>Feature sequence01 949 404 gene locus_tag LOCUS_00010 949 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2212 3825 gene locus_tag LOCUS_00020 gene lysS 2212 3825 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066108.1 protein_id gnl|my_center|LOCUS_00020 3891 4523 gene locus_tag LOCUS_00030 3891 4523 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020584.1 protein_id gnl|my_center|LOCUS_00030 4833 4576 gene locus_tag LOCUS_00040 4833 4576 CDS product pro-sigmaK processing inhibitor BofA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020585.1 protein_id gnl|my_center|LOCUS_00040 5486 5028 gene locus_tag LOCUS_00050 5486 5028 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020586.1 protein_id gnl|my_center|LOCUS_00050 8089 5528 gene locus_tag LOCUS_00060 8089 5528 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020587.1 protein_id gnl|my_center|LOCUS_00060 8628 9482 gene locus_tag LOCUS_00070 8628 9482 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048298.1 protein_id gnl|my_center|LOCUS_00070 10044 9661 gene locus_tag LOCUS_00080 10044 9661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020588.1 protein_id gnl|my_center|LOCUS_00080 10575 10261 gene locus_tag LOCUS_00090 10575 10261 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020589.1 protein_id gnl|my_center|LOCUS_00090 11406 10585 gene locus_tag LOCUS_00100 gene hisF 11406 10585 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020590.1 protein_id gnl|my_center|LOCUS_00100 12170 11706 gene locus_tag LOCUS_00110 12170 11706 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020591.1 protein_id gnl|my_center|LOCUS_00110 12997 12275 gene locus_tag LOCUS_00120 12997 12275 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020593.1 protein_id gnl|my_center|LOCUS_00120 13604 12972 gene locus_tag LOCUS_00130 13604 12972 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020594.1 protein_id gnl|my_center|LOCUS_00130 13773 14450 gene locus_tag LOCUS_00140 13773 14450 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169713.1 protein_id gnl|my_center|LOCUS_00140 14447 15187 gene locus_tag LOCUS_00150 gene ribB 14447 15187 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020597.1 protein_id gnl|my_center|LOCUS_00150 15428 16324 gene locus_tag LOCUS_00160 15428 16324 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064910.1 protein_id gnl|my_center|LOCUS_00160 16331 17428 gene locus_tag LOCUS_00170 gene aroC 16331 17428 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_00170 17565 17774 gene locus_tag LOCUS_00180 17565 17774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 18085 19155 gene locus_tag LOCUS_00190 18085 19155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 19465 19866 gene locus_tag LOCUS_00200 19465 19866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024351.1 protein_id gnl|my_center|LOCUS_00200 20736 20512 gene locus_tag LOCUS_00210 20736 20512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 21169 21486 gene locus_tag LOCUS_00220 21169 21486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 21644 22081 gene locus_tag LOCUS_00230 21644 22081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048120149.1 protein_id gnl|my_center|LOCUS_00230 22273 22506 gene locus_tag LOCUS_00240 22273 22506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 22449 23012 gene locus_tag LOCUS_00250 22449 23012 CDS product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990620.1 protein_id gnl|my_center|LOCUS_00250 23442 23119 gene locus_tag LOCUS_00260 23442 23119 CDS product DUF5518 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020856.1 protein_id gnl|my_center|LOCUS_00260 23813 24232 gene locus_tag LOCUS_00270 23813 24232 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064971.1 protein_id gnl|my_center|LOCUS_00270 24355 24624 gene locus_tag LOCUS_00280 24355 24624 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020854.1 protein_id gnl|my_center|LOCUS_00280 24643 25062 gene locus_tag LOCUS_00290 24643 25062 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020853.1 protein_id gnl|my_center|LOCUS_00290 25372 26469 gene locus_tag LOCUS_00300 25372 26469 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020852.1 protein_id gnl|my_center|LOCUS_00300 26553 27188 gene locus_tag LOCUS_00310 26553 27188 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020851.1 protein_id gnl|my_center|LOCUS_00310 27425 27565 gene locus_tag LOCUS_00320 27425 27565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00320 27828 28046 gene locus_tag LOCUS_00330 27828 28046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00330 28916 28356 gene locus_tag LOCUS_00340 28916 28356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 28927 29154 gene locus_tag LOCUS_00350 28927 29154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 30949 30158 gene locus_tag LOCUS_00360 30949 30158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 31675 31445 gene locus_tag LOCUS_00370 31675 31445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 33570 31831 gene locus_tag LOCUS_00380 33570 31831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 33981 33910 gene locus_tag LOCUS_t00010 33981 33910 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 35173 34163 gene locus_tag LOCUS_00390 35173 34163 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020662.1 protein_id gnl|my_center|LOCUS_00390 35889 35233 gene locus_tag LOCUS_00400 35889 35233 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064923.1 protein_id gnl|my_center|LOCUS_00400 37118 36105 gene locus_tag LOCUS_00410 37118 36105 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020659.1 protein_id gnl|my_center|LOCUS_00410 37577 37308 gene locus_tag LOCUS_00420 37577 37308 CDS product Gar1/Naf1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020658.1 protein_id gnl|my_center|LOCUS_00420 37896 40544 gene locus_tag LOCUS_00430 gene ppdK 37896 40544 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020657.1 protein_id gnl|my_center|LOCUS_00430 41823 40861 gene locus_tag LOCUS_00440 41823 40861 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066119.1 protein_id gnl|my_center|LOCUS_00440 43207 41864 gene locus_tag LOCUS_00450 43207 41864 CDS product RNase J family beta-CASP ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020654.1 protein_id gnl|my_center|LOCUS_00450 45254 44157 gene locus_tag LOCUS_00460 gene fni 45254 44157 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020653.1 protein_id gnl|my_center|LOCUS_00460 46039 45257 gene locus_tag LOCUS_00470 46039 45257 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020652.1 protein_id gnl|my_center|LOCUS_00470 47082 46165 gene locus_tag LOCUS_00480 47082 46165 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064922.1 protein_id gnl|my_center|LOCUS_00480 48313 47516 gene locus_tag LOCUS_00490 48313 47516 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020650.1 protein_id gnl|my_center|LOCUS_00490 49130 48384 gene locus_tag LOCUS_00500 gene rpsB 49130 48384 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020649.1 protein_id gnl|my_center|LOCUS_00500 49383 49201 gene locus_tag LOCUS_00510 49383 49201 CDS product DNA-directed RNA polymerase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020648.1 protein_id gnl|my_center|LOCUS_00510 49570 49496 gene locus_tag LOCUS_t00020 49570 49496 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 49760 49572 gene locus_tag LOCUS_00520 49760 49572 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020647.1 protein_id gnl|my_center|LOCUS_00520 50169 49765 gene locus_tag LOCUS_00530 50169 49765 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020646.1 protein_id gnl|my_center|LOCUS_00530 50605 50183 gene locus_tag LOCUS_00540 50605 50183 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020645.1 protein_id gnl|my_center|LOCUS_00540 50996 50616 gene locus_tag LOCUS_00550 50996 50616 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064921.1 protein_id gnl|my_center|LOCUS_00550 51798 53429 gene locus_tag LOCUS_00560 51798 53429 CDS product alpha-keto acid decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020643.1 protein_id gnl|my_center|LOCUS_00560 54045 53542 gene locus_tag LOCUS_00570 54045 53542 CDS product DUF2240 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020642.1 protein_id gnl|my_center|LOCUS_00570 55850 54279 gene locus_tag LOCUS_00580 gene serA 55850 54279 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020641.1 protein_id gnl|my_center|LOCUS_00580 56893 56024 gene locus_tag LOCUS_00590 56893 56024 CDS product RPA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064919.1 protein_id gnl|my_center|LOCUS_00590 58253 56886 gene locus_tag LOCUS_00600 58253 56886 CDS product Single-stranded DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020639.1 protein_id gnl|my_center|LOCUS_00600 58625 59722 gene locus_tag LOCUS_00610 58625 59722 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020637.1 protein_id gnl|my_center|LOCUS_00610 63969 60157 gene locus_tag LOCUS_00620 63969 60157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 66161 64446 gene locus_tag LOCUS_00630 66161 64446 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064918.1 protein_id gnl|my_center|LOCUS_00630 66688 66383 gene locus_tag LOCUS_00640 66688 66383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020635.1 protein_id gnl|my_center|LOCUS_00640 67422 66688 gene locus_tag LOCUS_00650 67422 66688 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020634.1 protein_id gnl|my_center|LOCUS_00650 68276 67497 gene locus_tag LOCUS_00660 68276 67497 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020633.1 protein_id gnl|my_center|LOCUS_00660 69181 68276 gene locus_tag LOCUS_00670 69181 68276 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066118.1 protein_id gnl|my_center|LOCUS_00670 70159 69206 gene locus_tag LOCUS_00680 gene hemC 70159 69206 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020631.1 protein_id gnl|my_center|LOCUS_00680 71467 70193 gene locus_tag LOCUS_00690 gene hemL 71467 70193 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020630.1 protein_id gnl|my_center|LOCUS_00690 72838 71864 gene locus_tag LOCUS_00700 gene hemB 72838 71864 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020627.1 protein_id gnl|my_center|LOCUS_00700 74248 72926 gene locus_tag LOCUS_00710 gene hemA 74248 72926 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020626.1 protein_id gnl|my_center|LOCUS_00710 75189 74515 gene locus_tag LOCUS_00720 75189 74515 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020625.1 protein_id gnl|my_center|LOCUS_00720 75759 75301 gene locus_tag LOCUS_00730 gene ahbB 75759 75301 CDS product siroheme decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064915.1 protein_id gnl|my_center|LOCUS_00730 76314 75766 gene locus_tag LOCUS_00740 76314 75766 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785477.1 protein_id gnl|my_center|LOCUS_00740 77374 76307 gene locus_tag LOCUS_00750 gene ahbD 77374 76307 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_00750 78327 77896 gene locus_tag LOCUS_00760 78327 77896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020620.1 protein_id gnl|my_center|LOCUS_00760 79699 78527 gene locus_tag LOCUS_00770 79699 78527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064972.1 protein_id gnl|my_center|LOCUS_00770 80865 79912 gene locus_tag LOCUS_00780 80865 79912 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020859.1 protein_id gnl|my_center|LOCUS_00780 81635 80871 gene locus_tag LOCUS_00790 81635 80871 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_00790 81911 81654 gene locus_tag LOCUS_00800 81911 81654 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020862.1 protein_id gnl|my_center|LOCUS_00800 83273 82350 gene locus_tag LOCUS_00810 gene mdh 83273 82350 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020863.1 protein_id gnl|my_center|LOCUS_00810 83518 84267 gene locus_tag LOCUS_00820 83518 84267 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020864.1 protein_id gnl|my_center|LOCUS_00820 84540 85304 gene locus_tag LOCUS_00830 84540 85304 CDS product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020865.1 protein_id gnl|my_center|LOCUS_00830 85583 86341 gene locus_tag LOCUS_00840 85583 86341 CDS product NrpR regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020866.1 protein_id gnl|my_center|LOCUS_00840 87881 86481 gene locus_tag LOCUS_00850 87881 86481 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064974.1 protein_id gnl|my_center|LOCUS_00850 88415 87933 gene locus_tag LOCUS_00860 88415 87933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020868.1 protein_id gnl|my_center|LOCUS_00860 89185 88790 gene locus_tag LOCUS_00870 89185 88790 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066143.1 protein_id gnl|my_center|LOCUS_00870 91748 90105 gene locus_tag LOCUS_00880 91748 90105 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020870.1 protein_id gnl|my_center|LOCUS_00880 92605 92030 gene locus_tag LOCUS_00890 92605 92030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020871.1 protein_id gnl|my_center|LOCUS_00890 92768 92944 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 93217 93370 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 94105 96105 gene locus_tag LOCUS_00900 94105 96105 CDS product S-layer protein SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020873.1 protein_id gnl|my_center|LOCUS_00900 96283 96861 gene locus_tag LOCUS_00910 96283 96861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020874.1 protein_id gnl|my_center|LOCUS_00910 98265 97507 gene locus_tag LOCUS_00920 98265 97507 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020876.1 protein_id gnl|my_center|LOCUS_00920 99984 98266 gene locus_tag LOCUS_00930 99984 98266 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064976.1 protein_id gnl|my_center|LOCUS_00930 101291 99987 gene locus_tag LOCUS_00940 101291 99987 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020878.1 protein_id gnl|my_center|LOCUS_00940 101757 101374 gene locus_tag LOCUS_00950 101757 101374 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020879.1 protein_id gnl|my_center|LOCUS_00950 104070 105335 gene locus_tag LOCUS_00960 104070 105335 CDS product GeoRSP system radical SAM/SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044909.1 protein_id gnl|my_center|LOCUS_00960 105453 105678 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 106407 105973 gene locus_tag LOCUS_00970 106407 105973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 106832 107782 gene locus_tag LOCUS_00980 106832 107782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 108561 107959 gene locus_tag LOCUS_00990 108561 107959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 108774 108928 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 109134 109841 gene locus_tag LOCUS_01000 109134 109841 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166537637.1 protein_id gnl|my_center|LOCUS_01000 110090 110533 gene locus_tag LOCUS_01010 110090 110533 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466989.1 protein_id gnl|my_center|LOCUS_01010 110717 111157 gene locus_tag LOCUS_01020 110717 111157 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226147.1 protein_id gnl|my_center|LOCUS_01020 111729 112682 gene locus_tag LOCUS_01030 111729 112682 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020910.1 protein_id gnl|my_center|LOCUS_01030 113509 112784 gene locus_tag LOCUS_01040 113509 112784 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020911.1 protein_id gnl|my_center|LOCUS_01040 114276 113509 gene locus_tag LOCUS_01050 114276 113509 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064988.1 protein_id gnl|my_center|LOCUS_01050 115166 114273 gene locus_tag LOCUS_01060 115166 114273 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020913.1 protein_id gnl|my_center|LOCUS_01060 117023 115254 gene locus_tag LOCUS_01070 117023 115254 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990758.1 protein_id gnl|my_center|LOCUS_01070 118776 117100 gene locus_tag LOCUS_01080 118776 117100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066150.1 protein_id gnl|my_center|LOCUS_01080 122578 118694 gene locus_tag LOCUS_01090 gene cobN 122578 118694 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020916.1 protein_id gnl|my_center|LOCUS_01090 124308 122593 gene locus_tag LOCUS_01100 124308 122593 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020917.1 protein_id gnl|my_center|LOCUS_01100 125848 124313 gene locus_tag LOCUS_01110 125848 124313 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020918.1 protein_id gnl|my_center|LOCUS_01110 126456 125872 gene locus_tag LOCUS_01120 126456 125872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020919.1 protein_id gnl|my_center|LOCUS_01120 126880 128574 gene locus_tag LOCUS_01130 126880 128574 CDS product S-layer protein domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020920.1 protein_id gnl|my_center|LOCUS_01130 128596 130656 gene locus_tag LOCUS_01140 128596 130656 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020921.1 protein_id gnl|my_center|LOCUS_01140 130883 133660 gene locus_tag LOCUS_01150 130883 133660 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064990.1 protein_id gnl|my_center|LOCUS_01150 134012 134902 gene locus_tag LOCUS_01160 134012 134902 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_01160 134934 135824 gene locus_tag LOCUS_01170 gene pstC 134934 135824 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_01170 135827 136684 gene locus_tag LOCUS_01180 gene pstA 135827 136684 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990843.1 protein_id gnl|my_center|LOCUS_01180 136752 137528 gene locus_tag LOCUS_01190 gene pstB 136752 137528 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020934.1 protein_id gnl|my_center|LOCUS_01190 137559 138218 gene locus_tag LOCUS_01200 gene phoU 137559 138218 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020935.1 protein_id gnl|my_center|LOCUS_01200 138389 139795 gene locus_tag LOCUS_01210 138389 139795 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020936.1 protein_id gnl|my_center|LOCUS_01210 140504 139956 gene locus_tag LOCUS_01220 140504 139956 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020937.1 protein_id gnl|my_center|LOCUS_01220 141289 140507 gene locus_tag LOCUS_01230 141289 140507 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020938.1 protein_id gnl|my_center|LOCUS_01230 141557 141291 gene locus_tag LOCUS_01240 gene eif1A 141557 141291 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064992.1 protein_id gnl|my_center|LOCUS_01240 >Feature sequence02 389 3 gene locus_tag LOCUS_01250 389 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 1093 2790 gene locus_tag LOCUS_01260 1093 2790 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027069.1 protein_id gnl|my_center|LOCUS_01260 4033 3569 gene locus_tag LOCUS_01270 4033 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01270 5648 5868 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6335 7051 gene locus_tag LOCUS_01280 6335 7051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01280 10795 8210 gene locus_tag LOCUS_01290 10795 8210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 11157 11492 gene locus_tag LOCUS_01300 11157 11492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01300 11495 11662 gene locus_tag LOCUS_01310 11495 11662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01310 11801 15619 gene locus_tag LOCUS_01320 11801 15619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 15929 17038 gene locus_tag LOCUS_01330 15929 17038 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023369.1 protein_id gnl|my_center|LOCUS_01330 17116 17259 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17661 17846 gene locus_tag LOCUS_01340 17661 17846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065717.1 protein_id gnl|my_center|LOCUS_01340 18110 19177 gene locus_tag LOCUS_01350 gene amrS 18110 19177 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023404.1 protein_id gnl|my_center|LOCUS_01350 19826 19305 gene locus_tag LOCUS_01360 19826 19305 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990650.1 protein_id gnl|my_center|LOCUS_01360 20302 19997 gene locus_tag LOCUS_01370 20302 19997 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990651.1 protein_id gnl|my_center|LOCUS_01370 20861 20592 gene locus_tag LOCUS_01380 20861 20592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 21872 21090 gene locus_tag LOCUS_01390 gene tatC 21872 21090 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023409.1 protein_id gnl|my_center|LOCUS_01390 22560 22735 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23092 23877 gene locus_tag LOCUS_01400 gene tatC 23092 23877 CDS product Sec-independent protein translocase TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023410.1 protein_id gnl|my_center|LOCUS_01400 24507 30101 gene locus_tag LOCUS_01410 24507 30101 CDS product DUF3320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065729.1 protein_id gnl|my_center|LOCUS_01410 30785 30240 gene locus_tag LOCUS_01420 30785 30240 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023416.1 protein_id gnl|my_center|LOCUS_01420 32828 31047 gene locus_tag LOCUS_01430 32828 31047 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023417.1 protein_id gnl|my_center|LOCUS_01430 32933 33120 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35298 33376 gene locus_tag LOCUS_01440 35298 33376 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023418.1 protein_id gnl|my_center|LOCUS_01440 36224 36460 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36937 37893 gene locus_tag LOCUS_01450 36937 37893 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021606.1 protein_id gnl|my_center|LOCUS_01450 37945 38181 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38587 38342 gene locus_tag LOCUS_01460 38587 38342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 38930 39517 gene locus_tag LOCUS_01470 38930 39517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 40299 39538 gene locus_tag LOCUS_01480 40299 39538 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021719.1 protein_id gnl|my_center|LOCUS_01480 40372 40588 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42581 40593 gene locus_tag LOCUS_01490 42581 40593 CDS product DUF460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990592.1 protein_id gnl|my_center|LOCUS_01490 44019 42871 gene locus_tag LOCUS_01500 44019 42871 CDS product serine/threonine-protein kinase RIO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022486.1 protein_id gnl|my_center|LOCUS_01500 45003 44533 gene locus_tag LOCUS_01510 45003 44533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 45281 44922 gene locus_tag LOCUS_01520 45281 44922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 46551 45310 gene locus_tag LOCUS_01530 46551 45310 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066406.1 protein_id gnl|my_center|LOCUS_01530 47390 46542 gene locus_tag LOCUS_01540 47390 46542 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066550.1 protein_id gnl|my_center|LOCUS_01540 48226 47387 gene locus_tag LOCUS_01550 48226 47387 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021156.1 protein_id gnl|my_center|LOCUS_01550 49314 48232 gene locus_tag LOCUS_01560 49314 48232 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065044.1 protein_id gnl|my_center|LOCUS_01560 51067 50567 gene locus_tag LOCUS_01570 51067 50567 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022499.1 protein_id gnl|my_center|LOCUS_01570 52397 51213 gene locus_tag LOCUS_01580 52397 51213 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022500.1 protein_id gnl|my_center|LOCUS_01580 52705 53910 gene locus_tag LOCUS_01590 gene pncB 52705 53910 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022501.1 protein_id gnl|my_center|LOCUS_01590 55474 54191 gene locus_tag LOCUS_01600 55474 54191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 56530 55784 gene locus_tag LOCUS_01610 56530 55784 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022504.1 protein_id gnl|my_center|LOCUS_01610 56985 57446 gene locus_tag LOCUS_01620 56985 57446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01620 57815 59458 gene locus_tag LOCUS_01630 57815 59458 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022506.1 protein_id gnl|my_center|LOCUS_01630 60378 59995 gene locus_tag LOCUS_01640 60378 59995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021374.1 protein_id gnl|my_center|LOCUS_01640 60636 62000 gene locus_tag LOCUS_01650 60636 62000 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021373.1 protein_id gnl|my_center|LOCUS_01650 62724 62374 gene locus_tag LOCUS_01660 gene eif1A 62724 62374 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755900.1 protein_id gnl|my_center|LOCUS_01660 63123 62923 gene locus_tag LOCUS_01670 63123 62923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 64058 63786 gene locus_tag LOCUS_01680 gene eif1A 64058 63786 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021369.1 protein_id gnl|my_center|LOCUS_01680 64779 64573 gene locus_tag LOCUS_01690 64779 64573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 65316 65098 gene locus_tag LOCUS_01700 65316 65098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 65781 67202 gene locus_tag LOCUS_01710 65781 67202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023314.1 protein_id gnl|my_center|LOCUS_01710 67338 67547 gene locus_tag LOCUS_01720 67338 67547 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021362.1 protein_id gnl|my_center|LOCUS_01720 68712 68386 gene locus_tag LOCUS_01730 68712 68386 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065092.1 protein_id gnl|my_center|LOCUS_01730 68940 71276 gene locus_tag LOCUS_01740 68940 71276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 72942 72857 gene locus_tag LOCUS_t00030 72942 72857 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 73036 73791 gene locus_tag LOCUS_01750 73036 73791 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022348.1 protein_id gnl|my_center|LOCUS_01750 73984 74328 gene locus_tag LOCUS_01760 73984 74328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065385.1 protein_id gnl|my_center|LOCUS_01760 75953 74577 gene locus_tag LOCUS_01770 75953 74577 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022352.1 protein_id gnl|my_center|LOCUS_01770 77170 76136 gene locus_tag LOCUS_01780 77170 76136 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022353.1 protein_id gnl|my_center|LOCUS_01780 79574 77178 gene locus_tag LOCUS_01790 79574 77178 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022354.1 protein_id gnl|my_center|LOCUS_01790 80442 81071 gene locus_tag LOCUS_01800 80442 81071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022298.1 protein_id gnl|my_center|LOCUS_01800 82059 81277 gene locus_tag LOCUS_01810 82059 81277 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065422.1 protein_id gnl|my_center|LOCUS_01810 82712 82425 gene locus_tag LOCUS_01820 82712 82425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 82734 83010 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 84534 83704 gene locus_tag LOCUS_01830 84534 83704 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022132.1 protein_id gnl|my_center|LOCUS_01830 86042 84528 gene locus_tag LOCUS_01840 86042 84528 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172728.1 protein_id gnl|my_center|LOCUS_01840 86794 87900 gene locus_tag LOCUS_01850 gene carA 86794 87900 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022130.1 protein_id gnl|my_center|LOCUS_01850 87900 91124 gene locus_tag LOCUS_01860 gene carB 87900 91124 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022129.1 protein_id gnl|my_center|LOCUS_01860 91388 92572 gene locus_tag LOCUS_01870 91388 92572 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022128.1 protein_id gnl|my_center|LOCUS_01870 93089 94525 gene locus_tag LOCUS_01880 93089 94525 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015770.1 protein_id gnl|my_center|LOCUS_01880 94711 95097 gene locus_tag LOCUS_01890 94711 95097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 96302 95748 gene locus_tag LOCUS_01900 96302 95748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 97440 96289 gene locus_tag LOCUS_01910 97440 96289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 99130 98762 gene locus_tag LOCUS_01920 99130 98762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 100740 99133 gene locus_tag LOCUS_01930 100740 99133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 101063 101590 gene locus_tag LOCUS_01940 101063 101590 CDS product PGF-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270488.1 protein_id gnl|my_center|LOCUS_01940 102044 102283 gene locus_tag LOCUS_01950 102044 102283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01950 102628 102440 gene locus_tag LOCUS_01960 102628 102440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065234.1 protein_id gnl|my_center|LOCUS_01960 103726 103334 gene locus_tag LOCUS_01970 103726 103334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 105214 103865 gene locus_tag LOCUS_01980 105214 103865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 105558 105893 gene locus_tag LOCUS_01990 105558 105893 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048170895.1 protein_id gnl|my_center|LOCUS_01990 106275 106435 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 106882 107187 gene locus_tag LOCUS_02000 106882 107187 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022117.1 protein_id gnl|my_center|LOCUS_02000 107230 107601 gene locus_tag LOCUS_02010 107230 107601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 107956 107765 gene locus_tag LOCUS_02020 107956 107765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065234.1 protein_id gnl|my_center|LOCUS_02020 108987 108658 gene locus_tag LOCUS_02030 108987 108658 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020942.1 protein_id gnl|my_center|LOCUS_02030 111964 109493 gene locus_tag LOCUS_02040 111964 109493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 112683 113741 gene locus_tag LOCUS_02050 112683 113741 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065256.1 protein_id gnl|my_center|LOCUS_02050 115100 114564 gene locus_tag LOCUS_02060 115100 114564 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065398.1 protein_id gnl|my_center|LOCUS_02060 116063 116650 gene locus_tag LOCUS_02070 116063 116650 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990826.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02070 117331 116837 gene locus_tag LOCUS_02080 117331 116837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 117866 117702 gene locus_tag LOCUS_02090 117866 117702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 119141 120190 gene locus_tag LOCUS_02100 119141 120190 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755895.1 protein_id gnl|my_center|LOCUS_02100 121604 120297 gene locus_tag LOCUS_02110 121604 120297 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021729.1 protein_id gnl|my_center|LOCUS_02110 122229 121630 gene locus_tag LOCUS_02120 122229 121630 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392451.1 protein_id gnl|my_center|LOCUS_02120 123344 122226 gene locus_tag LOCUS_02130 123344 122226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 123447 123655 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 127926 124750 gene locus_tag LOCUS_02140 gene ileS 127926 124750 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022402.1 protein_id gnl|my_center|LOCUS_02140 128965 128762 gene locus_tag LOCUS_02150 128965 128762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 130338 129235 gene locus_tag LOCUS_02160 130338 129235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022403.1 protein_id gnl|my_center|LOCUS_02160 131494 130592 gene locus_tag LOCUS_02170 131494 130592 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022404.1 protein_id gnl|my_center|LOCUS_02170 133291 131660 gene locus_tag LOCUS_02180 133291 131660 CDS product alternate F1F0 ATPase, F1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022405.1 protein_id gnl|my_center|LOCUS_02180 134357 133353 gene locus_tag LOCUS_02190 134357 133353 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022406.1 protein_id gnl|my_center|LOCUS_02190 134445 134639 gene locus_tag LOCUS_02200 134445 134639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 135380 134685 gene locus_tag LOCUS_02210 135380 134685 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022408.1 protein_id gnl|my_center|LOCUS_02210 135684 135364 gene locus_tag LOCUS_02220 135684 135364 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022409.1 protein_id gnl|my_center|LOCUS_02220 136015 135677 gene locus_tag LOCUS_02230 136015 135677 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022410.1 protein_id gnl|my_center|LOCUS_02230 136412 136008 gene locus_tag LOCUS_02240 136412 136008 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022411.1 protein_id gnl|my_center|LOCUS_02240 137911 136415 gene locus_tag LOCUS_02250 gene atpD 137911 136415 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065404.1 protein_id gnl|my_center|LOCUS_02250 138727 138275 gene locus_tag LOCUS_02260 138727 138275 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022414.1 protein_id gnl|my_center|LOCUS_02260 139179 139391 gene locus_tag LOCUS_02270 139179 139391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022246.1 protein_id gnl|my_center|LOCUS_02270 140386 139637 gene locus_tag LOCUS_02280 140386 139637 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022247.1 protein_id gnl|my_center|LOCUS_02280 >Feature sequence03 222 1631 gene locus_tag LOCUS_02290 222 1631 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065402.1 protein_id gnl|my_center|LOCUS_02290 3222 4007 gene locus_tag LOCUS_02300 3222 4007 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020906.1 protein_id gnl|my_center|LOCUS_02300 4095 6686 gene locus_tag LOCUS_02310 4095 6686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 6708 7121 gene locus_tag LOCUS_02320 6708 7121 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021483.1 protein_id gnl|my_center|LOCUS_02320 7764 7940 gene locus_tag LOCUS_02330 7764 7940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 7980 8288 gene locus_tag LOCUS_02340 7980 8288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02340 9834 8311 gene locus_tag LOCUS_02350 gene pap 9834 8311 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065389.1 protein_id gnl|my_center|LOCUS_02350 12417 11953 gene locus_tag LOCUS_02360 12417 11953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022361.1 protein_id gnl|my_center|LOCUS_02360 13309 13635 gene locus_tag LOCUS_02370 13309 13635 CDS product DUF2551 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065388.1 protein_id gnl|my_center|LOCUS_02370 13676 14077 gene locus_tag LOCUS_02380 13676 14077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022359.1 protein_id gnl|my_center|LOCUS_02380 14208 14280 gene locus_tag LOCUS_t00040 14208 14280 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 15162 16175 gene locus_tag LOCUS_02390 15162 16175 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022067.1 protein_id gnl|my_center|LOCUS_02390 16337 17368 gene locus_tag LOCUS_02400 16337 17368 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022056.1 protein_id gnl|my_center|LOCUS_02400 17898 17404 gene locus_tag LOCUS_02410 17898 17404 CDS product DUF6141 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990822.1 protein_id gnl|my_center|LOCUS_02410 19011 18652 gene locus_tag LOCUS_02420 19011 18652 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022051.1 protein_id gnl|my_center|LOCUS_02420 19642 19175 gene locus_tag LOCUS_02430 19642 19175 CDS product DUF2124 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021715.1 protein_id gnl|my_center|LOCUS_02430 20842 19877 gene locus_tag LOCUS_02440 gene mch 20842 19877 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021714.1 protein_id gnl|my_center|LOCUS_02440 24804 21721 gene locus_tag LOCUS_02450 24804 21721 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022738.1 protein_id gnl|my_center|LOCUS_02450 26491 25958 gene locus_tag LOCUS_02460 26491 25958 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065297.1 protein_id gnl|my_center|LOCUS_02460 26928 26773 gene locus_tag LOCUS_02470 26928 26773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 28418 26904 gene locus_tag LOCUS_02480 28418 26904 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_02480 28682 29356 gene locus_tag LOCUS_02490 28682 29356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 30788 29664 gene locus_tag LOCUS_02500 30788 29664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 33670 30800 gene locus_tag LOCUS_02510 33670 30800 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065303.1 protein_id gnl|my_center|LOCUS_02510 34597 33971 gene locus_tag LOCUS_02520 34597 33971 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065304.1 protein_id gnl|my_center|LOCUS_02520 35625 34873 gene locus_tag LOCUS_02530 35625 34873 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022096.1 protein_id gnl|my_center|LOCUS_02530 36467 35622 gene locus_tag LOCUS_02540 36467 35622 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022097.1 protein_id gnl|my_center|LOCUS_02540 37181 37870 gene locus_tag LOCUS_02550 37181 37870 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182762.1 protein_id gnl|my_center|LOCUS_02550 38543 39277 gene locus_tag LOCUS_02560 gene htpX 38543 39277 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022098.1 protein_id gnl|my_center|LOCUS_02560 39334 39933 gene locus_tag LOCUS_02570 39334 39933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022099.1 protein_id gnl|my_center|LOCUS_02570 40330 40830 gene locus_tag LOCUS_02580 40330 40830 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021966.1 protein_id gnl|my_center|LOCUS_02580 40827 42032 gene locus_tag LOCUS_02590 40827 42032 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984844.1 protein_id gnl|my_center|LOCUS_02590 42178 42380 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42586 43161 gene locus_tag LOCUS_02600 42586 43161 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021963.1 protein_id gnl|my_center|LOCUS_02600 44228 43371 gene locus_tag LOCUS_02610 44228 43371 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082088944.1 protein_id gnl|my_center|LOCUS_02610 45783 44296 gene locus_tag LOCUS_02620 45783 44296 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021961.1 protein_id gnl|my_center|LOCUS_02620 45999 46379 gene locus_tag LOCUS_02630 45999 46379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02630 46722 48737 gene locus_tag LOCUS_02640 46722 48737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 48976 49227 gene locus_tag LOCUS_02650 gene purS 48976 49227 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066286.1 protein_id gnl|my_center|LOCUS_02650 49287 49985 gene locus_tag LOCUS_02660 gene purQ 49287 49985 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021958.1 protein_id gnl|my_center|LOCUS_02660 51940 51671 gene locus_tag LOCUS_02670 51940 51671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 52770 54671 gene locus_tag LOCUS_02680 gene gatE 52770 54671 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022814.1 protein_id gnl|my_center|LOCUS_02680 55118 55501 gene locus_tag LOCUS_02690 55118 55501 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022813.1 protein_id gnl|my_center|LOCUS_02690 56841 57067 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 57070 57426 gene locus_tag LOCUS_02700 57070 57426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 57648 58880 gene locus_tag LOCUS_02710 57648 58880 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022811.1 protein_id gnl|my_center|LOCUS_02710 59844 59359 gene locus_tag LOCUS_02720 59844 59359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065545.1 protein_id gnl|my_center|LOCUS_02720 60948 60031 gene locus_tag LOCUS_02730 60948 60031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 61927 61415 gene locus_tag LOCUS_02740 61927 61415 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023516.1 protein_id gnl|my_center|LOCUS_02740 62232 63236 gene locus_tag LOCUS_02750 gene pta 62232 63236 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023515.1 protein_id gnl|my_center|LOCUS_02750 63355 64581 gene locus_tag LOCUS_02760 63355 64581 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023514.1 protein_id gnl|my_center|LOCUS_02760 65006 65638 gene locus_tag LOCUS_02770 65006 65638 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023510.1 protein_id gnl|my_center|LOCUS_02770 65635 66483 gene locus_tag LOCUS_02780 65635 66483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023509.1 protein_id gnl|my_center|LOCUS_02780 66489 67988 gene locus_tag LOCUS_02790 66489 67988 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023508.1 protein_id gnl|my_center|LOCUS_02790 68212 70392 gene locus_tag LOCUS_02800 68212 70392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 70779 72611 gene locus_tag LOCUS_02810 70779 72611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 73165 74370 gene locus_tag LOCUS_02820 73165 74370 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990734.1 protein_id gnl|my_center|LOCUS_02820 75075 74776 gene locus_tag LOCUS_02830 75075 74776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 74999 76201 gene locus_tag LOCUS_02840 74999 76201 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990734.1 protein_id gnl|my_center|LOCUS_02840 76777 76583 gene locus_tag LOCUS_02850 76777 76583 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023504.1 protein_id gnl|my_center|LOCUS_02850 77160 76864 gene locus_tag LOCUS_02860 77160 76864 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755954.1 protein_id gnl|my_center|LOCUS_02860 78202 77609 gene locus_tag LOCUS_02870 78202 77609 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023502.1 protein_id gnl|my_center|LOCUS_02870 78647 79663 gene locus_tag LOCUS_02880 78647 79663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 80764 80072 gene locus_tag LOCUS_02890 80764 80072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 82032 81808 gene locus_tag LOCUS_02900 82032 81808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 82284 83522 gene locus_tag LOCUS_02910 gene pgk 82284 83522 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023501.1 protein_id gnl|my_center|LOCUS_02910 83981 84580 gene locus_tag LOCUS_02920 83981 84580 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023500.1 protein_id gnl|my_center|LOCUS_02920 84918 85217 gene locus_tag LOCUS_02930 84918 85217 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065930.1 protein_id gnl|my_center|LOCUS_02930 85863 85459 gene locus_tag LOCUS_02940 85863 85459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02940 86205 86360 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 87728 86391 gene locus_tag LOCUS_02950 87728 86391 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289743.1 protein_id gnl|my_center|LOCUS_02950 89141 88176 gene locus_tag LOCUS_02960 89141 88176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023486.1 protein_id gnl|my_center|LOCUS_02960 90367 89897 gene locus_tag LOCUS_02970 90367 89897 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023498.1 protein_id gnl|my_center|LOCUS_02970 90843 91718 gene locus_tag LOCUS_02980 90843 91718 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022522.1 protein_id gnl|my_center|LOCUS_02980 92253 91876 gene locus_tag LOCUS_02990 92253 91876 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064788.1 protein_id gnl|my_center|LOCUS_02990 92789 93574 gene locus_tag LOCUS_03000 gene thiM 92789 93574 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022683.1 protein_id gnl|my_center|LOCUS_03000 93617 94279 gene locus_tag LOCUS_03010 gene thiE 93617 94279 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022682.1 protein_id gnl|my_center|LOCUS_03010 94982 96394 gene locus_tag LOCUS_03020 94982 96394 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021139.1 protein_id gnl|my_center|LOCUS_03020 97360 97010 gene locus_tag LOCUS_03030 97360 97010 CDS product DUF2173 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022242.1 protein_id gnl|my_center|LOCUS_03030 97712 98485 gene locus_tag LOCUS_03040 97712 98485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065347.