4105 4449 gene locus_tag LOCUS_15640 4105 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 4436 5047 gene locus_tag LOCUS_15650 4436 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 5109 7040 gene locus_tag LOCUS_15660 5109 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896809.1 protein_id gnl|my_center|LOCUS_15660 7040 8263 gene locus_tag LOCUS_15670 7040 8263 CDS product phage tail tip lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310786.1 protein_id gnl|my_center|LOCUS_15670 8275 9141 gene locus_tag LOCUS_15680 8275 9141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 9131 9736 gene locus_tag LOCUS_15690 9131 9736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 9979 10194 gene locus_tag LOCUS_15700 9979 10194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 >Feature sequence082 1263 697 gene locus_tag LOCUS_15710 1263 697 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905659.1 protein_id gnl|my_center|LOCUS_15710 1400 2278 gene locus_tag LOCUS_15720 1400 2278 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905660.1 protein_id gnl|my_center|LOCUS_15720 2291 3931 gene locus_tag LOCUS_15730 2291 3931 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905661.1 protein_id gnl|my_center|LOCUS_15730 4525 3953 gene locus_tag LOCUS_15740 4525 3953 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130958.1 protein_id gnl|my_center|LOCUS_15740 5434 4556 gene locus_tag LOCUS_15750 5434 4556 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836763.1 protein_id gnl|my_center|LOCUS_15750 5795 6256 gene locus_tag LOCUS_15760 5795 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905890.1 protein_id gnl|my_center|LOCUS_15760 6412 7425 gene locus_tag LOCUS_15770 6412 7425 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211854.1 protein_id gnl|my_center|LOCUS_15770 8436 7624 gene locus_tag LOCUS_15780 gene yidA 8436 7624 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130632.1 protein_id gnl|my_center|LOCUS_15780 9761 8463 gene locus_tag LOCUS_15790 9761 8463 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130634.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence083 1053 94 gene locus_tag LOCUS_15800 1053 94 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131614.1 protein_id gnl|my_center|LOCUS_15800 1642 1046 gene locus_tag LOCUS_15810 1642 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 2504 1698 gene locus_tag LOCUS_15820 2504 1698 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272547.1 protein_id gnl|my_center|LOCUS_15820 3896 2517 gene locus_tag LOCUS_15830 3896 2517 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905304.1 protein_id gnl|my_center|LOCUS_15830 4272 5024 gene locus_tag LOCUS_15840 4272 5024 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131617.1 protein_id gnl|my_center|LOCUS_15840 6403 5525 gene locus_tag LOCUS_15850 6403 5525 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905303.1 protein_id gnl|my_center|LOCUS_15850 7529 6717 gene locus_tag LOCUS_15860 7529 6717 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131619.1 protein_id gnl|my_center|LOCUS_15860 8208 7516 gene locus_tag LOCUS_15870 8208 7516 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131620.1 protein_id gnl|my_center|LOCUS_15870 8498 9094 gene locus_tag LOCUS_15880 8498 9094 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905301.1 protein_id gnl|my_center|LOCUS_15880 9225 9743 gene locus_tag LOCUS_15890 9225 9743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 >Feature sequence084 1454 57 gene locus_tag LOCUS_15900 gene sufB 1454 57 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255207.1 protein_id gnl|my_center|LOCUS_15900 1934 1479 gene locus_tag LOCUS_15910 1934 1479 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255197.1 protein_id gnl|my_center|LOCUS_15910 3170 1959 gene locus_tag LOCUS_15920 3170 1959 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255189.1 protein_id gnl|my_center|LOCUS_15920 4426 3170 gene locus_tag LOCUS_15930 gene sufD 4426 3170 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159648.1 protein_id gnl|my_center|LOCUS_15930 5270 4500 gene locus_tag LOCUS_15940 gene sufC 5270 4500 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255181.1 protein_id gnl|my_center|LOCUS_15940 7096 5843 gene locus_tag LOCUS_15950 7096 5843 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906141.1 protein_id gnl|my_center|LOCUS_15950 7783 7100 gene locus_tag LOCUS_15960 7783 7100 CDS product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255173.1 protein_id gnl|my_center|LOCUS_15960 8030 8938 gene locus_tag LOCUS_15970 8030 8938 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130548.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence085 333 644 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 655 1842 gene locus_tag LOCUS_15980 655 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 1989 2912 gene locus_tag LOCUS_15990 gene hprK 1989 2912 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129528.1 protein_id gnl|my_center|LOCUS_15990 2923 3708 gene locus_tag LOCUS_16000 gene lgt 2923 3708 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129530.1 protein_id gnl|my_center|LOCUS_16000 3840 4259 gene locus_tag LOCUS_16010 3840 4259 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129531.1 protein_id gnl|my_center|LOCUS_16010 4261 4827 gene locus_tag LOCUS_16020 4261 4827 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905465.1 protein_id gnl|my_center|LOCUS_16020 4951 6372 gene locus_tag LOCUS_16030 gene gndA 4951 6372 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129534.1 protein_id gnl|my_center|LOCUS_16030 7561 6629 gene locus_tag LOCUS_16040 7561 6629 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724071.1 protein_id gnl|my_center|LOCUS_16040 8412 7558 gene locus_tag LOCUS_16050 8412 7558 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567411.1 protein_id gnl|my_center|LOCUS_16050 9153 8419 gene locus_tag LOCUS_16060 9153 8419 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286846.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence086 278 51 gene locus_tag LOCUS_16070 278 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 587 351 gene locus_tag LOCUS_16080 587 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 1216 587 gene locus_tag LOCUS_16090 1216 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1700 2794 gene locus_tag LOCUS_16100 1700 2794 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922179.1 protein_id gnl|my_center|LOCUS_16100 4520 2988 gene locus_tag LOCUS_16110 4520 2988 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905493.1 protein_id gnl|my_center|LOCUS_16110 4798 5469 gene locus_tag LOCUS_16120 gene sdaAB 4798 5469 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132581.1 protein_id gnl|my_center|LOCUS_16120 5479 6351 gene locus_tag LOCUS_16130 gene sdaAA 5479 6351 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905579.1 protein_id gnl|my_center|LOCUS_16130 6494 6934 gene locus_tag LOCUS_16140 6494 6934 CDS product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132584.1 protein_id gnl|my_center|LOCUS_16140 6950 7159 gene locus_tag LOCUS_16150 6950 7159 CDS product copper ion binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132585.1 protein_id gnl|my_center|LOCUS_16150 7231 9318 gene locus_tag LOCUS_16160 7231 9318 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905580.