>Feature sequence001 1229 1507 gene locus_tag LOCUS_00010 1229 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1507 1971 gene locus_tag LOCUS_00020 1507 1971 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023990.1 protein_id gnl|my_center|LOCUS_00020 1950 2465 gene locus_tag LOCUS_00030 1950 2465 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023327.1 protein_id gnl|my_center|LOCUS_00030 3688 2477 gene locus_tag LOCUS_00040 3688 2477 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024286.1 protein_id gnl|my_center|LOCUS_00040 4380 3676 gene locus_tag LOCUS_00050 gene sufC 4380 3676 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876773.1 protein_id gnl|my_center|LOCUS_00050 5479 4655 gene locus_tag LOCUS_00060 5479 4655 CDS product F420-dependent methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065986.1 protein_id gnl|my_center|LOCUS_00060 7928 5694 gene locus_tag LOCUS_00070 7928 5694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8501 8205 gene locus_tag LOCUS_00080 8501 8205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8656 8498 gene locus_tag LOCUS_00090 8656 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9263 8862 gene locus_tag LOCUS_00100 9263 8862 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020302.1 protein_id gnl|my_center|LOCUS_00100 10429 9266 gene locus_tag LOCUS_00110 10429 9266 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020303.1 protein_id gnl|my_center|LOCUS_00110 11422 10499 gene locus_tag LOCUS_00120 gene mtrH 11422 10499 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021807.1 protein_id gnl|my_center|LOCUS_00120 13045 11495 gene locus_tag LOCUS_00130 gene uvrC 13045 11495 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023256.1 protein_id gnl|my_center|LOCUS_00130 14735 13032 gene locus_tag LOCUS_00140 14735 13032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14972 14757 gene locus_tag LOCUS_00150 14972 14757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 15265 14969 gene locus_tag LOCUS_00160 15265 14969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 15763 16821 gene locus_tag LOCUS_00170 15763 16821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 17016 17384 gene locus_tag LOCUS_00180 17016 17384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 17665 17435 gene locus_tag LOCUS_00190 17665 17435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 18348 18097 gene locus_tag LOCUS_00200 18348 18097 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022120.1 protein_id gnl|my_center|LOCUS_00200 19357 18428 gene locus_tag LOCUS_00210 19357 18428 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021489.1 protein_id gnl|my_center|LOCUS_00210 20538 19390 gene locus_tag LOCUS_00220 gene proS 20538 19390 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023782.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00220 20813 20535 gene locus_tag LOCUS_00230 20813 20535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00230 21433 20810 gene locus_tag LOCUS_00240 21433 20810 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066526.1 protein_id gnl|my_center|LOCUS_00240 22147 21530 gene locus_tag LOCUS_00250 22147 21530 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064923.1 protein_id gnl|my_center|LOCUS_00250 22279 22208 gene locus_tag LOCUS_t00010 22279 22208 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 23141 22362 gene locus_tag LOCUS_00260 23141 22362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 23904 23029 gene locus_tag LOCUS_00270 23904 23029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 24079 24582 gene locus_tag LOCUS_00280 24079 24582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 26205 24724 gene locus_tag LOCUS_00290 26205 24724 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023184.1 protein_id gnl|my_center|LOCUS_00290 26790 26419 gene locus_tag LOCUS_00300 26790 26419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 27957 27112 gene locus_tag LOCUS_00310 27957 27112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 28637 29581 gene locus_tag LOCUS_00320 28637 29581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 29879 29646 gene locus_tag LOCUS_00330 29879 29646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 30949 29981 gene locus_tag LOCUS_00340 30949 29981 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066119.1 protein_id gnl|my_center|LOCUS_00340 32354 31014 gene locus_tag LOCUS_00350 32354 31014 CDS product RNase J family beta-CASP ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020654.1 protein_id gnl|my_center|LOCUS_00350 33439 32351 gene locus_tag LOCUS_00360 gene fni 33439 32351 