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03040 98552 98740 gene locus_tag LOCUS_03050 98552 98740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03050 99155 101845 gene locus_tag LOCUS_03060 99155 101845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 102060 102743 gene locus_tag LOCUS_03070 102060 102743 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022238.1 protein_id gnl|my_center|LOCUS_03070 103036 104130 gene locus_tag LOCUS_03080 103036 104130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990836.1 protein_id gnl|my_center|LOCUS_03080 104419 104823 gene locus_tag LOCUS_03090 104419 104823 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021844.1 protein_id gnl|my_center|LOCUS_03090 105726 105923 gene locus_tag LOCUS_03100 105726 105923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 108278 106062 gene locus_tag LOCUS_03110 108278 106062 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022836.1 protein_id gnl|my_center|LOCUS_03110 108712 108488 gene locus_tag LOCUS_03120 108712 108488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 110489 109305 gene locus_tag LOCUS_03130 110489 109305 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_03130 111938 110568 gene locus_tag LOCUS_03140 111938 110568 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022297.1 protein_id gnl|my_center|LOCUS_03140 112036 112206 gene locus_tag LOCUS_03150 112036 112206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 113024 113329 gene locus_tag LOCUS_03160 113024 113329 CDS product MscL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022264.1 protein_id gnl|my_center|LOCUS_03160 114700 113543 gene locus_tag LOCUS_03170 114700 113543 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021256.1 protein_id gnl|my_center|LOCUS_03170 115386 114703 gene locus_tag LOCUS_03180 gene modB 115386 114703 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021257.1 protein_id gnl|my_center|LOCUS_03180 116188 115397 gene locus_tag LOCUS_03190 gene modA 116188 115397 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022259.1 protein_id gnl|my_center|LOCUS_03190 117215 116385 gene locus_tag LOCUS_03200 117215 116385 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022258.1 protein_id gnl|my_center|LOCUS_03200 117576 117941 gene locus_tag LOCUS_03210 117576 117941 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_03210 119738 118185 gene locus_tag LOCUS_03220 119738 118185 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022292.1 protein_id gnl|my_center|LOCUS_03220 120125 119760 gene locus_tag LOCUS_03230 120125 119760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022293.1 protein_id gnl|my_center|LOCUS_03230 122898 121222 gene locus_tag LOCUS_03240 gene glgP 122898 121222 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021875.1 protein_id gnl|my_center|LOCUS_03240 123308 124303 gene locus_tag LOCUS_03250 123308 124303 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022527.1 protein_id gnl|my_center|LOCUS_03250 124768 125208 gene locus_tag LOCUS_03260 124768 125208 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065436.1 protein_id gnl|my_center|LOCUS_03260 125938 125363 gene locus_tag LOCUS_03270 125938 125363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 126726 127130 gene locus_tag LOCUS_03280 126726 127130 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022524.1 protein_id gnl|my_center|LOCUS_03280 127221 127442 gene locus_tag LOCUS_03290 127221 127442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022523.1 protein_id gnl|my_center|LOCUS_03290 129416 127827 gene locus_tag LOCUS_03300 129416 127827 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022533.1 protein_id gnl|my_center|LOCUS_03300 130081 130830 gene locus_tag LOCUS_03310 130081 130830 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022780.1 protein_id gnl|my_center|LOCUS_03310 130999 131175 gene locus_tag LOCUS_03320 130999 131175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 131732 135103 gene locus_tag LOCUS_03330 131732 135103 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022778.1 protein_id gnl|my_center|LOCUS_03330 135335 136648 gene locus_tag LOCUS_03340 gene thiI 135335 136648 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021480.1 protein_id gnl|my_center|LOCUS_03340 136659 136973 gene locus_tag LOCUS_03350 136659 136973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03350 137041 137862 gene locus_tag LOCUS_03360 137041 137862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03360 138587 137934 gene locus_tag LOCUS_03370 138587 137934 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022274.1 protein_id gnl|my_center|LOCUS_03370 138922 139284 gene locus_tag LOCUS_03380 138922 139284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990864.1 protein_id gnl|my_center|LOCUS_03380 139802 139581 gene locus_tag LOCUS_03390 139802 139581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 >Feature sequence04 <1 876 gene locus_tag LOCUS_03400 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_054297574.1:IS200/IS605 family element RNA-guided endonuclease TnpB 1278 1568 gene locus_tag LOCUS_03410 1278 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 1903 2085 gene locus_tag LOCUS_03420 1903 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 2395 4359 gene locus_tag LOCUS_03430 2395 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 5079 5008 gene locus_tag LOCUS_t00050 5079 5008 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5798 5286 gene locus_tag LOCUS_03440 5798 5286 CDS product chorismate pyruvate-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024074.1 protein_id gnl|my_center|LOCUS_03440 6180 5866 gene locus_tag LOCUS_03450 6180 5866 CDS product DUF5611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065922.1 protein_id gnl|my_center|LOCUS_03450 6947 7255 gene locus_tag LOCUS_03460 6947 7255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065924.1 protein_id gnl|my_center|LOCUS_03460 8406 7405 gene locus_tag LOCUS_03470 8406 7405 CDS product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024078.1 protein_id gnl|my_center|LOCUS_03470 8642 8818 gene locus_tag LOCUS_03480 8642 8818 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024079.1 protein_id gnl|my_center|LOCUS_03480 9955 8990 gene locus_tag LOCUS_03490 gene nifB 9955 8990 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024080.1 protein_id gnl|my_center|LOCUS_03490 10640 10287 gene locus_tag LOCUS_03500 gene queD 10640 10287 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065925.1 protein_id gnl|my_center|LOCUS_03500 11492 10725 gene locus_tag LOCUS_03510 11492 10725 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024082.1 protein_id gnl|my_center|LOCUS_03510 12052 11492 gene locus_tag LOCUS_03520 12052 11492 CDS product DUF366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024083.1 protein_id gnl|my_center|LOCUS_03520 12816 12112 gene locus_tag LOCUS_03530 gene queC 12816 12112 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024084.1 protein_id gnl|my_center|LOCUS_03530 13289 13789 gene locus_tag LOCUS_03540 13289 13789 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024085.1 protein_id gnl|my_center|LOCUS_03540 14128 14457 gene locus_tag LOCUS_03550 14128 14457 CDS product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024086.1 protein_id gnl|my_center|LOCUS_03550 15552 14572 gene locus_tag LOCUS_03560 gene arsB 15552 14572 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393695.1 protein_id gnl|my_center|LOCUS_03560 16011 15673 gene locus_tag LOCUS_03570 16011 15673 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890787.1 protein_id gnl|my_center|LOCUS_03570 16028 16249 gene locus_tag LOCUS_03580 16028 16249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 16970 16506 gene locus_tag LOCUS_03590 16970 16506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990576.1 protein_id gnl|my_center|LOCUS_03590 17952 17308 gene locus_tag LOCUS_03600 17952 17308 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024137.1 protein_id gnl|my_center|LOCUS_03600 18537 17956 gene locus_tag LOCUS_03610 18537 17956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 18899 19240 gene locus_tag LOCUS_03620 18899 19240 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023848.1 protein_id gnl|my_center|LOCUS_03620 19635 19294 gene locus_tag LOCUS_03630 19635 19294 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023849.1 protein_id gnl|my_center|LOCUS_03630 19940 19797 gene locus_tag LOCUS_03640 19940 19797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 20349 21146 gene locus_tag LOCUS_03650 20349 21146 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066548.1 protein_id gnl|my_center|LOCUS_03650 21464 22261 gene locus_tag LOCUS_03660 21464 22261 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860357.1 protein_id gnl|my_center|LOCUS_03660 22300 22680 gene locus_tag LOCUS_03670 22300 22680 CDS product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755961.1 protein_id gnl|my_center|LOCUS_03670 22723 23067 gene locus_tag LOCUS_03680 22723 23067 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023823.1 protein_id gnl|my_center|LOCUS_03680 23104 23403 gene locus_tag LOCUS_03690 gene tusB 23104 23403 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023824.1 protein_id gnl|my_center|LOCUS_03690 23532 23828 gene locus_tag LOCUS_03700 23532 23828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023825.1 protein_id gnl|my_center|LOCUS_03700 23994 24383 gene locus_tag LOCUS_03710 23994 24383 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023042.1 protein_id gnl|my_center|LOCUS_03710 25337 24438 gene locus_tag LOCUS_03720 25337 24438 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107120.1 protein_id gnl|my_center|LOCUS_03720 25885 25496 gene locus_tag LOCUS_03730 25885 25496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 26465 26166 gene locus_tag LOCUS_03740 26465 26166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 26725 27027 gene locus_tag LOCUS_03750 26725 27027 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023836.1 protein_id gnl|my_center|LOCUS_03750 27967 27221 gene locus_tag LOCUS_03760 gene arsM 27967 27221 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023683.1 protein_id gnl|my_center|LOCUS_03760 29612 28173 gene locus_tag LOCUS_03770 29612 28173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 30801 30124 gene locus_tag LOCUS_03780 gene hypB 30801 30124 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860109.1 protein_id gnl|my_center|LOCUS_03780 32667 30922 gene locus_tag LOCUS_03790 gene arsA 32667 30922 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272721.1 protein_id gnl|my_center|LOCUS_03790 33062 32673 gene locus_tag LOCUS_03800 gene arsD 33062 32673 CDS product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948467.1 protein_id gnl|my_center|LOCUS_03800 35286 33355 gene locus_tag LOCUS_03810 35286 33355 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024088.1 protein_id gnl|my_center|LOCUS_03810 35530 35691 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35853 36554 gene locus_tag LOCUS_03820 35853 36554 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024089.1 protein_id gnl|my_center|LOCUS_03820 37053 37163 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39036 37351 gene locus_tag LOCUS_03830 39036 37351 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015951.1 protein_id gnl|my_center|LOCUS_03830 40146 39688 gene locus_tag LOCUS_03840 40146 39688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065853.1 protein_id gnl|my_center|LOCUS_03840 41030 40674 gene locus_tag LOCUS_03850 41030 40674 CDS product ech hydrogenase subunit EchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937736.1 protein_id gnl|my_center|LOCUS_03850 42123 41047 gene locus_tag LOCUS_03860 42123 41047 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937737.1 protein_id gnl|my_center|LOCUS_03860 42487 42146 gene locus_tag LOCUS_03870 42487 42146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 42950 42480 gene locus_tag LOCUS_03880 42950 42480 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937739.1 protein_id gnl|my_center|LOCUS_03880 43835 42966 gene locus_tag LOCUS_03890 43835 42966 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937740.1 protein_id gnl|my_center|LOCUS_03890 45736 43832 gene locus_tag LOCUS_03900 45736 43832 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937741.1 protein_id gnl|my_center|LOCUS_03900 47555 47322 gene locus_tag LOCUS_03910 47555 47322 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023834.1 protein_id gnl|my_center|LOCUS_03910 48727 47675 gene locus_tag LOCUS_03920 48727 47675 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023833.1 protein_id gnl|my_center|LOCUS_03920 49119 50000 gene locus_tag LOCUS_03930 49119 50000 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023811.1 protein_id gnl|my_center|LOCUS_03930 50050 50293 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 50323 53076 gene locus_tag LOCUS_03940 50323 53076 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023810.1 protein_id gnl|my_center|LOCUS_03940 53238 54428 gene locus_tag LOCUS_03950 53238 54428 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023790.1 protein_id gnl|my_center|LOCUS_03950 54943 54584 gene locus_tag LOCUS_03960 54943 54584 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023788.1 protein_id gnl|my_center|LOCUS_03960 56007 55105 gene locus_tag LOCUS_03970 56007 55105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023787.1 protein_id gnl|my_center|LOCUS_03970 57639 56206 gene locus_tag LOCUS_03980 gene pyk 57639 56206 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066546.1 protein_id gnl|my_center|LOCUS_03980 58636 57713 gene locus_tag LOCUS_03990 58636 57713 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065835.1 protein_id gnl|my_center|LOCUS_03990 59157 59085 gene locus_tag LOCUS_t00060 59157 59085 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 59305 59231 gene locus_tag LOCUS_t00070 59305 59231 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 59483 59411 gene locus_tag LOCUS_t00080 59483 59411 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 61923 60874 gene locus_tag LOCUS_04000 61923 60874 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023783.1 protein_id gnl|my_center|LOCUS_04000 63994 62552 gene locus_tag LOCUS_04010 gene proS 63994 62552 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023782.1 protein_id gnl|my_center|LOCUS_04010 64960 64391 gene locus_tag LOCUS_04020 64960 64391 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023781.1 protein_id gnl|my_center|LOCUS_04020 65454 65032 gene locus_tag LOCUS_04030 gene sepF 65454 65032 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023780.1 protein_id gnl|my_center|LOCUS_04030 66029 65592 gene locus_tag LOCUS_04040 66029 65592 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023779.1 protein_id gnl|my_center|LOCUS_04040 67384 66236 gene locus_tag LOCUS_04050 67384 66236 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066545.1 protein_id gnl|my_center|LOCUS_04050 68711 67566 gene locus_tag LOCUS_04060 68711 67566 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065833.1 protein_id gnl|my_center|LOCUS_04060 72148 69659 gene locus_tag LOCUS_04070 72148 69659 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 protein_id gnl|my_center|LOCUS_04070 72759 74792 gene locus_tag LOCUS_04080 72759 74792 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066544.1 protein_id gnl|my_center|LOCUS_04080 75646 75188 gene locus_tag LOCUS_04090 75646 75188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023774.1 protein_id gnl|my_center|LOCUS_04090 77163 75682 gene locus_tag LOCUS_04100 77163 75682 CDS product dihydropteroate synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023773.1 protein_id gnl|my_center|LOCUS_04100 78471 77290 gene locus_tag LOCUS_04110 gene ftsZ 78471 77290 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023772.1 protein_id gnl|my_center|LOCUS_04110 79596 80258 gene locus_tag LOCUS_04120 79596 80258 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065832.1 protein_id gnl|my_center|LOCUS_04120 82227 80314 gene locus_tag LOCUS_04130 82227 80314 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023770.1 protein_id gnl|my_center|LOCUS_04130 82971 82336 gene locus_tag LOCUS_04140 gene psmB 82971 82336 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023769.1 protein_id gnl|my_center|LOCUS_04140 83762 83250 gene locus_tag LOCUS_04150 83762 83250 CDS product TIGR00295 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023768.1 protein_id gnl|my_center|LOCUS_04150 84266 83772 gene locus_tag LOCUS_04160 84266 83772 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066543.1 protein_id gnl|my_center|LOCUS_04160 85573 84350 gene locus_tag LOCUS_04170 85573 84350 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023766.1 protein_id gnl|my_center|LOCUS_04170 86466 85594 gene locus_tag LOCUS_04180 86466 85594 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023765.1 protein_id gnl|my_center|LOCUS_04180 87681 87827 gene locus_tag LOCUS_04190 87681 87827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 87919 88200 gene locus_tag LOCUS_04200 87919 88200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 89813 89415 gene locus_tag LOCUS_04210 89813 89415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04210 91229 90354 gene locus_tag LOCUS_04220 91229 90354 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021142.1 protein_id gnl|my_center|LOCUS_04220 92984 91578 gene locus_tag LOCUS_04230 gene acsC 92984 91578 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021046.1 protein_id gnl|my_center|LOCUS_04230 94301 92988 gene locus_tag LOCUS_04240 gene cdhD 94301 92988 CDS product CO dehydrogenase/acetyl-CoA synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023762.1 protein_id gnl|my_center|LOCUS_04240 95310 94549 gene locus_tag LOCUS_04250 95310 94549 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023761.1 protein_id gnl|my_center|LOCUS_04250 96781 95366 gene locus_tag LOCUS_04260 gene cdhC 96781 95366 CDS product CO dehydrogenase/CO-methylating acetyl-CoA synthase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021049.1 protein_id gnl|my_center|LOCUS_04260 97318 96806 gene locus_tag LOCUS_04270 gene cdhB 97318 96806 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023759.1 protein_id gnl|my_center|LOCUS_04270 99723 97321 gene locus_tag LOCUS_04280 gene cdhA 99723 97321 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023758.1 protein_id gnl|my_center|LOCUS_04280 101197 101820 gene locus_tag LOCUS_04290 101197 101820 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990667.1 protein_id gnl|my_center|LOCUS_04290 101979 102239 gene locus_tag LOCUS_04300 101979 102239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04300 102687 103271 gene locus_tag LOCUS_04310 102687 103271 CDS product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065830.1 protein_id gnl|my_center|LOCUS_04310 104334 103357 gene locus_tag LOCUS_04320 104334 103357 CDS product methanogenesis marker 12 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023754.1 protein_id gnl|my_center|LOCUS_04320 104744 104358 gene locus_tag LOCUS_04330 104744 104358 CDS product DUF2103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065829.1 protein_id gnl|my_center|LOCUS_04330 105456 105007 gene locus_tag LOCUS_04340 105456 105007 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023752.1 protein_id gnl|my_center|LOCUS_04340 107048 105744 gene locus_tag LOCUS_04350 107048 105744 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023751.1 protein_id gnl|my_center|LOCUS_04350 108547 107543 gene locus_tag LOCUS_04360 108547 107543 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023750.1 protein_id gnl|my_center|LOCUS_04360 109037 108684 gene locus_tag LOCUS_04370 109037 108684 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023749.1 protein_id gnl|my_center|LOCUS_04370 109602 110675 gene locus_tag LOCUS_04380 109602 110675 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065828.1 protein_id gnl|my_center|LOCUS_04380 111458 110901 gene locus_tag LOCUS_04390 111458 110901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 112248 111448 gene locus_tag LOCUS_04400 gene gvpL 112248 111448 CDS product gas vesicle protein GvpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890528.1 protein_id gnl|my_center|LOCUS_04400 112561 112205 gene locus_tag LOCUS_04410 112561 112205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 113242 112589 gene locus_tag LOCUS_04420 113242 112589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 113674 113276 gene locus_tag LOCUS_04430 113674 113276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 114129 113815 gene locus_tag LOCUS_04440 114129 113815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 114385 114104 gene locus_tag LOCUS_04450 gene gvpG 114385 114104 CDS product gas vesicle protein GvpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890523.1 protein_id gnl|my_center|LOCUS_04450 115044 114385 gene locus_tag LOCUS_04460 gene gvpF 115044 114385 CDS product gas vesicle protein GvpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890522.1 protein_id gnl|my_center|LOCUS_04460 115518 115234 gene locus_tag LOCUS_04470 115518 115234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 115942 115706 gene locus_tag LOCUS_04480 115942 115706 CDS product gas vesicle structural protein GvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904108.1 protein_id gnl|my_center|LOCUS_04480 116647 117039 gene locus_tag LOCUS_04490 116647 117039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 117207 117800 gene locus_tag LOCUS_04500 117207 117800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 118467 119042 gene locus_tag LOCUS_04510 118467 119042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 120458 120601 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 121184 122323 gene locus_tag LOCUS_04520 gene tnpB 121184 122323 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_04520 122617 122796 gene locus_tag LOCUS_04530 122617 122796 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004257.1 protein_id gnl|my_center|LOCUS_04530 123741 125159 gene locus_tag LOCUS_04540 123741 125159 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589535.1 protein_id gnl|my_center|LOCUS_04540 125441 127207 gene locus_tag LOCUS_04550 125441 127207 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_04550 127207 127692 gene locus_tag LOCUS_04560 gene ilvN 127207 127692 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_04560 128060 129067 gene locus_tag LOCUS_04570 gene ilvC 128060 129067 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023690.1 protein_id gnl|my_center|LOCUS_04570 129167 129709 gene locus_tag LOCUS_04580 129167 129709 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023689.1 protein_id gnl|my_center|LOCUS_04580 129943 130014 gene locus_tag LOCUS_t00090 129943 130014 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 131049 130690 gene locus_tag LOCUS_04590 131049 130690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 >Feature sequence05 1719 265 gene locus_tag LOCUS_04600 1719 265 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022909.1 protein_id gnl|my_center|LOCUS_04600 2191 2117 gene locus_tag LOCUS_t00100 2191 2117 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2479 3243 gene locus_tag LOCUS_04610 2479 3243 CDS product A24 family peptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023041.1 protein_id gnl|my_center|LOCUS_04610 3910 3323 gene locus_tag LOCUS_04620 3910 3323 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020569.1 protein_id gnl|my_center|LOCUS_04620 4993 3974 gene locus_tag LOCUS_04630 4993 3974 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020570.1 protein_id gnl|my_center|LOCUS_04630 5273 5430 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8128 6014 gene locus_tag LOCUS_04640 gene mutL 8128 6014 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020571.1 protein_id gnl|my_center|LOCUS_04640 10884 8182 gene locus_tag LOCUS_04650 gene mutS 10884 8182 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020572.1 protein_id gnl|my_center|LOCUS_04650 13542 11932 gene locus_tag LOCUS_04660 gene groL 13542 11932 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020679.1 protein_id gnl|my_center|LOCUS_04660 13942 13664 gene locus_tag LOCUS_04670 gene groES 13942 13664 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020678.1 protein_id gnl|my_center|LOCUS_04670 14179 14586 gene locus_tag LOCUS_04680 14179 14586 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020677.1 protein_id gnl|my_center|LOCUS_04680 14749 15873 gene locus_tag LOCUS_04690 14749 15873 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020676.1 protein_id gnl|my_center|LOCUS_04690 18005 16056 gene locus_tag LOCUS_04700 18005 16056 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064929.1 protein_id gnl|my_center|LOCUS_04700 18948 18151 gene locus_tag LOCUS_04710 18948 18151 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066121.1 protein_id gnl|my_center|LOCUS_04710 19503 19721 gene locus_tag LOCUS_04720 19503 19721 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066120.1 protein_id gnl|my_center|LOCUS_04720 19756 19931 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20603 20001 gene locus_tag LOCUS_04730 20603 20001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020671.1 protein_id gnl|my_center|LOCUS_04730 20994 20773 gene locus_tag LOCUS_04740 20994 20773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 21033 21173 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22011 22268 gene locus_tag LOCUS_04750 22011 22268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 23422 23558 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23899 24558 gene locus_tag LOCUS_04760 23899 24558 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064926.1 protein_id gnl|my_center|LOCUS_04760 24610 26058 gene locus_tag LOCUS_04770 24610 26058 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877102.1 protein_id gnl|my_center|LOCUS_04770 26241 26939 gene locus_tag LOCUS_04780 26241 26939 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064925.1 protein_id gnl|my_center|LOCUS_04780 27102 28190 gene locus_tag LOCUS_04790 gene wtpA 27102 28190 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020338.1 protein_id gnl|my_center|LOCUS_04790 28297 29115 gene locus_tag LOCUS_04800 28297 29115 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020339.1 protein_id gnl|my_center|LOCUS_04800 29102 30151 gene locus_tag LOCUS_04810 29102 30151 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020340.1 protein_id gnl|my_center|LOCUS_04810 30166 30717 gene locus_tag LOCUS_04820 30166 30717 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020341.1 protein_id gnl|my_center|LOCUS_04820 31976 30918 gene locus_tag LOCUS_04830 31976 30918 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064850.1 protein_id gnl|my_center|LOCUS_04830 33075 31969 gene locus_tag LOCUS_04840 33075 31969 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020343.1 protein_id gnl|my_center|LOCUS_04840 35375 33105 gene locus_tag LOCUS_04850 35375 33105 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020344.1 protein_id gnl|my_center|LOCUS_04850 35752 36522 gene locus_tag LOCUS_04860 35752 36522 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020345.1 protein_id gnl|my_center|LOCUS_04860 36652 37314 gene locus_tag LOCUS_04870 36652 37314 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064852.1 protein_id gnl|my_center|LOCUS_04870 37389 37712 gene locus_tag LOCUS_04880 37389 37712 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020348.1 protein_id gnl|my_center|LOCUS_04880 38172 37864 gene locus_tag LOCUS_04890 38172 37864 CDS product signal recognition particle protein Srp19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066074.1 protein_id gnl|my_center|LOCUS_04890 38328 38585 gene locus_tag LOCUS_04900 38328 38585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020351.1 protein_id gnl|my_center|LOCUS_04900 38822 39664 gene locus_tag LOCUS_04910 38822 39664 CDS product DUF5803 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990720.1 protein_id gnl|my_center|LOCUS_04910 39797 40477 gene locus_tag LOCUS_04920 39797 40477 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990721.1 protein_id gnl|my_center|LOCUS_04920 40935 41537 gene locus_tag LOCUS_04930 40935 41537 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990722.1 protein_id gnl|my_center|LOCUS_04930 41556 42596 gene locus_tag LOCUS_04940 41556 42596 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020363.1 protein_id gnl|my_center|LOCUS_04940 42597 44351 gene locus_tag LOCUS_04950 42597 44351 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020364.1 protein_id gnl|my_center|LOCUS_04950 44356 45222 gene locus_tag LOCUS_04960 44356 45222 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020365.1 protein_id gnl|my_center|LOCUS_04960 45233 45628 gene locus_tag LOCUS_04970 45233 45628 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020366.1 protein_id gnl|my_center|LOCUS_04970 45631 46932 gene locus_tag LOCUS_04980 45631 46932 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020367.1 protein_id gnl|my_center|LOCUS_04980 47826 47098 gene locus_tag LOCUS_04990 47826 47098 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023847.1 protein_id gnl|my_center|LOCUS_04990 49067 49390 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 49406 49609 gene locus_tag LOCUS_05000 49406 49609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 49999 51078 gene locus_tag LOCUS_05010 49999 51078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 52428 52781 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 53915 53085 gene locus_tag LOCUS_05020 53915 53085 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020379.1 protein_id gnl|my_center|LOCUS_05020 54758 53967 gene locus_tag LOCUS_05030 54758 53967 CDS product nicotinate-nucleotide pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064859.1 protein_id gnl|my_center|LOCUS_05030 55880 54819 gene locus_tag LOCUS_05040 55880 54819 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020381.1 protein_id gnl|my_center|LOCUS_05040 56755 55877 gene locus_tag LOCUS_05050 56755 55877 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020382.1 protein_id gnl|my_center|LOCUS_05050 57561 56743 gene locus_tag LOCUS_05060 gene modA 57561 56743 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020383.1 protein_id gnl|my_center|LOCUS_05060 58951 57968 gene locus_tag LOCUS_05070 58951 57968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 59347 59165 gene locus_tag LOCUS_05080 59347 59165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 61188 60532 gene locus_tag LOCUS_05090 61188 60532 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020384.1 protein_id gnl|my_center|LOCUS_05090 62304 61729 gene locus_tag LOCUS_05100 gene hisB 62304 61729 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020277.1 protein_id gnl|my_center|LOCUS_05100 63291 62548 gene locus_tag LOCUS_05110 gene hisA 63291 62548 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020276.1 protein_id gnl|my_center|LOCUS_05110 64232 63363 gene locus_tag LOCUS_05120 gene hisG 64232 63363 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020275.1 protein_id gnl|my_center|LOCUS_05120 64626 65822 gene locus_tag LOCUS_05130 64626 65822 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020274.1 protein_id gnl|my_center|LOCUS_05130 65908 66108 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 66428 66501 gene locus_tag LOCUS_t00110 66428 66501 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 66731 67003 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 67230 67464 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 68590 69480 gene locus_tag LOCUS_05140 gene map 68590 69480 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020270.1 protein_id gnl|my_center|LOCUS_05140 69548 69645 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 69969 70121 gene locus_tag LOCUS_05150 69969 70121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 70149 70436 gene locus_tag LOCUS_05160 70149 70436 CDS product YunC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066065.1 protein_id gnl|my_center|LOCUS_05160 71871 72917 gene locus_tag LOCUS_05170 71871 72917 CDS product TRM11 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020267.1 protein_id gnl|my_center|LOCUS_05170 73735 72926 gene locus_tag LOCUS_05180 gene truA 73735 72926 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020266.1 protein_id gnl|my_center|LOCUS_05180 74664 73744 gene locus_tag LOCUS_05190 74664 73744 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020265.1 protein_id gnl|my_center|LOCUS_05190 74850 75920 gene locus_tag LOCUS_05200 74850 75920 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064840.1 protein_id gnl|my_center|LOCUS_05200 76478 76981 gene locus_tag LOCUS_05210 76478 76981 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020260.1 protein_id gnl|my_center|LOCUS_05210 77060 78187 gene locus_tag LOCUS_05220 77060 78187 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020259.1 protein_id gnl|my_center|LOCUS_05220 78807 78442 gene locus_tag LOCUS_05230 78807 78442 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064788.1 protein_id gnl|my_center|LOCUS_05230 79733 78945 gene locus_tag LOCUS_05240 79733 78945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065629.1 protein_id gnl|my_center|LOCUS_05240 81037 80426 gene locus_tag LOCUS_05250 81037 80426 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021907.1 protein_id gnl|my_center|LOCUS_05250 82040 81027 gene locus_tag LOCUS_05260 82040 81027 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021908.1 protein_id gnl|my_center|LOCUS_05260 83161 82304 gene locus_tag LOCUS_05270 83161 82304 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021909.1 protein_id gnl|my_center|LOCUS_05270 84150 83158 gene locus_tag LOCUS_05280 84150 83158 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021910.1 protein_id gnl|my_center|LOCUS_05280 85673 84450 gene locus_tag LOCUS_05290 85673 84450 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021911.1 protein_id gnl|my_center|LOCUS_05290 85740 85948 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 86956 87153 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 88267 88520 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 89309 89440 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 89422 91001 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attcgtgagcaagatccactaaaacaaggattgaaac 91057 91159 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 91158 91922 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attcgtgagcaagatccactaaaacaaggattgaaac 91903 92076 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 92060 92310 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attcgtgagcaagatccactaaaacaaggattgaaac 92304 92468 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 92449 93214 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attcgtgagcaagatccactaaaacaaggattgaaac 93268 93402 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 93401 93880 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attcgtgagcaagatccactaaaacaaggattgaaac 93864 94093 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 94083 94704 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gagcaagatccactaaaacaaggattgaaac 94942 95298 gene locus_tag LOCUS_05300 94942 95298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 95540 96169 gene locus_tag LOCUS_05310 95540 96169 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619543.1 protein_id gnl|my_center|LOCUS_05310 96451 96625 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 97130 96933 gene locus_tag LOCUS_05320 97130 96933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 97260 97826 gene locus_tag LOCUS_05330 97260 97826 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021922.1 protein_id gnl|my_center|LOCUS_05330 98506 99183 gene locus_tag LOCUS_05340 98506 99183 CDS product CRISPR-associated endonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065262.1 protein_id gnl|my_center|LOCUS_05340 99249 100082 gene locus_tag LOCUS_05350 gene cmr1 99249 100082 CDS product type III-B CRISPR module RAMP protein Cmr1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880201.1 protein_id gnl|my_center|LOCUS_05350 100079 101851 gene locus_tag LOCUS_05360 gene cas10 100079 101851 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880206.1 protein_id gnl|my_center|LOCUS_05360 101851 102930 gene locus_tag LOCUS_05370 gene cmr3 101851 102930 CDS product type III-B CRISPR module-associated protein Cmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155321014.1 protein_id gnl|my_center|LOCUS_05370 102960 103904 gene locus_tag LOCUS_05380 gene cmr4 102960 103904 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064477.1 protein_id gnl|my_center|LOCUS_05380 103922 104350 gene locus_tag LOCUS_05390 103922 104350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 104334 105293 gene locus_tag LOCUS_05400 104334 105293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 105318 106145 gene locus_tag LOCUS_05410 105318 106145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 106190 106480 gene locus_tag LOCUS_05420 gene crn3 106190 106480 CDS product CRISPR-associated ring nuclease Crn3/Csx3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582986.1 protein_id gnl|my_center|LOCUS_05420 106581 107063 gene locus_tag LOCUS_05430 106581 107063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021936.1 protein_id gnl|my_center|LOCUS_05430 107191 108231 gene locus_tag LOCUS_05440 107191 108231 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064837.1 protein_id gnl|my_center|LOCUS_05440 111178 108395 gene locus_tag LOCUS_05450 gene alaS 111178 108395 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020252.1 protein_id gnl|my_center|LOCUS_05450 111921 111661 gene locus_tag LOCUS_05460 111921 111661 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020250.1 protein_id gnl|my_center|LOCUS_05460 112511 113302 gene locus_tag LOCUS_05470 112511 113302 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020249.1 protein_id gnl|my_center|LOCUS_05470 114256 116487 gene locus_tag LOCUS_05480 114256 116487 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020246.1 protein_id gnl|my_center|LOCUS_05480 117183 116644 gene locus_tag LOCUS_05490 117183 116644 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064835.1 protein_id gnl|my_center|LOCUS_05490 117347 118468 gene locus_tag LOCUS_05500 117347 118468 CDS product DUF1786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020242.1 protein_id gnl|my_center|LOCUS_05500 118911 119366 gene locus_tag LOCUS_05510 118911 119366 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020241.1 protein_id gnl|my_center|LOCUS_05510 119399 120007 gene locus_tag LOCUS_05520 119399 120007 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020240.1 protein_id gnl|my_center|LOCUS_05520 120183 121409 gene locus_tag LOCUS_05530 120183 121409 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020233.1 protein_id gnl|my_center|LOCUS_05530 121750 123225 gene locus_tag LOCUS_05540 121750 123225 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020230.1 protein_id gnl|my_center|LOCUS_05540 123407 124885 gene locus_tag LOCUS_05550 123407 124885 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020229.1 protein_id gnl|my_center|LOCUS_05550 125146 125469 gene locus_tag LOCUS_05560 125146 125469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 >Feature sequence06 4961 2958 gene locus_tag LOCUS_05570 4961 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 6610 5426 gene locus_tag LOCUS_05580 6610 5426 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024330.1 protein_id gnl|my_center|LOCUS_05580 6814 8019 gene locus_tag LOCUS_05590 6814 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 8617 8342 gene locus_tag LOCUS_05600 8617 8342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 11522 10509 gene locus_tag LOCUS_05610 11522 10509 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963936.1 protein_id gnl|my_center|LOCUS_05610 12453 11548 gene locus_tag LOCUS_05620 12453 11548 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022154.1 protein_id gnl|my_center|LOCUS_05620 13353 14240 gene locus_tag LOCUS_05630 13353 14240 CDS product DUF1616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065996.1 protein_id gnl|my_center|LOCUS_05630 14243 15085 gene locus_tag LOCUS_05640 14243 15085 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065997.1 protein_id gnl|my_center|LOCUS_05640 15413 15658 gene locus_tag LOCUS_05650 15413 15658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 16360 17028 gene locus_tag LOCUS_05660 16360 17028 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763299.1 protein_id gnl|my_center|LOCUS_05660 17094 18176 gene locus_tag LOCUS_05670 17094 18176 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_05670 18223 19161 gene locus_tag LOCUS_05680 18223 19161 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024326.1 protein_id gnl|my_center|LOCUS_05680 19268 20695 gene locus_tag LOCUS_05690 19268 20695 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062390429.1 protein_id gnl|my_center|LOCUS_05690 20692 21801 gene locus_tag LOCUS_05700 20692 21801 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020209.1 protein_id gnl|my_center|LOCUS_05700 22236 23732 gene locus_tag LOCUS_05710 22236 23732 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066597.1 protein_id gnl|my_center|LOCUS_05710 24748 23801 gene locus_tag LOCUS_05720 24748 23801 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022154.1 protein_id gnl|my_center|LOCUS_05720 25600 26496 gene locus_tag LOCUS_05730 25600 26496 CDS product DUF1616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065996.1 protein_id gnl|my_center|LOCUS_05730 27139 27969 gene locus_tag LOCUS_05740 27139 27969 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065997.1 protein_id gnl|my_center|LOCUS_05740 28491 28648 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29320 30249 gene locus_tag LOCUS_05750 29320 30249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 30350 32227 gene locus_tag LOCUS_05760 30350 32227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 33339 32443 gene locus_tag LOCUS_05770 33339 32443 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024341.1 protein_id gnl|my_center|LOCUS_05770 33723 34610 gene locus_tag LOCUS_05780 33723 34610 CDS product DUF1616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065996.1 protein_id gnl|my_center|LOCUS_05780 34613 35488 gene locus_tag LOCUS_05790 34613 35488 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065997.1 protein_id gnl|my_center|LOCUS_05790 36770 37069 gene locus_tag LOCUS_05800 36770 37069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065999.1 protein_id gnl|my_center|LOCUS_05800 37570 37764 gene locus_tag LOCUS_05810 37570 37764 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024348.1 protein_id gnl|my_center|LOCUS_05810 37825 38700 gene locus_tag LOCUS_05820 gene dapA 37825 38700 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024349.1 protein_id gnl|my_center|LOCUS_05820 38697 39488 gene locus_tag LOCUS_05830 gene dapB 38697 39488 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024350.1 protein_id gnl|my_center|LOCUS_05830 40644 40234 gene locus_tag LOCUS_05840 40644 40234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860404.1 protein_id gnl|my_center|LOCUS_05840 40906 41355 gene locus_tag LOCUS_05850 40906 41355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024361.1 protein_id gnl|my_center|LOCUS_05850 41375 42004 gene locus_tag LOCUS_05860 41375 42004 CDS product DUF1673 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024362.1 protein_id gnl|my_center|LOCUS_05860 42084 42704 gene locus_tag LOCUS_05870 42084 42704 CDS product DUF1673 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066000.1 protein_id gnl|my_center|LOCUS_05870 42701 43000 gene locus_tag LOCUS_05880 42701 43000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 45109 45717 gene locus_tag LOCUS_05890 45109 45717 CDS product DUF1673 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024370.1 protein_id gnl|my_center|LOCUS_05890 45718 46470 gene locus_tag LOCUS_05900 45718 46470 CDS product DUF1673 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024373.1 protein_id gnl|my_center|LOCUS_05900 47026 46547 gene locus_tag LOCUS_05910 47026 46547 CDS product DUF5788 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024376.1 protein_id gnl|my_center|LOCUS_05910 47686 47216 gene locus_tag LOCUS_05920 gene pyrI 47686 47216 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024377.1 protein_id gnl|my_center|LOCUS_05920 48609 47683 gene locus_tag LOCUS_05930 gene pyrB 48609 47683 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024378.1 protein_id gnl|my_center|LOCUS_05930 49183 48707 gene locus_tag LOCUS_05940 49183 48707 CDS product DUF5788 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024379.1 protein_id gnl|my_center|LOCUS_05940 49647 50798 gene locus_tag LOCUS_05950 49647 50798 CDS product bifunctional hexulose-6-phosphate synthase/ribonuclease regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860554.1 protein_id gnl|my_center|LOCUS_05950 53439 50935 gene locus_tag LOCUS_05960 gene recQ 53439 50935 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066602.1 protein_id gnl|my_center|LOCUS_05960 54495 55412 gene locus_tag LOCUS_05970 gene guaA 54495 55412 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024387.1 protein_id gnl|my_center|LOCUS_05970 55425 56471 gene locus_tag LOCUS_05980 55425 56471 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066004.1 protein_id gnl|my_center|LOCUS_05980 57427 56528 gene locus_tag LOCUS_05990 gene argB 57427 56528 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024391.1 protein_id gnl|my_center|LOCUS_05990 57955 57671 gene locus_tag LOCUS_06000 57955 57671 CDS product non-histone chromosomal MC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024392.1 protein_id gnl|my_center|LOCUS_06000 58356 59315 gene locus_tag LOCUS_06010 gene mptA 58356 59315 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066005.1 protein_id gnl|my_center|LOCUS_06010 59497 59820 gene locus_tag LOCUS_06020 59497 59820 CDS product DUF2098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066006.1 protein_id gnl|my_center|LOCUS_06020 61365 59932 gene locus_tag LOCUS_06030 61365 59932 CDS product methanogenesis marker 14 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024395.1 protein_id gnl|my_center|LOCUS_06030 62270 63433 gene locus_tag LOCUS_06040 62270 63433 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024396.1 protein_id gnl|my_center|LOCUS_06040 63637 63918 gene locus_tag LOCUS_06050 gene gatC 63637 63918 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024398.1 protein_id gnl|my_center|LOCUS_06050 63931 65358 gene locus_tag LOCUS_06060 gene gatA 63931 65358 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066007.1 protein_id gnl|my_center|LOCUS_06060 65359 66846 gene locus_tag LOCUS_06070 gene gatB 65359 66846 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024400.1 protein_id gnl|my_center|LOCUS_06070 67182 67844 gene locus_tag LOCUS_06080 67182 67844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022016.1 protein_id gnl|my_center|LOCUS_06080 68830 68012 gene locus_tag LOCUS_06090 68830 68012 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066008.1 protein_id gnl|my_center|LOCUS_06090 69499 70359 gene locus_tag LOCUS_06100 gene htpX 69499 70359 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024415.1 protein_id gnl|my_center|LOCUS_06100 70751 72046 gene locus_tag LOCUS_06110 gene aroA 70751 72046 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024417.1 protein_id gnl|my_center|LOCUS_06110 72238 73218 gene locus_tag LOCUS_06120 72238 73218 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024418.1 protein_id gnl|my_center|LOCUS_06120 75627 73912 gene locus_tag LOCUS_06130 gene mcrA 75627 73912 CDS product coenzyme-B sulfoethylthiotransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024419.1 protein_id gnl|my_center|LOCUS_06130 76384 75638 gene locus_tag LOCUS_06140 gene mcrG 76384 75638 CDS product coenzyme-B sulfoethylthiotransferase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024420.1 protein_id gnl|my_center|LOCUS_06140 77006 76386 gene locus_tag LOCUS_06150 gene mcrC 77006 76386 CDS product methyl-coenzyme M reductase I operon protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024421.1 protein_id gnl|my_center|LOCUS_06150 77528 77013 gene locus_tag LOCUS_06160 gene mcrD 77528 77013 CDS product methyl-coenzyme M reductase operon protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024422.1 protein_id gnl|my_center|LOCUS_06160 78856 77552 gene locus_tag LOCUS_06170 gene mcrB 78856 77552 CDS product coenzyme-B sulfoethylthiotransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024423.1 protein_id gnl|my_center|LOCUS_06170 79277 80512 gene locus_tag LOCUS_06180 gene mmp10 79277 80512 CDS product methyl coenzyme M reductase-arginine methyltransferase Mmp10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024424.1 protein_id gnl|my_center|LOCUS_06180 84322 80882 gene locus_tag LOCUS_06190 84322 80882 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024425.1 protein_id gnl|my_center|LOCUS_06190 84586 84359 gene locus_tag LOCUS_06200 84586 84359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 85781 84678 gene locus_tag LOCUS_06210 85781 84678 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024427.1 protein_id gnl|my_center|LOCUS_06210 87117 85831 gene locus_tag LOCUS_06220 gene rbcL 87117 85831 CDS product type III ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024428.1 protein_id gnl|my_center|LOCUS_06220 89120 88008 gene locus_tag LOCUS_06230 89120 88008 CDS product DUF1646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878290.1 protein_id gnl|my_center|LOCUS_06230 91096 89984 gene locus_tag LOCUS_06240 91096 89984 CDS product DUF1646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878290.1 protein_id gnl|my_center|LOCUS_06240 92915 91803 gene locus_tag LOCUS_06250 92915 91803 CDS product DUF1646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878290.1 protein_id gnl|my_center|LOCUS_06250 93635 93793 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 95353 94241 gene locus_tag LOCUS_06260 95353 94241 CDS product DUF1646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878290.1 protein_id gnl|my_center|LOCUS_06260 97296 96799 gene locus_tag LOCUS_06270 97296 96799 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024446.1 protein_id gnl|my_center|LOCUS_06270 97877 97350 gene locus_tag LOCUS_06280 97877 97350 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024447.1 protein_id gnl|my_center|LOCUS_06280 100308 98047 gene locus_tag LOCUS_06290 100308 98047 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024448.1 protein_id gnl|my_center|LOCUS_06290 100991 100305 gene locus_tag LOCUS_06300 100991 100305 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024449.1 protein_id gnl|my_center|LOCUS_06300 102089 101637 gene locus_tag LOCUS_06310 102089 101637 CDS product Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066022.1 protein_id gnl|my_center|LOCUS_06310 103058 102465 gene