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence087 402 551 gene locus_tag LOCUS_16170 402 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 567 1016 gene locus_tag LOCUS_16180 567 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 1147 1383 gene locus_tag LOCUS_16190 1147 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 1380 1847 gene locus_tag LOCUS_16200 1380 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 2214 2825 gene locus_tag LOCUS_16210 gene coaE 2214 2825 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033899639.1 protein_id gnl|my_center|LOCUS_16210 2926 4062 gene locus_tag LOCUS_16220 2926 4062 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905496.1 protein_id gnl|my_center|LOCUS_16220 4327 5550 gene locus_tag LOCUS_16230 4327 5550 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905497.1 protein_id gnl|my_center|LOCUS_16230 5857 9270 gene locus_tag LOCUS_16240 5857 9270 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905498.1 protein_id gnl|my_center|LOCUS_16240 >Feature sequence088 1301 195 gene locus_tag LOCUS_16250 1301 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 3343 1316 gene locus_tag LOCUS_16260 3343 1316 CDS product RTX toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187288335.1 protein_id gnl|my_center|LOCUS_16260 3928 3356 gene locus_tag LOCUS_16270 3928 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905905.1 protein_id gnl|my_center|LOCUS_16270 4893 3925 gene locus_tag LOCUS_16280 4893 3925 CDS product DUF916 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132423.1 protein_id gnl|my_center|LOCUS_16280 6149 5013 gene locus_tag LOCUS_16290 6149 5013 CDS product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014525057.1 protein_id gnl|my_center|LOCUS_16290 7074 6346 gene locus_tag LOCUS_16300 7074 6346 CDS product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355609.1 protein_id gnl|my_center|LOCUS_16300 7872 7102 gene locus_tag LOCUS_16310 7872 7102 CDS product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906040.1 protein_id gnl|my_center|LOCUS_16310 8739 7918 gene locus_tag LOCUS_16320 8739 7918 CDS product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012898201.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence089 1070 60 gene locus_tag LOCUS_16330 gene gap 1070 60 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131244.1 protein_id gnl|my_center|LOCUS_16330 1756 1280 gene locus_tag LOCUS_16340 1756 1280 CDS product DUF536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131246.1 protein_id gnl|my_center|LOCUS_16340 1887 4493 gene locus_tag LOCUS_16350 1887 4493 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906412.1 protein_id gnl|my_center|LOCUS_16350 6006 4606 gene locus_tag LOCUS_16360 6006 4606 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905870.1 protein_id gnl|my_center|LOCUS_16360 7539 6028 gene locus_tag LOCUS_16370 gene gadC 7539 6028 CDS product glutamate:gamma-aminobutyrate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905871.1 protein_id gnl|my_center|LOCUS_16370 7735 7936 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9181 9096 gene locus_tag LOCUS_t00210 9181 9096 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence090 76 1098 gene locus_tag LOCUS_16380 76 1098 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217780.1 protein_id gnl|my_center|LOCUS_16380 1418 1657 gene locus_tag LOCUS_16390 1418 1657 CDS product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130191.1 protein_id gnl|my_center|LOCUS_16390 1673 3085 gene locus_tag LOCUS_16400 gene racE 1673 3085 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674284.1 protein_id gnl|my_center|LOCUS_16400 3115 3624 gene locus_tag LOCUS_16410 3115 3624 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130196.1 protein_id gnl|my_center|LOCUS_16410 3644 4108 gene locus_tag LOCUS_16420 3644 4108 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905865.1 protein_id gnl|my_center|LOCUS_16420 4083 4793 gene locus_tag LOCUS_16430 gene xerD 4083 4793 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905864.1 protein_id gnl|my_center|LOCUS_16430 4790 5524 gene locus_tag LOCUS_16440 4790 5524 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130199.1 protein_id gnl|my_center|LOCUS_16440 5508 6086 gene locus_tag LOCUS_16450 gene scpB 5508 6086 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905863.1 protein_id gnl|my_center|LOCUS_16450 6073 6789 gene locus_tag LOCUS_16460 6073 6789 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905862.1 protein_id gnl|my_center|LOCUS_16460 7129 7722 gene locus_tag LOCUS_16470 7129 7722 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132093.1 protein_id gnl|my_center|LOCUS_16470 7741 9045 gene locus_tag LOCUS_16480 7741 9045 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132095.1 protein_id gnl|my_center|LOCUS_16480 >Feature sequence091 368 1804 gene locus_tag LOCUS_16490 368 1804 CDS product DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905452.1 protein_id gnl|my_center|LOCUS_16490 1801 1935 gene locus_tag LOCUS_16500 1801 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 2270 2584 gene locus_tag LOCUS_16510 2270 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 2584 2874 gene locus_tag LOCUS_16520 2584 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 3210 3428 gene locus_tag LOCUS_16530 3210 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 3429 6653 gene locus_tag LOCUS_16540 gene hsdR 3429 6653 CDS product type I restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122926.1 protein_id gnl|my_center|LOCUS_16540 6703 8142 gene locus_tag LOCUS_16550 6703 8142 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122925.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence092 1 534 gene locus_tag LOCUS_16560 1 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 817 1713 gene locus_tag LOCUS_16570 817 1713 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131457.1 protein_id gnl|my_center|LOCUS_16570 1988 2518 gene locus_tag LOCUS_16580 1988 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 2832 3698 gene locus_tag LOCUS_16590 2832 3698 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021722748.1 protein_id gnl|my_center|LOCUS_16590 3695 4420 gene locus_tag LOCUS_16600 3695 4420 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131466.1 protein_id gnl|my_center|LOCUS_16600 4457 6352 gene locus_tag LOCUS_16610 4457 6352 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905984.1 protein_id gnl|my_center|LOCUS_16610 6482 7915 gene locus_tag LOCUS_16620 6482 7915 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964714.1 protein_id gnl|my_center|LOCUS_16620 8792 8088 gene locus_tag LOCUS_16630 8792 8088 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289461.