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020653.1 protein_id gnl|my_center|LOCUS_00360 34194 33436 gene locus_tag LOCUS_00370 34194 33436 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020652.1 protein_id gnl|my_center|LOCUS_00370 35186 34191 gene locus_tag LOCUS_00380 35186 34191 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250425.1 protein_id gnl|my_center|LOCUS_00380 35990 35193 gene locus_tag LOCUS_00390 35990 35193 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020650.1 protein_id gnl|my_center|LOCUS_00390 36612 35995 gene locus_tag LOCUS_00400 gene rpsB 36612 35995 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020649.1 protein_id gnl|my_center|LOCUS_00400 36819 36622 gene locus_tag LOCUS_00410 36819 36622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 36922 36845 gene locus_tag LOCUS_t00020 36922 36845 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 37520 37122 gene locus_tag LOCUS_00420 37520 37122 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020646.1 protein_id gnl|my_center|LOCUS_00420 37947 37531 gene locus_tag LOCUS_00430 37947 37531 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020645.1 protein_id gnl|my_center|LOCUS_00430 38314 37952 gene locus_tag LOCUS_00440 38314 37952 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064921.1 protein_id gnl|my_center|LOCUS_00440 38545 39807 gene locus_tag LOCUS_00450 38545 39807 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021968.1 protein_id gnl|my_center|LOCUS_00450 40628 40302 gene locus_tag LOCUS_00460 40628 40302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 42069 41089 gene locus_tag LOCUS_00470 42069 41089 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066456.1 protein_id gnl|my_center|LOCUS_00470 43079 42294 gene locus_tag LOCUS_00480 43079 42294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 protein_id gnl|my_center|LOCUS_00480 43405 44514 gene locus_tag LOCUS_00490 43405 44514 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941161.1 protein_id gnl|my_center|LOCUS_00490 45142 44579 gene locus_tag LOCUS_00500 45142 44579 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021279.1 protein_id gnl|my_center|LOCUS_00500 45575 45147 gene locus_tag LOCUS_00510 45575 45147 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021280.1 protein_id gnl|my_center|LOCUS_00510 46084 45653 gene locus_tag LOCUS_00520 46084 45653 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021281.1 protein_id gnl|my_center|LOCUS_00520 46388 46077 gene locus_tag LOCUS_00530 46388 46077 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065070.1 protein_id gnl|my_center|LOCUS_00530 <47000 46398 gene locus_tag LOCUS_00540 <47000 46398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066196.1:DNA-directed RNA polymerase subunit A'' 46644 46677 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence002 <1 1007 gene locus_tag LOCUS_00550 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459437.1:RNA-guided endonuclease TnpB family protein 1163 1020 gene locus_tag LOCUS_00560 1163 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 1123 2181 gene locus_tag LOCUS_00570 1123 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 2236 2748 gene locus_tag LOCUS_00580 gene msrA 2236 2748 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021447.1 protein_id gnl|my_center|LOCUS_00580 3120 2932 gene locus_tag LOCUS_00590 3120 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 3142 3471 gene locus_tag LOCUS_00600 3142 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 3574 3981 gene locus_tag LOCUS_00610 3574 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 4291 4001 gene locus_tag LOCUS_00620 4291 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 6937 4439 gene locus_tag LOCUS_00630 6937 4439 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877365.1 protein_id gnl|my_center|LOCUS_00630 7056 7940 gene locus_tag LOCUS_00640 7056 7940 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066246.1 protein_id gnl|my_center|LOCUS_00640 8146 9486 gene locus_tag LOCUS_00650 8146 9486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 10572 12158 gene locus_tag LOCUS_00660 10572 12158 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258022.1 protein_id gnl|my_center|LOCUS_00660 12170 12697 gene locus_tag LOCUS_00670 12170 12697 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258023.1 protein_id gnl|my_center|LOCUS_00670 12780 13445 gene locus_tag LOCUS_00680 12780 13445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258024.1 protein_id gnl|my_center|LOCUS_00680 15103 16293 gene locus_tag LOCUS_00690 15103 16293 CDS product