locus_tag LOCUS_06320 103058 102465 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048174238.1 protein_id gnl|my_center|LOCUS_06320 103514 104290 gene locus_tag LOCUS_06330 103514 104290 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024455.1 protein_id gnl|my_center|LOCUS_06330 105234 104278 gene locus_tag LOCUS_06340 105234 104278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 106319 106526 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 106739 106992 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 107430 107507 gene locus_tag LOCUS_t00120 107430 107507 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 107542 107579 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 109072 109275 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 109979 109410 gene locus_tag LOCUS_06350 109979 109410 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024463.1 protein_id gnl|my_center|LOCUS_06350 110583 111380 gene locus_tag LOCUS_06360 110583 111380 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024464.1 protein_id gnl|my_center|LOCUS_06360 111478 112620 gene locus_tag LOCUS_06370 111478 112620 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024465.1 protein_id gnl|my_center|LOCUS_06370 113141 113428 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 113590 113870 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 114693 116156 gene locus_tag LOCUS_06380 114693 116156 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024468.1 protein_id gnl|my_center|LOCUS_06380 116352 117800 gene locus_tag LOCUS_06390 116352 117800 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990706.1 protein_id gnl|my_center|LOCUS_06390 118495 117890 gene locus_tag LOCUS_06400 gene tpiA 118495 117890 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024480.1 protein_id gnl|my_center|LOCUS_06400 119866 118712 gene locus_tag LOCUS_06410 119866 118712 CDS product bifunctional 5,6,7,8-tetrahydromethanopterin hydro-lyase/3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024481.1 protein_id gnl|my_center|LOCUS_06410 120581 120510 gene locus_tag LOCUS_t00130 120581 120510 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 120826 120755 gene locus_tag LOCUS_t00140 120826 120755 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 121571 120969 gene locus_tag LOCUS_06420 121571 120969 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066031.1 protein_id gnl|my_center|LOCUS_06420 122499 122969 gene locus_tag LOCUS_06430 gene bfr 122499 122969 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677991.1 protein_id gnl|my_center|LOCUS_06430 >Feature sequence07 644 919 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1147 1327 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1394 1741 gene locus_tag LOCUS_06440 1394 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 2620 3606 gene locus_tag LOCUS_06450 gene mer 2620 3606 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023637.1 protein_id gnl|my_center|LOCUS_06450 3709 4749 gene locus_tag LOCUS_06460 gene fpoF 3709 4749 CDS product F420H2 dehydrogenase subunit FpoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023636.1 protein_id gnl|my_center|LOCUS_06460 4820 5341 gene locus_tag LOCUS_06470 4820 5341 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065785.1 protein_id gnl|my_center|LOCUS_06470 6145 6642 gene locus_tag LOCUS_06480 6145 6642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 7276 6728 gene locus_tag LOCUS_06490 7276 6728 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023634.1 protein_id gnl|my_center|LOCUS_06490 7508 7689 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9815 7905 gene locus_tag LOCUS_06500 9815 7905 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_06500 10250 10020 gene locus_tag LOCUS_06510 10250 10020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 11612 10743 gene locus_tag LOCUS_06520 gene uppS 11612 10743 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990666.1 protein_id gnl|my_center|LOCUS_06520 12302 12416 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13032 12763 gene locus_tag LOCUS_06530 13032 12763 CDS product DUF2551 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023626.1 protein_id gnl|my_center|LOCUS_06530 14745 13603 gene locus_tag LOCUS_06540 14745 13603 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023617.1 protein_id gnl|my_center|LOCUS_06540 14816 15001 gene locus_tag LOCUS_06550 14816 15001 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066529.1 protein_id gnl|my_center|LOCUS_06550 15011 15796 gene locus_tag LOCUS_06560 15011 15796 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023615.1 protein_id gnl|my_center|LOCUS_06560 16045 16506 gene locus_tag LOCUS_06570 16045 16506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065779.1 protein_id gnl|my_center|LOCUS_06570 17130 16555 gene locus_tag LOCUS_06580 17130 16555 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023613.1 protein_id gnl|my_center|LOCUS_06580 18760 17123 gene locus_tag LOCUS_06590 18760 17123 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023612.1 protein_id gnl|my_center|LOCUS_06590 21926 18879 gene locus_tag LOCUS_06600 21926 18879 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065778.1 protein_id gnl|my_center|LOCUS_06600 24378 22096 gene locus_tag LOCUS_06610 24378 22096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 24895 24746 gene locus_tag LOCUS_06620 24895 24746 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011032551.1 protein_id gnl|my_center|LOCUS_06620 25216 24911 gene locus_tag LOCUS_06630 25216 24911 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023602.1 protein_id gnl|my_center|LOCUS_06630 25784 25197 gene locus_tag LOCUS_06640 25784 25197 CDS product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023601.1 protein_id gnl|my_center|LOCUS_06640 25971 25786 gene locus_tag LOCUS_06650 25971 25786 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023600.1 protein_id gnl|my_center|LOCUS_06650 26575 25988 gene locus_tag LOCUS_06660 26575 25988 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023599.1 protein_id gnl|my_center|LOCUS_06660 27003 26635 gene locus_tag LOCUS_06670 27003 26635 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023598.1 protein_id gnl|my_center|LOCUS_06670 28226 27000 gene locus_tag LOCUS_06680 28226 27000 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066527.1 protein_id gnl|my_center|LOCUS_06680 29749 28586 gene locus_tag LOCUS_06690 29749 28586 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023596.1 protein_id gnl|my_center|LOCUS_06690 30907 30143 gene locus_tag LOCUS_06700 30907 30143 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066526.1 protein_id gnl|my_center|LOCUS_06700 31831 30974 gene locus_tag LOCUS_06710 31831 30974 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066525.1 protein_id gnl|my_center|LOCUS_06710 32393 33457 gene locus_tag LOCUS_06720 32393 33457 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023593.1 protein_id gnl|my_center|LOCUS_06720 33953 34402 gene locus_tag LOCUS_06730 33953 34402 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023592.1 protein_id gnl|my_center|LOCUS_06730 34474 35109 gene locus_tag LOCUS_06740 34474 35109 CDS product DUF2150 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023591.1 protein_id gnl|my_center|LOCUS_06740 36524 35340 gene locus_tag LOCUS_06750 36524 35340 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065771.1 protein_id gnl|my_center|LOCUS_06750 37957 36956 gene locus_tag LOCUS_06760 37957 36956 CDS product DUF4921 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023587.1 protein_id gnl|my_center|LOCUS_06760 39945 38131 gene locus_tag LOCUS_06770 39945 38131 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023586.1 protein_id gnl|my_center|LOCUS_06770 40918 40160 gene locus_tag LOCUS_06780 40918 40160 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065770.1 protein_id gnl|my_center|LOCUS_06780 40928 41065 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42134 41316 gene locus_tag LOCUS_06790 42134 41316 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065769.1 protein_id gnl|my_center|LOCUS_06790 42648 42864 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43249 43482 gene locus_tag LOCUS_06800 43249 43482 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023046.1 protein_id gnl|my_center|LOCUS_06800 44053 44409 gene locus_tag LOCUS_06810 44053 44409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023582.1 protein_id gnl|my_center|LOCUS_06810 44928 45137 gene locus_tag LOCUS_06820 44928 45137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 47101 46799 gene locus_tag LOCUS_06830 47101 46799 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023551.1 protein_id gnl|my_center|LOCUS_06830 47800 48156 gene locus_tag LOCUS_06840 47800 48156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023545.1 protein_id gnl|my_center|LOCUS_06840 48363 48587 gene locus_tag LOCUS_06850 48363 48587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 49122 49427 gene locus_tag LOCUS_06860 49122 49427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860065.1 protein_id gnl|my_center|LOCUS_06860 49793 49620 gene locus_tag LOCUS_06870 49793 49620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 50248 51414 gene locus_tag LOCUS_06880 50248 51414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06880 51525 52334 gene locus_tag LOCUS_06890 51525 52334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06890 52744 53013 gene locus_tag LOCUS_06900 52744 53013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065757.1 protein_id gnl|my_center|LOCUS_06900 53772 54248 gene locus_tag LOCUS_06910 53772 54248 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065756.1 protein_id gnl|my_center|LOCUS_06910 54324 54812 gene locus_tag LOCUS_06920 54324 54812 CDS product DUF2267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228678.1 protein_id gnl|my_center|LOCUS_06920 55051 55443 gene locus_tag LOCUS_06930 gene cfbA 55051 55443 CDS product sirohydrochlorin nickelochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023539.1 protein_id gnl|my_center|LOCUS_06930 55468 57063 gene locus_tag LOCUS_06940 55468 57063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 57441 58553 gene locus_tag LOCUS_06950 gene cfbD 57441 58553 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023536.1 protein_id gnl|my_center|LOCUS_06950 58623 59420 gene locus_tag LOCUS_06960 gene cfbC 58623 59420 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase ATP-dependent reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023535.1 protein_id gnl|my_center|LOCUS_06960 59446 60930 gene locus_tag LOCUS_06970 gene cfbB 59446 60930 CDS product Ni-sirohydrochlorin a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023534.1 protein_id gnl|my_center|LOCUS_06970 61248 62300 gene locus_tag LOCUS_06980 gene endA 61248 62300 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023532.1 protein_id gnl|my_center|LOCUS_06980 62468 62803 gene locus_tag LOCUS_06990 62468 62803 CDS product DUF2209 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023531.1 protein_id gnl|my_center|LOCUS_06990 62800 64089 gene locus_tag LOCUS_07000 gene hflX 62800 64089 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755955.1 protein_id gnl|my_center|LOCUS_07000 64228 64046 gene locus_tag LOCUS_07010 64228 64046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 64409 65083 gene locus_tag LOCUS_07020 64409 65083 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_07020 66000 66332 gene locus_tag LOCUS_07030 66000 66332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 66739 67101 gene locus_tag LOCUS_07040 66739 67101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023326.1 protein_id gnl|my_center|LOCUS_07040 68247 67279 gene locus_tag LOCUS_07050 68247 67279 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022590.1 protein_id gnl|my_center|LOCUS_07050 68828 70867 gene locus_tag LOCUS_07060 68828 70867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 70025 70190 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 70864 74088 gene locus_tag LOCUS_07070 70864 74088 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021188.1 protein_id gnl|my_center|LOCUS_07070 74118 74450 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 75260 74472 gene locus_tag LOCUS_07080 75260 74472 CDS product C15orf41 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065051.1 protein_id gnl|my_center|LOCUS_07080 76158 75409 gene locus_tag LOCUS_07090 76158 75409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021190.1 protein_id gnl|my_center|LOCUS_07090 77070 76219 gene locus_tag LOCUS_07100 77070 76219 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021191.1 protein_id gnl|my_center|LOCUS_07100 77666 77178 gene locus_tag LOCUS_07110 gene moaC 77666 77178 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066185.1 protein_id gnl|my_center|LOCUS_07110 77961 77776 gene locus_tag LOCUS_07120 77961 77776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065052.1 protein_id gnl|my_center|LOCUS_07120 79515 78025 gene locus_tag LOCUS_07130 79515 78025 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021194.1 protein_id gnl|my_center|LOCUS_07130 80098 81564 gene locus_tag LOCUS_07140 80098 81564 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065053.1 protein_id gnl|my_center|LOCUS_07140 84205 81731 gene locus_tag LOCUS_07150 84205 81731 CDS product oligosaccharyl transferase, archaeosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065054.1 protein_id gnl|my_center|LOCUS_07150 84087 84347 gene locus_tag LOCUS_07160 84087 84347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 84987 86069 gene locus_tag LOCUS_07170 84987 86069 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021199.1 protein_id gnl|my_center|LOCUS_07170 86838 88058 gene locus_tag LOCUS_07180 86838 88058 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021201.1 protein_id gnl|my_center|LOCUS_07180 88078 89412 gene locus_tag LOCUS_07190 88078 89412 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279119.1 protein_id gnl|my_center|LOCUS_07190 89775 91850 gene locus_tag LOCUS_07200 89775 91850 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066188.1 protein_id gnl|my_center|LOCUS_07200 91816 92982 gene locus_tag LOCUS_07210 91816 92982 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021204.1 protein_id gnl|my_center|LOCUS_07210 93227 93955 gene locus_tag LOCUS_07220 93227 93955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 96235 94031 gene locus_tag LOCUS_07230 96235 94031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021205.1 protein_id gnl|my_center|LOCUS_07230 96294 96536 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 97011 97358 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 97489 98136 gene locus_tag LOCUS_07240 97489 98136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 98168 98336 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 99167 98436 gene locus_tag LOCUS_07250 99167 98436 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206409.1 protein_id gnl|my_center|LOCUS_07250 100485 99448 gene locus_tag LOCUS_07260 100485 99448 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546047.1 protein_id gnl|my_center|LOCUS_07260 102106 100922 gene locus_tag LOCUS_07270 102106 100922 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021210.1 protein_id gnl|my_center|LOCUS_07270 102783 102115 gene locus_tag LOCUS_07280 102783 102115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 102793 102983 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 103708 104337 gene locus_tag LOCUS_07290 gene wrbA 103708 104337 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021213.1 protein_id gnl|my_center|LOCUS_07290 104690 104424 gene locus_tag LOCUS_07300 104690 104424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 105722 107095 gene locus_tag LOCUS_07310 105722 107095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 107585 107971 gene locus_tag LOCUS_07320 107585 107971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 107998 109866 gene locus_tag LOCUS_07330 107998 109866 CDS product TIGR02556 family CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582997.1 protein_id gnl|my_center|LOCUS_07330 109859 110848 gene locus_tag LOCUS_07340 gene cas7b 109859 110848 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582996.1 protein_id gnl|my_center|LOCUS_07340 110858 111559 gene locus_tag LOCUS_07350 gene cas5b 110858 111559 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582995.1 protein_id gnl|my_center|LOCUS_07350 111534 113969 gene locus_tag LOCUS_07360 111534 113969 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582994.1 protein_id gnl|my_center|LOCUS_07360 113971 114630 gene locus_tag LOCUS_07370 113971 114630 CDS product CRISPR-associated endonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065262.1 protein_id gnl|my_center|LOCUS_07370 114618 115589 gene locus_tag LOCUS_07380 gene cas1 114618 115589 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879371.1 protein_id gnl|my_center|LOCUS_07380 115677 115967 gene locus_tag LOCUS_07390 gene cas2 115677 115967 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846123.1 protein_id gnl|my_center|LOCUS_07390 116014 116715 gene locus_tag LOCUS_07400 116014 116715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 116829 117765 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attcgcgagcaagatccattaaaacaaggattgaaac 117779 117967 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 117968 >121468 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attcgcgagcaagatccattaaaacaaggattgaaac >Feature sequence08 465 34 gene locus_tag LOCUS_07410 465 34 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023990.1 protein_id gnl|my_center|LOCUS_07410 887 570 gene locus_tag LOCUS_07420 887 570 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066569.1 protein_id gnl|my_center|LOCUS_07420 1710 2585 gene locus_tag LOCUS_07430 1710 2585 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023987.1 protein_id gnl|my_center|LOCUS_07430 2603 3049 gene locus_tag LOCUS_07440 2603 3049 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023986.1 protein_id gnl|my_center|LOCUS_07440 3141 3995 gene locus_tag LOCUS_07450 3141 3995 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023985.1 protein_id gnl|my_center|LOCUS_07450 4173 4859 gene locus_tag LOCUS_07460 4173 4859 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023984.1 protein_id gnl|my_center|LOCUS_07460 4886 5129 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5426 6718 gene locus_tag LOCUS_07470 5426 6718 CDS product purine/pyrimidine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164691339.1 protein_id gnl|my_center|LOCUS_07470 6708 6965 gene locus_tag LOCUS_07480 6708 6965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 7935 7171 gene locus_tag LOCUS_07490 7935 7171 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023983.1 protein_id gnl|my_center|LOCUS_07490 8238 8417 gene locus_tag LOCUS_07500 8238 8417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 9045 8746 gene locus_tag LOCUS_07510 gene crcB 9045 8746 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065899.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07510 9230 9048 gene locus_tag LOCUS_07520 9230 9048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 9291 9515 gene locus_tag LOCUS_07530 9291 9515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07530 10454 10074 gene locus_tag LOCUS_07540 10454 10074 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023831.1 protein_id gnl|my_center|LOCUS_07540 10849 10451 gene locus_tag LOCUS_07550 gene crcB 10849 10451 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023830.1 protein_id gnl|my_center|LOCUS_07550 12382 11189 gene locus_tag LOCUS_07560 12382 11189 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023979.1 protein_id gnl|my_center|LOCUS_07560 12718 12425 gene locus_tag LOCUS_07570 12718 12425 CDS product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023978.1 protein_id gnl|my_center|LOCUS_07570 12777 14462 gene locus_tag LOCUS_07580 12777 14462 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023977.1 protein_id gnl|my_center|LOCUS_07580 14732 15517 gene locus_tag LOCUS_07590 14732 15517 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888361.1 protein_id gnl|my_center|LOCUS_07590 18264 15544 gene locus_tag LOCUS_07600 18264 15544 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023974.1 protein_id gnl|my_center|LOCUS_07600 18668 19993 gene locus_tag LOCUS_07610 18668 19993 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023973.1 protein_id gnl|my_center|LOCUS_07610 20494 20766 gene locus_tag LOCUS_07620 20494 20766 CDS product DUF3303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065897.1 protein_id gnl|my_center|LOCUS_07620 22328 20898 gene locus_tag LOCUS_07630 22328 20898 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589538.1 protein_id gnl|my_center|LOCUS_07630 22920 22456 gene locus_tag LOCUS_07640 22920 22456 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022043.1 protein_id gnl|my_center|LOCUS_07640 24317 23115 gene locus_tag LOCUS_07650 24317 23115 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905157.1 protein_id gnl|my_center|LOCUS_07650 25810 25595 gene locus_tag LOCUS_07660 25810 25595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 26874 27326 gene locus_tag LOCUS_07670 26874 27326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 27666 29237 gene locus_tag LOCUS_07680 27666 29237 CDS product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065895.1 protein_id gnl|my_center|LOCUS_07680 29338 29694 gene locus_tag LOCUS_07690 29338 29694 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065894.1 protein_id gnl|my_center|LOCUS_07690 30224 29802 gene locus_tag LOCUS_07700 gene nikR 30224 29802 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023967.1 protein_id gnl|my_center|LOCUS_07700 30478 30664 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32457 32128 gene locus_tag LOCUS_07710 32457 32128 CDS product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065892.1 protein_id gnl|my_center|LOCUS_07710 32500 32765 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32785 33888 gene locus_tag LOCUS_07720 32785 33888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990679.1 protein_id gnl|my_center|LOCUS_07720 34066 34548 gene locus_tag LOCUS_07730 34066 34548 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023960.1 protein_id gnl|my_center|LOCUS_07730 34571 34752 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35127 34894 gene locus_tag LOCUS_07740 35127 34894 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065891.1 protein_id gnl|my_center|LOCUS_07740 35969 35625 gene locus_tag LOCUS_07750 35969 35625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065890.1 protein_id gnl|my_center|LOCUS_07750 37045 36305 gene locus_tag LOCUS_07760 37045 36305 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023957.1 protein_id gnl|my_center|LOCUS_07760 38328 37048 gene locus_tag LOCUS_07770 38328 37048 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023956.1 protein_id gnl|my_center|LOCUS_07770 38803 39516 gene locus_tag LOCUS_07780 38803 39516 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065889.1 protein_id gnl|my_center|LOCUS_07780 40804 39578 gene locus_tag LOCUS_07790 40804 39578 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023953.1 protein_id gnl|my_center|LOCUS_07790 41165 40806 gene locus_tag LOCUS_07800 41165 40806 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023952.1 protein_id gnl|my_center|LOCUS_07800 41691 41383 gene locus_tag LOCUS_07810 gene yciH 41691 41383 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023951.1 protein_id gnl|my_center|LOCUS_07810 42238 42486 gene locus_tag LOCUS_07820 42238 42486 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023950.1 protein_id gnl|my_center|LOCUS_07820 42952 45096 gene locus_tag LOCUS_07830 gene purL 42952 45096 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023948.1 protein_id gnl|my_center|LOCUS_07830 45760 46521 gene locus_tag LOCUS_07840 45760 46521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 46518 47714 gene locus_tag LOCUS_07850 46518 47714 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_07850 47753 48562 gene locus_tag LOCUS_07860 47753 48562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065887.1 protein_id gnl|my_center|LOCUS_07860 48559 50580 gene locus_tag LOCUS_07870 48559 50580 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065886.1 protein_id gnl|my_center|LOCUS_07870 51653 50604 gene locus_tag LOCUS_07880 gene sppA 51653 50604 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065885.1 protein_id gnl|my_center|LOCUS_07880 52151 54286 gene locus_tag LOCUS_07890 gene metG 52151 54286 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065884.1 protein_id gnl|my_center|LOCUS_07890 54514 54996 gene locus_tag LOCUS_07900 54514 54996 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024098.1 protein_id gnl|my_center|LOCUS_07900 56033 55245 gene locus_tag LOCUS_07910 56033 55245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 57504 56479 gene locus_tag LOCUS_07920 57504 56479 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021548.1 protein_id gnl|my_center|LOCUS_07920 59084 57507 gene locus_tag LOCUS_07930 59084 57507 CDS product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021549.1 protein_id gnl|my_center|LOCUS_07930 59997 59077 gene locus_tag LOCUS_07940 59997 59077 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066232.1 protein_id gnl|my_center|LOCUS_07940 60887 59994 gene locus_tag LOCUS_07950 60887 59994 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021551.1 protein_id gnl|my_center|LOCUS_07950 62707 60884 gene locus_tag LOCUS_07960 62707 60884 CDS product TolB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065148.1 protein_id gnl|my_center|LOCUS_07960 63438 62995 gene locus_tag LOCUS_07970 63438 62995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 64601 63921 gene locus_tag LOCUS_07980 64601 63921 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990796.1 protein_id gnl|my_center|LOCUS_07980 65163 64663 gene locus_tag LOCUS_07990 65163 64663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066236.1 protein_id gnl|my_center|LOCUS_07990 68061 65746 gene locus_tag LOCUS_08000 68061 65746 CDS product DUF3160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990739.1 protein_id gnl|my_center|LOCUS_08000 68807 68406 gene locus_tag LOCUS_08010 68807 68406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024351.1 protein_id gnl|my_center|LOCUS_08010 69038 69182 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 70690 71229 gene locus_tag LOCUS_08020 70690 71229 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024115.1 protein_id gnl|my_center|LOCUS_08020 71403 72110 gene locus_tag LOCUS_08030 gene npdG 71403 72110 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279215.1 protein_id gnl|my_center|LOCUS_08030 72605 73090 gene locus_tag LOCUS_08040 gene hdrC 72605 73090 CDS product CoB--CoM heterodisulfide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024118.1 protein_id gnl|my_center|LOCUS_08040 73102 74004 gene locus_tag LOCUS_08050 gene hdrB 73102 74004 CDS product CoB--CoM heterodisulfide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024119.1 protein_id gnl|my_center|LOCUS_08050 74589 74140 gene locus_tag LOCUS_08060 74589 74140 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024120.1 protein_id gnl|my_center|LOCUS_08060 75194 74661 gene locus_tag LOCUS_08070 75194 74661 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024121.1 protein_id gnl|my_center|LOCUS_08070 75864 76202 gene locus_tag LOCUS_08080 75864 76202 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024127.1 protein_id gnl|my_center|LOCUS_08080 76254 77099 gene locus_tag LOCUS_08090 76254 77099 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024128.1 protein_id gnl|my_center|LOCUS_08090 77657 78175 gene locus_tag LOCUS_08100 77657 78175 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024136.1 protein_id gnl|my_center|LOCUS_08100 78304 78945 gene locus_tag LOCUS_08110 78304 78945 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024137.1 protein_id gnl|my_center|LOCUS_08110 78861 79055 gene locus_tag LOCUS_08120 78861 79055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 79501 79082 gene locus_tag LOCUS_08130 79501 79082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 80690 79959 gene locus_tag LOCUS_08140 80690 79959 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024140.1 protein_id gnl|my_center|LOCUS_08140 81480 80680 gene locus_tag LOCUS_08150 gene cobJ 81480 80680 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024141.1 protein_id gnl|my_center|LOCUS_08150 81802 81449 gene locus_tag LOCUS_08160 81802 81449 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990686.1 protein_id gnl|my_center|LOCUS_08160 82362 81988 gene locus_tag LOCUS_08170 82362 81988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 83231 82503 gene locus_tag LOCUS_08180 83231 82503 CDS product cobalt-precorrin-4/precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024142.1 protein_id gnl|my_center|LOCUS_08180 83959 83351 gene locus_tag LOCUS_08190 83959 83351 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024143.1 protein_id gnl|my_center|LOCUS_08190 84618 84064 gene locus_tag LOCUS_08200 gene cbiT 84618 84064 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024144.1 protein_id gnl|my_center|LOCUS_08200 85899 87227 gene locus_tag LOCUS_08210 85899 87227 CDS product isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024145.1 protein_id gnl|my_center|LOCUS_08210 88278 87250 gene locus_tag LOCUS_08220 88278 87250 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024146.1 protein_id gnl|my_center|LOCUS_08220 88514 89368 gene locus_tag LOCUS_08230 88514 89368 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024147.1 protein_id gnl|my_center|LOCUS_08230 90133 89648 gene locus_tag LOCUS_08240 90133 89648 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065943.1 protein_id gnl|my_center|LOCUS_08240 90191 91486 gene locus_tag LOCUS_08250 90191 91486 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048136943.1 protein_id gnl|my_center|LOCUS_08250 91702 92172 gene locus_tag LOCUS_08260 91702 92172 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024150.1 protein_id gnl|my_center|LOCUS_08260 92606 93733 gene locus_tag LOCUS_08270 gene ftsZ 92606 93733 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024152.1 protein_id gnl|my_center|LOCUS_08270 94144 94359 gene locus_tag LOCUS_08280 94144 94359 CDS product protein translocase SEC61 complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024153.1 protein_id gnl|my_center|LOCUS_08280 94356 94814 gene locus_tag LOCUS_08290 94356 94814 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065945.1 protein_id gnl|my_center|LOCUS_08290 94936 95421 gene locus_tag LOCUS_08300 94936 95421 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024155.1 protein_id gnl|my_center|LOCUS_08300 95659 96300 gene locus_tag LOCUS_08310 95659 96300 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024156.1 protein_id gnl|my_center|LOCUS_08310 96301 97344 gene locus_tag LOCUS_08320 96301 97344 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024157.1 protein_id gnl|my_center|LOCUS_08320 97380 97694 gene locus_tag LOCUS_08330 gene rpl12p 97380 97694 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024158.1 protein_id gnl|my_center|LOCUS_08330 98757 99749 gene locus_tag LOCUS_08340 98757 99749 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024160.1 protein_id gnl|my_center|LOCUS_08340 102372 99946 gene locus_tag LOCUS_08350 102372 99946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 102908 103345 gene locus_tag LOCUS_08360 102908 103345 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023884.1 protein_id gnl|my_center|LOCUS_08360 104119 103430 gene locus_tag LOCUS_08370 104119 103430 CDS product matrixin family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066558.1 protein_id gnl|my_center|LOCUS_08370 104958 104482 gene locus_tag LOCUS_08380 104958 104482 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065868.1 protein_id gnl|my_center|LOCUS_08380 106038 105103 gene locus_tag LOCUS_08390 106038 105103 CDS product methanogenesis marker 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023887.1 protein_id gnl|my_center|LOCUS_08390 106642 106040 gene locus_tag LOCUS_08400 106642 106040 CDS product methanogenesis marker 17 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023888.1 protein_id gnl|my_center|LOCUS_08400 107893 106646 gene locus_tag LOCUS_08410 107893 106646 CDS product methanogenesis marker 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023889.1 protein_id gnl|my_center|LOCUS_08410 108393 107890 gene locus_tag LOCUS_08420 108393 107890 CDS product methanogenesis marker 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066559.1 protein_id gnl|my_center|LOCUS_08420 108841 108398 gene locus_tag LOCUS_08430 108841 108398 CDS product methanogenesis marker 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065869.1 protein_id gnl|my_center|LOCUS_08430 110581 109007 gene locus_tag LOCUS_08440 110581 109007 CDS product methanogenesis marker 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023892.1 protein_id gnl|my_center|LOCUS_08440 112235 110622 gene locus_tag LOCUS_08450 gene atwA 112235 110622 CDS product methyl coenzyme M reductase system, component A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023893.1 protein_id gnl|my_center|LOCUS_08450 112567 112418 gene locus_tag LOCUS_08460 112567 112418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 113410 112628 gene locus_tag LOCUS_08470 113410 112628 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023894.1 protein_id gnl|my_center|LOCUS_08470 114482 113589 gene locus_tag LOCUS_08480 114482 113589 CDS product presenilin family intramembrane aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065870.1 protein_id gnl|my_center|LOCUS_08480 >Feature sequence09 662 817 gene locus_tag LOCUS_08490 662 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 935 2404 gene locus_tag LOCUS_08500 935 2404 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024339.1 protein_id gnl|my_center|LOCUS_08500 3422 2463 gene locus_tag LOCUS_08510 3422 2463 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_08510 5073 3790 gene locus_tag LOCUS_08520 5073 3790 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024335.1 protein_id gnl|my_center|LOCUS_08520 5341 5619 gene locus_tag LOCUS_08530 5341 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990914.1 protein_id gnl|my_center|LOCUS_08530 6292 7275 gene locus_tag LOCUS_08540 6292 7275 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024333.1 protein_id gnl|my_center|LOCUS_08540 7268 8311 gene locus_tag LOCUS_08550 7268 8311 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024332.1 protein_id gnl|my_center|LOCUS_08550 8301 9227 gene locus_tag LOCUS_08560 8301 9227 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024331.1 protein_id gnl|my_center|LOCUS_08560 9270 10490 gene locus_tag LOCUS_08570 9270 10490 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024330.1 protein_id gnl|my_center|LOCUS_08570 10623 11630 gene locus_tag LOCUS_08580 10623 11630 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020371.1 protein_id gnl|my_center|LOCUS_08580 13260 11806 gene locus_tag LOCUS_08590 13260 11806 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066597.1 protein_id gnl|my_center|LOCUS_08590 14826 13339 gene locus_tag LOCUS_08600 14826 13339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065991.1 protein_id gnl|my_center|LOCUS_08600 16458 15430 gene locus_tag LOCUS_08610 16458 15430 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020209.1 protein_id gnl|my_center|LOCUS_08610 17905 19500 gene locus_tag LOCUS_08620 17905 19500 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024324.1 protein_id gnl|my_center|LOCUS_08620 19558 19704 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22094 20007 gene locus_tag LOCUS_08630 22094 20007 CDS product disaggregatase related repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065989.1 protein_id gnl|my_center|LOCUS_08630 22796 23401 gene locus_tag LOCUS_08640 22796 23401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 25018 23411 gene locus_tag LOCUS_08650 25018 23411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 25820 26053 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28099 27920 gene locus_tag LOCUS_08660 28099 27920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 29128 29493 gene locus_tag LOCUS_08670 29128 29493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 30103 29672 gene locus_tag LOCUS_08680 30103 29672 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024315.1 protein_id gnl|my_center|LOCUS_08680 30979 30275 gene locus_tag LOCUS_08690 30979 30275 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024314.1 protein_id gnl|my_center|LOCUS_08690 31092 31826 gene locus_tag LOCUS_08700 31092 31826 CDS product HisA/HisF-related TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024313.1 protein_id gnl|my_center|LOCUS_08700 31941 32201 gene locus_tag LOCUS_08710 31941 32201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024312.1 protein_id gnl|my_center|LOCUS_08710 32854 32237 gene locus_tag LOCUS_08720 gene tmk 32854 32237 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024311.1 protein_id gnl|my_center|LOCUS_08720 33030 33692 gene locus_tag LOCUS_08730 33030 33692 CDS product DUF166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024310.1 protein_id gnl|my_center|LOCUS_08730 33981 34199 gene locus_tag LOCUS_08740 33981 34199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 35162 34332 gene locus_tag LOCUS_08750 35162 34332 CDS product F420-dependent methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065986.1 protein_id gnl|my_center|LOCUS_08750 35566 36273 gene locus_tag LOCUS_08760 gene serB 35566 36273 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024307.1 protein_id gnl|my_center|LOCUS_08760 36323 37180 gene locus_tag LOCUS_08770 36323 37180 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024306.1 protein_id gnl|my_center|LOCUS_08770 38662 37523 gene locus_tag LOCUS_08780 38662 37523 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024301.1 protein_id gnl|my_center|LOCUS_08780 39892 38735 gene locus_tag LOCUS_08790 39892 38735 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024300.1 protein_id gnl|my_center|LOCUS_08790 40848 39907 gene locus_tag LOCUS_08800 40848 39907 CDS product UbiA prenyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065984.1 protein_id gnl|my_center|LOCUS_08800 42535 41063 gene locus_tag LOCUS_08810 gene tgtA 42535 41063 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024298.1 protein_id gnl|my_center|LOCUS_08810 43318 42731 gene locus_tag LOCUS_08820 43318 42731 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024295.1 protein_id gnl|my_center|LOCUS_08820 43817 44563 gene locus_tag LOCUS_08830 43817 44563 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066594.1 protein_id gnl|my_center|LOCUS_08830 44568 44957 gene locus_tag LOCUS_08840 44568 44957 CDS product DUF473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024293.1 protein_id gnl|my_center|LOCUS_08840 45457 45927 gene locus_tag LOCUS_08850 45457 45927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 47888 46260 gene locus_tag LOCUS_08860 gene thsB 47888 46260 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024292.1 protein_id gnl|my_center|LOCUS_08860 48783 48166 gene locus_tag LOCUS_08870 48783 48166 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589510.1 protein_id gnl|my_center|LOCUS_08870 49065 48790 gene locus_tag LOCUS_08880 49065 48790 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065981.1 protein_id gnl|my_center|LOCUS_08880 50129 49431 gene locus_tag LOCUS_08890 50129 49431 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020389.1 protein_id gnl|my_center|LOCUS_08890 51801 50578 gene locus_tag LOCUS_08900 51801 50578 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024286.1 protein_id gnl|my_center|LOCUS_08900 52526 51783 gene locus_tag LOCUS_08910 52526 51783 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024285.1 protein_id gnl|my_center|LOCUS_08910 53663 53001 gene locus_tag LOCUS_08920 53663 53001 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024284.1 protein_id gnl|my_center|LOCUS_08920 54639 53671 gene locus_tag LOCUS_08930 54639 53671 CDS product DUF128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065980.1 protein_id gnl|my_center|LOCUS_08930 56563 55202 gene locus_tag LOCUS_08940 gene glmM 56563 55202 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065480.1 protein_id gnl|my_center|LOCUS_08940 56867 57700 gene locus_tag LOCUS_08950 gene larE 56867 57700 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020298.1 protein_id gnl|my_center|LOCUS_08950 57849 58292 gene locus_tag LOCUS_08960 57849 58292 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020297.1 protein_id gnl|my_center|LOCUS_08960 58335 58482 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 58678 59211 gene locus_tag LOCUS_08970 58678 59211 CDS product DUF531 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020296.1 protein_id gnl|my_center|LOCUS_08970 59660 59818 gene locus_tag LOCUS_08980 59660 59818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08980 59861 61042 gene locus_tag LOCUS_08990 59861 61042 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020294.1 protein_id gnl|my_center|LOCUS_08990 61768 63444 gene locus_tag LOCUS_09000 61768 63444 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020292.1 protein_id gnl|my_center|LOCUS_09000 63613 63850 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 63869 65572 gene locus_tag LOCUS_09010 63869 65572 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020291.1 protein_id gnl|my_center|LOCUS_09010 66687 66211 gene locus_tag LOCUS_09020 66687 66211 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020282.1 protein_id gnl|my_center|LOCUS_09020 67451 68416 gene locus_tag LOCUS_09030 67451 68416 CDS product type IV pilin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064843.1 protein_id gnl|my_center|LOCUS_09030 68460 69488 gene locus_tag LOCUS_09040 68460 69488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064842.1 protein_id gnl|my_center|LOCUS_09040 69557 71059 gene locus_tag LOCUS_09050 69557 71059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 71118 71891 gene locus_tag LOCUS_09060 71118 71891 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020278.1 protein_id gnl|my_center|LOCUS_09060 72557 71982 gene locus_tag LOCUS_09070 72557 71982 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020385.1 protein_id gnl|my_center|LOCUS_09070 72975 72685 gene locus_tag LOCUS_09080 72975 72685 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860072.1 protein_id gnl|my_center|LOCUS_09080 73590 73066 gene locus_tag LOCUS_09090 73590 73066 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064860.1 protein_id gnl|my_center|LOCUS_09090 74350 73793 gene locus_tag LOCUS_09100 74350 73793 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020390.1 protein_id gnl|my_center|LOCUS_09100 74786 74918 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 75420 77741 gene locus_tag LOCUS_09110 75420 77741 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066079.1 protein_id gnl|my_center|LOCUS_09110 78010 78474 gene locus_tag LOCUS_09120 78010 78474 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020395.1 protein_id gnl|my_center|LOCUS_09120 78625 79494 gene locus_tag LOCUS_09130 78625 79494 CDS product DUF2953 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064862.1 protein_id gnl|my_center|LOCUS_09130 79550 80515 gene locus_tag LOCUS_09140 79550 80515 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064863.1 protein_id gnl|my_center|LOCUS_09140 80512 81522 gene locus_tag LOCUS_09150 80512 81522 CDS product NOP5/NOP56 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020398.1 protein_id gnl|my_center|LOCUS_09150 81523 82203 gene locus_tag LOCUS_09160 81523 82203 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020399.1 protein_id gnl|my_center|LOCUS_09160 82896 82351 gene locus_tag LOCUS_09170 82896 82351 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020400.1 protein_id gnl|my_center|LOCUS_09170 83347 84039 gene locus_tag LOCUS_09180 83347 84039 CDS product DUF2162 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066038.1 protein_id gnl|my_center|LOCUS_09180 84036 84659 gene locus_tag LOCUS_09190 84036 84659 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020402.1 protein_id gnl|my_center|LOCUS_09190 84691 85143 gene locus_tag LOCUS_09200 84691 85143 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020403.1 protein_id gnl|my_center|LOCUS_09200 85466 85696 gene locus_tag LOCUS_09210 85466 85696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09210 85716 85904 gene locus_tag LOCUS_09220 85716 85904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09220 89185 89363 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 89422 92223 gene locus_tag LOCUS_09230 89422 92223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 92841 92407 gene locus_tag LOCUS_09240 gene tsaA 92841 92407 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064869.1 protein_id gnl|my_center|LOCUS_09240 93418 92834 gene locus_tag LOCUS_09250 93418 92834 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082088841.1 protein_id gnl|my_center|LOCUS_09250 94484 95152 gene locus_tag LOCUS_09260 94484 95152 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048120431.1 protein_id gnl|my_center|LOCUS_09260 95240 96163 gene locus_tag LOCUS_09270 95240 96163 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020436.1 protein_id gnl|my_center|LOCUS_09270 97000 96236 gene locus_tag LOCUS_09280 97000 96236 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984863.1 protein_id gnl|my_center|LOCUS_09280 98108 96993 gene locus_tag LOCUS_09290 98108 96993 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020431.1 protein_id gnl|my_center|LOCUS_09290 99352 98174 gene locus_tag LOCUS_09300 99352 98174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020430.1 protein_id gnl|my_center|LOCUS_09300 100505 99804 gene locus_tag LOCUS_09310 gene pyrH 100505 99804 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020429.1 protein_id gnl|my_center|LOCUS_09310 100694 101500 gene locus_tag LOCUS_09320 gene larB 100694 101500 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020480.1 protein_id gnl|my_center|LOCUS_09320 101572 101712 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 101761 102951 gene locus_tag LOCUS_09330 gene larC 101761 102951 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020481.1 protein_id gnl|my_center|LOCUS_09330 104224 103196 gene locus_tag LOCUS_09340 gene asd 104224 103196 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020482.1 protein_id gnl|my_center|LOCUS_09340 104492 104310 gene locus_tag LOCUS_09350 104492 104310 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020483.1 protein_id gnl|my_center|LOCUS_09350 105039 104731 gene locus_tag LOCUS_09360 105039 104731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020484.1 protein_id gnl|my_center|LOCUS_09360 106347 105253 gene locus_tag LOCUS_09370 106347 105253 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020485.1 protein_id gnl|my_center|LOCUS_09370 106396 106674 gene locus_tag LOCUS_09380 106396 106674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 107402 108397 gene locus_tag LOCUS_09390 107402 108397 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066092.1 protein_id gnl|my_center|LOCUS_09390 108952 110961 gene locus_tag LOCUS_09400 108952 110961 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024274.