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence093 125 655 gene locus_tag LOCUS_16640 125 655 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131387.1 protein_id gnl|my_center|LOCUS_16640 1870 701 gene locus_tag LOCUS_16650 1870 701 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399716.1 protein_id gnl|my_center|LOCUS_16650 3972 1921 gene locus_tag LOCUS_16660 gene malX 3972 1921 CDS product maltose/glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387436.1 protein_id gnl|my_center|LOCUS_16660 4806 4078 gene locus_tag LOCUS_16670 4806 4078 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898159.1 protein_id gnl|my_center|LOCUS_16670 5720 5370 gene locus_tag LOCUS_16680 gene rplS 5720 5370 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012897519.1 protein_id gnl|my_center|LOCUS_16680 7199 5808 gene locus_tag LOCUS_16690 7199 5808 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437034.1 protein_id gnl|my_center|LOCUS_16690 7604 7209 gene locus_tag LOCUS_16700 7604 7209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 8293 7604 gene locus_tag LOCUS_16710 8293 7604 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131377.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence094 89 1120 gene locus_tag LOCUS_16720 89 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 1223 2848 gene locus_tag LOCUS_16730 1223 2848 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382265.1 protein_id gnl|my_center|LOCUS_16730 3242 3766 gene locus_tag LOCUS_16740 gene pyrR 3242 3766 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906054.1 protein_id gnl|my_center|LOCUS_16740 3769 5055 gene locus_tag LOCUS_16750 3769 5055 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906053.1 protein_id gnl|my_center|LOCUS_16750 5169 6092 gene locus_tag LOCUS_16760 5169 6092 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129382.1 protein_id gnl|my_center|LOCUS_16760 6116 7198 gene locus_tag LOCUS_16770 6116 7198 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906052.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence095 828 2021 gene locus_tag LOCUS_16780 828 2021 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906264.1 protein_id gnl|my_center|LOCUS_16780 2112 2828 gene locus_tag LOCUS_16790 gene pyrH 2112 2828 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254608.1 protein_id gnl|my_center|LOCUS_16790 2858 3415 gene locus_tag LOCUS_16800 gene frr 2858 3415 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254618.1 protein_id gnl|my_center|LOCUS_16800 3508 4371 gene locus_tag LOCUS_16810 3508 4371 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906261.1 protein_id gnl|my_center|LOCUS_16810 4595 5026 gene locus_tag LOCUS_16820 gene msrA 4595 5026 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438899.1 protein_id gnl|my_center|LOCUS_16820 5023 5238 gene locus_tag LOCUS_16830 5023 5238 CDS product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906259.1 protein_id gnl|my_center|LOCUS_16830 5256 5627 gene locus_tag LOCUS_16840 5256 5627 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002327753.1 protein_id gnl|my_center|LOCUS_16840 5855 6253 gene locus_tag LOCUS_16850 5855 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 >Feature sequence096 1264 548 gene locus_tag LOCUS_16860 1264 548 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905223.1 protein_id gnl|my_center|LOCUS_16860 2389 1304 gene locus_tag LOCUS_16870 2389 1304 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129834.1 protein_id gnl|my_center|LOCUS_16870 3108 2377 gene locus_tag LOCUS_16880 3108 2377 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905221.1 protein_id gnl|my_center|LOCUS_16880 3468 3109 gene locus_tag LOCUS_16890 gene rsfS 3468 3109 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129832.1 protein_id gnl|my_center|LOCUS_16890 4084 3491 gene locus_tag LOCUS_16900 gene yqeK 4084 3491 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129830.1 protein_id gnl|my_center|LOCUS_16900 4670 4077 gene locus_tag LOCUS_16910 4670 4077 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905220.1 protein_id gnl|my_center|LOCUS_16910 4982 4674 gene locus_tag LOCUS_16920 gene yhbY 4982 4674 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129828.1 protein_id gnl|my_center|LOCUS_16920 6232 4997 gene locus_tag LOCUS_16930 gene hflX 6232 4997 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905219.1 protein_id gnl|my_center|LOCUS_16930 7362 6235 gene locus_tag LOCUS_16940 gene yqeH 7362 6235 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014571938.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence097 774 61 gene locus_tag LOCUS_16950 gene rsmG 774 61 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131091.1 protein_id gnl|my_center|LOCUS_16950 1733 774 gene locus_tag LOCUS_16960 1733 774 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131090.1 protein_id gnl|my_center|LOCUS_16960 2254 1724 gene locus_tag LOCUS_16970 2254 1724 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131089.1 protein_id gnl|my_center|LOCUS_16970 2637 2251 gene locus_tag LOCUS_16980 2637 2251 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131088.1 protein_id gnl|my_center|LOCUS_16980 3670 2744 gene locus_tag LOCUS_16990 gene galU 3670 2744 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905896.1 protein_id gnl|my_center|LOCUS_16990 4715 3696 gene locus_tag LOCUS_17000 4715 3696 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131086.1 protein_id gnl|my_center|LOCUS_17000 5029 5607 gene locus_tag LOCUS_17010 5029 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 5617 6783 gene locus_tag LOCUS_17020 5617 6783 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131084.1 protein_id gnl|my_center|LOCUS_17020 6885 8036 gene locus_tag LOCUS_17030 gene nagA 6885 8036 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905894.1 protein_id gnl|my_center|LOCUS_17030 >Feature sequence098 1541 48 gene locus_tag LOCUS_17040 1541 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 2553 1870 gene locus_tag LOCUS_17050 2553 1870 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906108.1 protein_id gnl|my_center|LOCUS_17050 4358 2553 gene locus_tag LOCUS_17060 gene pepF 4358 2553 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906109.1 protein_id gnl|my_center|LOCUS_17060 5373 4342 gene locus_tag LOCUS_17070 5373 4342 CDS product competence protein CoiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906110.1 protein_id gnl|my_center|LOCUS_17070 6541 5441 gene locus_tag LOCUS_17080 6541 5441 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130405.1 protein_id gnl|my_center|LOCUS_17080 8034 6613 gene locus_tag LOCUS_17090 8034 6613 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130403.