DUF4255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258026.1 protein_id gnl|my_center|LOCUS_00690 16290 18308 gene locus_tag LOCUS_00700 16290 18308 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258027.1 protein_id gnl|my_center|LOCUS_00700 18305 18556 gene locus_tag LOCUS_00710 18305 18556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 18840 18604 gene locus_tag LOCUS_00720 18840 18604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 19897 20064 gene locus_tag LOCUS_00730 19897 20064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 20155 20349 gene locus_tag LOCUS_00740 20155 20349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 20443 20859 gene locus_tag LOCUS_00750 20443 20859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 20978 22351 gene locus_tag LOCUS_00760 20978 22351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 22841 23482 gene locus_tag LOCUS_00770 22841 23482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258031.1 protein_id gnl|my_center|LOCUS_00770 23532 23828 gene locus_tag LOCUS_00780 23532 23828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258032.1 protein_id gnl|my_center|LOCUS_00780 23835 24950 gene locus_tag LOCUS_00790 23835 24950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258033.1 protein_id gnl|my_center|LOCUS_00790 24952 25512 gene locus_tag LOCUS_00800 24952 25512 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258034.1 protein_id gnl|my_center|LOCUS_00800 25534 25845 gene locus_tag LOCUS_00810 25534 25845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258035.1 protein_id gnl|my_center|LOCUS_00810 25848 26204 gene locus_tag LOCUS_00820 25848 26204 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258036.1 protein_id gnl|my_center|LOCUS_00820 26206 28665 gene locus_tag LOCUS_00830 26206 28665 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258037.1 protein_id gnl|my_center|LOCUS_00830 28662 31568 gene locus_tag LOCUS_00840 28662 31568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 31565 34018 gene locus_tag LOCUS_00850 31565 34018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 34039 37050 gene locus_tag LOCUS_00860 34039 37050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 37074 41273 gene locus_tag LOCUS_00870 37074 41273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 41285 43018 gene locus_tag LOCUS_00880 41285 43018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 43570 44589 gene locus_tag LOCUS_00890 43570 44589 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023154.1 protein_id gnl|my_center|LOCUS_00890 44758 45195 gene locus_tag LOCUS_00900 44758 45195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 45311 45688 gene locus_tag LOCUS_00910 45311 45688 CDS product DUF555 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021390.1 protein_id gnl|my_center|LOCUS_00910 >Feature sequence003 507 214 gene locus_tag LOCUS_00920 507 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 394 1392 gene locus_tag LOCUS_00930 394 1392 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023996.1 protein_id gnl|my_center|LOCUS_00930 2023 1439 gene locus_tag LOCUS_00940 2023 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 3625 2051 gene locus_tag LOCUS_00950 3625 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 4269 3622 gene locus_tag LOCUS_00960 4269 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 5708 4266 gene locus_tag LOCUS_00970 5708 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 7590 5710 gene locus_tag LOCUS_00980 7590 5710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 8984 7845 gene locus_tag LOCUS_00990 8984 7845 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065228.1 protein_id gnl|my_center|LOCUS_00990 9650 9018 gene locus_tag LOCUS_01000 gene rnhB 9650 9018 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249756.1 protein_id gnl|my_center|LOCUS_01000 11770 9719 gene locus_tag LOCUS_01010 11770 9719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 14328 12427 gene locus_tag LOCUS_01020 14328 12427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 15399 14797 gene locus_tag LOCUS_01030 15399 14797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 16029 15520 gene locus_tag LOCUS_01040 16029 15520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 17231 16131 gene locus_tag LOCUS_01050 17231 16131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 18261 17464 gene locus_tag LOCUS_01060 18261 17464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 19047 18301 gene locus_tag LOCUS_01070 19047 18301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 19342 19701 gene locus_tag LOCUS_01080 19342 