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence10 1314 940 gene locus_tag LOCUS_09410 1314 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990763.1 protein_id gnl|my_center|LOCUS_09410 2399 1437 gene locus_tag LOCUS_09420 2399 1437 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020974.1 protein_id gnl|my_center|LOCUS_09420 3142 2396 gene locus_tag LOCUS_09430 3142 2396 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020975.1 protein_id gnl|my_center|LOCUS_09430 3767 3162 gene locus_tag LOCUS_09440 3767 3162 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020976.1 protein_id gnl|my_center|LOCUS_09440 4594 3752 gene locus_tag LOCUS_09450 gene cobS 4594 3752 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020977.1 protein_id gnl|my_center|LOCUS_09450 5154 4612 gene locus_tag LOCUS_09460 gene cobZ 5154 4612 CDS product alpha-ribazole phosphatase CobZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065005.1 protein_id gnl|my_center|LOCUS_09460 6275 5289 gene locus_tag LOCUS_09470 6275 5289 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020979.1 protein_id gnl|my_center|LOCUS_09470 7762 6272 gene locus_tag LOCUS_09480 gene cobD 7762 6272 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020980.1 protein_id gnl|my_center|LOCUS_09480 8243 9472 gene locus_tag LOCUS_09490 gene hisS 8243 9472 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020981.1 protein_id gnl|my_center|LOCUS_09490 9895 10644 gene locus_tag LOCUS_09500 9895 10644 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022097.1 protein_id gnl|my_center|LOCUS_09500 10646 11752 gene locus_tag LOCUS_09510 10646 11752 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877096.1 protein_id gnl|my_center|LOCUS_09510 12055 11843 gene locus_tag LOCUS_09520 12055 11843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 12210 12998 gene locus_tag LOCUS_09530 12210 12998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 13279 13737 gene locus_tag LOCUS_09540 13279 13737 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020987.1 protein_id gnl|my_center|LOCUS_09540 14727 13945 gene locus_tag LOCUS_09550 14727 13945 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065008.1 protein_id gnl|my_center|LOCUS_09550 15806 14724 gene locus_tag LOCUS_09560 15806 14724 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020989.1 protein_id gnl|my_center|LOCUS_09560 17042 15825 gene locus_tag LOCUS_09570 17042 15825 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020990.1 protein_id gnl|my_center|LOCUS_09570 17769 17494 gene locus_tag LOCUS_09580 17769 17494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09580 18727 17903 gene locus_tag LOCUS_09590 gene nadC 18727 17903 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020993.1 protein_id gnl|my_center|LOCUS_09590 19065 19880 gene locus_tag LOCUS_09600 19065 19880 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 protein_id gnl|my_center|LOCUS_09600 20504 21418 gene locus_tag LOCUS_09610 gene nadA 20504 21418 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020997.1 protein_id gnl|my_center|LOCUS_09610 22218 21562 gene locus_tag LOCUS_09620 22218 21562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 22511 22887 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23587 24456 gene locus_tag LOCUS_09630 23587 24456 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020999.1 protein_id gnl|my_center|LOCUS_09630 25712 24480 gene locus_tag LOCUS_09640 25712 24480 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021000.1 protein_id gnl|my_center|LOCUS_09640 25910 26039 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26929 26180 gene locus_tag LOCUS_09650 26929 26180 CDS product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021001.1 protein_id gnl|my_center|LOCUS_09650 27516 27857 gene locus_tag LOCUS_09660 27516 27857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589515.1 protein_id gnl|my_center|LOCUS_09660 28301 30568 gene locus_tag LOCUS_09670 28301 30568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 31295 31369 gene locus_tag LOCUS_t00150 31295 31369 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 32917 31763 gene locus_tag LOCUS_09680 32917 31763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 33056 33208 gene locus_tag LOCUS_09690 33056 33208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 33693 34571 gene locus_tag LOCUS_09700 33693 34571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 34571 36157 gene locus_tag LOCUS_09710 34571 36157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 36154 37542 gene locus_tag LOCUS_09720 36154 37542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 38264 38704 gene locus_tag LOCUS_09730 38264 38704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 40688 39042 gene locus_tag LOCUS_09740 40688 39042 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860157.1 protein_id gnl|my_center|LOCUS_09740 41548 42090 gene locus_tag LOCUS_09750 41548 42090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 42567 42250 gene locus_tag LOCUS_09760 42567 42250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 42965 43129 gene locus_tag LOCUS_09770 42965 43129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 43180 43473 gene locus_tag LOCUS_09780 43180 43473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 43835 44707 gene locus_tag LOCUS_09790 43835 44707 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145171390.1 protein_id gnl|my_center|LOCUS_09790 48628 44837 gene locus_tag LOCUS_09800 48628 44837 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864285.1 protein_id gnl|my_center|LOCUS_09800 49628 49422 gene locus_tag LOCUS_09810 49628 49422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 53117 51138 gene locus_tag LOCUS_09820 53117 51138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 51294 51425 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 53777 54640 gene locus_tag LOCUS_09830 gene mtxX 53777 54640 CDS product methanogenesis marker protein Mmp4/MtxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065223.1 protein_id gnl|my_center|LOCUS_09830 54637 55230 gene locus_tag LOCUS_09840 54637 55230 CDS product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021808.1 protein_id gnl|my_center|LOCUS_09840 55326 56258 gene locus_tag LOCUS_09850 gene mtrH 55326 56258 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021807.1 protein_id gnl|my_center|LOCUS_09850 58676 57015 gene locus_tag LOCUS_09860 gene ilvD 58676 57015 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021805.1 protein_id gnl|my_center|LOCUS_09860 59401 61182 gene locus_tag LOCUS_09870 59401 61182 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021803.1 protein_id gnl|my_center|LOCUS_09870 61419 61868 gene locus_tag LOCUS_09880 61419 61868 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021802.1 protein_id gnl|my_center|LOCUS_09880 62876 62079 gene locus_tag LOCUS_09890 62876 62079 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021800.1 protein_id gnl|my_center|LOCUS_09890 63726 63319 gene locus_tag LOCUS_09900 63726 63319 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065220.1 protein_id gnl|my_center|LOCUS_09900 64971 64465 gene locus_tag LOCUS_09910 gene fae 64971 64465 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022945.1 protein_id gnl|my_center|LOCUS_09910 65954 65163 gene locus_tag LOCUS_09920 65954 65163 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022940.1 protein_id gnl|my_center|LOCUS_09920 66538 66206 gene locus_tag LOCUS_09930 66538 66206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022939.1 protein_id gnl|my_center|LOCUS_09930 67181 66942 gene locus_tag LOCUS_09940 67181 66942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022937.1 protein_id gnl|my_center|LOCUS_09940 69333 67870 gene locus_tag LOCUS_09950 69333 67870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 71279 69906 gene locus_tag LOCUS_09960 71279 69906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 72673 71276 gene locus_tag LOCUS_09970 72673 71276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 72889 72894 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 73050 75740 gene locus_tag LOCUS_09980 73050 75740 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021615.1 protein_id gnl|my_center|LOCUS_09980 76116 77051 gene locus_tag LOCUS_09990 76116 77051 CDS product DUF1259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965726.1 protein_id gnl|my_center|LOCUS_09990 77907 77320 gene locus_tag LOCUS_10000 77907 77320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 78650 78982 gene locus_tag LOCUS_10010 78650 78982 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021616.1 protein_id gnl|my_center|LOCUS_10010 79497 80714 gene locus_tag LOCUS_10020 gene thrC 79497 80714 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021620.1 protein_id gnl|my_center|LOCUS_10020 80759 83659 gene locus_tag LOCUS_10030 gene leuS 80759 83659 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021621.1 protein_id gnl|my_center|LOCUS_10030 84803 83982 gene locus_tag LOCUS_10040 84803 83982 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065733.1 protein_id gnl|my_center|LOCUS_10040 86072 85143 gene locus_tag LOCUS_10050 86072 85143 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022948.1 protein_id gnl|my_center|LOCUS_10050 86670 87167 gene locus_tag LOCUS_10060 86670 87167 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022951.1 protein_id gnl|my_center|LOCUS_10060 87468 88505 gene locus_tag LOCUS_10070 87468 88505 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022952.1 protein_id gnl|my_center|LOCUS_10070 88569 89090 gene locus_tag LOCUS_10080 88569 89090 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022953.1 protein_id gnl|my_center|LOCUS_10080 89087 89878 gene locus_tag LOCUS_10090 89087 89878 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589532.1 protein_id gnl|my_center|LOCUS_10090 90245 90787 gene locus_tag LOCUS_10100 90245 90787 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022955.1 protein_id gnl|my_center|LOCUS_10100 91166 90945 gene locus_tag LOCUS_10110 91166 90945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022956.1 protein_id gnl|my_center|LOCUS_10110 >Feature sequence11 99 14 gene locus_tag LOCUS_t00160 99 14 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1203 295 gene locus_tag LOCUS_10120 gene argF 1203 295 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023243.1 protein_id gnl|my_center|LOCUS_10120 2618 1317 gene locus_tag LOCUS_10130 gene purD 2618 1317 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065667.1 protein_id gnl|my_center|LOCUS_10130 3694 3137 gene locus_tag LOCUS_10140 gene pyrE 3694 3137 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023240.1 protein_id gnl|my_center|LOCUS_10140 4423 3896 gene locus_tag LOCUS_10150 4423 3896 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023239.1 protein_id gnl|my_center|LOCUS_10150 5562 5960 gene locus_tag LOCUS_10160 5562 5960 CDS product transcriptional regulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065665.1 protein_id gnl|my_center|LOCUS_10160 6663 6451 gene locus_tag LOCUS_10170 6663 6451 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023233.1 protein_id gnl|my_center|LOCUS_10170 6788 6660 gene locus_tag LOCUS_10180 6788 6660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 7388 7317 gene locus_tag LOCUS_t00170 7388 7317 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7475 7401 gene locus_tag LOCUS_t00180 7475 7401 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 7626 7551 gene locus_tag LOCUS_t00190 7626 7551 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7928 9244 gene locus_tag LOCUS_10190 7928 9244 CDS product methanogenesis marker 16 metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023232.1 protein_id gnl|my_center|LOCUS_10190 10419 9271 gene locus_tag LOCUS_10200 gene comE 10419 9271 CDS product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023231.1 protein_id gnl|my_center|LOCUS_10200 11818 10568 gene locus_tag LOCUS_10210 11818 10568 CDS product cysteate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066469.1 protein_id gnl|my_center|LOCUS_10210 12605 12141 gene locus_tag LOCUS_10220 12605 12141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023229.1 protein_id gnl|my_center|LOCUS_10220 12758 12967 gene locus_tag LOCUS_10230 12758 12967 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065663.1 protein_id gnl|my_center|LOCUS_10230 13055 13218 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13444 13875 gene locus_tag LOCUS_10240 13444 13875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 14871 15107 gene locus_tag LOCUS_10250 14871 15107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 15973 15104 gene locus_tag LOCUS_10260 15973 15104 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023223.1 protein_id gnl|my_center|LOCUS_10260 16471 18567 gene locus_tag LOCUS_10270 gene lonB 16471 18567 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023222.1 protein_id gnl|my_center|LOCUS_10270 18570 19910 gene locus_tag LOCUS_10280 18570 19910 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990640.1 protein_id gnl|my_center|LOCUS_10280 19913 21223 gene locus_tag LOCUS_10290 19913 21223 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065661.1 protein_id gnl|my_center|LOCUS_10290 22136 21447 gene locus_tag LOCUS_10300 22136 21447 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022879.1 protein_id gnl|my_center|LOCUS_10300 23161 22133 gene locus_tag LOCUS_10310 23161 22133 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022880.1 protein_id gnl|my_center|LOCUS_10310 23323 23180 gene locus_tag LOCUS_10320 23323 23180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 23819 23592 gene locus_tag LOCUS_10330 23819 23592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 24763 24095 gene locus_tag LOCUS_10340 24763 24095 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022642.1 protein_id gnl|my_center|LOCUS_10340 25568 24849 gene locus_tag LOCUS_10350 25568 24849 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065489.1 protein_id gnl|my_center|LOCUS_10350 26018 25728 gene locus_tag LOCUS_10360 26018 25728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 26145 25978 gene locus_tag LOCUS_10370 26145 25978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 26659 26093 gene locus_tag LOCUS_10380 26659 26093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 27275 26673 gene locus_tag LOCUS_10390 27275 26673 CDS product C25 family cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879254.1 protein_id gnl|my_center|LOCUS_10390 28947 28378 gene locus_tag LOCUS_10400 28947 28378 CDS product RPA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022957.1 protein_id gnl|my_center|LOCUS_10400 30201 28948 gene locus_tag LOCUS_10410 30201 28948 CDS product replication protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022958.1 protein_id gnl|my_center|LOCUS_10410 30857 32074 gene locus_tag LOCUS_10420 30857 32074 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022961.1 protein_id gnl|my_center|LOCUS_10420 32093 33946 gene locus_tag LOCUS_10430 gene glmS 32093 33946 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022962.1 protein_id gnl|my_center|LOCUS_10430 34018 35322 gene locus_tag LOCUS_10440 gene glmM 34018 35322 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065583.1 protein_id gnl|my_center|LOCUS_10440 35319 36512 gene locus_tag LOCUS_10450 35319 36512 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022964.1 protein_id gnl|my_center|LOCUS_10450 37154 36669 gene locus_tag LOCUS_10460 37154 36669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065584.1 protein_id gnl|my_center|LOCUS_10460 37175 37356 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37794 37597 gene locus_tag LOCUS_10470 37794 37597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162197611.1 protein_id gnl|my_center|LOCUS_10470 38433 39551 gene locus_tag LOCUS_10480 38433 39551 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022968.1 protein_id gnl|my_center|LOCUS_10480 39702 39962 gene locus_tag LOCUS_10490 39702 39962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065588.1 protein_id gnl|my_center|LOCUS_10490 41203 40286 gene locus_tag LOCUS_10500 gene rnz 41203 40286 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 protein_id gnl|my_center|LOCUS_10500 41496 42341 gene locus_tag LOCUS_10510 gene cobA 41496 42341 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022972.1 protein_id gnl|my_center|LOCUS_10510 42345 43166 gene locus_tag LOCUS_10520 42345 43166 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022973.1 protein_id gnl|my_center|LOCUS_10520 43250 44449 gene locus_tag LOCUS_10530 gene ahbC 43250 44449 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022974.1 protein_id gnl|my_center|LOCUS_10530 44961 45410 gene locus_tag LOCUS_10540 44961 45410 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022482.1 protein_id gnl|my_center|LOCUS_10540 45773 47014 gene locus_tag LOCUS_10550 45773 47014 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022483.1 protein_id gnl|my_center|LOCUS_10550 47139 47684 gene locus_tag LOCUS_10560 47139 47684 CDS product DUF2148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022484.1 protein_id gnl|my_center|LOCUS_10560 49064 47907 gene locus_tag LOCUS_10570 49064 47907 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065191.1 protein_id gnl|my_center|LOCUS_10570 49207 49371 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 50445 50233 gene locus_tag LOCUS_10580 50445 50233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021873.1 protein_id gnl|my_center|LOCUS_10580 50640 50847 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51092 52447 gene locus_tag LOCUS_10590 51092 52447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 52538 53716 gene locus_tag LOCUS_10600 52538 53716 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065248.1 protein_id gnl|my_center|LOCUS_10600 54598 53756 gene locus_tag LOCUS_10610 54598 53756 CDS product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099768.1 protein_id gnl|my_center|LOCUS_10610 55306 58239 gene locus_tag LOCUS_10620 55306 58239 CDS product PGF-pre-PGF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990840.1 protein_id gnl|my_center|LOCUS_10620 59453 59641 gene locus_tag LOCUS_10630 59453 59641 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065544.1 protein_id gnl|my_center|LOCUS_10630 59666 59875 gene locus_tag LOCUS_10640 59666 59875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 59949 60137 gene locus_tag LOCUS_10650 59949 60137 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065544.1 protein_id gnl|my_center|LOCUS_10650 60398 60548 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 60953 61147 gene locus_tag LOCUS_10660 60953 61147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 62105 61440 gene locus_tag LOCUS_10670 gene pyrF 62105 61440 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065013.1 protein_id gnl|my_center|LOCUS_10670 63063 62110 gene locus_tag LOCUS_10680 63063 62110 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021005.1 protein_id gnl|my_center|LOCUS_10680 63422 64258 gene locus_tag LOCUS_10690 63422 64258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 64393 64567 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 65405 66211 gene locus_tag LOCUS_10700 65405 66211 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768886.1 protein_id gnl|my_center|LOCUS_10700 66663 66271 gene locus_tag LOCUS_10710 66663 66271 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021003.1 protein_id gnl|my_center|LOCUS_10710 68008 69306 gene locus_tag LOCUS_10720 68008 69306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10720 69312 70763 gene locus_tag LOCUS_10730 69312 70763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10730 70930 71964 gene locus_tag LOCUS_10740 70930 71964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 72283 73707 gene locus_tag LOCUS_10750 72283 73707 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022106.1 protein_id gnl|my_center|LOCUS_10750 73896 75386 gene locus_tag LOCUS_10760 73896 75386 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022102.1 protein_id gnl|my_center|LOCUS_10760 75653 75468 gene locus_tag LOCUS_10770 75653 75468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 75961 75629 gene locus_tag LOCUS_10780 75961 75629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 76462 76001 gene locus_tag LOCUS_10790 76462 76001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10790 76948 76538 gene locus_tag LOCUS_10800 76948 76538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 79416 77008 gene locus_tag LOCUS_10810 79416 77008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 79712 80512 gene locus_tag LOCUS_10820 79712 80512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 83726 81051 gene locus_tag LOCUS_10830 83726 81051 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022429.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence12 537 64 gene locus_tag LOCUS_10840 537 64 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065697.1 protein_id gnl|my_center|LOCUS_10840 813 1121 gene locus_tag LOCUS_10850 813 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065696.1 protein_id gnl|my_center|LOCUS_10850 1318 2082 gene locus_tag LOCUS_10860 1318 2082 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023329.1 protein_id gnl|my_center|LOCUS_10860 3439 2129 gene locus_tag LOCUS_10870 3439 2129 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056829.1 protein_id gnl|my_center|LOCUS_10870 5320 4130 gene locus_tag LOCUS_10880 5320 4130 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966323.1 protein_id gnl|my_center|LOCUS_10880 5589 6080 gene locus_tag LOCUS_10890 5589 6080 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937739.1 protein_id gnl|my_center|LOCUS_10890 6213 6362 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6742 7332 gene locus_tag LOCUS_10900 6742 7332 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021787.1 protein_id gnl|my_center|LOCUS_10900 7329 7772 gene locus_tag LOCUS_10910 7329 7772 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755897.1 protein_id gnl|my_center|LOCUS_10910 7765 8484 gene locus_tag LOCUS_10920 7765 8484 CDS product ribonuclease P protein component 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021785.1 protein_id gnl|my_center|LOCUS_10920 8481 8840 gene locus_tag LOCUS_10930 8481 8840 CDS product Rpp14/Pop5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021784.1 protein_id gnl|my_center|LOCUS_10930 9376 10125 gene locus_tag LOCUS_10940 gene psmA 9376 10125 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_10940 10205 10897 gene locus_tag LOCUS_10950 10205 10897 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021781.1 protein_id gnl|my_center|LOCUS_10950 10909 11691 gene locus_tag LOCUS_10960 gene rrp4 10909 11691 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021780.1 protein_id gnl|my_center|LOCUS_10960 12807 13056 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13147 13938 gene locus_tag LOCUS_10970 gene rrp42 13147 13938 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021779.1 protein_id gnl|my_center|LOCUS_10970 14126 14410 gene locus_tag LOCUS_10980 14126 14410 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021778.1 protein_id gnl|my_center|LOCUS_10980 14432 14569 gene locus_tag LOCUS_10990 14432 14569 CDS product DNA-directed RNA polymerase subunit P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021777.1 protein_id gnl|my_center|LOCUS_10990 15128 16486 gene locus_tag LOCUS_11000 gene glmM 15128 16486 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065480.1 protein_id gnl|my_center|LOCUS_11000 16839 19286 gene locus_tag LOCUS_11010 gene ppsA 16839 19286 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022627.1 protein_id gnl|my_center|LOCUS_11010 19323 19982 gene locus_tag LOCUS_11020 19323 19982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11020 20133 20870 gene locus_tag LOCUS_11030 20133 20870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11030 23398 20954 gene locus_tag LOCUS_11040 23398 20954 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496762.1 protein_id gnl|my_center|LOCUS_11040 25025 23694 gene locus_tag LOCUS_11050 25025 23694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 26416 25400 gene locus_tag LOCUS_11060 26416 25400 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021053.1 protein_id gnl|my_center|LOCUS_11060 28425 27187 gene locus_tag LOCUS_11070 gene pgk 28425 27187 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022629.1 protein_id gnl|my_center|LOCUS_11070 30337 29933 gene locus_tag LOCUS_11080 30337 29933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 30581 31000 gene locus_tag LOCUS_11090 30581 31000 CDS product rRNA maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021745.1 protein_id gnl|my_center|LOCUS_11090 31053 31304 gene locus_tag LOCUS_11100 31053 31304 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021744.1 protein_id gnl|my_center|LOCUS_11100 31680 31507 gene locus_tag LOCUS_11110 31680 31507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162829679.1 protein_id gnl|my_center|LOCUS_11110 32404 32009 gene locus_tag LOCUS_11120 32404 32009 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066255.1 protein_id gnl|my_center|LOCUS_11120 34138 32726 gene locus_tag LOCUS_11130 34138 32726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 35033 34323 gene locus_tag LOCUS_11140 35033 34323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020614.1 protein_id gnl|my_center|LOCUS_11140 35612 35779 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36611 35904 gene locus_tag LOCUS_11150 36611 35904 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544852.1 protein_id gnl|my_center|LOCUS_11150 36713 36858 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37042 37710 gene locus_tag LOCUS_11160 37042 37710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 38520 38125 gene locus_tag LOCUS_11170 38520 38125 CDS product F420H2 dehydrogenase subunit FpoO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021521.1 protein_id gnl|my_center|LOCUS_11170 39979 38534 gene locus_tag LOCUS_11180 gene fpoN 39979 38534 CDS product F(420)H(2) dehydrogenase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021520.1 protein_id gnl|my_center|LOCUS_11180 41470 39983 gene locus_tag LOCUS_11190 gene fpoM 41470 39983 CDS product F(420)H(2) dehydrogenase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021519.1 protein_id gnl|my_center|LOCUS_11190 43488 41470 gene locus_tag LOCUS_11200 gene fpoL 43488 41470 CDS product F420H2 dehydrogenase subunit FpoL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021518.1 protein_id gnl|my_center|LOCUS_11200 43784 43482 gene locus_tag LOCUS_11210 gene fpoK 43784 43482 CDS product F420H2 dehydrogenase subunit FpoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589525.1 protein_id gnl|my_center|LOCUS_11210 44032 43781 gene locus_tag LOCUS_11220 gene fpoJ 44032 43781 CDS product F420H2 dehydrogenase subunit FpoJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048140882.1 protein_id gnl|my_center|LOCUS_11220 44312 44022 gene locus_tag LOCUS_11230 44312 44022 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048140880.1 protein_id gnl|my_center|LOCUS_11230 44719 44309 gene locus_tag LOCUS_11240 gene fpoI 44719 44309 CDS product F420H2 dehydrogenase subunit FpoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021514.1 protein_id gnl|my_center|LOCUS_11240 45764 44724 gene locus_tag LOCUS_11250 gene fpoH 45764 44724 CDS product F420H2 dehydrogenase subunit FpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065137.1 protein_id gnl|my_center|LOCUS_11250 46894 45770 gene locus_tag LOCUS_11260 gene fpoD 46894 45770 CDS product F420H2 dehydrogenase subunit FpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021512.1 protein_id gnl|my_center|LOCUS_11260 47381 46905 gene locus_tag LOCUS_11270 gene fpoC 47381 46905 CDS product F420H2 dehydrogenase subunit FpoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021511.1 protein_id gnl|my_center|LOCUS_11270 47980 47429 gene locus_tag LOCUS_11280 gene fpoB 47980 47429 CDS product F(420)H(2) dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021510.1 protein_id gnl|my_center|LOCUS_11280 48342 47968 gene locus_tag LOCUS_11290 gene fpoA 48342 47968 CDS product F420H2 dehydrogenase subunit FpoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021509.1 protein_id gnl|my_center|LOCUS_11290 49171 49356 gene locus_tag LOCUS_11300 49171 49356 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065135.1 protein_id gnl|my_center|LOCUS_11300 49353 50630 gene locus_tag LOCUS_11310 49353 50630 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021506.1 protein_id gnl|my_center|LOCUS_11310 50807 51655 gene locus_tag LOCUS_11320 gene cofG 50807 51655 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755891.1 protein_id gnl|my_center|LOCUS_11320 51762 52955 gene locus_tag LOCUS_11330 gene cofH 51762 52955 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021503.1 protein_id gnl|my_center|LOCUS_11330 53437 54063 gene locus_tag LOCUS_11340 gene cofC 53437 54063 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021502.1 protein_id gnl|my_center|LOCUS_11340 54174 54394 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 55050 55178 gene locus_tag LOCUS_11350 55050 55178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 55175 56398 gene locus_tag LOCUS_11360 55175 56398 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021498.1 protein_id gnl|my_center|LOCUS_11360 56542 56737 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 58215 56785 gene locus_tag LOCUS_11370 58215 56785 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 protein_id gnl|my_center|LOCUS_11370 59617 58271 gene locus_tag LOCUS_11380 gene trkA 59617 58271 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021496.1 protein_id gnl|my_center|LOCUS_11380 61140 59794 gene locus_tag LOCUS_11390 gene trkA 61140 59794 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021494.1 protein_id gnl|my_center|LOCUS_11390 62901 61735 gene locus_tag LOCUS_11400 gene dnaJ 62901 61735 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021493.1 protein_id gnl|my_center|LOCUS_11400 64860 63007 gene locus_tag LOCUS_11410 gene dnaK 64860 63007 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021492.1 protein_id gnl|my_center|LOCUS_11410 65652 65023 gene locus_tag LOCUS_11420 gene grpE 65652 65023 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021491.1 protein_id gnl|my_center|LOCUS_11420 66231 65788 gene locus_tag LOCUS_11430 66231 65788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048125745.1 protein_id gnl|my_center|LOCUS_11430 66485 67444 gene locus_tag LOCUS_11440 66485 67444 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021489.1 protein_id gnl|my_center|LOCUS_11440 67521 68504 gene locus_tag LOCUS_11450 67521 68504 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021488.1 protein_id gnl|my_center|LOCUS_11450 68667 69389 gene locus_tag LOCUS_11460 68667 69389 CDS product amino acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021487.1 protein_id gnl|my_center|LOCUS_11460 69846 70115 gene locus_tag LOCUS_11470 69846 70115 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021485.1 protein_id gnl|my_center|LOCUS_11470 70172 70243 gene locus_tag LOCUS_t00200 70172 70243 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 70741 71313 gene locus_tag LOCUS_11480 70741 71313 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065384.1 protein_id gnl|my_center|LOCUS_11480 71415 75020 gene locus_tag LOCUS_11490 gene brxC 71415 75020 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065383.1 protein_id gnl|my_center|LOCUS_11490 75040 77829 gene locus_tag LOCUS_11500 gene pglX 75040 77829 CDS product BREX-1 system adenine-specific DNA-methyltransferase PglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022345.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11500 77871 78551 gene locus_tag LOCUS_11510 77871 78551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11510 79341 78637 gene locus_tag LOCUS_11520 79341 78637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 79804 79331 gene locus_tag LOCUS_11530 79804 79331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence13 511 861 gene locus_tag LOCUS_11540 511 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064952.1 protein_id gnl|my_center|LOCUS_11540 1013 1192 gene locus_tag LOCUS_11550 1013 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1557 2984 gene locus_tag LOCUS_11560 1557 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 3257 4588 gene locus_tag LOCUS_11570 3257 4588 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020753.1 protein_id gnl|my_center|LOCUS_11570 4578 6956 gene locus_tag LOCUS_11580 4578 6956 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990744.1 protein_id gnl|my_center|LOCUS_11580 7376 7300 gene locus_tag LOCUS_t00210 7376 7300 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8189 7554 gene locus_tag LOCUS_11590 8189 7554 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020756.1 protein_id gnl|my_center|LOCUS_11590 8596 8207 gene locus_tag LOCUS_11600 8596 8207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020757.1 protein_id gnl|my_center|LOCUS_11600 9857 8658 gene locus_tag LOCUS_11610 9857 8658 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020758.1 protein_id gnl|my_center|LOCUS_11610 9968 10897 gene locus_tag LOCUS_11620 gene cofD 9968 10897 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066127.1 protein_id gnl|my_center|LOCUS_11620 10931 11263 gene locus_tag LOCUS_11630 10931 11263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 11619 12770 gene locus_tag LOCUS_11640 11619 12770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 13111 13683 gene locus_tag LOCUS_11650 gene hpt 13111 13683 CDS product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020762.1 protein_id gnl|my_center|LOCUS_11650 13664 14671 gene locus_tag LOCUS_11660 gene dph2 13664 14671 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020763.1 protein_id gnl|my_center|LOCUS_11660 14672 15265 gene locus_tag LOCUS_11670 14672 15265 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020764.1 protein_id gnl|my_center|LOCUS_11670 15640 16485 gene locus_tag LOCUS_11680 15640 16485 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020765.1 protein_id gnl|my_center|LOCUS_11680 16553 16831 gene locus_tag LOCUS_11690 16553 16831 CDS product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020766.1 protein_id gnl|my_center|LOCUS_11690 17219 18379 gene locus_tag LOCUS_11700 gene pscS 17219 18379 CDS product O-phospho-L-seryl-tRNA:Cys-tRNA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020767.1 protein_id gnl|my_center|LOCUS_11700 18983 18645 gene locus_tag LOCUS_11710 18983 18645 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020768.1 protein_id gnl|my_center|LOCUS_11710 19227 19592 gene locus_tag LOCUS_11720 19227 19592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 21131 19869 gene locus_tag LOCUS_11730 gene lysA 21131 19869 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020771.1 protein_id gnl|my_center|LOCUS_11730 21354 21136 gene locus_tag LOCUS_11740 21354 21136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 23245 21491 gene locus_tag LOCUS_11750 gene polX 23245 21491 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020772.1 protein_id gnl|my_center|LOCUS_11750 23806 23879 gene locus_tag LOCUS_t00220 23806 23879 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 24374 23970 gene locus_tag LOCUS_11760 24374 23970 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064953.1 protein_id gnl|my_center|LOCUS_11760 24378 24528 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24723 25427 gene locus_tag LOCUS_11770 24723 25427 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279101.1 protein_id gnl|my_center|LOCUS_11770 25925 27202 gene locus_tag LOCUS_11780 25925 27202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064954.1 protein_id gnl|my_center|LOCUS_11780 28183 28533 gene locus_tag LOCUS_11790 28183 28533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 30278 30505 gene locus_tag LOCUS_11800 30278 30505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 31813 32145 gene locus_tag LOCUS_11810 31813 32145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 32783 33253 gene locus_tag LOCUS_11820 32783 33253 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990749.1 protein_id gnl|my_center|LOCUS_11820 33568 33966 gene locus_tag LOCUS_11830 33568 33966 CDS product DUF2769 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023170.1 protein_id gnl|my_center|LOCUS_11830 34159 34554 gene locus_tag LOCUS_11840 34159 34554 CDS product DUF2769 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023170.1 protein_id gnl|my_center|LOCUS_11840 34804 35526 gene locus_tag LOCUS_11850 34804 35526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 35737 37755 gene locus_tag LOCUS_11860 35737 37755 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023875.1 protein_id gnl|my_center|LOCUS_11860 37911 38459 gene locus_tag LOCUS_11870 37911 38459 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020793.1 protein_id gnl|my_center|LOCUS_11870 38787 40208 gene locus_tag LOCUS_11880 gene cysS 38787 40208 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020794.1 protein_id gnl|my_center|LOCUS_11880 40513 40779 gene locus_tag LOCUS_11890 40513 40779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 40901 41836 gene locus_tag LOCUS_11900 40901 41836 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020797.1 protein_id gnl|my_center|LOCUS_11900 42104 42964 gene locus_tag LOCUS_11910 42104 42964 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020802.1 protein_id gnl|my_center|LOCUS_11910 44250 44442 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 46089 45316 gene locus_tag LOCUS_11920 46089 45316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 46624 46091 gene locus_tag LOCUS_11930 46624 46091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 49651 49073 gene locus_tag LOCUS_11940 49651 49073 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023327.1 protein_id gnl|my_center|LOCUS_11940 49906 50532 gene locus_tag LOCUS_11950 49906 50532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 50529 52352 gene locus_tag LOCUS_11960 50529 52352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 52471 53454 gene locus_tag LOCUS_11970 52471 53454 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009257713.1 protein_id gnl|my_center|LOCUS_11970 53513 54313 gene locus_tag LOCUS_11980 53513 54313 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860221.1 protein_id gnl|my_center|LOCUS_11980 54418 55350 gene locus_tag LOCUS_11990 54418 55350 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024134.1 protein_id gnl|my_center|LOCUS_11990 55400 56404 gene locus_tag LOCUS_12000 55400 56404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 56748 59516 gene locus_tag LOCUS_12010 56748 59516 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020807.1 protein_id gnl|my_center|LOCUS_12010 60384 59707 gene locus_tag LOCUS_12020 60384 59707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 61067 60732 gene locus_tag LOCUS_12030 61067 60732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 61565 61077 gene locus_tag LOCUS_12040 61565 61077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 61801 62103 gene locus_tag LOCUS_12050 61801 62103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 63260 62502 gene locus_tag LOCUS_12060 63260 62502 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020817.1 protein_id gnl|my_center|LOCUS_12060 63806 63552 gene locus_tag LOCUS_12070 63806 63552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020818.1 protein_id gnl|my_center|LOCUS_12070 64520 67108 gene locus_tag LOCUS_12080 64520 67108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 67890 67312 gene locus_tag LOCUS_12090 67890 67312 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020819.1 protein_id gnl|my_center|LOCUS_12090 68331 69407 gene locus_tag LOCUS_12100 68331 69407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020820.1 protein_id gnl|my_center|LOCUS_12100 70337 71371 gene locus_tag LOCUS_12110 70337 71371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 71678 72703 gene locus_tag LOCUS_12120 gene mtaA 71678 72703 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020823.1 protein_id gnl|my_center|LOCUS_12120 73690 72785 gene locus_tag LOCUS_12130 73690 72785 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020824.1 protein_id gnl|my_center|LOCUS_12130 75049 75219 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 75598 76491 gene locus_tag LOCUS_12140 75598 76491 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064966.1 protein_id gnl|my_center|LOCUS_12140 >Feature sequence14 472 56 gene locus_tag LOCUS_12150 472 56 CDS product DUF356 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023991.1 protein_id gnl|my_center|LOCUS_12150 554 823 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1432 2922 gene locus_tag LOCUS_12160 1432 2922 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023992.1 protein_id gnl|my_center|LOCUS_12160 3063 4220 gene locus_tag LOCUS_12170 gene proB 3063 4220 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023993.1 protein_id gnl|my_center|LOCUS_12170 4452 5270 gene locus_tag LOCUS_12180 gene proC 4452 5270 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_12180 6116 5316 gene locus_tag LOCUS_12190 6116 5316 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_12190 6458 7441 gene locus_tag LOCUS_12200 6458 7441 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023996.1 protein_id gnl|my_center|LOCUS_12200 7564 8568 gene locus_tag LOCUS_12210 7564 8568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990681.1 protein_id gnl|my_center|LOCUS_12210 8840 9025 gene locus_tag LOCUS_12220 8840 9025 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023998.1 protein_id gnl|my_center|LOCUS_12220 10463 9198 gene locus_tag LOCUS_12230 gene ftsY 10463 9198 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024000.1 protein_id gnl|my_center|LOCUS_12230 11006 10575 gene locus_tag LOCUS_12240 gene pfdA 11006 10575 CDS product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024001.1 protein_id gnl|my_center|LOCUS_12240 11188 11012 gene locus_tag LOCUS_12250 gene rpl18a 11188 11012 CDS product 50S ribosomal protein L18Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024002.1 protein_id gnl|my_center|LOCUS_12250 11902 11243 gene locus_tag LOCUS_12260 11902 11243 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024003.1 protein_id gnl|my_center|LOCUS_12260 12204 11935 gene locus_tag LOCUS_12270 12204 11935 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024004.1 protein_id gnl|my_center|LOCUS_12270 13252 12650 gene locus_tag LOCUS_12280 13252 12650 CDS product alpha hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024006.1 protein_id gnl|my_center|LOCUS_12280 13611 13258 gene locus_tag LOCUS_12290 13611 13258 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024007.1 protein_id gnl|my_center|LOCUS_12290 14168 13719 gene locus_tag LOCUS_12300 14168 13719 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024008.1 protein_id gnl|my_center|LOCUS_12300 15256 15825 gene locus_tag LOCUS_12310 15256 15825 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066367.1 protein_id gnl|my_center|LOCUS_12310 15851 16084 gene locus_tag LOCUS_12320 15851 16084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 16198 17262 gene locus_tag LOCUS_12330 16198 17262 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066378.1 protein_id gnl|my_center|LOCUS_12330 17710 17519 gene locus_tag LOCUS_12340 17710 17519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 18911 20281 gene locus_tag LOCUS_12350 gene frhA 18911 20281 CDS product coenzyme F420 hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990767.1 protein_id gnl|my_center|LOCUS_12350 20287 20766 gene locus_tag LOCUS_12360 gene frhD 20287 20766 CDS product coenzyme F420-reducing hydrogenase, FrhD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021013.1 protein_id gnl|my_center|LOCUS_12360 20753 21616 gene locus_tag LOCUS_12370 gene frhG 20753 21616 CDS product coenzyme F420 hydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065016.1 protein_id gnl|my_center|LOCUS_12370 21627 22502 gene locus_tag LOCUS_12380 gene frhB 21627 22502 CDS product coenzyme F420 hydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021015.1 protein_id gnl|my_center|LOCUS_12380 24314 23400 gene locus_tag LOCUS_12390 24314 23400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 25062 25385 gene locus_tag LOCUS_12400 25062 25385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 26196 25618 gene locus_tag LOCUS_12410 26196 25618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 27436 26345 gene locus_tag LOCUS_12420 27436 26345 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021039.1 protein_id gnl|my_center|LOCUS_12420 27729 27457 gene locus_tag LOCUS_12430 27729 27457 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545047.1 protein_id gnl|my_center|LOCUS_12430 29974 27791 gene locus_tag LOCUS_12440 29974 27791 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065174.1 protein_id gnl|my_center|LOCUS_12440 31019 30003 gene locus_tag LOCUS_12450 31019 30003 CDS product TIGR03557 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258687.1 protein_id gnl|my_center|LOCUS_12450 31642 31811 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33461 32187 gene locus_tag LOCUS_12460 33461 32187 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024009.1 protein_id gnl|my_center|LOCUS_12460 34844 33999 gene locus_tag LOCUS_12470 34844 33999 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024277.1 protein_id gnl|my_center|LOCUS_12470 36210 35200 gene locus_tag LOCUS_12480 36210 35200 CDS product MtaA/CmuA family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020204.1 protein_id gnl|my_center|LOCUS_12480 36868 36227 gene locus_tag LOCUS_12490 36868 36227 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949054.1 protein_id gnl|my_center|LOCUS_12490 37930 36908 gene locus_tag LOCUS_12500 37930 36908 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583099.1 protein_id gnl|my_center|LOCUS_12500 38661 39116 gene locus_tag LOCUS_12510 38661 39116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 39818 39453 gene locus_tag LOCUS_12520 39818 39453 CDS product TIGR00304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024010.1 protein_id gnl|my_center|LOCUS_12520 40063 39815 gene locus_tag LOCUS_12530 40063 39815 CDS product DUF131 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024011.1 protein_id gnl|my_center|LOCUS_12530 40980 42221 gene locus_tag LOCUS_12540 40980 42221 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289167.1 protein_id gnl|my_center|LOCUS_12540 42430 42504 gene locus_tag LOCUS_t00230 42430 42504 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 43155 42586 gene locus_tag LOCUS_12550 43155 42586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023807.1 protein_id gnl|my_center|LOCUS_12550 43578 43766 gene locus_tag LOCUS_12560 43578 43766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 43916 44434 gene locus_tag LOCUS_12570 43916 44434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 44885 44601 gene locus_tag LOCUS_12580 44885 44601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 45274 46239 gene locus_tag LOCUS_12590 45274 46239 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065910.1 protein_id gnl|my_center|LOCUS_12590 46482 46676 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 47720 47933 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 48583 48497 gene locus_tag LOCUS_t00240 48583 48497 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 48755 48682 gene locus_tag LOCUS_t00250 48755 48682 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 49981 50838 gene locus_tag LOCUS_12600 49981 50838 CDS product geranylfarnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024038.1 protein_id gnl|my_center|LOCUS_12600 50971 52149 gene locus_tag LOCUS_12610 50971 52149 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065913.1 protein_id gnl|my_center|LOCUS_12610 52862 53191 gene locus_tag LOCUS_12620 gene ahaH 52862 53191 CDS product ATP synthase archaeal subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024040.1 protein_id gnl|my_center|LOCUS_12620 53184 55136 gene locus_tag LOCUS_12630 53184 55136 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589509.1 protein_id gnl|my_center|LOCUS_12630 55141 55383 gene locus_tag LOCUS_12640 55141 55383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024042.1 protein_id gnl|my_center|LOCUS_12640 55602 56153 gene locus_tag LOCUS_12650 55602 56153 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024043.1 protein_id gnl|my_center|LOCUS_12650 56160 57239 gene locus_tag LOCUS_12660 56160 57239 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024044.1 protein_id gnl|my_center|LOCUS_12660 57239 57541 gene locus_tag LOCUS_12670 57239 57541 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024045.1 protein_id gnl|my_center|LOCUS_12670 57532 59268 gene locus_tag LOCUS_12680 57532 59268 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024046.1 protein_id gnl|my_center|LOCUS_12680 59271 60653 gene locus_tag LOCUS_12690 59271 60653 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024047.1 protein_id gnl|my_center|LOCUS_12690 60650 61285 gene locus_tag LOCUS_12700 60650 61285 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024048.1 protein_id gnl|my_center|LOCUS_12700 61776 64073 gene locus_tag LOCUS_12710 gene hypF 61776 64073 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024049.1 protein_id gnl|my_center|LOCUS_12710 64295 64750 gene locus_tag LOCUS_12720 64295 64750 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024050.1 protein_id gnl|my_center|LOCUS_12720 65230 64781 gene locus_tag LOCUS_12730 65230 64781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 65442 65563 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 67084 67878 gene locus_tag LOCUS_12740 67084 67878 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024052.1 protein_id gnl|my_center|LOCUS_12740 67945 68979 gene locus_tag LOCUS_12750 67945 68979 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024053.1 protein_id gnl|my_center|LOCUS_12750 69161 70528 gene locus_tag LOCUS_12760 69161 70528 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860380.1 protein_id gnl|my_center|LOCUS_12760 71535 72389 gene locus_tag LOCUS_12770 71535 72389 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065918.1 protein_id gnl|my_center|LOCUS_12770 73138 73545 gene locus_tag LOCUS_12780 73138 73545 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024057.1 protein_id gnl|my_center|LOCUS_12780 74251 74523 gene locus_tag LOCUS_12790 74251 74523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence15 341 502 gene locus_tag LOCUS_12800 341 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 598 2259 gene locus_tag LOCUS_12810 598 2259 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021335.1 protein_id gnl|my_center|LOCUS_12810 3605 2340 gene locus_tag LOCUS_12820 gene larA 3605 2340 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860456.1 protein_id gnl|my_center|LOCUS_12820 5047 3785 gene locus_tag LOCUS_12830 gene larA 5047 3785 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065079.1 protein_id gnl|my_center|LOCUS_12830 6131 5439 gene locus_tag LOCUS_12840 6131 5439 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021328.1 protein_id gnl|my_center|LOCUS_12840 6259 6476 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7320 6664 gene locus_tag LOCUS_12850 7320 6664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990659.1 protein_id gnl|my_center|LOCUS_12850 8688 7756 gene locus_tag LOCUS_12860 8688 7756 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024123.1 protein_id gnl|my_center|LOCUS_12860 9542 8685 gene locus_tag LOCUS_12870 9542 8685 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024124.1 protein_id gnl|my_center|LOCUS_12870 9739 9557 gene locus_tag LOCUS_12880 9739 9557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 10022 9816 gene locus_tag LOCUS_12890 10022 9816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12890 10396 10232 gene locus_tag LOCUS_12900 10396 10232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12900 10883 10506 gene locus_tag LOCUS_12910 10883 10506 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065940.1 protein_id gnl|my_center|LOCUS_12910 11525 10926 gene locus_tag LOCUS_12920 11525 10926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 13450 12122 gene locus_tag LOCUS_12930 13450 12122 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021177.1 protein_id gnl|my_center|LOCUS_12930 14719 13622 gene locus_tag LOCUS_12940 gene glpX 14719 13622 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021176.1 protein_id gnl|my_center|LOCUS_12940 15552 15028 gene locus_tag LOCUS_12950 gene cgi121 15552 15028 CDS product KEOPS complex subunit Cgi121 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021174.1 protein_id gnl|my_center|LOCUS_12950 17157 16363 gene locus_tag LOCUS_12960 17157 16363 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021172.1 protein_id gnl|my_center|LOCUS_12960 18963 17173 gene locus_tag LOCUS_12970 18963 17173 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021171.1 protein_id gnl|my_center|LOCUS_12970 20048 18963 gene locus_tag LOCUS_12980 20048 18963 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065047.1 protein_id gnl|my_center|LOCUS_12980 20635 21573 gene locus_tag LOCUS_12990 20635 21573 CDS product peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021169.1 protein_id gnl|my_center|LOCUS_12990 22255 21770 gene locus_tag LOCUS_13000 22255 21770 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021168.1 protein_id gnl|my_center|LOCUS_13000 23122 22349 gene locus_tag LOCUS_13010 23122 22349 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021167.1 protein_id gnl|my_center|LOCUS_13010 24921 23137 gene locus_tag LOCUS_13020 24921 23137 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021166.1 protein_id gnl|my_center|LOCUS_13020 26068 24929 gene locus_tag LOCUS_13030 26068 24929 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066182.1 protein_id gnl|my_center|LOCUS_13030 26246 26049 gene locus_tag LOCUS_13040 26246 26049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 27320 27580 gene locus_tag LOCUS_13050 gene hypC 27320 27580 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021164.1 protein_id gnl|my_center|LOCUS_13050 27599 28717 gene locus_tag LOCUS_13060 gene hypD 27599 28717 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066181.1 protein_id gnl|my_center|LOCUS_13060 28710 29132 gene locus_tag LOCUS_13070 gene hypA 28710 29132 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021162.1 protein_id gnl|my_center|LOCUS_13070 29153 29821 gene locus_tag LOCUS_13080 gene hypB 29153 29821 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860109.1 protein_id gnl|my_center|LOCUS_13080 29917 30960 gene locus_tag LOCUS_13090 gene hypE 29917 30960 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021160.1 protein_id gnl|my_center|LOCUS_13090 31248 31778 gene locus_tag LOCUS_13100 31248 31778 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021158.1 protein_id gnl|my_center|LOCUS_13100 32070 31876 gene locus_tag LOCUS_13110 32070 31876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 32183 32031 gene locus_tag LOCUS_13120 32183 32031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 32740 33159 gene locus_tag LOCUS_13130 32740 33159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 33693 33400 gene locus_tag LOCUS_13140 33693 33400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 34480 34259 gene locus_tag LOCUS_13150 34480 34259 CDS product DUF5652 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065311.1 protein_id gnl|my_center|LOCUS_13150 35754 34666 gene locus_tag LOCUS_13160 35754 34666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 37915 35927 gene locus_tag LOCUS_13170 37915 35927 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980092.1 protein_id gnl|my_center|LOCUS_13170 39811 40107 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 41253 40456 gene locus_tag LOCUS_13180 41253 40456 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879771.1 protein_id gnl|my_center|LOCUS_13180 41716 41336 gene locus_tag LOCUS_13190 41716 41336 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021138.1 protein_id gnl|my_center|LOCUS_13190 42375 41719 gene locus_tag LOCUS_13200 42375 41719 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021137.1 protein_id gnl|my_center|LOCUS_13200 42857 42399 gene locus_tag LOCUS_13210 42857 42399 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066175.1 protein_id gnl|my_center|LOCUS_13210 43251 43166 gene locus_tag LOCUS_t00260 43251 43166 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 44501 43485 gene locus_tag LOCUS_13220 44501 43485 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021133.1 protein_id gnl|my_center|LOCUS_13220 45251 44709 gene locus_tag LOCUS_13230 45251 44709 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021132.1 protein_id gnl|my_center|LOCUS_13230 45871 45251 gene locus_tag LOCUS_13240 45871 45251 CDS product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021131.1 protein_id gnl|my_center|LOCUS_13240 46694 47185 gene locus_tag LOCUS_13250 46694 47185 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021127.1 protein_id gnl|my_center|LOCUS_13250 47643 47365 gene locus_tag LOCUS_13260 47643 47365 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065040.1 protein_id gnl|my_center|LOCUS_13260 48462 47812 gene locus_tag LOCUS_13270 48462 47812 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021125.1 protein_id gnl|my_center|LOCUS_13270 50021 48543 gene locus_tag LOCUS_13280 gene secY 50021 48543 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021124.1 protein_id gnl|my_center|LOCUS_13280 50589 50167 gene locus_tag LOCUS_13290 50589 50167 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021123.1 protein_id gnl|my_center|LOCUS_13290 51061 50600 gene locus_tag LOCUS_13300 51061 50600 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021122.1 protein_id gnl|my_center|LOCUS_13300 51689 51063 gene locus_tag LOCUS_13310 51689 51063 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021121.1 protein_id gnl|my_center|LOCUS_13310 52223 51699 gene locus_tag LOCUS_13320 52223 51699 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021120.1 protein_id gnl|my_center|LOCUS_13320 52692 52240 gene locus_tag LOCUS_13330 52692 52240 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021119.1 protein_id gnl|my_center|LOCUS_13330 53131 52694 gene locus_tag LOCUS_13340 53131 52694 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066173.1 protein_id gnl|my_center|LOCUS_13340 53672 53142 gene locus_tag LOCUS_13350 gene rpl6p 53672 53142 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021117.1 protein_id gnl|my_center|LOCUS_13350 54079 53687 gene locus_tag LOCUS_13360 54079 53687 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021116.1 protein_id gnl|my_center|LOCUS_13360 54242 54090 gene locus_tag LOCUS_13370 54242 54090 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021115.1 protein_id gnl|my_center|LOCUS_13370 54751 54242 gene locus_tag LOCUS_13380 54751 54242 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021114.1 protein_id gnl|my_center|LOCUS_13380 55451 54744 gene locus_tag LOCUS_13390 55451 54744 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021113.1 protein_id gnl|my_center|LOCUS_13390 55815 55465 gene locus_tag LOCUS_13400 gene rplX 55815 55465 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065039.1 protein_id gnl|my_center|LOCUS_13400 56224 55826 gene locus_tag LOCUS_13410 gene rpl14p 56224 55826 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021111.1 protein_id gnl|my_center|LOCUS_13410 56550 56221 gene locus_tag LOCUS_13420 56550 56221 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021110.1 protein_id gnl|my_center|LOCUS_13420 56887 56555 gene locus_tag LOCUS_13430 56887 56555 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021109.1 protein_id gnl|my_center|LOCUS_13430 57080 56877 gene locus_tag LOCUS_13440 gene rpmC 57080 56877 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021108.1 protein_id gnl|my_center|LOCUS_13440 58001 57081 gene locus_tag LOCUS_13450 58001 57081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 58457 58002 gene locus_tag LOCUS_13460 58457 58002 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021106.1 protein_id gnl|my_center|LOCUS_13460 58879 58469 gene locus_tag LOCUS_13470 58879 58469 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021105.1 protein_id gnl|my_center|LOCUS_13470 59611 58895 gene locus_tag LOCUS_13480 59611 58895 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021104.1 protein_id gnl|my_center|LOCUS_13480 59870 59622 gene locus_tag LOCUS_13490 59870 59622 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021103.1 protein_id gnl|my_center|LOCUS_13490 60628 59867 gene locus_tag LOCUS_13500 gene rpl4p 60628 59867 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021102.1 protein_id gnl|my_center|LOCUS_13500 61648 60635 gene locus_tag LOCUS_13510 gene rpl3p 61648 60635 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021101.1 protein_id gnl|my_center|LOCUS_13510 63058 62909 gene locus_tag LOCUS_13520 63058 62909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 64064 64216 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 64497 64775 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 65043 66251 gene locus_tag LOCUS_13530 65043 66251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 66693 67565 gene locus_tag LOCUS_13540 66693 67565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 67878 69149 gene locus_tag LOCUS_13550 67878 69149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 69776 70210 gene locus_tag LOCUS_13560 69776 70210 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065983.1 protein_id gnl|my_center|LOCUS_13560 70207 70629 gene locus_tag LOCUS_13570 70207 70629 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021853.1 protein_id gnl|my_center|LOCUS_13570 71379 71203 gene locus_tag LOCUS_13580 71379 71203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 71434 71589 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence16 422 1720 gene locus_tag LOCUS_13590 422 1720 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_13590 1857 3092 gene locus_tag LOCUS_13600 1857 3092 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021296.1 protein_id gnl|my_center|LOCUS_13600 4015 4226 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4374 6770 gene locus_tag LOCUS_13610 4374 6770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 7461 8030 gene locus_tag LOCUS_13620 7461 8030 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096447.1 protein_id gnl|my_center|LOCUS_13620 8910 8986 gene locus_tag LOCUS_t00270 8910 8986 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 9071 9307 gene locus_tag LOCUS_13630 9071 9307 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021287.1 protein_id gnl|my_center|LOCUS_13630 9518 11110 gene locus_tag LOCUS_13640 9518 11110 CDS product DNA-directed RNA polymerase subunit B'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755883.1 protein_id gnl|my_center|LOCUS_13640 11125 12939 gene locus_tag LOCUS_13650 gene rpoB 11125 12939 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021285.1 protein_id gnl|my_center|LOCUS_13650 12952 15594 gene locus_tag LOCUS_13660 12952 15594 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021284.1 protein_id gnl|my_center|LOCUS_13660 15594 16781 gene locus_tag LOCUS_13670 gene rpoA2 15594 16781 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066196.1 protein_id gnl|my_center|LOCUS_13670 17058 17348 gene locus_tag LOCUS_13680 17058 17348 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065070.1 protein_id gnl|my_center|LOCUS_13680 17369 17794 gene locus_tag LOCUS_13690 17369 17794 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021281.1 protein_id gnl|my_center|LOCUS_13690 17895 18323 gene locus_tag LOCUS_13700 17895 18323 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021280.1 protein_id gnl|my_center|LOCUS_13700 18330 18890 gene locus_tag LOCUS_13710 18330 18890 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021279.1 protein_id gnl|my_center|LOCUS_13710 18981 21155 gene locus_tag LOCUS_13720 18981 21155 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021278.1 protein_id gnl|my_center|LOCUS_13720 21540 22808 gene locus_tag LOCUS_13730 gene tuf 21540 22808 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021277.1 protein_id gnl|my_center|LOCUS_13730 22844 23152 gene locus_tag LOCUS_13740 gene rpsJ 22844 23152 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021276.1 protein_id gnl|my_center|LOCUS_13740 24962 23448 gene locus_tag LOCUS_13750 24962 23448 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021220.1 protein_id gnl|my_center|LOCUS_13750 25208 25906 gene locus_tag LOCUS_13760 25208 25906 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860219.1 protein_id gnl|my_center|LOCUS_13760 26593 26120 gene locus_tag LOCUS_13770 26593 26120 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022818.1 protein_id gnl|my_center|LOCUS_13770 27312 26950 gene locus_tag LOCUS_13780 27312 26950 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023090.1 protein_id gnl|my_center|LOCUS_13780 27503 28066 gene locus_tag LOCUS_13790 27503 28066 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964078.1 protein_id gnl|my_center|LOCUS_13790 28627 28259 gene locus_tag LOCUS_13800 28627 28259 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023097.1 protein_id gnl|my_center|LOCUS_13800 29386 28958 gene locus_tag LOCUS_13810 29386 28958 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928468.1 protein_id gnl|my_center|LOCUS_13810 29805 29461 gene locus_tag LOCUS_13820 29805 29461 CDS product CGGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065624.1 protein_id gnl|my_center|LOCUS_13820 30056 29880 gene locus_tag LOCUS_13830 30056 29880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13830 30220 30071 gene locus_tag LOCUS_13840 30220 30071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13840 30946 30287 gene locus_tag LOCUS_13850 30946 30287 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066452.1 protein_id gnl|my_center|LOCUS_13850 31231 31587 gene locus_tag LOCUS_13860 31231 31587 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065626.1 protein_id gnl|my_center|LOCUS_13860 32209 33042 gene locus_tag LOCUS_13870 32209 33042 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048170835.1 protein_id gnl|my_center|LOCUS_13870 33044 34351 gene locus_tag LOCUS_13880 33044 34351 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021144.1 protein_id gnl|my_center|LOCUS_13880 34524 35747 gene locus_tag LOCUS_13890 34524 35747 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023110.1 protein_id gnl|my_center|LOCUS_13890 35870 37309 gene locus_tag LOCUS_13900 35870 37309 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023126.1 protein_id gnl|my_center|LOCUS_13900 37611 37803 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39702 40481 gene locus_tag LOCUS_13910 39702 40481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 40640 41773 gene locus_tag LOCUS_13920 40640 41773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 43700 41889 gene locus_tag LOCUS_13930 43700 41889 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023116.1 protein_id gnl|my_center|LOCUS_13930 44065 45528 gene locus_tag LOCUS_13940 44065 45528 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066453.1 protein_id gnl|my_center|LOCUS_13940 45974 46432 gene locus_tag LOCUS_13950 45974 46432 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065631.1 protein_id gnl|my_center|LOCUS_13950 46604 46999 gene locus_tag LOCUS_13960 46604 46999 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023127.1 protein_id gnl|my_center|LOCUS_13960 48605 47154 gene locus_tag LOCUS_13970 gene purF 48605 47154 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065634.1 protein_id gnl|my_center|LOCUS_13970 49193 48975 gene locus_tag LOCUS_13980 49193 48975 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023130.1 protein_id gnl|my_center|LOCUS_13980 49593 50939 gene locus_tag LOCUS_13990 gene thiD 49593 50939 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023132.1 protein_id gnl|my_center|LOCUS_13990 51300 52598 gene locus_tag LOCUS_14000 51300 52598 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065635.1 protein_id gnl|my_center|LOCUS_14000 52815 52979 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 53447 53046 gene locus_tag LOCUS_14010 53447 53046 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023134.1 protein_id gnl|my_center|LOCUS_14010 54422 54015 gene locus_tag LOCUS_14020 54422 54015 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023135.1 protein_id gnl|my_center|LOCUS_14020 55818 54526 gene locus_tag LOCUS_14030 gene hisD 55818 54526 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023136.1 protein_id gnl|my_center|LOCUS_14030 58318 56129 gene locus_tag LOCUS_14040 58318 56129 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023138.1 protein_id gnl|my_center|LOCUS_14040 60264 58498 gene locus_tag LOCUS_14050 60264 58498 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023139.1 protein_id gnl|my_center|LOCUS_14050 60459 60617 gene locus_tag LOCUS_14060 60459 60617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 61071 60658 gene locus_tag LOCUS_14070 61071 60658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990637.1 protein_id gnl|my_center|LOCUS_14070 62379 61360 gene locus_tag LOCUS_14080 62379 61360 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066456.1 protein_id gnl|my_center|LOCUS_14080 63049 62642 gene locus_tag LOCUS_14090 63049 62642 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065220.1 protein_id gnl|my_center|LOCUS_14090 63824 63609 gene locus_tag LOCUS_14100 gene trxA 63824 63609 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065637.1 protein_id gnl|my_center|LOCUS_14100 64997 64188 gene locus_tag LOCUS_14110 gene cofE 64997 64188 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023428.1 protein_id gnl|my_center|LOCUS_14110 66136 65324 gene locus_tag LOCUS_14120 66136 65324 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023429.1 protein_id gnl|my_center|LOCUS_14120 67644 66766 gene locus_tag LOCUS_14130 67644 66766 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023430.1 protein_id gnl|my_center|LOCUS_14130 68050 67835 gene locus_tag LOCUS_14140 68050 67835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023179.1 protein_id gnl|my_center|LOCUS_14140 68485 69087 gene locus_tag LOCUS_14150 gene purN 68485 69087 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065739.1 protein_id gnl|my_center|LOCUS_14150 69548 70786 gene locus_tag LOCUS_14160 gene glyA 69548 70786 CDS product bifunctional serine hydroxymethyltransferase/L-allo-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023436.1 protein_id gnl|my_center|LOCUS_14160 70813 71676 gene locus_tag LOCUS_14170 70813 71676 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023435.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence17 1790 582 gene locus_tag LOCUS_14180 1790 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 2047 2298 gene locus_tag LOCUS_14190 2047 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 3013 2402 gene locus_tag LOCUS_14200 3013 2402 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065188.1 protein_id gnl|my_center|LOCUS_14200 4267 3236 gene locus_tag LOCUS_14210 4267 3236 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967612.1 protein_id gnl|my_center|LOCUS_14210 5042 5230 gene locus_tag LOCUS_14220 5042 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 6612 5734 gene locus_tag LOCUS_14230 gene nudC 6612 5734 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021453.1 protein_id gnl|my_center|LOCUS_14230 7575 6862 gene locus_tag LOCUS_14240 7575 6862 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860472.1 protein_id gnl|my_center|LOCUS_14240 7909 8808 gene locus_tag LOCUS_14250 7909 8808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021693.1 protein_id gnl|my_center|LOCUS_14250 10686 9325 gene locus_tag LOCUS_14260 10686 9325 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021695.1 protein_id gnl|my_center|LOCUS_14260 11005 10727 gene locus_tag LOCUS_14270 11005 10727 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023169.1 protein_id gnl|my_center|LOCUS_14270 11805 11296 gene locus_tag LOCUS_14280 11805 11296 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_14280 13738 13442 gene locus_tag LOCUS_14290 13738 13442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023552.1 protein_id gnl|my_center|LOCUS_14290 14972 14325 gene locus_tag LOCUS_14300 14972 14325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021681.1 protein_id gnl|my_center|LOCUS_14300 15453 16262 gene locus_tag LOCUS_14310 15453 16262 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066246.1 protein_id gnl|my_center|LOCUS_14310 17487 16318 gene locus_tag LOCUS_14320 17487 16318 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022460.1 protein_id gnl|my_center|LOCUS_14320 17675 17899 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19237 17951 gene locus_tag LOCUS_14330 gene eno 19237 17951 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065179.1 protein_id gnl|my_center|LOCUS_14330 20142 20360 gene locus_tag LOCUS_14340 20142 20360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 20927 20472 gene locus_tag LOCUS_14350 20927 20472 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021674.1 protein_id gnl|my_center|LOCUS_14350 21620 20937 gene locus_tag LOCUS_14360 21620 20937 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021673.1 protein_id gnl|my_center|LOCUS_14360 22723 21854 gene locus_tag LOCUS_14370 22723 21854 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066245.1 protein_id gnl|my_center|LOCUS_14370 24545 22884 gene locus_tag LOCUS_14380 24545 22884 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990800.1 protein_id gnl|my_center|LOCUS_14380 25327 24860 gene locus_tag LOCUS_14390 25327 24860 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065176.1 protein_id gnl|my_center|LOCUS_14390 27516 26041 gene locus_tag LOCUS_14400 27516 26041 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023184.1 protein_id gnl|my_center|LOCUS_14400 27965 27753 gene locus_tag LOCUS_14410 27965 27753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 28486 28655 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28742 29143 gene locus_tag LOCUS_14420 28742 29143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 29358 30527 gene locus_tag LOCUS_14430 29358 30527 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066363.1 protein_id gnl|my_center|LOCUS_14430 30911 31573 gene locus_tag LOCUS_14440 30911 31573 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990818.1 protein_id gnl|my_center|LOCUS_14440 32371 32517 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32710 33264 gene locus_tag LOCUS_14450 32710 33264 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022863.1 protein_id gnl|my_center|LOCUS_14450 33509 35179 gene locus_tag LOCUS_14460 33509 35179 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_14460 35520 35768 gene locus_tag LOCUS_14470 35520 35768 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022860.1 protein_id gnl|my_center|LOCUS_14470 35789 36844 gene locus_tag LOCUS_14480 35789 36844 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022859.1 protein_id gnl|my_center|LOCUS_14480 36847 38292 gene locus_tag LOCUS_14490 36847 38292 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066425.1 protein_id gnl|my_center|LOCUS_14490 39360 39509 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 41595 40423 gene locus_tag LOCUS_14500 41595 40423 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022687.1 protein_id gnl|my_center|LOCUS_14500 43448 42168 gene locus_tag LOCUS_14510 43448 42168 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023306.1 protein_id gnl|my_center|LOCUS_14510 45088 43907 gene locus_tag LOCUS_14520 45088 43907 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065687.1 protein_id gnl|my_center|LOCUS_14520 45515 47035 gene locus_tag LOCUS_14530 45515 47035 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023309.1 protein_id gnl|my_center|LOCUS_14530 47375 48295 gene locus_tag LOCUS_14540 47375 48295 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022038.1 protein_id gnl|my_center|LOCUS_14540 48395 48757 gene locus_tag LOCUS_14550 48395 48757 CDS product DUF3147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022039.1 protein_id gnl|my_center|LOCUS_14550 48807 49169 gene locus_tag LOCUS_14560 48807 49169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 49229 49436 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 49821 50972 gene locus_tag LOCUS_14570 49821 50972 CDS product DUF2157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022044.1 protein_id gnl|my_center|LOCUS_14570 51040 51612 gene locus_tag LOCUS_14580 51040 51612 CDS product GDYXXLXY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022045.1 protein_id gnl|my_center|LOCUS_14580 51746 52144 gene locus_tag LOCUS_14590 51746 52144 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021864.1 protein_id gnl|my_center|LOCUS_14590 52254 54641 gene locus_tag LOCUS_14600 gene lon 52254 54641 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021863.1 protein_id gnl|my_center|LOCUS_14600 55188 55850 gene locus_tag LOCUS_14610 55188 55850 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021861.1 protein_id gnl|my_center|LOCUS_14610 57519 56488 gene locus_tag LOCUS_14620 57519 56488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 58474 57779 gene locus_tag LOCUS_14630 58474 57779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228874.1 protein_id gnl|my_center|LOCUS_14630 58765 58610 gene locus_tag LOCUS_14640 58765 58610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 59607 59290 gene locus_tag LOCUS_14650 59607 59290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 60149 59604 gene locus_tag LOCUS_14660 60149 59604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 60667 60837 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 61072 61266 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 62297 62082 gene locus_tag LOCUS_14670 62297 62082 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021344.1 protein_id gnl|my_center|LOCUS_14670 63499 62495 gene locus_tag LOCUS_14680 63499 62495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 63755 63960 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence18 685 200 gene locus_tag LOCUS_14690 685 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1170 682 gene locus_tag LOCUS_14700 1170 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1942 1343 gene locus_tag LOCUS_14710 1942 1343 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021338.1 protein_id gnl|my_center|LOCUS_14710 4181 2451 gene locus_tag LOCUS_14720 4181 2451 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021977.1 protein_id gnl|my_center|LOCUS_14720 5057 4308 gene locus_tag LOCUS_14730 5057 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14730 6450 5761 gene locus_tag LOCUS_14740 gene radC 6450 5761 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021974.1 protein_id gnl|my_center|LOCUS_14740 6678 6843 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6933 7799 gene locus_tag LOCUS_14750 6933 7799 CDS product molybdopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065273.1 protein_id gnl|my_center|LOCUS_14750 7831 8583 gene locus_tag LOCUS_14760 7831 8583 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021972.1 protein_id gnl|my_center|LOCUS_14760 10150 9875 gene locus_tag LOCUS_14770 10150 9875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 10709 10963 gene locus_tag LOCUS_14780 10709 10963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 11137 11406 gene locus_tag LOCUS_14790 11137 11406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 11733 11864 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11965 13872 gene locus_tag LOCUS_14800 11965 13872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 14608 14099 gene locus_tag LOCUS_14810 14608 14099 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021971.1 protein_id gnl|my_center|LOCUS_14810 14799 15704 gene locus_tag LOCUS_14820 14799 15704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021970.1 protein_id gnl|my_center|LOCUS_14820 16662 15754 gene locus_tag LOCUS_14830 16662 15754 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021969.1 protein_id gnl|my_center|LOCUS_14830 17147 16905 gene locus_tag LOCUS_14840 17147 16905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 17280 17450 gene locus_tag LOCUS_14850 17280 17450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 18370 19761 gene locus_tag LOCUS_14860 18370 19761 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021968.1 protein_id gnl|my_center|LOCUS_14860 20322 20431 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21467 20487 gene locus_tag LOCUS_14870 gene ala 21467 20487 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023186.1 protein_id gnl|my_center|LOCUS_14870 21676 22401 gene locus_tag LOCUS_14880 21676 22401 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023187.1 protein_id gnl|my_center|LOCUS_14880 23589 22540 gene locus_tag LOCUS_14890 23589 22540 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065648.1 protein_id gnl|my_center|LOCUS_14890 24204 23815 gene locus_tag LOCUS_14900 24204 23815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023192.1 protein_id gnl|my_center|LOCUS_14900 24431 24668 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24763 25581 gene locus_tag LOCUS_14910 24763 25581 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860293.1 protein_id gnl|my_center|LOCUS_14910 26027 25824 gene locus_tag LOCUS_14920 26027 25824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 26163 26417 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28138 28338 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29678 28830 gene locus_tag LOCUS_14930 29678 28830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 29757 30022 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30246 30466 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30692 30874 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31138 31394 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32034 31396 gene locus_tag LOCUS_14940 32034 31396 CDS product DUF6448 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943772.1 protein_id gnl|my_center|LOCUS_14940 32502 33323 gene locus_tag LOCUS_14950 32502 33323 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023089.1 protein_id gnl|my_center|LOCUS_14950 33517 33855 gene locus_tag LOCUS_14960 33517 33855 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023100.1 protein_id gnl|my_center|LOCUS_14960 34412 35746 gene locus_tag LOCUS_14970 34412 35746 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065539.1 protein_id gnl|my_center|LOCUS_14970 35743 36948 gene locus_tag LOCUS_14980 35743 36948 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022791.1 protein_id gnl|my_center|LOCUS_14980 36936 37661 gene locus_tag LOCUS_14990 36936 37661 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755943.1 protein_id gnl|my_center|LOCUS_14990 37868 38135 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38386 39966 gene locus_tag LOCUS_15000 gene ppcA 38386 39966 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022649.1 protein_id gnl|my_center|LOCUS_15000 40454 40684 gene locus_tag LOCUS_15010 40454 40684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 42039 42219 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42370 42597 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 44287 42848 gene locus_tag LOCUS_15020 44287 42848 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022878.1 protein_id gnl|my_center|LOCUS_15020 44665 44816 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45001 45414 gene locus_tag LOCUS_15030 gene fxsA 45001 45414 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023195.1 protein_id gnl|my_center|LOCUS_15030 45695 46900 gene locus_tag LOCUS_15040 45695 46900 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021939.1 protein_id gnl|my_center|LOCUS_15040 48425 49912 gene locus_tag LOCUS_15050 48425 49912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 50667 49972 gene locus_tag LOCUS_15060 50667 49972 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022656.1 protein_id gnl|my_center|LOCUS_15060 50939 51175 gene locus_tag LOCUS_15070 50939 51175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 53155 51572 gene locus_tag LOCUS_15080 53155 51572 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990604.1 protein_id gnl|my_center|LOCUS_15080 54510 53158 gene locus_tag LOCUS_15090 54510 53158 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022675.1 protein_id gnl|my_center|LOCUS_15090 54660 54589 gene locus_tag LOCUS_t00280 54660 54589 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 56305 55391 gene locus_tag LOCUS_15100 gene nadA 56305 55391 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066395.1 protein_id gnl|my_center|LOCUS_15100 56808 56419 gene locus_tag LOCUS_15110 gene nifU 56808 56419 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022677.1 protein_id gnl|my_center|LOCUS_15110 57765 56956 gene locus_tag LOCUS_15120 57765 56956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15120 58204 58016 gene locus_tag LOCUS_15130 58204 58016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15130 58599 58940 gene locus_tag LOCUS_15140 58599 58940 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990605.1 protein_id gnl|my_center|LOCUS_15140 59384 60310 gene locus_tag LOCUS_15150 gene cysK 59384 60310 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022680.1 protein_id gnl|my_center|LOCUS_15150 60427 61371 gene locus_tag LOCUS_15160 gene cysE 60427 61371 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048171437.1 protein_id gnl|my_center|LOCUS_15160 62247 62600 gene locus_tag LOCUS_15170 62247 62600 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948232.1 protein_id gnl|my_center|LOCUS_15170 62625 65021 gene locus_tag LOCUS_15180 62625 65021 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485759.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence19 626 1609 gene locus_tag LOCUS_15190 626 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990714.1 protein_id gnl|my_center|LOCUS_15190 1606 1881 gene locus_tag LOCUS_15200 1606 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064828.1 protein_id gnl|my_center|LOCUS_15200 2606 1947 gene locus_tag LOCUS_15210 2606 1947 CDS product TfuA-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020222.1 protein_id gnl|my_center|LOCUS_15210 3880 2603 gene locus_tag LOCUS_15220 3880 2603 CDS product YcaO-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020223.1 protein_id gnl|my_center|LOCUS_15220 4130 4354 gene locus_tag LOCUS_15230 4130 4354 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990715.1 protein_id gnl|my_center|LOCUS_15230 4643 4870 gene locus_tag LOCUS_15240 4643 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 6597 4978 gene locus_tag LOCUS_15250 6597 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 7538 10342 gene locus_tag LOCUS_15260 7538 10342 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390375.1 protein_id gnl|my_center|LOCUS_15260 11627 10416 gene locus_tag LOCUS_15270 11627 10416 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020498.1 protein_id gnl|my_center|LOCUS_15270 11746 12267 gene locus_tag LOCUS_15280 11746 12267 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256496.1 protein_id gnl|my_center|LOCUS_15280 12969 12346 gene locus_tag LOCUS_15290 12969 12346 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990729.1 protein_id gnl|my_center|LOCUS_15290 15310 13151 gene locus_tag LOCUS_15300 15310 13151 CDS product DUF2341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064883.1 protein_id gnl|my_center|LOCUS_15300 15541 16056 gene locus_tag LOCUS_15310 15541 16056 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020492.1 protein_id gnl|my_center|LOCUS_15310 16224 17069 gene locus_tag LOCUS_15320 16224 17069 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020491.1 protein_id gnl|my_center|LOCUS_15320 18628 17255 gene locus_tag LOCUS_15330 18628 17255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064846.1 protein_id gnl|my_center|LOCUS_15330 19061 19804 gene locus_tag LOCUS_15340 19061 19804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020310.1 protein_id gnl|my_center|LOCUS_15340 21686 19902 gene locus_tag LOCUS_15350 21686 19902 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064847.1 protein_id gnl|my_center|LOCUS_15350 23398 21884 gene locus_tag LOCUS_15360 23398 21884 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064848.1 protein_id gnl|my_center|LOCUS_15360 23830 24573 gene locus_tag LOCUS_15370 23830 24573 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020313.1 protein_id gnl|my_center|LOCUS_15370 24677 25657 gene locus_tag LOCUS_15380 24677 25657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020314.1 protein_id gnl|my_center|LOCUS_15380 26241 25777 gene locus_tag LOCUS_15390 26241 25777 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020665.1 protein_id gnl|my_center|LOCUS_15390 28498 26483 gene locus_tag LOCUS_15400 28498 26483 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023276.1 protein_id gnl|my_center|LOCUS_15400 29063 28990 gene locus_tag LOCUS_t00290 29063 28990 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 29672 29124 gene locus_tag LOCUS_15410 29672 29124 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065022.1 protein_id gnl|my_center|LOCUS_15410 30431 30000 gene locus_tag LOCUS_15420 30431 30000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 30512 30874 gene locus_tag LOCUS_15430 30512 30874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 31297 31977 gene locus_tag LOCUS_15440 31297 31977 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081428832.1 protein_id gnl|my_center|LOCUS_15440 32313 32240 gene locus_tag LOCUS_t00300 32313 32240 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 32461 33060 gene locus_tag LOCUS_15450 32461 33060 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020321.1 protein_id gnl|my_center|LOCUS_15450 33338 33949 gene locus_tag LOCUS_15460 33338 33949 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020322.1 protein_id gnl|my_center|LOCUS_15460 34061 34507 gene locus_tag LOCUS_15470 34061 34507 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020323.1 protein_id gnl|my_center|LOCUS_15470 34872 36374 gene locus_tag LOCUS_15480 34872 36374 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020324.1 protein_id gnl|my_center|LOCUS_15480 37605 36520 gene locus_tag LOCUS_15490 37605 36520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020325.1 protein_id gnl|my_center|LOCUS_15490 39421 38471 gene locus_tag LOCUS_15500 gene mtrH 39421 38471 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020327.1 protein_id gnl|my_center|LOCUS_15500 39653 39435 gene locus_tag LOCUS_15510 gene mtrG 39653 39435 CDS product tetrahydromethanopterin S-methyltransferase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020328.1 protein_id gnl|my_center|LOCUS_15510 39890 39672 gene locus_tag LOCUS_15520 gene mtrF 39890 39672 CDS product tetrahydromethanopterin S-methyltransferase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020329.1 protein_id gnl|my_center|LOCUS_15520 40618 39896 gene locus_tag LOCUS_15530 gene mtrA 40618 39896 CDS product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020330.1 protein_id gnl|my_center|LOCUS_15530 40946 40620 gene locus_tag LOCUS_15540 40946 40620 CDS product tetrahydromethanopterin S-methyltransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020331.1 protein_id gnl|my_center|LOCUS_15540 41743 40943 gene locus_tag LOCUS_15550 gene mtrC 41743 40943 CDS product tetrahydromethanopterin S-methyltransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020332.1 protein_id gnl|my_center|LOCUS_15550 42497 41745 gene locus_tag LOCUS_15560 gene mtrD 42497 41745 CDS product tetrahydromethanopterin S-methyltransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020333.1 protein_id gnl|my_center|LOCUS_15560 43408 42494 gene locus_tag LOCUS_15570 gene mtrE 43408 42494 CDS product tetrahydromethanopterin S-methyltransferase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020334.1 protein_id gnl|my_center|LOCUS_15570 46368 44449 gene locus_tag LOCUS_15580 46368 44449 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020337.1 protein_id gnl|my_center|LOCUS_15580 46930 46766 gene locus_tag LOCUS_15590 46930 46766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 47991 46993 gene locus_tag LOCUS_15600 gene moaA 47991 46993 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020164.1 protein_id gnl|my_center|LOCUS_15600 48716 49144 gene locus_tag LOCUS_15610 48716 49144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020121.1 protein_id gnl|my_center|LOCUS_15610 50011 49250 gene locus_tag LOCUS_15620 50011 49250 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_15620 50801 50013 gene locus_tag LOCUS_15630 50801 50013 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020123.1 protein_id gnl|my_center|LOCUS_15630 51952 50966 gene locus_tag LOCUS_15640 51952 50966 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020124.1 protein_id gnl|my_center|LOCUS_15640 52427 52948 gene locus_tag LOCUS_15650 52427 52948 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020126.1 protein_id gnl|my_center|LOCUS_15650 56650 53144 gene locus_tag LOCUS_15660 56650 53144 CDS product S-layer protein domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020127.1 protein_id gnl|my_center|LOCUS_15660 57903 56824 gene locus_tag LOCUS_15670 gene thiL 57903 56824 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066048.1 protein_id gnl|my_center|LOCUS_15670 58865 58308 gene locus_tag LOCUS_15680 58865 58308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 61553 59169 gene locus_tag LOCUS_15690 gene nrdD 61553 59169 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020131.1 protein_id gnl|my_center|LOCUS_15690 61883 61632 gene locus_tag LOCUS_15700 61883 61632 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064801.