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence099 981 88 gene locus_tag LOCUS_17100 981 88 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129543.1 protein_id gnl|my_center|LOCUS_17100 1711 1043 gene locus_tag LOCUS_17110 1711 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129542.1 protein_id gnl|my_center|LOCUS_17110 2594 1701 gene locus_tag LOCUS_17120 gene miaA 2594 1701 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129541.1 protein_id gnl|my_center|LOCUS_17120 4118 2697 gene locus_tag LOCUS_17130 gene pdaC 4118 2697 CDS product peptidoglycan-N-acetylmuramic acid deacetylase PdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245023.1 protein_id gnl|my_center|LOCUS_17130 4316 4495 gene locus_tag LOCUS_17140 4316 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 4520 4690 gene locus_tag LOCUS_17150 4520 4690 CDS product DUF3042 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356337.1 protein_id gnl|my_center|LOCUS_17150 5645 5394 gene locus_tag LOCUS_17160 5645 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 6035 5763 gene locus_tag LOCUS_17170 6035 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 6396 6037 gene locus_tag LOCUS_17180 6396 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 6716 6393 gene locus_tag LOCUS_17190 6716 6393 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129889.1 protein_id gnl|my_center|LOCUS_17190 6880 7812 gene locus_tag LOCUS_17200 6880 7812 CDS product dihydroorotate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130679.1 protein_id gnl|my_center|LOCUS_17200 >Feature sequence100 2237 681 gene locus_tag LOCUS_17210 gene ffh 2237 681 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129408.1 protein_id gnl|my_center|LOCUS_17210 3002 2349 gene locus_tag LOCUS_17220 3002 2349 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289151.1 protein_id gnl|my_center|LOCUS_17220 4326 3004 gene locus_tag LOCUS_17230 4326 3004 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304549.1 protein_id gnl|my_center|LOCUS_17230 6204 4468 gene locus_tag LOCUS_17240 6204 4468 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129410.1 protein_id gnl|my_center|LOCUS_17240 6723 6322 gene locus_tag LOCUS_17250 6723 6322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 7493 6759 gene locus_tag LOCUS_17260 7493 6759 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289735.1 protein_id gnl|my_center|LOCUS_17260 >Feature sequence101 373 738 gene locus_tag LOCUS_17270 373 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 731 2377 gene locus_tag LOCUS_17280 731 2377 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836834.1 protein_id gnl|my_center|LOCUS_17280 2374 2685 gene locus_tag LOCUS_17290 2374 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836835.1 protein_id gnl|my_center|LOCUS_17290 2710 3009 gene locus_tag LOCUS_17300 2710 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 3260 4135 gene locus_tag LOCUS_17310 3260 4135 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836406.1 protein_id gnl|my_center|LOCUS_17310 4135 5121 gene locus_tag LOCUS_17320 4135 5121 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836741.1 protein_id gnl|my_center|LOCUS_17320 5114 6868 gene locus_tag LOCUS_17330 5114 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 6861 7730 gene locus_tag LOCUS_17340 6861 7730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence102 397 852 gene locus_tag LOCUS_17350 397 852 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129522.1 protein_id gnl|my_center|LOCUS_17350 1964 1062 gene locus_tag LOCUS_17360 1964 1062 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905463.1 protein_id gnl|my_center|LOCUS_17360 2857 2000 gene locus_tag LOCUS_17370 2857 2000 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631543.1 protein_id gnl|my_center|LOCUS_17370 3016 3459 gene locus_tag LOCUS_17380 3016 3459 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162136.1 protein_id gnl|my_center|LOCUS_17380 4225 3497 gene locus_tag LOCUS_17390 4225 3497 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129512.1 protein_id gnl|my_center|LOCUS_17390 4319 4594 gene locus_tag LOCUS_17400 4319 4594 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897016.1 protein_id gnl|my_center|LOCUS_17400 5546 4935 gene locus_tag LOCUS_17410 5546 4935 CDS product lysozyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905458.1 protein_id gnl|my_center|LOCUS_17410 6957 5716 gene locus_tag LOCUS_17420 6957 5716 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129504.1 protein_id gnl|my_center|LOCUS_17420 7670 7068 gene locus_tag LOCUS_17430 7670 7068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence103 1730 114 gene locus_tag LOCUS_17440 gene rny 1730 114 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131467.1 protein_id gnl|my_center|LOCUS_17440 3168 1975 gene locus_tag LOCUS_17450 gene metK 3168 1975 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906191.1 protein_id gnl|my_center|LOCUS_17450 3315 4064 gene locus_tag LOCUS_17460 3315 4064 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906192.1 protein_id gnl|my_center|LOCUS_17460 4476 4126 gene locus_tag LOCUS_17470 4476 4126 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131461.1 protein_id gnl|my_center|LOCUS_17470 4711 4508 gene locus_tag LOCUS_17480 4711 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 5836 4748 gene locus_tag LOCUS_17490 5836 4748 CDS product DUF4097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131459.1 protein_id gnl|my_center|LOCUS_17490 7484 5985 gene locus_tag LOCUS_17500 7484 5985 CDS product amidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379804.1 protein_id gnl|my_center|LOCUS_17500 >Feature sequence104 <1 1438 gene locus_tag LOCUS_17510 <1 1438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548049.1:YSIRK-type signal peptide-containing protein 2178 1702 gene locus_tag LOCUS_17520 2178 1702 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295999.1 protein_id gnl|my_center|LOCUS_17520 2716 2237 gene locus_tag LOCUS_17530 2716 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 2822 3796 gene locus_tag LOCUS_17540 2822 3796 CDS product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755047.1 protein_id gnl|my_center|LOCUS_17540 4269 4871 gene locus_tag LOCUS_17550 4269 4871 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129492.1 protein_id gnl|my_center|LOCUS_17550 4896 5969 gene locus_tag LOCUS_17560 gene prfA 4896 5969 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129495.1 protein_id gnl|my_center|LOCUS_17560 6250 7062 gene locus_tag LOCUS_17570 gene prmC 6250 7062 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905456.1 protein_id gnl|my_center|LOCUS_17570 >Feature sequence105 91 357 gene locus_tag LOCUS_17580 91 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 330 635 gene locus_tag LOCUS_17590 330 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 1219 1815 gene locus_tag LOCUS_17600 1219 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 2292 2594 gene locus_tag LOCUS_17610 2292 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 2980 3543 gene locus_tag LOCUS_17620 2980 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 3787 4344 gene locus_tag LOCUS_17630 3787 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 4853 4455 gene locus_tag LOCUS_17640 gene spx 4853 4455 CDS product transcriptional regulator Spx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129597.1 protein_id gnl|my_center|LOCUS_17640 5560 5030 gene locus_tag LOCUS_17650 5560 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129594.1 protein_id gnl|my_center|LOCUS_17650 6001 5621 gene locus_tag LOCUS_17660 6001 5621 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112904553.1 protein_id gnl|my_center|LOCUS_17660 6119 6718 gene locus_tag LOCUS_17670 gene clpP 6119 6718 CDS product ATP-dependent Clp protease proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613477.