19701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 19777 19848 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19866 20084 gene locus_tag LOCUS_01090 19866 20084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 20109 20654 gene locus_tag LOCUS_01100 20109 20654 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879241.1 protein_id gnl|my_center|LOCUS_01100 21612 20662 gene locus_tag LOCUS_01110 21612 20662 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_01110 22307 22657 gene locus_tag LOCUS_01120 22307 22657 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393074.1 protein_id gnl|my_center|LOCUS_01120 22650 22979 gene locus_tag LOCUS_01130 22650 22979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 23436 23122 gene locus_tag LOCUS_01140 23436 23122 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869934.1 protein_id gnl|my_center|LOCUS_01140 23779 23540 gene locus_tag LOCUS_01150 23779 23540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 24002 23769 gene locus_tag LOCUS_01160 24002 23769 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257967.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01160 24369 24220 gene locus_tag LOCUS_01170 24369 24220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 24432 27641 gene locus_tag LOCUS_01180 gene carB 24432 27641 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_01180 28813 27788 gene locus_tag LOCUS_01190 28813 27788 CDS product UPF0104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876885.1 protein_id gnl|my_center|LOCUS_01190 29071 29409 gene locus_tag LOCUS_01200 29071 29409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 29746 30408 gene locus_tag LOCUS_01210 29746 30408 CDS product DUF6345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064899.1 protein_id gnl|my_center|LOCUS_01210 30420 31565 gene locus_tag LOCUS_01220 30420 31565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 31706 32239 gene locus_tag LOCUS_01230 31706 32239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 <34331 32330 gene locus_tag LOCUS_01240 <34331 32330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020252.1:alanine--tRNA ligase >Feature sequence004 168 617 gene locus_tag LOCUS_01250 gene ndk 168 617 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065142.1 protein_id gnl|my_center|LOCUS_01250 708 2519 gene locus_tag LOCUS_01260 gene infB 708 2519 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065143.1 protein_id gnl|my_center|LOCUS_01260 2688 3122 gene locus_tag LOCUS_01270 2688 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 3306 4643 gene locus_tag LOCUS_01280 gene glnA 3306 4643 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545065.1 protein_id gnl|my_center|LOCUS_01280 6035 4824 gene locus_tag LOCUS_01290 6035 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 6252 8321 gene locus_tag LOCUS_01300 6252 8321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 8364 9431 gene locus_tag LOCUS_01310 gene glk 8364 9431 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141169.1 protein_id gnl|my_center|LOCUS_01310 10922 9465 gene locus_tag LOCUS_01320 10922 9465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 12321 10924 gene locus_tag LOCUS_01330 12321 10924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 12434 13441 gene locus_tag LOCUS_01340 12434 13441 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066146.1 protein_id gnl|my_center|LOCUS_01340 13494 14264 gene locus_tag LOCUS_01350 13494 14264 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020890.1 protein_id gnl|my_center|LOCUS_01350 16042 14324 gene locus_tag LOCUS_01360 16042 14324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 16321 17289 gene locus_tag LOCUS_01370 16321 17289 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_01370 17347 18318 gene locus_tag LOCUS_01380 17347 18318 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023359.1 protein_id gnl|my_center|LOCUS_01380 18416 19489 gene locus_tag LOCUS_01390 gene corA 18416 19489 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942048.1 protein_id gnl|my_center|LOCUS_01390 19563 20636 gene locus_tag LOCUS_01400 19563 20636 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228684.1 protein_id gnl|my_center|LOCUS_01400 20778 20614 gene locus_tag LOCUS_01410 20778 20614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 20744 21694 gene locus_tag LOCUS_01420 20744 21694 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020666.1 protein_id gnl|my_center|LOCUS_01420 22051 22797 gene locus_tag LOCUS_01430 22051 22797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 22951 24102 gene locus_tag LOCUS_01440 22951 