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence20 2765 741 gene locus_tag LOCUS_15710 2765 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 4493 3603 gene locus_tag LOCUS_15720 4493 3603 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022378.1 protein_id gnl|my_center|LOCUS_15720 5698 4490 gene locus_tag LOCUS_15730 gene porA 5698 4490 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020091.1 protein_id gnl|my_center|LOCUS_15730 6030 5698 gene locus_tag LOCUS_15740 6030 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 6575 6027 gene locus_tag LOCUS_15750 6575 6027 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_15750 8120 7149 gene locus_tag LOCUS_15760 gene dusB 8120 7149 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020094.1 protein_id gnl|my_center|LOCUS_15760 8954 8397 gene locus_tag LOCUS_15770 8954 8397 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020095.1 protein_id gnl|my_center|LOCUS_15770 10170 10354 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10788 11969 gene locus_tag LOCUS_15780 10788 11969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 12057 13085 gene locus_tag LOCUS_15790 gene twy1 12057 13085 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020099.1 protein_id gnl|my_center|LOCUS_15790 14057 15304 gene locus_tag LOCUS_15800 gene prf1 14057 15304 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020101.1 protein_id gnl|my_center|LOCUS_15800 15489 17198 gene locus_tag LOCUS_15810 gene argS 15489 17198 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064797.1 protein_id gnl|my_center|LOCUS_15810 19227 17440 gene locus_tag LOCUS_15820 19227 17440 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020110.1 protein_id gnl|my_center|LOCUS_15820 19711 20757 gene locus_tag LOCUS_15830 19711 20757 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020112.1 protein_id gnl|my_center|LOCUS_15830 21082 22116 gene locus_tag LOCUS_15840 21082 22116 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020113.1 protein_id gnl|my_center|LOCUS_15840 22711 22896 gene locus_tag LOCUS_15850 22711 22896 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020114.1 protein_id gnl|my_center|LOCUS_15850 25464 26708 gene locus_tag LOCUS_15860 25464 26708 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064787.1 protein_id gnl|my_center|LOCUS_15860 27076 27636 gene locus_tag LOCUS_15870 27076 27636 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024528.1 protein_id gnl|my_center|LOCUS_15870 27815 28291 gene locus_tag LOCUS_15880 27815 28291 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066042.1 protein_id gnl|my_center|LOCUS_15880 28438 29211 gene locus_tag LOCUS_15890 28438 29211 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024526.1 protein_id gnl|my_center|LOCUS_15890 30074 29451 gene locus_tag LOCUS_15900 30074 29451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 31183 30113 gene locus_tag LOCUS_15910 31183 30113 CDS product translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024522.1 protein_id gnl|my_center|LOCUS_15910 31303 31466 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32937 31765 gene locus_tag LOCUS_15920 32937 31765 CDS product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024521.1 protein_id gnl|my_center|LOCUS_15920 33195 33986 gene locus_tag LOCUS_15930 33195 33986 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024520.1 protein_id gnl|my_center|LOCUS_15930 35024 34248 gene locus_tag LOCUS_15940 35024 34248 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589511.1 protein_id gnl|my_center|LOCUS_15940 36073 35228 gene locus_tag LOCUS_15950 36073 35228 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024518.1 protein_id gnl|my_center|LOCUS_15950 37532 36657 gene locus_tag LOCUS_15960 37532 36657 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048168954.1 protein_id gnl|my_center|LOCUS_15960 38564 37749 gene locus_tag LOCUS_15970 38564 37749 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024516.1 protein_id gnl|my_center|LOCUS_15970 39281 38628 gene locus_tag LOCUS_15980 39281 38628 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024515.1 protein_id gnl|my_center|LOCUS_15980 41523 40069 gene locus_tag LOCUS_15990 41523 40069 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024513.1 protein_id gnl|my_center|LOCUS_15990 42144 42773 gene locus_tag LOCUS_16000 42144 42773 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024506.1 protein_id gnl|my_center|LOCUS_16000 43944 42949 gene locus_tag LOCUS_16010 gene rtcA 43944 42949 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024505.1 protein_id gnl|my_center|LOCUS_16010 45489 43981 gene locus_tag LOCUS_16020 45489 43981 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024504.1 protein_id gnl|my_center|LOCUS_16020 47095 48615 gene locus_tag LOCUS_16030 gene dnaG 47095 48615 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024503.1 protein_id gnl|my_center|LOCUS_16030 49061 49339 gene locus_tag LOCUS_16040 49061 49339 CDS product UPF0058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024502.1 protein_id gnl|my_center|LOCUS_16040 49853 49323 gene locus_tag LOCUS_16050 gene rimI 49853 49323 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066037.1 protein_id gnl|my_center|LOCUS_16050 51913 50033 gene locus_tag LOCUS_16060 gene arcS 51913 50033 CDS product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024500.1 protein_id gnl|my_center|LOCUS_16060 52216 53586 gene locus_tag LOCUS_16070 52216 53586 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066616.1 protein_id gnl|my_center|LOCUS_16070 53592 54719 gene locus_tag LOCUS_16080 53592 54719 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066036.1 protein_id gnl|my_center|LOCUS_16080 54845 55117 gene locus_tag LOCUS_16090 54845 55117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066034.1 protein_id gnl|my_center|LOCUS_16090 55124 55405 gene locus_tag LOCUS_16100 55124 55405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048168986.1 protein_id gnl|my_center|LOCUS_16100 57570 55450 gene locus_tag LOCUS_16110 57570 55450 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024488.1 protein_id gnl|my_center|LOCUS_16110 58259 57618 gene locus_tag LOCUS_16120 58259 57618 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024487.1 protein_id gnl|my_center|LOCUS_16120 59135 58362 gene locus_tag LOCUS_16130 59135 58362 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066032.1 protein_id gnl|my_center|LOCUS_16130 60807 59299 gene locus_tag LOCUS_16140 60807 59299 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024485.1 protein_id gnl|my_center|LOCUS_16140 >Feature sequence21 889 254 gene locus_tag LOCUS_16150 gene engB 889 254 CDS product GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022535.1 protein_id gnl|my_center|LOCUS_16150 1961 960 gene locus_tag LOCUS_16160 1961 960 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065440.1 protein_id gnl|my_center|LOCUS_16160 5040 3088 gene locus_tag LOCUS_16170 5040 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16170 6003 5209 gene locus_tag LOCUS_16180 6003 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16180 9395 6738 gene locus_tag LOCUS_16190 9395 6738 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023974.1 protein_id gnl|my_center|LOCUS_16190 10299 9685 gene locus_tag LOCUS_16200 10299 9685 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021454.1 protein_id gnl|my_center|LOCUS_16200 11194 10307 gene locus_tag LOCUS_16210 gene rsmA 11194 10307 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990848.1 protein_id gnl|my_center|LOCUS_16210 12012 11281 gene locus_tag LOCUS_16220 12012 11281 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065124.1 protein_id gnl|my_center|LOCUS_16220 12709 12356 gene locus_tag LOCUS_16230 12709 12356 CDS product RNA polymerase Rpb4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021458.1 protein_id gnl|my_center|LOCUS_16230 13560 13270 gene locus_tag LOCUS_16240 13560 13270 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021460.1 protein_id gnl|my_center|LOCUS_16240 15044 13749 gene locus_tag LOCUS_16250 15044 13749 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021461.1 protein_id gnl|my_center|LOCUS_16250 16118 15450 gene locus_tag LOCUS_16260 gene trmY 16118 15450 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066221.1 protein_id gnl|my_center|LOCUS_16260 16292 16948 gene locus_tag LOCUS_16270 16292 16948 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021463.1 protein_id gnl|my_center|LOCUS_16270 17582 18862 gene locus_tag LOCUS_16280 17582 18862 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021464.1 protein_id gnl|my_center|LOCUS_16280 19304 19861 gene locus_tag LOCUS_16290 19304 19861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065126.1 protein_id gnl|my_center|LOCUS_16290 20528 21202 gene locus_tag LOCUS_16300 20528 21202 CDS product cell surface lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990790.1 protein_id gnl|my_center|LOCUS_16300 21227 22393 gene locus_tag LOCUS_16310 21227 22393 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021469.1 protein_id gnl|my_center|LOCUS_16310 22545 23165 gene locus_tag LOCUS_16320 22545 23165 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021470.1 protein_id gnl|my_center|LOCUS_16320 23225 23920 gene locus_tag LOCUS_16330 23225 23920 CDS product DUF2110 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021471.1 protein_id gnl|my_center|LOCUS_16330 24812 24075 gene locus_tag LOCUS_16340 24812 24075 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021472.1 protein_id gnl|my_center|LOCUS_16340 25192 25944 gene locus_tag LOCUS_16350 25192 25944 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021474.1 protein_id gnl|my_center|LOCUS_16350 25948 26226 gene locus_tag LOCUS_16360 25948 26226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021475.1 protein_id gnl|my_center|LOCUS_16360 27147 26707 gene locus_tag LOCUS_16370 27147 26707 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021476.1 protein_id gnl|my_center|LOCUS_16370 28015 28755 gene locus_tag LOCUS_16380 28015 28755 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023847.1 protein_id gnl|my_center|LOCUS_16380 30257 29169 gene locus_tag LOCUS_16390 30257 29169 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022381.1 protein_id gnl|my_center|LOCUS_16390 30639 31373 gene locus_tag LOCUS_16400 30639 31373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022380.1 protein_id gnl|my_center|LOCUS_16400 33219 31441 gene locus_tag LOCUS_16410 33219 31441 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990580.1 protein_id gnl|my_center|LOCUS_16410 34765 33368 gene locus_tag LOCUS_16420 34765 33368 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022374.1 protein_id gnl|my_center|LOCUS_16420 35092 35934 gene locus_tag LOCUS_16430 35092 35934 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065423.1 protein_id gnl|my_center|LOCUS_16430 35934 36509 gene locus_tag LOCUS_16440 35934 36509 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022469.1 protein_id gnl|my_center|LOCUS_16440 38812 36560 gene locus_tag LOCUS_16450 38812 36560 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022481.1 protein_id gnl|my_center|LOCUS_16450 39018 38797 gene locus_tag LOCUS_16460 39018 38797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 39595 39086 gene locus_tag LOCUS_16470 39595 39086 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_16470 40193 39672 gene locus_tag LOCUS_16480 40193 39672 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065425.1 protein_id gnl|my_center|LOCUS_16480 41787 42509 gene locus_tag LOCUS_16490 41787 42509 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022415.1 protein_id gnl|my_center|LOCUS_16490 42499 43356 gene locus_tag LOCUS_16500 42499 43356 CDS product methanogen output domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990584.1 protein_id gnl|my_center|LOCUS_16500 44216 43506 gene locus_tag LOCUS_16510 44216 43506 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022417.1 protein_id gnl|my_center|LOCUS_16510 46328 44532 gene locus_tag LOCUS_16520 46328 44532 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022420.1 protein_id gnl|my_center|LOCUS_16520 47072 47389 gene locus_tag LOCUS_16530 47072 47389 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022421.1 protein_id gnl|my_center|LOCUS_16530 47623 47706 gene locus_tag LOCUS_t00310 47623 47706 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 48035 48823 gene locus_tag LOCUS_16540 48035 48823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 49209 48850 gene locus_tag LOCUS_16550 49209 48850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 50637 49705 gene locus_tag LOCUS_16560 gene galU 50637 49705 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065994.1 protein_id gnl|my_center|LOCUS_16560 50780 51095 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51512 52030 gene locus_tag LOCUS_16570 51512 52030 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022904.1 protein_id gnl|my_center|LOCUS_16570 52027 53790 gene locus_tag LOCUS_16580 52027 53790 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022903.1 protein_id gnl|my_center|LOCUS_16580 55452 53899 gene locus_tag LOCUS_16590 55452 53899 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860275.1 protein_id gnl|my_center|LOCUS_16590 55717 56124 gene locus_tag LOCUS_16600 55717 56124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16600 56121 56597 gene locus_tag LOCUS_16610 56121 56597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16610 56710 57228 gene locus_tag LOCUS_16620 56710 57228 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229426.1 protein_id gnl|my_center|LOCUS_16620 >Feature sequence22 1954 248 gene locus_tag LOCUS_16630 1954 248 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022536.1 protein_id gnl|my_center|LOCUS_16630 3009 2014 gene locus_tag LOCUS_16640 3009 2014 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022537.1 protein_id gnl|my_center|LOCUS_16640 3539 3036 gene locus_tag LOCUS_16650 3539 3036 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065441.1 protein_id gnl|my_center|LOCUS_16650 5105 4029 gene locus_tag LOCUS_16660 5105 4029 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990596.1 protein_id gnl|my_center|LOCUS_16660 5321 6373 gene locus_tag LOCUS_16670 5321 6373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022540.1 protein_id gnl|my_center|LOCUS_16670 6638 6904 gene locus_tag LOCUS_16680 6638 6904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022541.1 protein_id gnl|my_center|LOCUS_16680 7272 6946 gene locus_tag LOCUS_16690 7272 6946 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065462.1 protein_id gnl|my_center|LOCUS_16690 7815 8114 gene locus_tag LOCUS_16700 7815 8114 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065930.1 protein_id gnl|my_center|LOCUS_16700 8205 8753 gene locus_tag LOCUS_16710 8205 8753 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021181.1 protein_id gnl|my_center|LOCUS_16710 9109 8846 gene locus_tag LOCUS_16720 9109 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066205.1 protein_id gnl|my_center|LOCUS_16720 12110 9219 gene locus_tag LOCUS_16730 12110 9219 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021360.1 protein_id gnl|my_center|LOCUS_16730 13340 12693 gene locus_tag LOCUS_16740 13340 12693 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021359.1 protein_id gnl|my_center|LOCUS_16740 14145 13381 gene locus_tag LOCUS_16750 14145 13381 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065715.1 protein_id gnl|my_center|LOCUS_16750 14292 14642 gene locus_tag LOCUS_16760 14292 14642 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021357.1 protein_id gnl|my_center|LOCUS_16760 15039 14866 gene locus_tag LOCUS_16770 15039 14866 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065088.1 protein_id gnl|my_center|LOCUS_16770 15376 15209 gene locus_tag LOCUS_16780 15376 15209 CDS product copper ion binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082089387.1 protein_id gnl|my_center|LOCUS_16780 16792 15833 gene locus_tag LOCUS_16790 16792 15833 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021352.1 protein_id gnl|my_center|LOCUS_16790 16900 17103 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18048 17545 gene locus_tag LOCUS_16800 18048 17545 CDS product Holliday junction resolvase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990645.1 protein_id gnl|my_center|LOCUS_16800 18524 19357 gene locus_tag LOCUS_16810 18524 19357 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065707.1 protein_id gnl|my_center|LOCUS_16810 19357 19695 gene locus_tag LOCUS_16820 19357 19695 CDS product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065708.1 protein_id gnl|my_center|LOCUS_16820 19890 20747 gene locus_tag LOCUS_16830 19890 20747 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065709.1 protein_id gnl|my_center|LOCUS_16830 21930 20854 gene locus_tag LOCUS_16840 21930 20854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023363.1 protein_id gnl|my_center|LOCUS_16840 22609 22100 gene locus_tag LOCUS_16850 22609 22100 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990647.1 protein_id gnl|my_center|LOCUS_16850 23815 23309 gene locus_tag LOCUS_16860 23815 23309 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065175.1 protein_id gnl|my_center|LOCUS_16860 24243 23938 gene locus_tag LOCUS_16870 24243 23938 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021663.1 protein_id gnl|my_center|LOCUS_16870 25171 24431 gene locus_tag LOCUS_16880 25171 24431 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878933.1 protein_id gnl|my_center|LOCUS_16880 26618 25140 gene locus_tag LOCUS_16890 26618 25140 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_16890 27282 28403 gene locus_tag LOCUS_16900 27282 28403 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021661.1 protein_id gnl|my_center|LOCUS_16900 28776 30089 gene locus_tag LOCUS_16910 28776 30089 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140384.1 protein_id gnl|my_center|LOCUS_16910 32054 30369 gene locus_tag LOCUS_16920 32054 30369 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021660.1 protein_id gnl|my_center|LOCUS_16920 33386 32442 gene locus_tag LOCUS_16930 33386 32442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 33340 33492 gene locus_tag LOCUS_16940 33340 33492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 34151 35575 gene locus_tag LOCUS_16950 34151 35575 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021657.1 protein_id gnl|my_center|LOCUS_16950 36465 35608 gene locus_tag LOCUS_16960 36465 35608 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021656.1 protein_id gnl|my_center|LOCUS_16960 36790 37197 gene locus_tag LOCUS_16970 36790 37197 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065668.1 protein_id gnl|my_center|LOCUS_16970 37430 38575 gene locus_tag LOCUS_16980 37430 38575 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869500.1 protein_id gnl|my_center|LOCUS_16980 38572 39333 gene locus_tag LOCUS_16990 38572 39333 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_16990 39363 40058 gene locus_tag LOCUS_17000 39363 40058 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064970.1 protein_id gnl|my_center|LOCUS_17000 40626 41681 gene locus_tag LOCUS_17010 40626 41681 CDS product TIGR04083 family peptide-modifying radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023249.1 protein_id gnl|my_center|LOCUS_17010 43069 43252 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 44131 45564 gene locus_tag LOCUS_17020 44131 45564 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064900.1 protein_id gnl|my_center|LOCUS_17020 45717 45926 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 46962 47171 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 47229 47477 gene locus_tag LOCUS_17030 47229 47477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 47541 47912 gene locus_tag LOCUS_17040 47541 47912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023252.1 protein_id gnl|my_center|LOCUS_17040 50107 48074 gene locus_tag LOCUS_17050 gene uvrB 50107 48074 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023255.1 protein_id gnl|my_center|LOCUS_17050 51836 50277 gene locus_tag LOCUS_17060 gene uvrC 51836 50277 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023256.1 protein_id gnl|my_center|LOCUS_17060 55146 51991 gene locus_tag LOCUS_17070 gene uvrA 55146 51991 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023257.1 protein_id gnl|my_center|LOCUS_17070 52129 52389 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 55766 55981 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence23 1512 223 gene locus_tag LOCUS_17080 gene gatD 1512 223 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021336.1 protein_id gnl|my_center|LOCUS_17080 3052 1583 gene locus_tag LOCUS_17090 gene argH 3052 1583 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021337.1 protein_id gnl|my_center|LOCUS_17090 4868 3678 gene locus_tag LOCUS_17100 4868 3678 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065100.1 protein_id gnl|my_center|LOCUS_17100 5133 5870 gene locus_tag LOCUS_17110 5133 5870 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021381.1 protein_id gnl|my_center|LOCUS_17110 6933 6055 gene locus_tag LOCUS_17120 6933 6055 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021382.1 protein_id gnl|my_center|LOCUS_17120 8599 8090 gene locus_tag LOCUS_17130 8599 8090 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065101.1 protein_id gnl|my_center|LOCUS_17130 8840 9121 gene locus_tag LOCUS_17140 8840 9121 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066210.1 protein_id gnl|my_center|LOCUS_17140 9289 9431 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10411 9482 gene locus_tag LOCUS_17150 gene trxB 10411 9482 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065103.1 protein_id gnl|my_center|LOCUS_17150 10731 10480 gene locus_tag LOCUS_17160 10731 10480 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021387.1 protein_id gnl|my_center|LOCUS_17160 10901 11701 gene locus_tag LOCUS_17170 gene dph5 10901 11701 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021388.1 protein_id gnl|my_center|LOCUS_17170 11698 12036 gene locus_tag LOCUS_17180 11698 12036 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066211.1 protein_id gnl|my_center|LOCUS_17180 12369 12758 gene locus_tag LOCUS_17190 12369 12758 CDS product DUF555 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021390.1 protein_id gnl|my_center|LOCUS_17190 13019 13918 gene locus_tag LOCUS_17200 13019 13918 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021391.1 protein_id gnl|my_center|LOCUS_17200 14079 14750 gene locus_tag LOCUS_17210 14079 14750 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066212.1 protein_id gnl|my_center|LOCUS_17210 15052 14843 gene locus_tag LOCUS_17220 15052 14843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 15809 15408 gene locus_tag LOCUS_17230 15809 15408 CDS product AIR carboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021394.1 protein_id gnl|my_center|LOCUS_17230 16117 15830 gene locus_tag LOCUS_17240 16117 15830 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021395.1 protein_id gnl|my_center|LOCUS_17240 16995 16132 gene locus_tag LOCUS_17250 16995 16132 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021396.1 protein_id gnl|my_center|LOCUS_17250 17345 18247 gene locus_tag LOCUS_17260 17345 18247 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021397.1 protein_id gnl|my_center|LOCUS_17260 18705 18890 gene locus_tag LOCUS_17270 18705 18890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 18985 19626 gene locus_tag LOCUS_17280 18985 19626 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021398.1 protein_id gnl|my_center|LOCUS_17280 19623 19991 gene locus_tag LOCUS_17290 19623 19991 CDS product DUF2073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021399.1 protein_id gnl|my_center|LOCUS_17290 20006 20518 gene locus_tag LOCUS_17300 20006 20518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065104.1 protein_id gnl|my_center|LOCUS_17300 20820 21434 gene locus_tag LOCUS_17310 gene hxlB 20820 21434 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065105.1 protein_id gnl|my_center|LOCUS_17310 21549 22661 gene locus_tag LOCUS_17320 21549 22661 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021402.1 protein_id gnl|my_center|LOCUS_17320 23064 23417 gene locus_tag LOCUS_17330 23064 23417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 24040 24810 gene locus_tag LOCUS_17340 24040 24810 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990787.1 protein_id gnl|my_center|LOCUS_17340 26032 25037 gene locus_tag LOCUS_17350 26032 25037 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589523.1 protein_id gnl|my_center|LOCUS_17350 26387 27271 gene locus_tag LOCUS_17360 26387 27271 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021408.1 protein_id gnl|my_center|LOCUS_17360 27706 27392 gene locus_tag LOCUS_17370 gene hisE 27706 27392 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021409.1 protein_id gnl|my_center|LOCUS_17370 29082 27787 gene locus_tag LOCUS_17380 29082 27787 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589524.1 protein_id gnl|my_center|LOCUS_17380 30070 29234 gene locus_tag LOCUS_17390 30070 29234 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065106.1 protein_id gnl|my_center|LOCUS_17390 30252 30704 gene locus_tag LOCUS_17400 30252 30704 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021413.1 protein_id gnl|my_center|LOCUS_17400 32283 30895 gene locus_tag LOCUS_17410 32283 30895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 32589 33413 gene locus_tag LOCUS_17420 32589 33413 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022865.1 protein_id gnl|my_center|LOCUS_17420 34063 33419 gene locus_tag LOCUS_17430 34063 33419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021419.1 protein_id gnl|my_center|LOCUS_17430 34591 34956 gene locus_tag LOCUS_17440 34591 34956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021422.1 protein_id gnl|my_center|LOCUS_17440 35454 35110 gene locus_tag LOCUS_17450 35454 35110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021423.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17450 35791 36924 gene locus_tag LOCUS_17460 35791 36924 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066217.1 protein_id gnl|my_center|LOCUS_17460 36887 37804 gene locus_tag LOCUS_17470 gene mtnP 36887 37804 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021425.1 protein_id gnl|my_center|LOCUS_17470 38202 40682 gene locus_tag LOCUS_17480 38202 40682 CDS product DUF5814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021427.1 protein_id gnl|my_center|LOCUS_17480 40857 41255 gene locus_tag LOCUS_17490 40857 41255 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021428.1 protein_id gnl|my_center|LOCUS_17490 41683 41907 gene locus_tag LOCUS_17500 41683 41907 CDS product Sm protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021429.1 protein_id gnl|my_center|LOCUS_17500 41940 42341 gene locus_tag LOCUS_17510 41940 42341 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589516.1 protein_id gnl|my_center|LOCUS_17510 42461 42538 gene locus_tag LOCUS_t00320 42461 42538 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 42869 42946 gene locus_tag LOCUS_t00330 42869 42946 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 43988 43086 gene locus_tag LOCUS_17520 43988 43086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860124.1 protein_id gnl|my_center|LOCUS_17520 46661 45009 gene locus_tag LOCUS_17530 46661 45009 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021438.1 protein_id gnl|my_center|LOCUS_17530 47203 46760 gene locus_tag LOCUS_17540 47203 46760 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021439.1 protein_id gnl|my_center|LOCUS_17540 47913 47335 gene locus_tag LOCUS_17550 47913 47335 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021440.1 protein_id gnl|my_center|LOCUS_17550 49763 48666 gene locus_tag LOCUS_17560 49763 48666 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021442.1 protein_id gnl|my_center|LOCUS_17560 50704 49880 gene locus_tag LOCUS_17570 50704 49880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990789.1 protein_id gnl|my_center|LOCUS_17570 51456 50911 gene locus_tag LOCUS_17580 gene msrA 51456 50911 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021447.1 protein_id gnl|my_center|LOCUS_17580 52101 51517 gene locus_tag LOCUS_17590 52101 51517 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065119.1 protein_id gnl|my_center|LOCUS_17590 52699 52493 gene locus_tag LOCUS_17600 52699 52493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065120.1 protein_id gnl|my_center|LOCUS_17600 54173 52974 gene locus_tag LOCUS_17610 54173 52974 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021450.1 protein_id gnl|my_center|LOCUS_17610 54900 54325 gene locus_tag LOCUS_17620 54900 54325 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066220.1 protein_id gnl|my_center|LOCUS_17620 55526 54900 gene locus_tag LOCUS_17630 55526 54900 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021452.1 protein_id gnl|my_center|LOCUS_17630 55773 55991 gene locus_tag LOCUS_17640 55773 55991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 >Feature sequence24 <1 785 gene locus_tag LOCUS_17650 <1 785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157860416.1:DNA repair and recombination protein RadB 2091 991 gene locus_tag LOCUS_17660 2091 991 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020134.1 protein_id gnl|my_center|LOCUS_17660 2681 3700 gene locus_tag LOCUS_17670 2681 3700 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064802.1 protein_id gnl|my_center|LOCUS_17670 4104 4271 gene locus_tag LOCUS_17680 4104 4271 CDS product preprotein translocase subunit Sec61beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064803.1 protein_id gnl|my_center|LOCUS_17680 4299 5330 gene locus_tag LOCUS_17690 4299 5330 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860057.1 protein_id gnl|my_center|LOCUS_17690 5416 7575 gene locus_tag LOCUS_17700 5416 7575 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020139.1 protein_id gnl|my_center|LOCUS_17700 8064 10250 gene locus_tag LOCUS_17710 gene ppk1 8064 10250 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755861.1 protein_id gnl|my_center|LOCUS_17710 11480 10404 gene locus_tag LOCUS_17720 11480 10404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 11992 11387 gene locus_tag LOCUS_17730 11992 11387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 13240 13527 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13537 14106 gene locus_tag LOCUS_17740 13537 14106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17740 16939 14294 gene locus_tag LOCUS_17750 16939 14294 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064804.1 protein_id gnl|my_center|LOCUS_17750 17203 17949 gene locus_tag LOCUS_17760 17203 17949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020214.1 protein_id gnl|my_center|LOCUS_17760 18936 18130 gene locus_tag LOCUS_17770 18936 18130 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021773.1 protein_id gnl|my_center|LOCUS_17770 19278 19349 gene locus_tag LOCUS_t00340 19278 19349 tRNA product tRNA-Pyl inference COORDINATES:profile:Aragorn:1.2.38 19578 20840 gene locus_tag LOCUS_17780 gene pylS 19578 20840 CDS product pyrrolysine--tRNA(Pyl) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020213.1 protein_id gnl|my_center|LOCUS_17780 21455 22180 gene locus_tag LOCUS_17790 21455 22180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 22182 23273 gene locus_tag LOCUS_17800 gene pylC 22182 23273 CDS product 3-methylornithine--L-lysine ligase PylC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020211.1 protein_id gnl|my_center|LOCUS_17800 23301 24080 gene locus_tag LOCUS_17810 gene pylD 23301 24080 CDS product 3-methylornithyl-N6-L-lysine dehydrogenase PylD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020210.1 protein_id gnl|my_center|LOCUS_17810 25786 24164 gene locus_tag LOCUS_17820 25786 24164 CDS product methylamine methyltransferase corrinoid protein reductive activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020208.1 protein_id gnl|my_center|LOCUS_17820 26728 26027 gene locus_tag LOCUS_17830 26728 26027 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020206.1 protein_id gnl|my_center|LOCUS_17830 26828 26943 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27278 28297 gene locus_tag LOCUS_17840 27278 28297 CDS product MtaA/CmuA family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020204.1 protein_id gnl|my_center|LOCUS_17840 29187 29840 gene locus_tag LOCUS_17850 29187 29840 CDS product methyltransferase cognate corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022912.1 protein_id gnl|my_center|LOCUS_17850 29860 31236 gene locus_tag LOCUS_17860 gene mtmB 29860 31236 CDS product monomethylamine methyltransferase MtmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:P58969 transl_except (pos:30463..30465,aa:Pyl) note codon on position 202 is pyrrolysine amber codon. protein_id gnl|my_center|LOCUS_17860 31665 32801 gene locus_tag LOCUS_17870 31665 32801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 34733 33711 gene locus_tag LOCUS_17880 34733 33711 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064821.1 protein_id gnl|my_center|LOCUS_17880 36509 34794 gene locus_tag LOCUS_17890 36509 34794 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020198.1 protein_id gnl|my_center|LOCUS_17890 37411 36506 gene locus_tag LOCUS_17900 37411 36506 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020197.1 protein_id gnl|my_center|LOCUS_17900 37790 38266 gene locus_tag LOCUS_17910 37790 38266 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020196.1 protein_id gnl|my_center|LOCUS_17910 38412 38735 gene locus_tag LOCUS_17920 38412 38735 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061058.1 protein_id gnl|my_center|LOCUS_17920 39764 39000 gene locus_tag LOCUS_17930 39764 39000 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020194.1 protein_id gnl|my_center|LOCUS_17930 40219 40620 gene locus_tag LOCUS_17940 40219 40620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020193.1 protein_id gnl|my_center|LOCUS_17940 40888 41841 gene locus_tag LOCUS_17950 40888 41841 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020666.1 protein_id gnl|my_center|LOCUS_17950 42417 41956 gene locus_tag LOCUS_17960 42417 41956 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020192.1 protein_id gnl|my_center|LOCUS_17960 43839 42643 gene locus_tag LOCUS_17970 43839 42643 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020191.1 protein_id gnl|my_center|LOCUS_17970 44179 45675 gene locus_tag LOCUS_17980 44179 45675 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020190.1 protein_id gnl|my_center|LOCUS_17980 45701 46702 gene locus_tag LOCUS_17990 gene purM 45701 46702 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066059.1 protein_id gnl|my_center|LOCUS_17990 47232 46858 gene locus_tag LOCUS_18000 47232 46858 CDS product DUF1894 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020188.1 protein_id gnl|my_center|LOCUS_18000 47687 47229 gene locus_tag LOCUS_18010 47687 47229 CDS product DUF1890 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020187.1 protein_id gnl|my_center|LOCUS_18010 48236 48538 gene locus_tag LOCUS_18020 48236 48538 CDS product DUF1894 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020185.1 protein_id gnl|my_center|LOCUS_18020 49111 48560 gene locus_tag LOCUS_18030 49111 48560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066058.1 protein_id gnl|my_center|LOCUS_18030 50305 49211 gene locus_tag LOCUS_18040 50305 49211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066057.1 protein_id gnl|my_center|LOCUS_18040 50971 50828 gene locus_tag LOCUS_18050 50971 50828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 50970 51446 gene locus_tag LOCUS_18060 50970 51446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020180.1 protein_id gnl|my_center|LOCUS_18060 51788 52927 gene locus_tag LOCUS_18070 51788 52927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860060.1 protein_id gnl|my_center|LOCUS_18070 53325 54512 gene locus_tag LOCUS_18080 53325 54512 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066055.1 protein_id gnl|my_center|LOCUS_18080 54499 55593 gene locus_tag LOCUS_18090 gene hisC 54499 55593 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064817.1 protein_id gnl|my_center|LOCUS_18090 >Feature sequence25 707 60 gene locus_tag LOCUS_18100 707 60 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023336.1 protein_id gnl|my_center|LOCUS_18100 2267 957 gene locus_tag LOCUS_18110 2267 957 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022771.1 protein_id gnl|my_center|LOCUS_18110 3571 4896 gene locus_tag LOCUS_18120 3571 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 5644 7179 gene locus_tag LOCUS_18130 5644 7179 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022613.1 protein_id gnl|my_center|LOCUS_18130 7793 7305 gene locus_tag LOCUS_18140 7793 7305 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022604.1 protein_id gnl|my_center|LOCUS_18140 11198 8841 gene locus_tag LOCUS_18150 11198 8841 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022605.1 protein_id gnl|my_center|LOCUS_18150 11575 11381 gene locus_tag LOCUS_18160 11575 11381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 12501 11551 gene locus_tag LOCUS_18170 12501 11551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 12910 12572 gene locus_tag LOCUS_18180 12910 12572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 13707 13153 gene locus_tag LOCUS_18190 13707 13153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18190 14583 14059 gene locus_tag LOCUS_18200 14583 14059 CDS product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022592.1 protein_id gnl|my_center|LOCUS_18200 16060 14897 gene locus_tag LOCUS_18210 16060 14897 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_18210 16596 16438 gene locus_tag LOCUS_18220 16596 16438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18220 17317 19299 gene locus_tag LOCUS_18230 17317 19299 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022589.1 protein_id gnl|my_center|LOCUS_18230 19406 20431 gene locus_tag LOCUS_18240 19406 20431 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065537.1 protein_id gnl|my_center|LOCUS_18240 20610 21104 gene locus_tag LOCUS_18250 20610 21104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990643.1 protein_id gnl|my_center|LOCUS_18250 21198 22046 gene locus_tag LOCUS_18260 21198 22046 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146473.1 protein_id gnl|my_center|LOCUS_18260 22339 22151 gene locus_tag LOCUS_18270 22339 22151 CDS product CooT family nickel-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065683.1 protein_id gnl|my_center|LOCUS_18270 23540 22659 gene locus_tag LOCUS_18280 23540 22659 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023289.1 protein_id gnl|my_center|LOCUS_18280 23963 23790 gene locus_tag LOCUS_18290 23963 23790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 23944 25368 gene locus_tag LOCUS_18300 23944 25368 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065684.1 protein_id gnl|my_center|LOCUS_18300 25793 25518 gene locus_tag LOCUS_18310 25793 25518 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023295.1 protein_id gnl|my_center|LOCUS_18310 25895 26131 gene locus_tag LOCUS_18320 25895 26131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 26444 26217 gene locus_tag LOCUS_18330 26444 26217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022495.1 protein_id gnl|my_center|LOCUS_18330 27247 26762 gene locus_tag LOCUS_18340 27247 26762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023265.1 protein_id gnl|my_center|LOCUS_18340 27488 27336 gene locus_tag LOCUS_18350 27488 27336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 27866 28843 gene locus_tag LOCUS_18360 27866 28843 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022265.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18360 29764 29851 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29984 30205 gene locus_tag LOCUS_18370 29984 30205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 31022 31239 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31596 31444 gene locus_tag LOCUS_18380 31596 31444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 31959 31774 gene locus_tag LOCUS_18390 31959 31774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 32574 33581 gene locus_tag LOCUS_18400 32574 33581 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021053.1 protein_id gnl|my_center|LOCUS_18400 33878 34000 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34006 34824 gene locus_tag LOCUS_18410 34006 34824 CDS product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023274.1 protein_id gnl|my_center|LOCUS_18410 34826 35653 gene locus_tag LOCUS_18420 34826 35653 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023273.1 protein_id gnl|my_center|LOCUS_18420 36215 37432 gene locus_tag LOCUS_18430 36215 37432 CDS product homocitrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023272.1 protein_id gnl|my_center|LOCUS_18430 40014 37636 gene locus_tag LOCUS_18440 40014 37636 CDS product DUF3160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065672.1 protein_id gnl|my_center|LOCUS_18440 41018 42064 gene locus_tag LOCUS_18450 41018 42064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 42372 42890 gene locus_tag LOCUS_18460 42372 42890 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990886.1 protein_id gnl|my_center|LOCUS_18460 43282 42998 gene locus_tag LOCUS_18470 43282 42998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066421.1 protein_id gnl|my_center|LOCUS_18470 43874 43476 gene locus_tag LOCUS_18480 43874 43476 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065550.1 protein_id gnl|my_center|LOCUS_18480 45136 43874 gene locus_tag LOCUS_18490 45136 43874 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065549.1 protein_id gnl|my_center|LOCUS_18490 45593 45129 gene locus_tag LOCUS_18500 45593 45129 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022827.1 protein_id gnl|my_center|LOCUS_18500 46283 46002 gene locus_tag LOCUS_18510 46283 46002 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022822.1 protein_id gnl|my_center|LOCUS_18510 47660 50041 gene locus_tag LOCUS_18520 gene hdrA2 47660 50041 CDS product CoB-CoM heterodisulfide reductase HdrA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022820.1 protein_id gnl|my_center|LOCUS_18520 50038 51498 gene locus_tag LOCUS_18530 50038 51498 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022819.1 protein_id gnl|my_center|LOCUS_18530 52278 52418 gene locus_tag LOCUS_18540 52278 52418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 52535 52990 gene locus_tag LOCUS_18550 52535 52990 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023219.1 protein_id gnl|my_center|LOCUS_18550 53245 53886 gene locus_tag LOCUS_18560 53245 53886 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022401.1 protein_id gnl|my_center|LOCUS_18560 54710 53994 gene locus_tag LOCUS_18570 54710 53994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 >Feature sequence26 588 253 gene locus_tag LOCUS_18580 588 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18580 4613 3780 gene locus_tag LOCUS_18590 4613 3780 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024090.1 protein_id gnl|my_center|LOCUS_18590 5599 4610 gene locus_tag LOCUS_18600 5599 4610 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024091.1 protein_id gnl|my_center|LOCUS_18600 6665 6973 gene locus_tag LOCUS_18610 6665 6973 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065931.1 protein_id gnl|my_center|LOCUS_18610 7151 7360 gene locus_tag LOCUS_18620 7151 7360 CDS product DUF1059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024097.1 protein_id gnl|my_center|LOCUS_18620 8023 9219 gene locus_tag LOCUS_18630 8023 9219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 9290 10450 gene locus_tag LOCUS_18640 9290 10450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020604.1 protein_id gnl|my_center|LOCUS_18640 10954 11814 gene locus_tag LOCUS_18650 10954 11814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393121.1 protein_id gnl|my_center|LOCUS_18650 12159 12398 gene locus_tag LOCUS_18660 12159 12398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 13780 12746 gene locus_tag LOCUS_18670 13780 12746 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024104.1 protein_id gnl|my_center|LOCUS_18670 13817 14030 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16189 14678 gene locus_tag LOCUS_18680 16189 14678 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024102.1 protein_id gnl|my_center|LOCUS_18680 17238 16186 gene locus_tag LOCUS_18690 17238 16186 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065933.1 protein_id gnl|my_center|LOCUS_18690 17388 17666 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19509 18166 gene locus_tag LOCUS_18700 gene glnA 19509 18166 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024100.1 protein_id gnl|my_center|LOCUS_18700 20466 19909 gene locus_tag LOCUS_18710 gene cyaB 20466 19909 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023937.1 protein_id gnl|my_center|LOCUS_18710 20998 20600 gene locus_tag LOCUS_18720 20998 20600 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023936.1 protein_id gnl|my_center|LOCUS_18720 22177 21005 gene locus_tag LOCUS_18730 22177 21005 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_18730 23243 22194 gene locus_tag LOCUS_18740 23243 22194 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023934.1 protein_id gnl|my_center|LOCUS_18740 24032 23283 gene locus_tag LOCUS_18750 24032 23283 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023933.1 protein_id gnl|my_center|LOCUS_18750 24272 24991 gene locus_tag LOCUS_18760 24272 24991 CDS product Dna2/Cas4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065883.1 protein_id gnl|my_center|LOCUS_18760 25691 26884 gene locus_tag LOCUS_18770 25691 26884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 26943 28124 gene locus_tag LOCUS_18780 26943 28124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020604.1 protein_id gnl|my_center|LOCUS_18780 28225 28506 gene locus_tag LOCUS_18790 28225 28506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 28773 30044 gene locus_tag LOCUS_18800 28773 30044 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066448.1 protein_id gnl|my_center|LOCUS_18800 30500 30213 gene locus_tag LOCUS_18810 30500 30213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023923.1 protein_id gnl|my_center|LOCUS_18810 30771 32618 gene locus_tag LOCUS_18820 30771 32618 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867369.1 protein_id gnl|my_center|LOCUS_18820 33804 32707 gene locus_tag LOCUS_18830 gene dinB 33804 32707 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066563.1 protein_id gnl|my_center|LOCUS_18830 34252 35235 gene locus_tag LOCUS_18840 34252 35235 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023914.1 protein_id gnl|my_center|LOCUS_18840 35273 36079 gene locus_tag LOCUS_18850 gene cbiQ 35273 36079 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023913.1 protein_id gnl|my_center|LOCUS_18850 36255 36434 gene locus_tag LOCUS_18860 36255 36434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 36588 37253 gene locus_tag LOCUS_18870 gene cbiM 36588 37253 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065876.1 protein_id gnl|my_center|LOCUS_18870 37255 37515 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38430 37726 gene locus_tag LOCUS_18880 gene nth 38430 37726 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065874.1 protein_id gnl|my_center|LOCUS_18880 38694 38930 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40538 40840 gene locus_tag LOCUS_18890 40538 40840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023897.1 protein_id gnl|my_center|LOCUS_18890 41553 42569 gene locus_tag LOCUS_18900 gene fen 41553 42569 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023899.1 protein_id gnl|my_center|LOCUS_18900 43596 42640 gene locus_tag LOCUS_18910 43596 42640 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065872.1 protein_id gnl|my_center|LOCUS_18910 45417 43867 gene locus_tag LOCUS_18920 gene gpmI 45417 43867 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065873.1 protein_id gnl|my_center|LOCUS_18920 45666 46274 gene locus_tag LOCUS_18930 45666 46274 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023903.1 protein_id gnl|my_center|LOCUS_18930 47134 47838 gene locus_tag LOCUS_18940 47134 47838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 48790 48005 gene locus_tag LOCUS_18950 48790 48005 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048173813.1 protein_id gnl|my_center|LOCUS_18950 51269 49653 gene locus_tag LOCUS_18960 gene purH 51269 49653 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023907.1 protein_id gnl|my_center|LOCUS_18960 51990 51667 gene locus_tag LOCUS_18970 51990 51667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065871.1 protein_id gnl|my_center|LOCUS_18970 >Feature sequence27 1729 1019 gene locus_tag LOCUS_18980 1729 1019 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065490.1 protein_id gnl|my_center|LOCUS_18980 2833 1997 gene locus_tag LOCUS_18990 2833 1997 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022647.1 protein_id gnl|my_center|LOCUS_18990 3683 2865 gene locus_tag LOCUS_19000 3683 2865 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984847.