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence106 756 139 gene locus_tag LOCUS_17680 756 139 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131603.1 protein_id gnl|my_center|LOCUS_17680 2449 920 gene locus_tag LOCUS_17690 gene ahpF 2449 920 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905291.1 protein_id gnl|my_center|LOCUS_17690 3072 2509 gene locus_tag LOCUS_17700 gene ahpC 3072 2509 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131651.1 protein_id gnl|my_center|LOCUS_17700 3337 3610 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5310 5029 gene locus_tag LOCUS_17710 5310 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131192.1 protein_id gnl|my_center|LOCUS_17710 5859 5311 gene locus_tag LOCUS_17720 5859 5311 CDS product DUF6036 family nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905255.1 protein_id gnl|my_center|LOCUS_17720 7111 5966 gene locus_tag LOCUS_17730 7111 5966 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905558.1 protein_id gnl|my_center|LOCUS_17730 >Feature sequence107 1248 235 gene locus_tag LOCUS_17740 1248 235 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906201.1 protein_id gnl|my_center|LOCUS_17740 3953 1545 gene locus_tag LOCUS_17750 gene pheT 3953 1545 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906202.1 protein_id gnl|my_center|LOCUS_17750 5040 4000 gene locus_tag LOCUS_17760 gene pheS 5040 4000 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254858.1 protein_id gnl|my_center|LOCUS_17760 5335 5642 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6488 5847 gene locus_tag LOCUS_17770 6488 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 6793 6614 gene locus_tag LOCUS_17780 6793 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence108 1373 129 gene locus_tag LOCUS_17790 1373 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 1720 1364 gene locus_tag LOCUS_17800 1720 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837108.1 protein_id gnl|my_center|LOCUS_17800 2005 1724 gene locus_tag LOCUS_17810 2005 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 2622 2098 gene locus_tag LOCUS_17820 2622 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 3652 2810 gene locus_tag LOCUS_17830 3652 2810 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110164.1 protein_id gnl|my_center|LOCUS_17830 4431 4180 gene locus_tag LOCUS_17840 4431 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17840 5345 4452 gene locus_tag LOCUS_17850 gene ugd 5345 4452 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704871.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17850 6704 5379 gene locus_tag LOCUS_17860 gene hasA 6704 5379 CDS product hyaluronan synthase HasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038431685.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence109 102 440 gene locus_tag LOCUS_17870 102 440 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131392.1 protein_id gnl|my_center|LOCUS_17870 693 1124 gene locus_tag LOCUS_17880 693 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 1121 2128 gene locus_tag LOCUS_17890 1121 2128 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905610.1 protein_id gnl|my_center|LOCUS_17890 2121 2753 gene locus_tag LOCUS_17900 2121 2753 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131402.1 protein_id gnl|my_center|LOCUS_17900 3072 3662 gene locus_tag LOCUS_17910 3072 3662 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131404.1 protein_id gnl|my_center|LOCUS_17910 3664 4059 gene locus_tag LOCUS_17920 3664 4059 CDS product CvfD/Ygs/GSP13 family RNA-binding post-transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905611.1 protein_id gnl|my_center|LOCUS_17920 4078 4683 gene locus_tag LOCUS_17930 4078 4683 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131406.1 protein_id gnl|my_center|LOCUS_17930 4789 6111 gene locus_tag LOCUS_17940 4789 6111 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905612.1 protein_id gnl|my_center|LOCUS_17940 6258 6689 gene locus_tag LOCUS_17950 6258 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence110 627 1661 gene locus_tag LOCUS_17960 627 1661 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382358.1 protein_id gnl|my_center|LOCUS_17960 3029 1860 gene locus_tag LOCUS_17970 3029 1860 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905243.1 protein_id gnl|my_center|LOCUS_17970 4491 3295 gene locus_tag LOCUS_17980 4491 3295 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896645.1 protein_id gnl|my_center|LOCUS_17980 5216 4728 gene locus_tag LOCUS_17990 5216 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012898637.1 protein_id gnl|my_center|LOCUS_17990 6123 6035 gene locus_tag LOCUS_t00220 6123 6035 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6183 6472 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6546 6475 gene locus_tag LOCUS_t00230 6546 6475 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence111 157 705 gene locus_tag LOCUS_18000 157 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 1084 773 gene locus_tag LOCUS_18010 1084 773 CDS product DUF960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906371.1 protein_id gnl|my_center|LOCUS_18010 1964 1116 gene locus_tag LOCUS_18020 1964 1116 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906370.1 protein_id gnl|my_center|LOCUS_18020 3107 2274 gene locus_tag LOCUS_18030 gene recX 3107 2274 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906366.1 protein_id gnl|my_center|LOCUS_18030 4124 3306 gene locus_tag LOCUS_18040 4124 3306 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905288.1 protein_id gnl|my_center|LOCUS_18040 4264 4617 gene locus_tag LOCUS_18050 4264 4617 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905289.1 protein_id gnl|my_center|LOCUS_18050 4648 5040 gene locus_tag LOCUS_18060 4648 5040 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905290.1 protein_id gnl|my_center|LOCUS_18060 5142 6647 gene locus_tag LOCUS_18070 gene rlmD 5142 6647 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906363.1 protein_id gnl|my_center|LOCUS_18070 >Feature sequence112 289 1845 gene locus_tag LOCUS_18080 289 1845 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233752.1 protein_id gnl|my_center|LOCUS_18080 2075 3250 gene locus_tag LOCUS_18090 2075 3250 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906133.1 