24102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 24090 24767 gene locus_tag LOCUS_01450 24090 24767 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895848.1 protein_id gnl|my_center|LOCUS_01450 24764 25693 gene locus_tag LOCUS_01460 24764 25693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 25738 26958 gene locus_tag LOCUS_01470 25738 26958 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496851.1 protein_id gnl|my_center|LOCUS_01470 27196 27495 gene locus_tag LOCUS_01480 27196 27495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 27783 29531 gene locus_tag LOCUS_01490 gene thsB 27783 29531 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020145.1 protein_id gnl|my_center|LOCUS_01490 29461 29492 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence005 <1 1575 gene locus_tag LOCUS_01500 <1 1575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020726.1:minichromosome maintenance protein MCM 1599 1910 gene locus_tag LOCUS_01510 1599 1910 CDS product DUF424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064559.1 protein_id gnl|my_center|LOCUS_01510 1907 2980 gene locus_tag LOCUS_01520 1907 2980 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023765.1 protein_id gnl|my_center|LOCUS_01520 3426 4736 gene locus_tag LOCUS_01530 gene dnaG 3426 4736 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250361.1 protein_id gnl|my_center|LOCUS_01530 4885 5253 gene locus_tag LOCUS_01540 gene pth2 4885 5253 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023203.1 protein_id gnl|my_center|LOCUS_01540 5273 6571 gene locus_tag LOCUS_01550 gene truD 5273 6571 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065655.1 protein_id gnl|my_center|LOCUS_01550 6667 7560 gene locus_tag LOCUS_01560 6667 7560 CDS product DUF1743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021976.1 protein_id gnl|my_center|LOCUS_01560 7625 9151 gene locus_tag LOCUS_01570 7625 9151 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021977.1 protein_id gnl|my_center|LOCUS_01570 10112 9276 gene locus_tag LOCUS_01580 10112 9276 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392942.1 protein_id gnl|my_center|LOCUS_01580 12192 10216 gene locus_tag LOCUS_01590 12192 10216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 14068 12308 gene locus_tag LOCUS_01600 14068 12308 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986475.1 protein_id gnl|my_center|LOCUS_01600 15347 14166 gene locus_tag LOCUS_01610 15347 14166 CDS product homocitrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023272.1 protein_id gnl|my_center|LOCUS_01610 16547 15444 gene locus_tag LOCUS_01620 16547 15444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 17420 16623 gene locus_tag LOCUS_01630 17420 16623 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_01630 18321 18683 gene locus_tag LOCUS_01640 18321 18683 CDS product transcriptional regulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065665.1 protein_id gnl|my_center|LOCUS_01640 19678 18866 gene locus_tag LOCUS_01650 gene hisF 19678 18866 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061292.1 protein_id gnl|my_center|LOCUS_01650 20274 19672 gene locus_tag LOCUS_01660 gene hisH 20274 19672 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877134.1 protein_id gnl|my_center|LOCUS_01660 20497 20282 gene locus_tag LOCUS_01670 20497 20282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 20823 20404 gene locus_tag LOCUS_01680 20823 20404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 21257 20820 gene locus_tag LOCUS_01690 21257 20820 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868595.1 protein_id gnl|my_center|LOCUS_01690 23298 21259 gene locus_tag LOCUS_01700 gene fdhF 23298 21259 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774551.1 protein_id gnl|my_center|LOCUS_01700 24135 23311 gene locus_tag LOCUS_01710 24135 23311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878454.1 protein_id gnl|my_center|LOCUS_01710 >Feature sequence006 2000 807 gene locus_tag LOCUS_01720 2000 807 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990611.1 protein_id gnl|my_center|LOCUS_01720 3262 2207 gene locus_tag LOCUS_01730 3262 2207 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860356.1 protein_id gnl|my_center|LOCUS_01730 3448 3720 gene locus_tag LOCUS_01740 3448 3720 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931770.1 protein_id gnl|my_center|LOCUS_01740 3798 4220 gene locus_tag LOCUS_01750 3798 4220 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942952.1 protein_id gnl|my_center|LOCUS_01750 4470 5036 gene locus_tag LOCUS_01760 4470 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 5169 5807 gene