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19000 5239 4046 gene locus_tag LOCUS_19010 5239 4046 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021990.1 protein_id gnl|my_center|LOCUS_19010 6241 6092 gene locus_tag LOCUS_19020 6241 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 7060 6975 gene locus_tag LOCUS_t00350 7060 6975 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8007 7225 gene locus_tag LOCUS_19030 8007 7225 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022767.1 protein_id gnl|my_center|LOCUS_19030 8556 8987 gene locus_tag LOCUS_19040 gene nikR 8556 8987 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022768.1 protein_id gnl|my_center|LOCUS_19040 9991 9524 gene locus_tag LOCUS_19050 9991 9524 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023217.1 protein_id gnl|my_center|LOCUS_19050 10671 10159 gene locus_tag LOCUS_19060 10671 10159 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023216.1 protein_id gnl|my_center|LOCUS_19060 11982 10678 gene locus_tag LOCUS_19070 11982 10678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19070 12561 12016 gene locus_tag LOCUS_19080 12561 12016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19080 13063 13248 gene locus_tag LOCUS_19090 13063 13248 CDS product methytransferase partner Trm112 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023214.1 protein_id gnl|my_center|LOCUS_19090 13263 14003 gene locus_tag LOCUS_19100 13263 14003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023213.1 protein_id gnl|my_center|LOCUS_19100 14352 15965 gene locus_tag LOCUS_19110 gene pyrG 14352 15965 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023212.1 protein_id gnl|my_center|LOCUS_19110 16287 16421 gene locus_tag LOCUS_19120 16287 16421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 16710 16805 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17067 17516 gene locus_tag LOCUS_19130 17067 17516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065660.1 protein_id gnl|my_center|LOCUS_19130 17602 18864 gene locus_tag LOCUS_19140 17602 18864 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065659.1 protein_id gnl|my_center|LOCUS_19140 19112 18900 gene locus_tag LOCUS_19150 19112 18900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 19210 19638 gene locus_tag LOCUS_19160 19210 19638 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887845.1 protein_id gnl|my_center|LOCUS_19160 19635 21014 gene locus_tag LOCUS_19170 19635 21014 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022654.1 protein_id gnl|my_center|LOCUS_19170 22459 21143 gene locus_tag LOCUS_19180 gene truD 22459 21143 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065655.1 protein_id gnl|my_center|LOCUS_19180 23406 22501 gene locus_tag LOCUS_19190 23406 22501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 24220 23873 gene locus_tag LOCUS_19200 gene pth2 24220 23873 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023203.1 protein_id gnl|my_center|LOCUS_19200 25365 24379 gene locus_tag LOCUS_19210 gene mptN 25365 24379 CDS product tetrahydromethanopterin:alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023202.1 protein_id gnl|my_center|LOCUS_19210 25522 25720 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26162 25773 gene locus_tag LOCUS_19220 gene nifU 26162 25773 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023199.1 protein_id gnl|my_center|LOCUS_19220 27500 26310 gene locus_tag LOCUS_19230 gene nifS 27500 26310 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065651.1 protein_id gnl|my_center|LOCUS_19230 27608 27792 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27850 28071 gene locus_tag LOCUS_19240 27850 28071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990638.1 protein_id gnl|my_center|LOCUS_19240 28159 28384 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28583 28900 gene locus_tag LOCUS_19250 28583 28900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022118.1 protein_id gnl|my_center|LOCUS_19250 29199 29948 gene locus_tag LOCUS_19260 29199 29948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022925.1 protein_id gnl|my_center|LOCUS_19260 30633 30031 gene locus_tag LOCUS_19270 30633 30031 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022926.1 protein_id gnl|my_center|LOCUS_19270 32399 30711 gene locus_tag LOCUS_19280 gene trpE 32399 30711 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022927.1 protein_id gnl|my_center|LOCUS_19280 33096 32386 gene locus_tag LOCUS_19290 33096 32386 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065580.1 protein_id gnl|my_center|LOCUS_19290 34193 33108 gene locus_tag LOCUS_19300 gene trpD 34193 33108 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022929.1 protein_id gnl|my_center|LOCUS_19300 34462 34289 gene locus_tag LOCUS_19310 34462 34289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 34644 34881 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36522 35230 gene locus_tag LOCUS_19320 gene trpB 36522 35230 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022931.1 protein_id gnl|my_center|LOCUS_19320 37479 36676 gene locus_tag LOCUS_19330 37479 36676 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022932.1 protein_id gnl|my_center|LOCUS_19330 38849 37983 gene locus_tag LOCUS_19340 38849 37983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 38862 39129 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39389 39568 gene locus_tag LOCUS_19350 39389 39568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 40207 40332 gene locus_tag LOCUS_19360 40207 40332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 40442 40672 gene locus_tag LOCUS_19370 40442 40672 CDS product DUF2180 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023639.1 protein_id gnl|my_center|LOCUS_19370 40684 40905 gene locus_tag LOCUS_19380 40684 40905 CDS product DUF2180 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065787.1 protein_id gnl|my_center|LOCUS_19380 41237 41449 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 41815 42038 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42176 42371 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43381 42470 gene locus_tag LOCUS_19390 43381 42470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 43787 43903 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 44640 46349 gene locus_tag LOCUS_19400 44640 46349 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860269.1 protein_id gnl|my_center|LOCUS_19400 46703 47584 gene locus_tag LOCUS_19410 46703 47584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990603.1 protein_id gnl|my_center|LOCUS_19410 47873 48133 gene locus_tag LOCUS_19420 47873 48133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19420 52027 48272 gene locus_tag LOCUS_19430 52027 48272 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022279.1 protein_id gnl|my_center|LOCUS_19430 >Feature sequence28 989 1156 gene locus_tag LOCUS_19440 989 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 4138 1913 gene locus_tag LOCUS_19450 4138 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 5748 4906 gene locus_tag LOCUS_19460 5748 4906 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 protein_id gnl|my_center|LOCUS_19460 7285 5735 gene locus_tag LOCUS_19470 7285 5735 CDS product ADP-dependent glucokinase/phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023476.1 protein_id gnl|my_center|LOCUS_19470 8816 7341 gene locus_tag LOCUS_19480 gene pfkC 8816 7341 CDS product ADP-specific phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023477.1 protein_id gnl|my_center|LOCUS_19480 10228 9041 gene locus_tag LOCUS_19490 gene argJ 10228 9041 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023478.1 protein_id gnl|my_center|LOCUS_19490 10712 10248 gene locus_tag LOCUS_19500 10712 10248 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065746.1 protein_id gnl|my_center|LOCUS_19500 11823 10801 gene locus_tag LOCUS_19510 gene argC 11823 10801 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065747.1 protein_id gnl|my_center|LOCUS_19510 12285 12707 gene locus_tag LOCUS_19520 12285 12707 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023482.1 protein_id gnl|my_center|LOCUS_19520 13093 13263 gene locus_tag LOCUS_19530 13093 13263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 14080 13691 gene locus_tag LOCUS_19540 14080 13691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022807.1 protein_id gnl|my_center|LOCUS_19540 14660 14094 gene locus_tag LOCUS_19550 14660 14094 CDS product toll/interleukin-1 receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022806.1 protein_id gnl|my_center|LOCUS_19550 14861 14679 gene locus_tag LOCUS_19560 14861 14679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 15186 14998 gene locus_tag LOCUS_19570 15186 14998 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021259.1 protein_id gnl|my_center|LOCUS_19570 15477 16016 gene locus_tag LOCUS_19580 15477 16016 CDS product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990618.1 protein_id gnl|my_center|LOCUS_19580 16398 16165 gene locus_tag LOCUS_19590 16398 16165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 16587 17369 gene locus_tag LOCUS_19600 16587 17369 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022803.1 protein_id gnl|my_center|LOCUS_19600 17534 17606 gene locus_tag LOCUS_t00360 17534 17606 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 17864 19573 gene locus_tag LOCUS_19610 17864 19573 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022802.1 protein_id gnl|my_center|LOCUS_19610 19664 19847 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22880 20352 gene locus_tag LOCUS_19620 gene mgtA 22880 20352 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402038.1 protein_id gnl|my_center|LOCUS_19620 23985 22912 gene locus_tag LOCUS_19630 23985 22912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022800.1 protein_id gnl|my_center|LOCUS_19630 24579 24391 gene locus_tag LOCUS_19640 24579 24391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 24947 27805 gene locus_tag LOCUS_19650 24947 27805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 27575 27800 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27895 28635 gene locus_tag LOCUS_19660 27895 28635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023320.1 protein_id gnl|my_center|LOCUS_19660 28826 29518 gene locus_tag LOCUS_19670 28826 29518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023321.1 protein_id gnl|my_center|LOCUS_19670 29515 30621 gene locus_tag LOCUS_19680 29515 30621 CDS product PGF-pre-PGF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023322.1 protein_id gnl|my_center|LOCUS_19680 30937 32262 gene locus_tag LOCUS_19690 30937 32262 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023357.1 protein_id gnl|my_center|LOCUS_19690 32424 32678 gene locus_tag LOCUS_19700 32424 32678 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023356.1 protein_id gnl|my_center|LOCUS_19700 34969 32729 gene locus_tag LOCUS_19710 34969 32729 CDS product lectin like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066491.1 protein_id gnl|my_center|LOCUS_19710 35388 35681 gene locus_tag LOCUS_19720 35388 35681 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066490.1 protein_id gnl|my_center|LOCUS_19720 35717 36172 gene locus_tag LOCUS_19730 35717 36172 CDS product DNA polymerase ligase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023353.1 protein_id gnl|my_center|LOCUS_19730 36292 36666 gene locus_tag LOCUS_19740 36292 36666 CDS product STAS-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023352.1 protein_id gnl|my_center|LOCUS_19740 36659 37300 gene locus_tag LOCUS_19750 36659 37300 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023351.1 protein_id gnl|my_center|LOCUS_19750 37478 37314 gene locus_tag LOCUS_19760 37478 37314 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023347.1 protein_id gnl|my_center|LOCUS_19760 37614 37802 gene locus_tag LOCUS_19770 37614 37802 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755951.1 protein_id gnl|my_center|LOCUS_19770 39440 38223 gene locus_tag LOCUS_19780 39440 38223 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209169.1 protein_id gnl|my_center|LOCUS_19780 41674 39452 gene locus_tag LOCUS_19790 41674 39452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 42076 42501 gene locus_tag LOCUS_19800 42076 42501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 43433 43743 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43750 44829 gene locus_tag LOCUS_19810 43750 44829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 45326 45943 gene locus_tag LOCUS_19820 45326 45943 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023341.1 protein_id gnl|my_center|LOCUS_19820 46034 46163 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 48649 46301 gene locus_tag LOCUS_19830 48649 46301 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021792.1 protein_id gnl|my_center|LOCUS_19830 49330 50616 gene locus_tag LOCUS_19840 gene thiC 49330 50616 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021793.1 protein_id gnl|my_center|LOCUS_19840 51154 50756 gene locus_tag LOCUS_19850 51154 50756 CDS product DUF3303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021796.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence29 619 131 gene locus_tag LOCUS_19860 619 131 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024282.1 protein_id gnl|my_center|LOCUS_19860 1345 671 gene locus_tag LOCUS_19870 1345 671 CDS product undecaprenyl diphosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024281.1 protein_id gnl|my_center|LOCUS_19870 2634 1450 gene locus_tag LOCUS_19880 2634 1450 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024280.1 protein_id gnl|my_center|LOCUS_19880 2804 2877 gene locus_tag LOCUS_t00370 2804 2877 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3646 3718 gene locus_tag LOCUS_t00380 3646 3718 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4260 5852 gene locus_tag LOCUS_19890 gene kdpA 4260 5852 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943117.1 protein_id gnl|my_center|LOCUS_19890 5857 6456 gene locus_tag LOCUS_19900 5857 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19900 6472 7926 gene locus_tag LOCUS_19910 6472 7926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19910 7939 8499 gene locus_tag LOCUS_19920 gene kdpC 7939 8499 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943119.1 protein_id gnl|my_center|LOCUS_19920 8492 10447 gene locus_tag LOCUS_19930 8492 10447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 10862 12433 gene locus_tag LOCUS_19940 10862 12433 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024241.1 protein_id gnl|my_center|LOCUS_19940 12459 12719 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14142 12874 gene locus_tag LOCUS_19950 14142 12874 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990698.1 protein_id gnl|my_center|LOCUS_19950 15046 14135 gene locus_tag LOCUS_19960 15046 14135 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024245.1 protein_id gnl|my_center|LOCUS_19960 15273 15944 gene locus_tag LOCUS_19970 15273 15944 CDS product RibD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024246.1 protein_id gnl|my_center|LOCUS_19970 16393 16551 gene locus_tag LOCUS_19980 16393 16551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 16681 18624 gene locus_tag LOCUS_19990 16681 18624 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024247.1 protein_id gnl|my_center|LOCUS_19990 18621 19562 gene locus_tag LOCUS_20000 18621 19562 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024248.1 protein_id gnl|my_center|LOCUS_20000 19559 20257 gene locus_tag LOCUS_20010 19559 20257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024249.1 protein_id gnl|my_center|LOCUS_20010 20257 21735 gene locus_tag LOCUS_20020 20257 21735 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024250.1 protein_id gnl|my_center|LOCUS_20020 21754 23427 gene locus_tag LOCUS_20030 21754 23427 CDS product hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024251.1 protein_id gnl|my_center|LOCUS_20030 23438 23950 gene locus_tag LOCUS_20040 23438 23950 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024252.1 protein_id gnl|my_center|LOCUS_20040 24019 24245 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24940 25722 gene locus_tag LOCUS_20050 24940 25722 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024254.1 protein_id gnl|my_center|LOCUS_20050 26112 25741 gene locus_tag LOCUS_20060 26112 25741 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065974.1 protein_id gnl|my_center|LOCUS_20060 29150 26109 gene locus_tag LOCUS_20070 29150 26109 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024256.1 protein_id gnl|my_center|LOCUS_20070 32492 29607 gene locus_tag LOCUS_20080 32492 29607 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024257.1 protein_id gnl|my_center|LOCUS_20080 33047 34066 gene locus_tag LOCUS_20090 gene mtaA 33047 34066 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589539.1 protein_id gnl|my_center|LOCUS_20090 34473 36092 gene locus_tag LOCUS_20100 34473 36092 CDS product methylamine methyltransferase corrinoid protein reductive activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024259.1 protein_id gnl|my_center|LOCUS_20100 36173 37357 gene locus_tag LOCUS_20110 36173 37357 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066591.1 protein_id gnl|my_center|LOCUS_20110 38176 37403 gene locus_tag LOCUS_20120 38176 37403 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990699.1 protein_id gnl|my_center|LOCUS_20120 39275 41170 gene locus_tag LOCUS_20130 39275 41170 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024263.1 protein_id gnl|my_center|LOCUS_20130 41325 41588 gene locus_tag LOCUS_20140 41325 41588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 41730 41947 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42017 43432 gene locus_tag LOCUS_20150 42017 43432 CDS product TCP-1/cpn60 chaperonin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024265.1 protein_id gnl|my_center|LOCUS_20150 >Feature sequence30 370 83 gene locus_tag LOCUS_20160 370 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20160 1179 874 gene locus_tag LOCUS_20170 1179 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20170 1501 1169 gene locus_tag LOCUS_20180 1501 1169 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024224.1 protein_id gnl|my_center|LOCUS_20180 2395 1622 gene locus_tag LOCUS_20190 2395 1622 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024223.1 protein_id gnl|my_center|LOCUS_20190 3379 2549 gene locus_tag LOCUS_20200 3379 2549 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024222.1 protein_id gnl|my_center|LOCUS_20200 4179 3355 gene locus_tag LOCUS_20210 4179 3355 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024221.1 protein_id gnl|my_center|LOCUS_20210 4848 4285 gene locus_tag LOCUS_20220 4848 4285 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024220.1 protein_id gnl|my_center|LOCUS_20220 5011 5172 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5656 5731 gene locus_tag LOCUS_t00390 5656 5731 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6066 6518 gene locus_tag LOCUS_20230 6066 6518 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024219.1 protein_id gnl|my_center|LOCUS_20230 6703 7407 gene locus_tag LOCUS_20240 6703 7407 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065966.1 protein_id gnl|my_center|LOCUS_20240 7455 9434 gene locus_tag LOCUS_20250 gene feoB 7455 9434 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024217.1 protein_id gnl|my_center|LOCUS_20250 9695 9934 gene locus_tag LOCUS_20260 9695 9934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048136884.1 protein_id gnl|my_center|LOCUS_20260 10394 11356 gene locus_tag LOCUS_20270 10394 11356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065963.1 protein_id gnl|my_center|LOCUS_20270 11411 14938 gene locus_tag LOCUS_20280 gene smc 11411 14938 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024214.1 protein_id gnl|my_center|LOCUS_20280 14931 15890 gene locus_tag LOCUS_20290 14931 15890 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024213.1 protein_id gnl|my_center|LOCUS_20290 16107 16316 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16338 17138 gene locus_tag LOCUS_20300 16338 17138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 17332 17883 gene locus_tag LOCUS_20310 17332 17883 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024211.1 protein_id gnl|my_center|LOCUS_20310 18002 18919 gene locus_tag LOCUS_20320 gene aglJ 18002 18919 CDS product S-layer glycoprotein N-glycosyltransferase AglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024210.1 protein_id gnl|my_center|LOCUS_20320 19480 20382 gene locus_tag LOCUS_20330 19480 20382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020559.1 protein_id gnl|my_center|LOCUS_20330 20964 22250 gene locus_tag LOCUS_20340 gene thiC 20964 22250 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024209.1 protein_id gnl|my_center|LOCUS_20340 23651 22452 gene locus_tag LOCUS_20350 23651 22452 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065961.1 protein_id gnl|my_center|LOCUS_20350 24789 23698 gene locus_tag LOCUS_20360 24789 23698 CDS product DUF4367 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990693.1 protein_id gnl|my_center|LOCUS_20360 25952 24834 gene locus_tag LOCUS_20370 25952 24834 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024205.1 protein_id gnl|my_center|LOCUS_20370 26468 26737 gene locus_tag LOCUS_20380 26468 26737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 26948 27418 gene locus_tag LOCUS_20390 26948 27418 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_20390 27692 28564 gene locus_tag LOCUS_20400 27692 28564 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990692.1 protein_id gnl|my_center|LOCUS_20400 28680 29597 gene locus_tag LOCUS_20410 28680 29597 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024201.1 protein_id gnl|my_center|LOCUS_20410 30744 30232 gene locus_tag LOCUS_20420 30744 30232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 30858 31646 gene locus_tag LOCUS_20430 30858 31646 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024199.1 protein_id gnl|my_center|LOCUS_20430 31788 33515 gene locus_tag LOCUS_20440 31788 33515 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023883.1 protein_id gnl|my_center|LOCUS_20440 33950 34336 gene locus_tag LOCUS_20450 33950 34336 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023881.1 protein_id gnl|my_center|LOCUS_20450 34417 35298 gene locus_tag LOCUS_20460 gene speB 34417 35298 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023880.1 protein_id gnl|my_center|LOCUS_20460 35573 35394 gene locus_tag LOCUS_20470 35573 35394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065867.1 protein_id gnl|my_center|LOCUS_20470 36085 35906 gene locus_tag LOCUS_20480 36085 35906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065866.1 protein_id gnl|my_center|LOCUS_20480 36675 36439 gene locus_tag LOCUS_20490 36675 36439 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023878.1 protein_id gnl|my_center|LOCUS_20490 37179 36796 gene locus_tag LOCUS_20500 37179 36796 CDS product DUF2178 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023877.1 protein_id gnl|my_center|LOCUS_20500 38308 37952 gene locus_tag LOCUS_20510 38308 37952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 39023 38298 gene locus_tag LOCUS_20520 39023 38298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20520 39712 39020 gene locus_tag LOCUS_20530 39712 39020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20530 42005 40023 gene locus_tag LOCUS_20540 42005 40023 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023875.1 protein_id gnl|my_center|LOCUS_20540 >Feature sequence31 1351 68 gene locus_tag LOCUS_20550 1351 68 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_20550 3707 1794 gene locus_tag LOCUS_20560 3707 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065327.1 protein_id gnl|my_center|LOCUS_20560 4969 3785 gene locus_tag LOCUS_20570 4969 3785 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021091.1 protein_id gnl|my_center|LOCUS_20570 6477 5248 gene locus_tag LOCUS_20580 6477 5248 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_20580 8092 6503 gene locus_tag LOCUS_20590 8092 6503 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860105.1 protein_id gnl|my_center|LOCUS_20590 8480 8631 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8977 10188 gene locus_tag LOCUS_20600 8977 10188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 10263 10452 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10679 10482 gene locus_tag LOCUS_20610 10679 10482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 10971 11190 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12268 11774 gene locus_tag LOCUS_20620 12268 11774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 12362 12581 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15063 14239 gene locus_tag LOCUS_20630 15063 14239 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021056.1 protein_id gnl|my_center|LOCUS_20630 15508 16452 gene locus_tag LOCUS_20640 15508 16452 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022981.1 protein_id gnl|my_center|LOCUS_20640 16681 17430 gene locus_tag LOCUS_20650 16681 17430 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022982.1 protein_id gnl|my_center|LOCUS_20650 17555 17779 gene locus_tag LOCUS_20660 17555 17779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 17742 18395 gene locus_tag LOCUS_20670 17742 18395 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022990.1 protein_id gnl|my_center|LOCUS_20670 18743 21352 gene locus_tag LOCUS_20680 18743 21352 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022991.1 protein_id gnl|my_center|LOCUS_20680 22064 22432 gene locus_tag LOCUS_20690 22064 22432 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065599.1 protein_id gnl|my_center|LOCUS_20690 22907 24163 gene locus_tag LOCUS_20700 gene hmgA 22907 24163 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065600.1 protein_id gnl|my_center|LOCUS_20700 24267 24426 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25691 27331 gene locus_tag LOCUS_20710 25691 27331 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065602.1 protein_id gnl|my_center|LOCUS_20710 27318 28169 gene locus_tag LOCUS_20720 27318 28169 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023015.1 protein_id gnl|my_center|LOCUS_20720 28216 28401 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28751 29347 gene locus_tag LOCUS_20730 28751 29347 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023016.1 protein_id gnl|my_center|LOCUS_20730 29428 30000 gene locus_tag LOCUS_20740 29428 30000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023017.1 protein_id gnl|my_center|LOCUS_20740 30346 30837 gene locus_tag LOCUS_20750 30346 30837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023018.1 protein_id gnl|my_center|LOCUS_20750 30837 31349 gene locus_tag LOCUS_20760 30837 31349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023019.1 protein_id gnl|my_center|LOCUS_20760 31461 32318 gene locus_tag LOCUS_20770 31461 32318 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065603.1 protein_id gnl|my_center|LOCUS_20770 32448 34190 gene locus_tag LOCUS_20780 32448 34190 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023021.1 protein_id gnl|my_center|LOCUS_20780 34555 34760 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34791 35894 gene locus_tag LOCUS_20790 34791 35894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 35960 36850 gene locus_tag LOCUS_20800 35960 36850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 37137 36946 gene locus_tag LOCUS_20810 37137 36946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011032363.1 protein_id gnl|my_center|LOCUS_20810 38256 37321 gene locus_tag LOCUS_20820 gene hacA 38256 37321 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066440.1 protein_id gnl|my_center|LOCUS_20820 38350 38571 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38753 38986 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39166 39411 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40015 40269 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence32 1438 1121 gene locus_tag LOCUS_20830 1438 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 1647 2066 gene locus_tag LOCUS_20840 1647 2066 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023052.1 protein_id gnl|my_center|LOCUS_20840 2314 2535 gene locus_tag LOCUS_20850 2314 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021736.1 protein_id gnl|my_center|LOCUS_20850 2944 2696 gene locus_tag LOCUS_20860 2944 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021738.1 protein_id gnl|my_center|LOCUS_20860 4168 3185 gene locus_tag LOCUS_20870 4168 3185 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023440.1 protein_id gnl|my_center|LOCUS_20870 4317 5603 gene locus_tag LOCUS_20880 4317 5603 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066507.1 protein_id gnl|my_center|LOCUS_20880 6537 5728 gene locus_tag LOCUS_20890 6537 5728 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023442.1 protein_id gnl|my_center|LOCUS_20890 7144 9471 gene locus_tag LOCUS_20900 7144 9471 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023443.1 protein_id gnl|my_center|LOCUS_20900 9654 9905 gene locus_tag LOCUS_20910 9654 9905 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023444.1 protein_id gnl|my_center|LOCUS_20910 10223 10900 gene locus_tag LOCUS_20920 10223 10900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 11041 11226 gene locus_tag LOCUS_20930 11041 11226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 11394 12104 gene locus_tag LOCUS_20940 11394 12104 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589527.1 protein_id gnl|my_center|LOCUS_20940 13413 12733 gene locus_tag LOCUS_20950 13413 12733 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023459.1 protein_id gnl|my_center|LOCUS_20950 16109 13560 gene locus_tag LOCUS_20960 16109 13560 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086596.1 protein_id gnl|my_center|LOCUS_20960 17758 16781 gene locus_tag LOCUS_20970 gene radA 17758 16781 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023460.1 protein_id gnl|my_center|LOCUS_20970 18109 18579 gene locus_tag LOCUS_20980 18109 18579 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023461.1 protein_id gnl|my_center|LOCUS_20980 18653 18985 gene locus_tag LOCUS_20990 18653 18985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023462.1 protein_id gnl|my_center|LOCUS_20990 19000 19833 gene locus_tag LOCUS_21000 19000 19833 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023463.1 protein_id gnl|my_center|LOCUS_21000 20469 20173 gene locus_tag LOCUS_21010 20469 20173 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990654.1 protein_id gnl|my_center|LOCUS_21010 22275 20914 gene locus_tag LOCUS_21020 22275 20914 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023466.1 protein_id gnl|my_center|LOCUS_21020 23069 22287 gene locus_tag LOCUS_21030 gene cbiQ 23069 22287 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065744.1 protein_id gnl|my_center|LOCUS_21030 23551 23267 gene locus_tag LOCUS_21040 23551 23267 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023468.1 protein_id gnl|my_center|LOCUS_21040 24255 23548 gene locus_tag LOCUS_21050 24255 23548 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023469.1 protein_id gnl|my_center|LOCUS_21050 25441 24968 gene locus_tag LOCUS_21060 25441 24968 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023470.1 protein_id gnl|my_center|LOCUS_21060 28243 25634 gene locus_tag LOCUS_21070 28243 25634 CDS product S-layer protein domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023471.1 protein_id gnl|my_center|LOCUS_21070 28816 30180 gene locus_tag LOCUS_21080 gene cca 28816 30180 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023473.1 protein_id gnl|my_center|LOCUS_21080 32150 30270 gene locus_tag LOCUS_21090 32150 30270 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214431.1 protein_id gnl|my_center|LOCUS_21090 32659 32147 gene locus_tag LOCUS_21100 32659 32147 CDS product threonine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032693520.1 protein_id gnl|my_center|LOCUS_21100 33648 32647 gene locus_tag LOCUS_21110 33648 32647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127329.1 protein_id gnl|my_center|LOCUS_21110 >Feature sequence33 474 106 gene locus_tag LOCUS_21120 474 106 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020176.1 protein_id gnl|my_center|LOCUS_21120 1444 653 gene locus_tag LOCUS_21130 1444 653 CDS product archaetidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020175.1 protein_id gnl|my_center|LOCUS_21130 2070 1447 gene locus_tag LOCUS_21140 2070 1447 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020174.1 protein_id gnl|my_center|LOCUS_21140 2945 2076 gene locus_tag LOCUS_21150 gene artA 2945 2076 CDS product archaeosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064816.1 protein_id gnl|my_center|LOCUS_21150 3721 4137 gene locus_tag LOCUS_21160 3721 4137 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020172.1 protein_id gnl|my_center|LOCUS_21160 4142 4429 gene locus_tag LOCUS_21170 4142 4429 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020171.1 protein_id gnl|my_center|LOCUS_21170 4727 5464 gene locus_tag LOCUS_21180 4727 5464 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020169.1 protein_id gnl|my_center|LOCUS_21180 5470 6552 gene locus_tag LOCUS_21190 gene priL 5470 6552 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020168.1 protein_id gnl|my_center|LOCUS_21190 7957 6638 gene locus_tag LOCUS_21200 7957 6638 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064814.1 protein_id gnl|my_center|LOCUS_21200 8524 8833 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9264 9055 gene locus_tag LOCUS_21210 9264 9055 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011033303.1 protein_id gnl|my_center|LOCUS_21210 9527 9321 gene locus_tag LOCUS_21220 9527 9321 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011033302.1 protein_id gnl|my_center|LOCUS_21220 10097 10171 gene locus_tag LOCUS_t00400 10097 10171 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 10378 11565 gene locus_tag LOCUS_21230 gene mfnA 10378 11565 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020065.1 protein_id gnl|my_center|LOCUS_21230 12222 13316 gene locus_tag LOCUS_21240 12222 13316 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020066.1 protein_id gnl|my_center|LOCUS_21240 13904 15364 gene locus_tag LOCUS_21250 13904 15364 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020067.1 protein_id gnl|my_center|LOCUS_21250 16978 16187 gene locus_tag LOCUS_21260 gene fhcD 16978 16187 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020069.1 protein_id gnl|my_center|LOCUS_21260 18016 17537 gene locus_tag LOCUS_21270 18016 17537 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020070.1 protein_id gnl|my_center|LOCUS_21270 18785 18147 gene locus_tag LOCUS_21280 18785 18147 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020071.1 protein_id gnl|my_center|LOCUS_21280 19680 18751 gene locus_tag LOCUS_21290 19680 18751 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020072.1 protein_id gnl|my_center|LOCUS_21290 21607 19766 gene locus_tag LOCUS_21300 21607 19766 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990710.1 protein_id gnl|my_center|LOCUS_21300 22594 22229 gene locus_tag LOCUS_21310 22594 22229 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064788.1 protein_id gnl|my_center|LOCUS_21310 23432 23806 gene locus_tag LOCUS_21320 23432 23806 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020077.1 protein_id gnl|my_center|LOCUS_21320 24063 26141 gene locus_tag LOCUS_21330 24063 26141 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990711.1 protein_id gnl|my_center|LOCUS_21330 26417 26929 gene locus_tag LOCUS_21340 26417 26929 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020079.1 protein_id gnl|my_center|LOCUS_21340 27500 27949 gene locus_tag LOCUS_21350 27500 27949 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066044.1 protein_id gnl|my_center|LOCUS_21350 28182 29168 gene locus_tag LOCUS_21360 28182 29168 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020082.1 protein_id gnl|my_center|LOCUS_21360 29188 29405 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29528 30292 gene locus_tag LOCUS_21370 29528 30292 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_21370 30276 31154 gene locus_tag LOCUS_21380 30276 31154 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_21380 31651 32106 gene locus_tag LOCUS_21390 31651 32106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020085.1 protein_id gnl|my_center|LOCUS_21390 >Feature sequence34 284 511 gene locus_tag LOCUS_21400 284 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 852 1604 gene locus_tag LOCUS_21410 852 1604 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021999.1 protein_id gnl|my_center|LOCUS_21410 1618 2352 gene locus_tag LOCUS_21420 1618 2352 CDS product DUF2119 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082089005.1 protein_id gnl|my_center|LOCUS_21420 3294 2458 gene locus_tag LOCUS_21430 3294 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 3318 3447 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4260 3772 gene locus_tag LOCUS_21440 4260 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 6175 4532 gene locus_tag LOCUS_21450 gene thsA 6175 4532 CDS product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021686.1 protein_id gnl|my_center|LOCUS_21450 7114 6416 gene locus_tag LOCUS_21460 gene rpiA 7114 6416 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021687.1 protein_id gnl|my_center|LOCUS_21460 8498 7164 gene locus_tag LOCUS_21470 gene aspS 8498 7164 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021688.1 protein_id gnl|my_center|LOCUS_21470 9157 10848 gene locus_tag LOCUS_21480 9157 10848 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022623.1 protein_id gnl|my_center|LOCUS_21480 14250 11374 gene locus_tag LOCUS_21490 14250 11374 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021742.1 protein_id gnl|my_center|LOCUS_21490 16877 14529 gene locus_tag LOCUS_21500 16877 14529 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021742.1 protein_id gnl|my_center|LOCUS_21500 17662 17393 gene locus_tag LOCUS_21510 17662 17393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21510 18308 18021 gene locus_tag LOCUS_21520 18308 18021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21520 19845 18256 gene locus_tag LOCUS_21530 19845 18256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21530 20565 22022 gene locus_tag LOCUS_21540 20565 22022 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066384.1 protein_id gnl|my_center|LOCUS_21540 23006 22086 gene locus_tag LOCUS_21550 23006 22086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065193.1 protein_id gnl|my_center|LOCUS_21550 23318 24382 gene locus_tag LOCUS_21560 gene corA 23318 24382 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021725.1 protein_id gnl|my_center|LOCUS_21560 24589 25332 gene locus_tag LOCUS_21570 24589 25332 CDS product DUF432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021723.1 protein_id gnl|my_center|LOCUS_21570 25335 26252 gene locus_tag LOCUS_21580 25335 26252 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990806.1 protein_id gnl|my_center|LOCUS_21580 26389 28365 gene locus_tag LOCUS_21590 26389 28365 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021871.1 protein_id gnl|my_center|LOCUS_21590 29112 29447 gene locus_tag LOCUS_21600 29112 29447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048170416.1 protein_id gnl|my_center|LOCUS_21600 29966 30865 gene locus_tag LOCUS_21610 29966 30865 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990819.1 protein_id gnl|my_center|LOCUS_21610 31489 31097 gene locus_tag LOCUS_21620 31489 31097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 >Feature sequence35 1145 345 gene locus_tag LOCUS_21630 1145 345 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020906.1 protein_id gnl|my_center|LOCUS_21630 3461 1239 gene locus_tag LOCUS_21640 3461 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21640 3878 3492 gene locus_tag LOCUS_21650 3878 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21650 3909 4121 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4478 4671 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5024 6061 gene locus_tag LOCUS_21660 gene mtaA 5024 6061 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023521.1 protein_id gnl|my_center|LOCUS_21660 6752 6231 gene locus_tag LOCUS_21670 6752 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066347.1 protein_id gnl|my_center|LOCUS_21670 7125 8075 gene locus_tag LOCUS_21680 gene pheA 7125 8075 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066451.1 protein_id gnl|my_center|LOCUS_21680 8139 9026 gene locus_tag LOCUS_21690 8139 9026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860288.1 protein_id gnl|my_center|LOCUS_21690 9204 10178 gene locus_tag LOCUS_21700 9204 10178 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023086.1 protein_id gnl|my_center|LOCUS_21700 10305 11186 gene locus_tag LOCUS_21710 10305 11186 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023085.1 protein_id gnl|my_center|LOCUS_21710 11190 13067 gene locus_tag LOCUS_21720 11190 13067 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023084.1 protein_id gnl|my_center|LOCUS_21720 13064 15556 gene locus_tag LOCUS_21730 13064 15556 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023083.1 protein_id gnl|my_center|LOCUS_21730 16346 15798 gene locus_tag LOCUS_21740 16346 15798 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023081.1 protein_id gnl|my_center|LOCUS_21740 16952 16716 gene locus_tag LOCUS_21750 16952 16716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 16956 17172 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18723 18307 gene locus_tag LOCUS_21760 18723 18307 CDS product tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065620.1 protein_id gnl|my_center|LOCUS_21760 19246 18776 gene locus_tag LOCUS_21770 19246 18776 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023076.1 protein_id gnl|my_center|LOCUS_21770 19961 19365 gene locus_tag LOCUS_21780 19961 19365 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023075.1 protein_id gnl|my_center|LOCUS_21780 20448 19966 gene locus_tag LOCUS_21790 20448 19966 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023074.1 protein_id gnl|my_center|LOCUS_21790 21226 20579 gene locus_tag LOCUS_21800 21226 20579 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065619.1 protein_id gnl|my_center|LOCUS_21800 23056 21608 gene locus_tag LOCUS_21810 23056 21608 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021220.1 protein_id gnl|my_center|LOCUS_21810 24779 25109 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26134 25193 gene locus_tag LOCUS_21820 26134 25193 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065056.1 protein_id gnl|my_center|LOCUS_21820 26575 27846 gene locus_tag LOCUS_21830 26575 27846 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065055.1 protein_id gnl|my_center|LOCUS_21830 27938 28396 gene locus_tag LOCUS_21840 27938 28396 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021215.1 protein_id gnl|my_center|LOCUS_21840 28660 30426 gene locus_tag LOCUS_21850 28660 30426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 >Feature sequence36 451 780 gene locus_tag LOCUS_21860 451 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 1611 1258 gene locus_tag LOCUS_21870 1611 1258 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064993.1 protein_id gnl|my_center|LOCUS_21870 2003 1683 gene locus_tag LOCUS_21880 2003 1683 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020942.1 protein_id gnl|my_center|LOCUS_21880 3469 2297 gene locus_tag LOCUS_21890 3469 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064994.1 protein_id gnl|my_center|LOCUS_21890 3636 5615 gene locus_tag LOCUS_21900 3636 5615 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064995.1 protein_id gnl|my_center|LOCUS_21900 5706 6068 gene locus_tag LOCUS_21910 gene hisI 5706 6068 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020946.1 protein_id gnl|my_center|LOCUS_21910 6309 8234 gene locus_tag LOCUS_21920 6309 8234 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020947.1 protein_id gnl|my_center|LOCUS_21920 9718 9491 gene locus_tag LOCUS_21930 9718 9491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 9672 10193 gene locus_tag LOCUS_21940 9672 10193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 11415 12023 gene locus_tag LOCUS_21950 gene hisH 11415 12023 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020951.1 protein_id gnl|my_center|LOCUS_21950 12334 13659 gene locus_tag LOCUS_21960 12334 13659 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066157.1 protein_id gnl|my_center|LOCUS_21960 15053 13749 gene locus_tag LOCUS_21970 15053 13749 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020953.1 protein_id gnl|my_center|LOCUS_21970 15954 15172 gene locus_tag LOCUS_21980 15954 15172 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020954.1 protein_id gnl|my_center|LOCUS_21980 16554 18686 gene locus_tag LOCUS_21990 16554 18686 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064996.1 protein_id gnl|my_center|LOCUS_21990 19634 19020 gene locus_tag LOCUS_22000 19634 19020 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020957.1 protein_id gnl|my_center|LOCUS_22000 20293 19793 gene locus_tag LOCUS_22010 20293 19793 CDS product NOB1 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066159.1 protein_id gnl|my_center|LOCUS_22010 21637 20948 gene locus_tag LOCUS_22020 21637 20948 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064997.1 protein_id gnl|my_center|LOCUS_22020 22255 21929 gene locus_tag LOCUS_22030 22255 21929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020960.1 protein_id gnl|my_center|LOCUS_22030 22779 23156 gene locus_tag LOCUS_22040 22779 23156 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020961.1 protein_id gnl|my_center|LOCUS_22040 23232 23723 gene locus_tag LOCUS_22050 23232 23723 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020962.1 protein_id gnl|my_center|LOCUS_22050 23803 24984 gene locus_tag LOCUS_22060 23803 24984 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020963.1 protein_id gnl|my_center|LOCUS_22060 25432 25696 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25773 26006 gene locus_tag LOCUS_22070 25773 26006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 26088 26342 gene locus_tag LOCUS_22080 26088 26342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 26629 26895 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27788 28471 gene locus_tag LOCUS_22090 27788 28471 CDS product DUF5591 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020965.1 protein_id gnl|my_center|LOCUS_22090 29345 28692 gene locus_tag LOCUS_22100 29345 28692 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020578.1 protein_id gnl|my_center|LOCUS_22100 >Feature sequence37 713 93 gene locus_tag LOCUS_22110 713 93 CDS product S-layer protein domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064946.1 protein_id gnl|my_center|LOCUS_22110 1674 697 gene locus_tag LOCUS_22120 1674 697 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020721.1 protein_id gnl|my_center|LOCUS_22120 1733 1879 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3405 1924 gene locus_tag LOCUS_22130 3405 1924 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020720.1 protein_id gnl|my_center|LOCUS_22130 5144 3429 gene locus_tag LOCUS_22140 gene oadA 5144 3429 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020719.1 protein_id gnl|my_center|LOCUS_22140 6533 5577 gene locus_tag LOCUS_22150 6533 5577 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020718.1 protein_id gnl|my_center|LOCUS_22150 7164 7373 gene locus_tag LOCUS_22160 7164 7373 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020717.1 protein_id gnl|my_center|LOCUS_22160 7747 7484 gene locus_tag LOCUS_22170 7747 7484 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020716.1 protein_id gnl|my_center|LOCUS_22170 8704 8183 gene locus_tag LOCUS_22180 8704 8183 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064945.1 protein_id gnl|my_center|LOCUS_22180 9831 8821 gene locus_tag LOCUS_22190 9831 8821 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064944.1 protein_id gnl|my_center|LOCUS_22190 10474 10025 gene locus_tag LOCUS_22200 10474 10025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020620.1 protein_id gnl|my_center|LOCUS_22200 11270 10512 gene locus_tag LOCUS_22210 11270 10512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065938.