protein_id gnl|my_center|LOCUS_18090 3299 3949 gene locus_tag LOCUS_18100 3299 3949 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906131.1 protein_id gnl|my_center|LOCUS_18100 5283 5556 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence113 351 660 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1205 825 gene locus_tag LOCUS_18110 gene rplQ 1205 825 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130558.1 protein_id gnl|my_center|LOCUS_18110 2159 1221 gene locus_tag LOCUS_18120 2159 1221 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906296.1 protein_id gnl|my_center|LOCUS_18120 2594 2211 gene locus_tag LOCUS_18130 gene rpsK 2594 2211 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906297.1 protein_id gnl|my_center|LOCUS_18130 2977 2612 gene locus_tag LOCUS_18140 gene rpsM 2977 2612 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130555.1 protein_id gnl|my_center|LOCUS_18140 3383 3165 gene locus_tag LOCUS_18150 gene infA 3383 3165 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130554.1 protein_id gnl|my_center|LOCUS_18150 3588 4031 gene locus_tag LOCUS_18160 3588 4031 CDS product zinc-dependent MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906313.1 protein_id gnl|my_center|LOCUS_18160 4052 4774 gene locus_tag LOCUS_18170 4052 4774 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906311.1 protein_id gnl|my_center|LOCUS_18170 4767 5576 gene locus_tag LOCUS_18180 4767 5576 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906310.1 protein_id gnl|my_center|LOCUS_18180 >Feature sequence114 835 272 gene locus_tag LOCUS_18190 835 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 1801 1556 gene locus_tag LOCUS_18200 gene rpsR 1801 1556 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131952.1 protein_id gnl|my_center|LOCUS_18200 2428 1937 gene locus_tag LOCUS_18210 2428 1937 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131953.1 protein_id gnl|my_center|LOCUS_18210 2759 2466 gene locus_tag LOCUS_18220 gene rpsF 2759 2466 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131954.1 protein_id gnl|my_center|LOCUS_18220 3356 3144 gene locus_tag LOCUS_18230 3356 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 3812 5275 gene locus_tag LOCUS_18240 3812 5275 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641236.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence115 1820 108 gene locus_tag LOCUS_18250 1820 108 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836987.1 protein_id gnl|my_center|LOCUS_18250 2557 1976 gene locus_tag LOCUS_18260 2557 1976 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130510.1 protein_id gnl|my_center|LOCUS_18260 3112 2561 gene locus_tag LOCUS_18270 gene coaC 3112 2561 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130511.1 protein_id gnl|my_center|LOCUS_18270 3803 3105 gene locus_tag LOCUS_18280 3803 3105 CDS product phosphopantothenate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130512.1 protein_id gnl|my_center|LOCUS_18280 3945 5234 gene locus_tag LOCUS_18290 3945 5234 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479508.1 protein_id gnl|my_center|LOCUS_18290 5527 5348 gene locus_tag LOCUS_18300 5527 5348 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897588.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence116 57 884 gene locus_tag LOCUS_18310 gene purR 57 884 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906422.1 protein_id gnl|my_center|LOCUS_18310 1777 1103 gene locus_tag LOCUS_18320 gene lepB 1777 1103 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906421.1 protein_id gnl|my_center|LOCUS_18320 2667 1780 gene locus_tag LOCUS_18330 gene rnhC 2667 1780 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906420.1 protein_id gnl|my_center|LOCUS_18330 2848 3294 gene locus_tag LOCUS_18340 gene rplM 2848 3294 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906417.1 protein_id gnl|my_center|LOCUS_18340 3311 3703 gene locus_tag LOCUS_18350 gene rpsI 3311 3703 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254378.1 protein_id gnl|my_center|LOCUS_18350 4082 5530 gene locus_tag LOCUS_18360 gene cls 4082 5530 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379827.1 protein_id gnl|my_center|LOCUS_18360 >Feature sequence117 124 471 gene locus_tag LOCUS_18370 124 471 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_18370 1840 725 gene locus_tag LOCUS_18380 1840 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 3051 1840 gene locus_tag LOCUS_18390 3051 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 3421 3065 gene locus_tag LOCUS_18400 3421 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 5125 3443 gene locus_tag LOCUS_18410 5125 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence118 409 74 gene locus_tag LOCUS_18420 409 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 734 1690 gene locus_tag LOCUS_18430 734 1690 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904591.1 protein_id gnl|my_center|LOCUS_18430 3751 2612 gene locus_tag LOCUS_18440 3751 2612 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836412.1 protein_id gnl|my_center|LOCUS_18440 4476 3820 gene locus_tag LOCUS_18450 4476 3820 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167493974.1 protein_id gnl|my_center|LOCUS_18450 5393 4479 gene locus_tag LOCUS_18460 5393 4479 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254327.1 protein_id gnl|my_center|LOCUS_18460 >Feature sequence119 101 997 gene locus_tag LOCUS_18470 101 997 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906424.1 protein_id gnl|my_center|LOCUS_18470 1016 2404 gene locus_tag LOCUS_18480 1016 2404 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262635.1 protein_id gnl|my_center|LOCUS_18480 3641 2442 gene locus_tag LOCUS_18490 3641 2442 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906423.1 protein_id gnl|my_center|LOCUS_18490 4029 4442 gene locus_tag LOCUS_18500 gene rpsL 4029 4442 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893867.1 protein_id gnl|my_center|LOCUS_18500 4925 5242 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence120 1431 748 gene locus_tag LOCUS_18510 1431 748 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130398.1 protein_id gnl|my_center|LOCUS_18510 2906 1434 gene locus_tag LOCUS_18520 2906 1434 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130400.1 protein_id gnl|my_center|LOCUS_18520 3687 2920 gene locus_tag LOCUS_18530 3687 2920 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906112.1 protein_id gnl|my_center|LOCUS_18530 4129 3971 gene locus_tag LOCUS_18540 4129 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 4311 4165 gene locus_tag LOCUS_18550 4311 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 4880 4326 gene locus_tag LOCUS_18560 gene amaP 4880 4326 CDS product alkaline shock response membrane anchor protein AmaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131026.1 protein_id gnl|my_center|LOCUS_18560 5146 4907 gene locus_tag LOCUS_18570 5146 4907 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131025.