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22210 13061 12516 gene locus_tag LOCUS_22220 gene thpR 13061 12516 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066123.1 protein_id gnl|my_center|LOCUS_22220 13598 14473 gene locus_tag LOCUS_22230 13598 14473 CDS product diadenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064938.1 protein_id gnl|my_center|LOCUS_22230 14647 15366 gene locus_tag LOCUS_22240 14647 15366 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064937.1 protein_id gnl|my_center|LOCUS_22240 15391 15545 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16988 15717 gene locus_tag LOCUS_22250 16988 15717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 18498 17446 gene locus_tag LOCUS_22260 18498 17446 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020699.1 protein_id gnl|my_center|LOCUS_22260 20918 18495 gene locus_tag LOCUS_22270 gene rqcH 20918 18495 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020698.1 protein_id gnl|my_center|LOCUS_22270 21651 21013 gene locus_tag LOCUS_22280 21651 21013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 22376 23641 gene locus_tag LOCUS_22290 gene priS 22376 23641 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020695.1 protein_id gnl|my_center|LOCUS_22290 23607 24269 gene locus_tag LOCUS_22300 23607 24269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064936.1 protein_id gnl|my_center|LOCUS_22300 24897 25175 gene locus_tag LOCUS_22310 24897 25175 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020693.1 protein_id gnl|my_center|LOCUS_22310 25182 25370 gene locus_tag LOCUS_22320 25182 25370 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020692.1 protein_id gnl|my_center|LOCUS_22320 25443 26249 gene locus_tag LOCUS_22330 25443 26249 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064935.1 protein_id gnl|my_center|LOCUS_22330 26421 27191 gene locus_tag LOCUS_22340 26421 27191 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020689.1 protein_id gnl|my_center|LOCUS_22340 27302 28690 gene locus_tag LOCUS_22350 27302 28690 CDS product endonuclease Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020688.1 protein_id gnl|my_center|LOCUS_22350 28815 28900 gene locus_tag LOCUS_t00410 28815 28900 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence38 1317 1528 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3935 1641 gene locus_tag LOCUS_22360 3935 1641 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022836.1 protein_id gnl|my_center|LOCUS_22360 7327 4184 gene locus_tag LOCUS_22370 7327 4184 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022836.1 protein_id gnl|my_center|LOCUS_22370 9650 8064 gene locus_tag LOCUS_22380 9650 8064 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022838.1 protein_id gnl|my_center|LOCUS_22380 11359 9647 gene locus_tag LOCUS_22390 11359 9647 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022839.1 protein_id gnl|my_center|LOCUS_22390 11934 11740 gene locus_tag LOCUS_22400 11934 11740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 12318 12494 gene locus_tag LOCUS_22410 12318 12494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066422.1 protein_id gnl|my_center|LOCUS_22410 14005 12740 gene locus_tag LOCUS_22420 14005 12740 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022842.1 protein_id gnl|my_center|LOCUS_22420 14392 16725 gene locus_tag LOCUS_22430 14392 16725 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022843.1 protein_id gnl|my_center|LOCUS_22430 19261 18458 gene locus_tag LOCUS_22440 19261 18458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 19662 20771 gene locus_tag LOCUS_22450 19662 20771 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022844.1 protein_id gnl|my_center|LOCUS_22450 21050 22957 gene locus_tag LOCUS_22460 21050 22957 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022845.1 protein_id gnl|my_center|LOCUS_22460 23413 25605 gene locus_tag LOCUS_22470 23413 25605 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022846.1 protein_id gnl|my_center|LOCUS_22470 26430 26023 gene locus_tag LOCUS_22480 26430 26023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 26675 27574 gene locus_tag LOCUS_22490 26675 27574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022849.1 protein_id gnl|my_center|LOCUS_22490 27813 27604 gene locus_tag LOCUS_22500 27813 27604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 27853 28107 gene locus_tag LOCUS_22510 27853 28107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 >Feature sequence39 1598 2374 gene locus_tag LOCUS_22520 gene mtaC 1598 2374 CDS product methanol--corrinoid protein MtaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024270.1 protein_id gnl|my_center|LOCUS_22520 2388 3776 gene locus_tag LOCUS_22530 gene mtaB 2388 3776 CDS product methanol--corrinoid protein co-methyltransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024271.1 protein_id gnl|my_center|LOCUS_22530 4239 6167 gene locus_tag LOCUS_22540 4239 6167 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065978.1 protein_id gnl|my_center|LOCUS_22540 6316 7101 gene locus_tag LOCUS_22550 6316 7101 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024276.1 protein_id gnl|my_center|LOCUS_22550 7443 8231 gene locus_tag LOCUS_22560 7443 8231 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024277.1 protein_id gnl|my_center|LOCUS_22560 8723 8902 gene locus_tag LOCUS_22570 8723 8902 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020514.1 protein_id gnl|my_center|LOCUS_22570 9483 9007 gene locus_tag LOCUS_22580 9483 9007 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020513.1 protein_id gnl|my_center|LOCUS_22580 9695 9840 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11027 10098 gene locus_tag LOCUS_22590 11027 10098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 12712 11312 gene locus_tag LOCUS_22600 12712 11312 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257976.1 protein_id gnl|my_center|LOCUS_22600 13664 12735 gene locus_tag LOCUS_22610 13664 12735 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403373.1 protein_id gnl|my_center|LOCUS_22610 13829 15859 gene locus_tag LOCUS_22620 13829 15859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 16794 19586 gene locus_tag LOCUS_22630 16794 19586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 20528 19878 gene locus_tag LOCUS_22640 20528 19878 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020502.1 protein_id gnl|my_center|LOCUS_22640 21156 20938 gene locus_tag LOCUS_22650 21156 20938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 21951 24164 gene locus_tag LOCUS_22660 21951 24164 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990716.1 protein_id gnl|my_center|LOCUS_22660 24512 24294 gene locus_tag LOCUS_22670 24512 24294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 24736 24509 gene locus_tag LOCUS_22680 24736 24509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 25939 24884 gene locus_tag LOCUS_22690 25939 24884 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020227.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22690 26292 25960 gene locus_tag LOCUS_22700 26292 25960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22700 >Feature sequence40 112 1056 gene locus_tag LOCUS_22710 112 1056 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990755.1 protein_id gnl|my_center|LOCUS_22710 2151 1180 gene locus_tag LOCUS_22720 2151 1180 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064967.1 protein_id gnl|my_center|LOCUS_22720 2965 2183 gene locus_tag LOCUS_22730 2965 2183 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990756.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22730 4304 3429 gene locus_tag LOCUS_22740 4304 3429 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020838.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22740 5685 5832 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5983 6927 gene locus_tag LOCUS_22750 5983 6927 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020839.1 protein_id gnl|my_center|LOCUS_22750 7172 6945 gene locus_tag LOCUS_22760 7172 6945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22760 7279 7124 gene locus_tag LOCUS_22770 7279 7124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22770 9133 7394 gene locus_tag LOCUS_22780 9133 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021330.1 protein_id gnl|my_center|LOCUS_22780 9892 9275 gene locus_tag LOCUS_22790 9892 9275 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023847.1 protein_id gnl|my_center|LOCUS_22790 11635 10916 gene locus_tag LOCUS_22800 11635 10916 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064968.1 protein_id gnl|my_center|LOCUS_22800 12740 11607 gene locus_tag LOCUS_22810 12740 11607 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020842.1 protein_id gnl|my_center|LOCUS_22810 14374 17184 gene locus_tag LOCUS_22820 gene acnA 14374 17184 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020308.1 protein_id gnl|my_center|LOCUS_22820 17602 18675 gene locus_tag LOCUS_22830 17602 18675 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020307.1 protein_id gnl|my_center|LOCUS_22830 18847 18980 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19202 20470 gene locus_tag LOCUS_22840 19202 20470 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020304.1 protein_id gnl|my_center|LOCUS_22840 20514 21719 gene locus_tag LOCUS_22850 20514 21719 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020303.1 protein_id gnl|my_center|LOCUS_22850 21706 22143 gene locus_tag LOCUS_22860 21706 22143 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020302.1 protein_id gnl|my_center|LOCUS_22860 22190 22345 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22451 23563 gene locus_tag LOCUS_22870 22451 23563 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020301.1 protein_id gnl|my_center|LOCUS_22870 23594 24736 gene locus_tag LOCUS_22880 23594 24736 CDS product TIGR04013 family B12-binding domain/radical SAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020300.1 protein_id gnl|my_center|LOCUS_22880 >Feature sequence41 78 557 gene locus_tag LOCUS_22890 78 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 595 1113 gene locus_tag LOCUS_22900 595 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 2359 1400 gene locus_tag LOCUS_22910 2359 1400 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020723.1 protein_id gnl|my_center|LOCUS_22910 3012 2389 gene locus_tag LOCUS_22920 3012 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066125.1 protein_id gnl|my_center|LOCUS_22920 3466 3176 gene locus_tag LOCUS_22930 3466 3176 CDS product DUF424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020725.1 protein_id gnl|my_center|LOCUS_22930 5708 3603 gene locus_tag LOCUS_22940 5708 3603 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020726.1 protein_id gnl|my_center|LOCUS_22940 6582 5860 gene locus_tag LOCUS_22950 6582 5860 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064947.1 protein_id gnl|my_center|LOCUS_22950 6838 6641 gene locus_tag LOCUS_22960 6838 6641 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020728.1 protein_id gnl|my_center|LOCUS_22960 7137 7520 gene locus_tag LOCUS_22970 7137 7520 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020729.1 protein_id gnl|my_center|LOCUS_22970 7783 7986 gene locus_tag LOCUS_22980 7783 7986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 8210 8887 gene locus_tag LOCUS_22990 8210 8887 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064948.1 protein_id gnl|my_center|LOCUS_22990 9370 10152 gene locus_tag LOCUS_23000 9370 10152 CDS product disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064949.1 protein_id gnl|my_center|LOCUS_23000 10157 11386 gene locus_tag LOCUS_23010 10157 11386 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020733.1 protein_id gnl|my_center|LOCUS_23010 11486 12127 gene locus_tag LOCUS_23020 11486 12127 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020734.1 protein_id gnl|my_center|LOCUS_23020 12120 12740 gene locus_tag LOCUS_23030 12120 12740 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020735.1 protein_id gnl|my_center|LOCUS_23030 12994 14118 gene locus_tag LOCUS_23040 12994 14118 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064950.1 protein_id gnl|my_center|LOCUS_23040 14260 15435 gene locus_tag LOCUS_23050 14260 15435 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020737.1 protein_id gnl|my_center|LOCUS_23050 16271 17410 gene locus_tag LOCUS_23060 16271 17410 CDS product methanogenesis marker 9 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020738.1 protein_id gnl|my_center|LOCUS_23060 17397 18437 gene locus_tag LOCUS_23070 17397 18437 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020739.1 protein_id gnl|my_center|LOCUS_23070 18434 19072 gene locus_tag LOCUS_23080 18434 19072 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020740.1 protein_id gnl|my_center|LOCUS_23080 19412 19990 gene locus_tag LOCUS_23090 19412 19990 CDS product dihydromethanopterin reductase (acceptor) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020741.1 protein_id gnl|my_center|LOCUS_23090 21707 20166 gene locus_tag LOCUS_23100 21707 20166 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048142299.1 protein_id gnl|my_center|LOCUS_23100 22121 23323 gene locus_tag LOCUS_23110 22121 23323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 >Feature sequence42 1212 3170 gene locus_tag LOCUS_23120 1212 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 3650 4951 gene locus_tag LOCUS_23130 3650 4951 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022225.1 protein_id gnl|my_center|LOCUS_23130 5513 5340 gene locus_tag LOCUS_23140 5513 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 7257 5764 gene locus_tag LOCUS_23150 7257 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022222.1 protein_id gnl|my_center|LOCUS_23150 7770 8027 gene locus_tag LOCUS_23160 7770 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 7969 10290 gene locus_tag LOCUS_23170 7969 10290 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022220.1 protein_id gnl|my_center|LOCUS_23170 10899 11747 gene locus_tag LOCUS_23180 10899 11747 CDS product DUF2099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022219.1 protein_id gnl|my_center|LOCUS_23180 12126 11959 gene locus_tag LOCUS_23190 12126 11959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 12724 12359 gene locus_tag LOCUS_23200 12724 12359 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990834.1 protein_id gnl|my_center|LOCUS_23200 12971 14563 gene locus_tag LOCUS_23210 12971 14563 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022183.1 protein_id gnl|my_center|LOCUS_23210 14630 16303 gene locus_tag LOCUS_23220 14630 16303 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022182.1 protein_id gnl|my_center|LOCUS_23220 16406 16577 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17444 16632 gene locus_tag LOCUS_23230 17444 16632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022177.1 protein_id gnl|my_center|LOCUS_23230 17604 17452 gene locus_tag LOCUS_23240 17604 17452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 18193 17792 gene locus_tag LOCUS_23250 18193 17792 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021683.1 protein_id gnl|my_center|LOCUS_23250 18547 19287 gene locus_tag LOCUS_23260 18547 19287 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022254.1 protein_id gnl|my_center|LOCUS_23260 19528 20922 gene locus_tag LOCUS_23270 19528 20922 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065351.1 protein_id gnl|my_center|LOCUS_23270 20957 22321 gene locus_tag LOCUS_23280 20957 22321 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065350.1 protein_id gnl|my_center|LOCUS_23280 22515 23021 gene locus_tag LOCUS_23290 22515 23021 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022249.1 protein_id gnl|my_center|LOCUS_23290 >Feature sequence43 180 4 gene locus_tag LOCUS_23300 180 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 833 426 gene locus_tag LOCUS_23310 833 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 1815 2582 gene locus_tag LOCUS_23320 1815 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022686.1 protein_id gnl|my_center|LOCUS_23320 3182 2916 gene locus_tag LOCUS_23330 3182 2916 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021018.1 protein_id gnl|my_center|LOCUS_23330 3396 3172 gene locus_tag LOCUS_23340 3396 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065017.1 protein_id gnl|my_center|LOCUS_23340 3598 3311 gene locus_tag LOCUS_23350 3598 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 5117 3708 gene locus_tag LOCUS_23360 gene gltA 5117 3708 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023687.1 protein_id gnl|my_center|LOCUS_23360 5980 5135 gene locus_tag LOCUS_23370 5980 5135 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065799.1 protein_id gnl|my_center|LOCUS_23370 6596 6736 gene locus_tag LOCUS_23380 6596 6736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 6812 6949 gene locus_tag LOCUS_23390 6812 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 7178 8554 gene locus_tag LOCUS_23400 7178 8554 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860339.1 protein_id gnl|my_center|LOCUS_23400 10258 8795 gene locus_tag LOCUS_23410 10258 8795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 11029 12153 gene locus_tag LOCUS_23420 gene gmd 11029 12153 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066186.1 protein_id gnl|my_center|LOCUS_23420 12215 13153 gene locus_tag LOCUS_23430 12215 13153 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_23430 13262 14110 gene locus_tag LOCUS_23440 13262 14110 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_23440 14111 15421 gene locus_tag LOCUS_23450 14111 15421 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679021.1 protein_id gnl|my_center|LOCUS_23450 15559 16548 gene locus_tag LOCUS_23460 15559 16548 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050431.1 protein_id gnl|my_center|LOCUS_23460 17083 18066 gene locus_tag LOCUS_23470 17083 18066 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_23470 18029 18976 gene locus_tag LOCUS_23480 18029 18976 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_23480 19358 19819 gene locus_tag LOCUS_23490 19358 19819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 20178 21563 gene locus_tag LOCUS_23500 20178 21563 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257983.1 protein_id gnl|my_center|LOCUS_23500 21805 21965 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence44 805 287 gene locus_tag LOCUS_23510 805 287 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023175.1 protein_id gnl|my_center|LOCUS_23510 2398 878 gene locus_tag LOCUS_23520 2398 878 CDS product AMP phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023176.1 protein_id gnl|my_center|LOCUS_23520 2774 2902 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3468 3004 gene locus_tag LOCUS_23530 3468 3004 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021483.1 protein_id gnl|my_center|LOCUS_23530 7891 3461 gene locus_tag LOCUS_23540 7891 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 10330 8267 gene locus_tag LOCUS_23550 gene brxL 10330 8267 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022338.1 protein_id gnl|my_center|LOCUS_23550 13092 10393 gene locus_tag LOCUS_23560 gene pglZ 13092 10393 CDS product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022339.1 protein_id gnl|my_center|LOCUS_23560 13564 13406 gene locus_tag LOCUS_23570 13564 13406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 14534 13641 gene locus_tag LOCUS_23580 14534 13641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 14917 15026 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15769 15215 gene locus_tag LOCUS_23590 15769 15215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107054.1 protein_id gnl|my_center|LOCUS_23590 15915 15772 gene locus_tag LOCUS_23600 15915 15772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 16468 16334 gene locus_tag LOCUS_23610 16468 16334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 17948 16458 gene locus_tag LOCUS_23620 17948 16458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 18370 17921 gene locus_tag LOCUS_23630 18370 17921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 20429 18363 gene locus_tag LOCUS_23640 20429 18363 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679308.1 protein_id gnl|my_center|LOCUS_23640 21475 20450 gene locus_tag LOCUS_23650 21475 20450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 >Feature sequence45 454 906 gene locus_tag LOCUS_23660 454 906 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020220.1 protein_id gnl|my_center|LOCUS_23660 1107 1646 gene locus_tag LOCUS_23670 1107 1646 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020220.1 protein_id gnl|my_center|LOCUS_23670 1695 2132 gene locus_tag LOCUS_23680 1695 2132 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020220.1 protein_id gnl|my_center|LOCUS_23680 2714 3835 gene locus_tag LOCUS_23690 2714 3835 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020144.1 protein_id gnl|my_center|LOCUS_23690 5741 4095 gene locus_tag LOCUS_23700 gene thsB 5741 4095 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020145.1 protein_id gnl|my_center|LOCUS_23700 6966 6193 gene locus_tag LOCUS_23710 6966 6193 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064805.1 protein_id gnl|my_center|LOCUS_23710 8629 7010 gene locus_tag LOCUS_23720 gene sepS 8629 7010 CDS product O-phosphoserine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020149.1 protein_id gnl|my_center|LOCUS_23720 9645 9019 gene locus_tag LOCUS_23730 9645 9019 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020150.1 protein_id gnl|my_center|LOCUS_23730 10480 10208 gene locus_tag LOCUS_23740 10480 10208 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064806.1 protein_id gnl|my_center|LOCUS_23740 10738 11406 gene locus_tag LOCUS_23750 10738 11406 CDS product Sjogren's syndrome/scleroderma autoantigen 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066053.1 protein_id gnl|my_center|LOCUS_23750 13998 11527 gene locus_tag LOCUS_23760 13998 11527 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020155.1 protein_id gnl|my_center|LOCUS_23760 16058 14220 gene locus_tag LOCUS_23770 gene glyS 16058 14220 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020156.1 protein_id gnl|my_center|LOCUS_23770 16313 16555 gene locus_tag LOCUS_23780 16313 16555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 17082 17264 gene locus_tag LOCUS_23790 17082 17264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 17584 18375 gene locus_tag LOCUS_23800 gene surE 17584 18375 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020163.1 protein_id gnl|my_center|LOCUS_23800 19529 18525 gene locus_tag LOCUS_23810 19529 18525 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066126.1 protein_id gnl|my_center|LOCUS_23810 >Feature sequence46 512 1354 gene locus_tag LOCUS_23820 512 1354 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963967.1 protein_id gnl|my_center|LOCUS_23820 1691 2815 gene locus_tag LOCUS_23830 1691 2815 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949066.1 protein_id gnl|my_center|LOCUS_23830 3046 3387 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3714 3514 gene locus_tag LOCUS_23840 3714 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 3769 3888 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4412 5347 gene locus_tag LOCUS_23850 4412 5347 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256476.1 protein_id gnl|my_center|LOCUS_23850 5611 6090 gene locus_tag LOCUS_23860 5611 6090 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022308.1 protein_id gnl|my_center|LOCUS_23860 7220 6153 gene locus_tag LOCUS_23870 7220 6153 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022231.1 protein_id gnl|my_center|LOCUS_23870 7367 7639 gene locus_tag LOCUS_23880 7367 7639 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022232.1 protein_id gnl|my_center|LOCUS_23880 8082 9173 gene locus_tag LOCUS_23890 8082 9173 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065345.1 protein_id gnl|my_center|LOCUS_23890 9694 9410 gene locus_tag LOCUS_23900 9694 9410 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545162.1 protein_id gnl|my_center|LOCUS_23900 11035 9890 gene locus_tag LOCUS_23910 11035 9890 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_23910 11272 12321 gene locus_tag LOCUS_23920 gene dinB 11272 12321 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172312.1 protein_id gnl|my_center|LOCUS_23920 13023 13673 gene locus_tag LOCUS_23930 13023 13673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 13677 14543 gene locus_tag LOCUS_23940 13677 14543 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250632.1 protein_id gnl|my_center|LOCUS_23940 14732 15028 gene locus_tag LOCUS_23950 14732 15028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 15929 15123 gene locus_tag LOCUS_23960 15929 15123 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020249.1 protein_id gnl|my_center|LOCUS_23960 17672 16797 gene locus_tag LOCUS_23970 17672 16797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 17812 18129 gene locus_tag LOCUS_23980 17812 18129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 >Feature sequence47 526 1752 gene locus_tag LOCUS_23990 gene folP 526 1752 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065738.1 protein_id gnl|my_center|LOCUS_23990 1755 2369 gene locus_tag LOCUS_24000 1755 2369 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023431.1 protein_id gnl|my_center|LOCUS_24000 2470 2637 gene locus_tag LOCUS_24010 2470 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 2680 2937 gene locus_tag LOCUS_24020 2680 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 4342 3344 gene locus_tag LOCUS_24030 gene fgd 4342 3344 CDS product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892203.1 protein_id gnl|my_center|LOCUS_24030 4594 4727 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5533 4802 gene locus_tag LOCUS_24040 gene alaXM 5533 4802 CDS product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022008.1 protein_id gnl|my_center|LOCUS_24040 7026 5749 gene locus_tag LOCUS_24050 7026 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065283.1 protein_id gnl|my_center|LOCUS_24050 7408 8250 gene locus_tag LOCUS_24060 7408 8250 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065231.1 protein_id gnl|my_center|LOCUS_24060 8721 8407 gene locus_tag LOCUS_24070 8721 8407 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065230.1 protein_id gnl|my_center|LOCUS_24070 9743 8937 gene locus_tag LOCUS_24080 9743 8937 CDS product DUF166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021826.1 protein_id gnl|my_center|LOCUS_24080 10201 10367 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10825 10439 gene locus_tag LOCUS_24090 10825 10439 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065229.1 protein_id gnl|my_center|LOCUS_24090 12330 10828 gene locus_tag LOCUS_24100 12330 10828 CDS product L-aspartate semialdehyde sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021823.1 protein_id gnl|my_center|LOCUS_24100 12705 13124 gene locus_tag LOCUS_24110 12705 13124 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021822.1 protein_id gnl|my_center|LOCUS_24110 14322 13180 gene locus_tag LOCUS_24120 14322 13180 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021821.1 protein_id gnl|my_center|LOCUS_24120 14780 14376 gene locus_tag LOCUS_24130 gene ribH 14780 14376 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021820.1 protein_id gnl|my_center|LOCUS_24130 15284 14820 gene locus_tag LOCUS_24140 gene ribC 15284 14820 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021819.1 protein_id gnl|my_center|LOCUS_24140 16511 15360 gene locus_tag LOCUS_24150 16511 15360 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065228.1 protein_id gnl|my_center|LOCUS_24150 17427 16864 gene locus_tag LOCUS_24160 17427 16864 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021817.1 protein_id gnl|my_center|LOCUS_24160 <19012 17804 gene locus_tag LOCUS_24170 <19012 17804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021816.1:CDC48 family AAA ATPase >Feature sequence48 974 567 gene locus_tag LOCUS_24180 974 567 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021540.1 protein_id gnl|my_center|LOCUS_24180 2887 1112 gene locus_tag LOCUS_24190 gene infB 2887 1112 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065143.1 protein_id gnl|my_center|LOCUS_24190 3492 3043 gene locus_tag LOCUS_24200 gene ndk 3492 3043 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065142.1 protein_id gnl|my_center|LOCUS_24200 3727 3539 gene locus_tag LOCUS_24210 3727 3539 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021537.1 protein_id gnl|my_center|LOCUS_24210 3965 3744 gene locus_tag LOCUS_24220 3965 3744 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065141.1 protein_id gnl|my_center|LOCUS_24220 4352 3990 gene locus_tag LOCUS_24230 gene rpl7ae 4352 3990 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021535.1 protein_id gnl|my_center|LOCUS_24230 4759 5406 gene locus_tag LOCUS_24240 4759 5406 CDS product TatD family nuclease-associated radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990793.1 protein_id gnl|my_center|LOCUS_24240 6937 5570 gene locus_tag LOCUS_24250 6937 5570 CDS product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990792.1 protein_id gnl|my_center|LOCUS_24250 8673 7186 gene locus_tag LOCUS_24260 8673 7186 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021531.1 protein_id gnl|my_center|LOCUS_24260 10025 9141 gene locus_tag LOCUS_24270 10025 9141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066431.1 protein_id gnl|my_center|LOCUS_24270 11906 10410 gene locus_tag LOCUS_24280 11906 10410 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990587.1 protein_id gnl|my_center|LOCUS_24280 12980 12144 gene locus_tag LOCUS_24290 12980 12144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022917.1 protein_id gnl|my_center|LOCUS_24290 13971 13138 gene locus_tag LOCUS_24300 13971 13138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022916.1 protein_id gnl|my_center|LOCUS_24300 14333 14530 gene locus_tag LOCUS_24310 14333 14530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 16034 14580 gene locus_tag LOCUS_24320 16034 14580 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022909.1 protein_id gnl|my_center|LOCUS_24320 >Feature sequence49 8 241 gene locus_tag LOCUS_24330 8 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 1679 531 gene locus_tag LOCUS_24340 1679 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2228 2103 gene locus_tag LOCUS_24350 2228 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 2485 2720 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2838 3413 gene locus_tag LOCUS_24360 2838 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24360 5619 3631 gene locus_tag LOCUS_24370 5619 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 6860 6213 gene locus_tag LOCUS_24380 6860 6213 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065077.1 protein_id gnl|my_center|LOCUS_24380 7748 6966 gene locus_tag LOCUS_24390 7748 6966 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021309.1 protein_id gnl|my_center|LOCUS_24390 8610 7936 gene locus_tag LOCUS_24400 8610 7936 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990781.1 protein_id gnl|my_center|LOCUS_24400 10052 9012 gene locus_tag LOCUS_24410 10052 9012 CDS product eukaryotic peptide chain release factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021302.1 protein_id gnl|my_center|LOCUS_24410 10522 11793 gene locus_tag LOCUS_24420 gene coaBC 10522 11793 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065075.1 protein_id gnl|my_center|LOCUS_24420 11971 12873 gene locus_tag LOCUS_24430 11971 12873 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066198.1 protein_id gnl|my_center|LOCUS_24430 13101 13862 gene locus_tag LOCUS_24440 13101 13862 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021299.1 protein_id gnl|my_center|LOCUS_24440 13883 14536 gene locus_tag LOCUS_24450 13883 14536 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021298.1 protein_id gnl|my_center|LOCUS_24450 15255 14734 gene locus_tag LOCUS_24460 15255 14734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24460 >Feature sequence50 215 475 gene locus_tag LOCUS_24470 215 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 554 760 gene locus_tag LOCUS_24480 554 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 1159 3024 gene locus_tag LOCUS_24490 1159 3024 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021597.1 protein_id gnl|my_center|LOCUS_24490 3026 4135 gene locus_tag LOCUS_24500 3026 4135 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065160.1 protein_id gnl|my_center|LOCUS_24500 4980 6884 gene locus_tag LOCUS_24510 gene gyrB 4980 6884 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021594.1 protein_id gnl|my_center|LOCUS_24510 6897 9554 gene locus_tag LOCUS_24520 gene gyrA 6897 9554 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021593.1 protein_id gnl|my_center|LOCUS_24520 12048 9889 gene locus_tag LOCUS_24530 12048 9889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021590.1 protein_id gnl|my_center|LOCUS_24530 13206 12151 gene locus_tag LOCUS_24540 13206 12151 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021587.1 protein_id gnl|my_center|LOCUS_24540 13870 13436 gene locus_tag LOCUS_24550 13870 13436 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990797.1 protein_id gnl|my_center|LOCUS_24550 >Feature sequence51 1232 576 gene locus_tag LOCUS_24560 1232 576 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020576.1 protein_id gnl|my_center|LOCUS_24560 3225 2056 gene locus_tag LOCUS_24570 3225 2056 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020575.1 protein_id gnl|my_center|LOCUS_24570 3710 4240 gene locus_tag LOCUS_24580 3710 4240 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020574.1 protein_id gnl|my_center|LOCUS_24580 4444 4521 gene locus_tag LOCUS_t00420 4444 4521 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4796 4626 gene locus_tag LOCUS_24590 4796 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 5413 5583 gene locus_tag LOCUS_24600 5413 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 5920 6747 gene locus_tag LOCUS_24610 5920 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064930.1 protein_id gnl|my_center|LOCUS_24610 6974 7186 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7287 7892 gene locus_tag LOCUS_24620 7287 7892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064931.1 protein_id gnl|my_center|LOCUS_24620 8152 9336 gene locus_tag LOCUS_24630 8152 9336 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020683.1 protein_id gnl|my_center|LOCUS_24630 10786 12120 gene locus_tag LOCUS_24640 10786 12120 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020367.1 protein_id gnl|my_center|LOCUS_24640 >Feature sequence52 374 90 gene locus_tag LOCUS_24650 374 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 876 1361 gene locus_tag LOCUS_24660 876 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 6518 1695 gene locus_tag LOCUS_24670 6518 1695 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021623.1 protein_id gnl|my_center|LOCUS_24670 7529 8548 gene locus_tag LOCUS_24680 gene mtaA 7529 8548 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021625.1 protein_id gnl|my_center|LOCUS_24680 10211 8823 gene locus_tag LOCUS_24690 gene mtaB 10211 8823 CDS product methanol--corrinoid protein co-methyltransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021626.1 protein_id gnl|my_center|LOCUS_24690 10992 10225 gene locus_tag LOCUS_24700 gene mtaC 10992 10225 CDS product methanol--corrinoid protein MtaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021627.1 protein_id gnl|my_center|LOCUS_24700 11360 11533 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence53 472 2145 gene locus_tag LOCUS_24710 472 2145 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020884.1 protein_id gnl|my_center|LOCUS_24710 2129 2986 gene locus_tag LOCUS_24720 2129 2986 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064977.1 protein_id gnl|my_center|LOCUS_24720 3011 3997 gene locus_tag LOCUS_24730 3011 3997 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020886.1 protein_id gnl|my_center|LOCUS_24730 3994 4932 gene locus_tag LOCUS_24740 3994 4932 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064978.1 protein_id gnl|my_center|LOCUS_24740 4935 6653 gene locus_tag LOCUS_24750 4935 6653 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020888.1 protein_id gnl|my_center|LOCUS_24750 8587 7853 gene locus_tag LOCUS_24760 8587 7853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 9351 8707 gene locus_tag LOCUS_24770 9351 8707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021547.1 protein_id gnl|my_center|LOCUS_24770 9488 9348 gene locus_tag LOCUS_24780 9488 9348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 10595 9597 gene locus_tag LOCUS_24790 10595 9597 CDS product DUF4367 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064366.1 protein_id gnl|my_center|LOCUS_24790 11652 10915 gene locus_tag LOCUS_24800 11652 10915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 >Feature sequence54 1109 1264 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1458 2093 gene locus_tag LOCUS_24810 gene afpA 1458 2093 CDS product archaeoflavoprotein AfpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023646.1 protein_id gnl|my_center|LOCUS_24810 2147 2653 gene locus_tag LOCUS_24820 2147 2653 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023647.1 protein_id gnl|my_center|LOCUS_24820 3290 3439 gene locus_tag LOCUS_24830 3290 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 3836 3645 gene locus_tag LOCUS_24840 3836 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 5056 4064 gene locus_tag LOCUS_24850 5056 4064 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023652.1 protein_id gnl|my_center|LOCUS_24850 5748 5188 gene locus_tag LOCUS_24860 5748 5188 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023653.1 protein_id gnl|my_center|LOCUS_24860 6429 6100 gene locus_tag LOCUS_24870 6429 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 7900 7022 gene locus_tag LOCUS_24880 7900 7022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023654.1 protein_id gnl|my_center|LOCUS_24880 8543 8046 gene locus_tag LOCUS_24890 gene hacB 8543 8046 CDS product homoaconitase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065791.1 protein_id gnl|my_center|LOCUS_24890 11298 8776 gene locus_tag LOCUS_24900 11298 8776 CDS product oligosaccharyl transferase, archaeosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065792.1 protein_id gnl|my_center|LOCUS_24900 >Feature sequence55 849 64 gene locus_tag LOCUS_24910 849 64 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021543.1 protein_id gnl|my_center|LOCUS_24910 1288 788 gene locus_tag LOCUS_24920 1288 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066236.1 protein_id gnl|my_center|LOCUS_24920 1928 1521 gene locus_tag LOCUS_24930 1928 1521 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065151.1 protein_id gnl|my_center|LOCUS_24930 2877 2278 gene locus_tag LOCUS_24940 gene pdxT 2877 2278 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021577.1 protein_id gnl|my_center|LOCUS_24940 4129 3233 gene locus_tag LOCUS_24950 gene pdxS 4129 3233 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065155.1 protein_id gnl|my_center|LOCUS_24950 4633 4758 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5827 4787 gene locus_tag LOCUS_24960 5827 4787 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860134.1 protein_id gnl|my_center|LOCUS_24960 7725 6124 gene locus_tag LOCUS_24970 7725 6124 CDS product methylamine methyltransferase corrinoid protein reductive activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020208.1 protein_id gnl|my_center|LOCUS_24970 8802 7975 gene locus_tag LOCUS_24980 gene mtaC 8802 7975 CDS product methanol--corrinoid protein MtaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024270.1 protein_id gnl|my_center|LOCUS_24980 9902 8799 gene locus_tag LOCUS_24990 9902 8799 CDS product MtaA/CmuA family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393827.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence56 274 83 gene locus_tag LOCUS_25000 274 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065969.1 protein_id gnl|my_center|LOCUS_25000 424 1686 gene locus_tag LOCUS_25010 424 1686 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020830.1 protein_id gnl|my_center|LOCUS_25010 1902 4013 gene locus_tag LOCUS_25020 1902 4013 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024232.1 protein_id gnl|my_center|LOCUS_25020 5168 4074 gene locus_tag LOCUS_25030 5168 4074 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024231.1 protein_id gnl|my_center|LOCUS_25030 7457 5529 gene locus_tag LOCUS_25040 7457 5529 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024230.1 protein_id gnl|my_center|LOCUS_25040 8759 7881 gene locus_tag LOCUS_25050 gene ilvE 8759 7881 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065968.1 protein_id gnl|my_center|LOCUS_25050 9113 9188 gene locus_tag LOCUS_t00430 9113 9188 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10056 9436 gene locus_tag LOCUS_25060 10056 9436 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024226.1 protein_id gnl|my_center|LOCUS_25060 >Feature sequence57 1743 415 gene locus_tag LOCUS_25070 1743 415 CDS product MEDS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990901.1 protein_id gnl|my_center|LOCUS_25070 2269 3000 gene locus_tag LOCUS_25080 2269 3000 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023861.1 protein_id gnl|my_center|LOCUS_25080 4842 3088 gene locus_tag LOCUS_25090 4842 3088 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065860.1 protein_id gnl|my_center|LOCUS_25090 6084 5341 gene locus_tag LOCUS_25100 6084 5341 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023864.1 protein_id gnl|my_center|LOCUS_25100 6240 6091 gene locus_tag LOCUS_25110 6240 6091 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065861.1 protein_id gnl|my_center|LOCUS_25110 7078 7320 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9855 8230 gene locus_tag LOCUS_25120 9855 8230 CDS product methylamine methyltransferase corrinoid protein reductive activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065863.1 protein_id gnl|my_center|LOCUS_25120 >Feature sequence58 739 940 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3114 3309 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3331 3555 gene locus_tag LOCUS_25130 3331 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 3609 4097 gene locus_tag LOCUS_25140 3609 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 7856 4530 gene locus_tag LOCUS_25150 7856 4530 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065172.1 protein_id gnl|my_center|LOCUS_25150 8214 8381 gene locus_tag LOCUS_25160 8214 8381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 8604 8356 gene locus_tag LOCUS_25170 8604 8356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence59 444 1190 gene locus_tag LOCUS_25180 444 1190 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922020.1 protein_id gnl|my_center|LOCUS_25180 1368 2363 gene locus_tag LOCUS_25190 1368 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 3247 2381 gene locus_tag LOCUS_25200 3247 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 4350 3244 gene locus_tag LOCUS_25210 4350 3244 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023660.1 protein_id gnl|my_center|LOCUS_25210 4449 5603 gene locus_tag LOCUS_25220 4449 5603 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023659.1 protein_id gnl|my_center|LOCUS_25220 5661 8189 gene locus_tag LOCUS_25230 5661 8189 CDS product oligosaccharyl transferase, archaeosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065792.1 protein_id gnl|my_center|LOCUS_25230 >Feature sequence60 51 710 gene locus_tag LOCUS_25240 51 710 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065395.1 protein_id gnl|my_center|LOCUS_25240 1469 834 gene locus_tag LOCUS_25250 1469 834 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022370.1 protein_id gnl|my_center|LOCUS_25250 1889 2008 gene locus_tag LOCUS_25260 1889 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 2943 2173 gene locus_tag LOCUS_25270 2943 2173 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020795.1 protein_id gnl|my_center|LOCUS_25270 3222 3422 gene locus_tag LOCUS_25280 3222 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 3572 4009 gene locus_tag LOCUS_25290 3572 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 4712 4539 gene locus_tag LOCUS_25300 4712 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 6896 5409 gene locus_tag LOCUS_25310 6896 5409 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022234.1 protein_id gnl|my_center|LOCUS_25310 >Feature sequence61 708 902 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 975 1307 gene locus_tag LOCUS_25320 975 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 2369 1482 gene locus_tag LOCUS_25330 2369 1482 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023064.1 protein_id gnl|my_center|LOCUS_25330 3090 2380 gene locus_tag LOCUS_25340 3090 2380 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023065.1 protein_id gnl|my_center|LOCUS_25340 5495 3087 gene locus_tag LOCUS_25350 5495 3087 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065616.1 protein_id gnl|my_center|LOCUS_25350 6042 6443 gene locus_tag LOCUS_25360 6042 6443 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023067.1 protein_id gnl|my_center|LOCUS_25360 >Feature sequence62 668 798 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1391 1315 gene locus_tag LOCUS_t00440 1391 1315 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1528 1452 gene locus_tag LOCUS_t00450 1528 1452 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1751 1823 gene locus_tag LOCUS_t00460 1751 1823 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2166 1963 gene locus_tag LOCUS_25370 2166 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 4077 2413 gene locus_tag LOCUS_25380 4077 2413 CDS product methylamine methyltransferase corrinoid protein reductive activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020893.1 protein_id gnl|my_center|LOCUS_25380 4625 4479 gene locus_tag LOCUS_25390 4625 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 >Feature sequence63 1138 185 gene locus_tag LOCUS_25400 1138 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 2482 1268 gene locus_tag LOCUS_25410 2482 1268 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065855.1 protein_id gnl|my_center|LOCUS_25410