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence121 1 516 gene locus_tag LOCUS_18580 1 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 513 1169 gene locus_tag LOCUS_18590 513 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 1173 4232 gene locus_tag LOCUS_18600 1173 4232 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_18600 4473 4719 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence122 3356 747 gene locus_tag LOCUS_18610 3356 747 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905581.1 protein_id gnl|my_center|LOCUS_18610 3469 3801 gene locus_tag LOCUS_18620 3469 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 3996 4679 gene locus_tag LOCUS_18630 3996 4679 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156294863.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence123 734 2158 gene locus_tag LOCUS_18640 734 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 2494 4272 gene locus_tag LOCUS_18650 2494 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 >Feature sequence124 111 1106 gene locus_tag LOCUS_18660 gene ccpA 111 1106 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906075.1 protein_id gnl|my_center|LOCUS_18660 1470 1670 gene locus_tag LOCUS_18670 1470 1670 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293303.1 protein_id gnl|my_center|LOCUS_18670 1673 1912 gene locus_tag LOCUS_18680 1673 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 1923 2612 gene locus_tag LOCUS_18690 gene aroD 1923 2612 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129440.1 protein_id gnl|my_center|LOCUS_18690 2724 4019 gene locus_tag LOCUS_18700 gene purB 2724 4019 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129439.1 protein_id gnl|my_center|LOCUS_18700 4072 4452 gene locus_tag LOCUS_18710 4072 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 >Feature sequence125 901 98 gene locus_tag LOCUS_18720 901 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 1714 917 gene locus_tag LOCUS_18730 1714 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 4499 1704 gene locus_tag LOCUS_18740 4499 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 >Feature sequence126 145 1326 gene locus_tag LOCUS_18750 145 1326 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906400.1 protein_id gnl|my_center|LOCUS_18750 1621 2520 gene locus_tag LOCUS_18760 1621 2520 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357699.1 protein_id gnl|my_center|LOCUS_18760 2513 3784 gene locus_tag LOCUS_18770 2513 3784 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357698.1 protein_id gnl|my_center|LOCUS_18770 4258 3824 gene locus_tag LOCUS_18780 4258 3824 CDS product Spx/MgsR family RNA polymerase-binding regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905585.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence127 1289 225 gene locus_tag LOCUS_18790 1289 225 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131754.1 protein_id gnl|my_center|LOCUS_18790 1929 1654 gene locus_tag LOCUS_18800 1929 1654 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905402.1 protein_id gnl|my_center|LOCUS_18800 2628 2047 gene locus_tag LOCUS_18810 2628 2047 CDS product YpmS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905401.1 protein_id gnl|my_center|LOCUS_18810 3442 2618 gene locus_tag LOCUS_18820 3442 2618 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131499.1 protein_id gnl|my_center|LOCUS_18820 4271 3435 gene locus_tag LOCUS_18830 4271 3435 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014570388.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence128 57 1520 gene locus_tag LOCUS_18840 57 1520 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138892.1 protein_id gnl|my_center|LOCUS_18840 1525 2013 gene locus_tag LOCUS_18850 1525 2013 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905757.1 protein_id gnl|my_center|LOCUS_18850 2016 2840 gene locus_tag LOCUS_18860 gene nadE 2016 2840 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255352.1 protein_id gnl|my_center|LOCUS_18860 2964 4256 gene locus_tag LOCUS_18870 2964 4256 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748796.1 protein_id gnl|my_center|LOCUS_18870 >Feature sequence129 405 1634 gene locus_tag LOCUS_18880 405 1634 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132414.1 protein_id gnl|my_center|LOCUS_18880 1655 2755 gene locus_tag LOCUS_18890 1655 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132415.1 protein_id gnl|my_center|LOCUS_18890 2752 3552 gene locus_tag LOCUS_18900 2752 3552 CDS product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132416.1 protein_id gnl|my_center|LOCUS_18900 4114 3581 gene locus_tag LOCUS_18910 4114 3581 CDS product rRNA large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025017118.1 protein_id gnl|my_center|LOCUS_18910 >Feature sequence130 140 15 gene locus_tag LOCUS_18920 140 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 1612 332 gene locus_tag LOCUS_18930 1612 332 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930426.1 protein_id gnl|my_center|LOCUS_18930 2012 1623 gene locus_tag LOCUS_18940 2012 1623 CDS product DUF1310 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930429.1 protein_id gnl|my_center|LOCUS_18940 2188 2526 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2888 3250 gene locus_tag LOCUS_18950 2888 3250 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130423.1 protein_id gnl|my_center|LOCUS_18950 3480 3800 gene locus_tag LOCUS_18960 3480 3800 CDS product SugE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021723289.1 protein_id gnl|my_center|LOCUS_18960 >Feature sequence131 468 2339 gene locus_tag LOCUS_18970 468 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 2336 3388 gene locus_tag LOCUS_18980 2336 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence132 84 452 gene locus_tag LOCUS_18990 84 452 CDS product DUF1033 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906167.1 protein_id gnl|my_center|LOCUS_18990 601 1161 gene locus_tag LOCUS_19000 601 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 1698 1964 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2748 3041 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3111 3782 gene locus_tag LOCUS_19010 3111 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 >Feature sequence133 819 40 gene locus_tag LOCUS_19020 819 40 CDS product DUF4931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905582.1 protein_id gnl|my_center|LOCUS_19020 983 2104 gene locus_tag LOCUS_19030 gene mnmA 983 2104 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132592.1 protein_id gnl|my_center|LOCUS_19030 2432 3655 gene locus_tag LOCUS_19040 gene rpsA 2432 3655 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132594.1 protein_id gnl|my_center|LOCUS_19040 >Feature sequence134 134 430 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1390 578 gene locus_tag LOCUS_19050 1390 578 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131583.1 protein_id gnl|my_center|LOCUS_19050 2766 1387 gene locus_tag LOCUS_19060 2766 1387 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905315.1 protein_id gnl|my_center|LOCUS_19060 3136 2798 gene locus_tag LOCUS_19070 3136 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 3215 3457 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence135 450 1607 gene locus_tag LOCUS_19080 450 1607 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165992825.1 protein_id gnl|my_center|LOCUS_19080 1472 1583 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1763 1783 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3469 2243 gene locus_tag LOCUS_19090 3469 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 >Feature sequence136 >Feature sequence137 75 1187 gene locus_tag LOCUS_19100 gene purK 75 1187 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906014.1 protein_id gnl|my_center|LOCUS_19100 1218 2021 gene locus_tag LOCUS_19110 1218 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 2294 2638 gene locus_tag LOCUS_19120 2294 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19120 2729 2887 gene locus_tag LOCUS_19130 2729 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 2999 3424 gene locus_tag LOCUS_19140 2999 3424 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131384.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence138 1427 492 gene locus_tag LOCUS_19150 1427 492 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132278.1 protein_id gnl|my_center|LOCUS_19150 1718 2584 gene locus_tag LOCUS_19160 gene accD 1718 2584 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905556.1 protein_id gnl|my_center|LOCUS_19160 2577 3332 gene locus_tag LOCUS_19170 gene accA 2577 3332 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905557.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence139 26 1567 gene locus_tag LOCUS_19180 gene guaA 26 1567 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130105.1 protein_id gnl|my_center|LOCUS_19180 1679 1941 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2505 2125 gene locus_tag LOCUS_19190 2505 2125 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813029.1 protein_id gnl|my_center|LOCUS_19190 2732 2544 gene locus_tag LOCUS_19200 2732 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 2846 3152 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence140 123 893 gene locus_tag LOCUS_19210 123 893 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129618.1 protein_id gnl|my_center|LOCUS_19210 890 1438 gene locus_tag LOCUS_19220 gene rnmV 890 1438 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129620.1 protein_id gnl|my_center|LOCUS_19220 1435 2361 gene locus_tag LOCUS_19230 1435 2361 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287494.1 protein_id gnl|my_center|LOCUS_19230 2354 3124 gene locus_tag LOCUS_19240 2354 3124 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721786.1 protein_id gnl|my_center|LOCUS_19240 >Feature sequence141 1196 1549 gene locus_tag LOCUS_19250 1196 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 1555 2772 gene locus_tag LOCUS_19260 1555 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 2832 3170 gene locus_tag LOCUS_19270 2832 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence142 804 1523 gene locus_tag LOCUS_19280 804 1523 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548691.1 protein_id gnl|my_center|LOCUS_19280 2087 1623 gene locus_tag LOCUS_19290 gene tnpA 2087 1623 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703269.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence143 67 594 gene locus_tag LOCUS_19300 67 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 594 1352 gene locus_tag LOCUS_19310 594 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 1380 3014 gene locus_tag LOCUS_19320 1380 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 >Feature sequence144 1204 281 gene locus_tag LOCUS_19330 1204 281 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132452.1 protein_id gnl|my_center|LOCUS_19330 2496 1216 gene locus_tag LOCUS_19340 2496 1216 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132450.1 protein_id gnl|my_center|LOCUS_19340 3052 2489 gene locus_tag LOCUS_19350 3052 2489 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132449.1 protein_id gnl|my_center|LOCUS_19350 >Feature sequence145 155 544 gene locus_tag LOCUS_19360 155 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 541 1788 gene locus_tag LOCUS_19370 541 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 1800 2117 gene locus_tag LOCUS_19380 1800 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 2127 2387 gene locus_tag LOCUS_19390 2127 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 >Feature sequence146 1473 1 gene locus_tag LOCUS_19400 1473 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 2409 1492 gene locus_tag LOCUS_19410 2409 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 3038 2469 gene locus_tag LOCUS_19420 3038 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 >Feature sequence147 >Feature sequence148 78 3 gene locus_tag LOCUS_t00240 78 3 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 159 85 gene locus_tag LOCUS_t00250 159 85 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1634 474 gene locus_tag LOCUS_19430 1634 474 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_19430 2149 1925 gene locus_tag LOCUS_19440 2149 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 2367 2840 gene locus_tag LOCUS_19450 2367 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence149 838 1043 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1349 2707 gene locus_tag LOCUS_19460 gene dnaA 1349 2707 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905022.1 protein_id gnl|my_center|LOCUS_19460 >Feature sequence150 498 142 gene locus_tag LOCUS_19470 498 142 CDS product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131624.1 protein_id gnl|my_center|LOCUS_19470 856 482 gene locus_tag LOCUS_19480 856 482 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905299.1 protein_id gnl|my_center|LOCUS_19480 1396 2760 gene locus_tag LOCUS_19490 1396 2760 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131627.1 protein_id gnl|my_center|LOCUS_19490 >Feature sequence151 1043 1319 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence152 2521 941 gene locus_tag LOCUS_19500 2521 941 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905296.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence153 2543 729 gene locus_tag LOCUS_19510 2543 729 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918506.1 protein_id gnl|my_center|LOCUS_19510 >Feature sequence154 1388 1194 gene locus_tag LOCUS_19520 1388 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 1858 1397 gene locus_tag LOCUS_19530 1858 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2016 2306 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence155 2098 71 gene locus_tag LOCUS_19540 2098 71 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 protein_id gnl|my_center|LOCUS_19540 2434 2111 gene locus_tag LOCUS_19550 2434 2111 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083485680.1 protein_id gnl|my_center|LOCUS_19550