locus_tag LOCUS_01770 5169 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 6786 5830 gene locus_tag LOCUS_01780 6786 5830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 7592 6783 gene locus_tag LOCUS_01790 7592 6783 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024467.1 protein_id gnl|my_center|LOCUS_01790 7728 9272 gene locus_tag LOCUS_01800 7728 9272 CDS product AMP phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878838.1 protein_id gnl|my_center|LOCUS_01800 9622 9359 gene locus_tag LOCUS_01810 9622 9359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 9743 9919 gene locus_tag LOCUS_01820 9743 9919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 10843 10055 gene locus_tag LOCUS_01830 10843 10055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 11754 11182 gene locus_tag LOCUS_01840 11754 11182 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022735.1 protein_id gnl|my_center|LOCUS_01840 13168 11855 gene locus_tag LOCUS_01850 13168 11855 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860380.1 protein_id gnl|my_center|LOCUS_01850 13570 14901 gene locus_tag LOCUS_01860 13570 14901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 15067 15591 gene locus_tag LOCUS_01870 15067 15591 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461633.1 protein_id gnl|my_center|LOCUS_01870 15654 15944 gene locus_tag LOCUS_01880 15654 15944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 16791 16102 gene locus_tag LOCUS_01890 16791 16102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 17949 17086 gene locus_tag LOCUS_01900 17949 17086 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023985.1 protein_id gnl|my_center|LOCUS_01900 18383 17946 gene locus_tag LOCUS_01910 18383 17946 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022818.1 protein_id gnl|my_center|LOCUS_01910 19453 18395 gene locus_tag LOCUS_01920 19453 18395 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023987.1 protein_id gnl|my_center|LOCUS_01920 19463 20176 gene locus_tag LOCUS_01930 19463 20176 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023984.1 protein_id gnl|my_center|LOCUS_01930 20959 20258 gene locus_tag LOCUS_01940 20959 20258 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065272.1 protein_id gnl|my_center|LOCUS_01940 21161 21397 gene locus_tag LOCUS_01950 21161 21397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020107.1 protein_id gnl|my_center|LOCUS_01950 21397 21660 gene locus_tag LOCUS_01960 21397 21660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 22872 21694 gene locus_tag LOCUS_01970 22872 21694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 >Feature sequence007 549 1610 gene locus_tag LOCUS_01980 549 1610 CDS product putative sulfate/molybdate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925781.1 protein_id gnl|my_center|LOCUS_01980 2347 1640 gene locus_tag LOCUS_01990 2347 1640 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022907.1 protein_id gnl|my_center|LOCUS_01990 5090 2817 gene locus_tag LOCUS_02000 5090 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 7687 5333 gene locus_tag LOCUS_02010 7687 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 8613 7684 gene locus_tag LOCUS_02020 8613 7684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 9579 8956 gene locus_tag LOCUS_02030 9579 8956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 11707 10190 gene locus_tag LOCUS_02040 11707 10190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 11977 13593 gene locus_tag LOCUS_02050 11977 13593 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860269.1 protein_id gnl|my_center|LOCUS_02050 13650 14069 gene locus_tag LOCUS_02060 13650 14069 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023052.1 protein_id gnl|my_center|LOCUS_02060 14926 14372 gene locus_tag LOCUS_02070 14926 14372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 16674 14929 gene locus_tag LOCUS_02080 gene arcS 16674 14929 CDS product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024500.1 protein_id gnl|my_center|LOCUS_02080 18107 16671 gene locus_tag LOCUS_02090 gene tgtA 18107 16671 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024298.1 protein_id gnl|my_center|LOCUS_02090 18201 18680 gene locus_tag LOCUS_02100 18201 18680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 20656 18707 gene locus_tag LOCUS_02110 20656 18707 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881159.1 protein_id gnl|my_center|LOCUS_02110 21544 21644 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence008 1314 310 gene locus_tag LOCUS_02120 1314 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 2076 2267 gene locus_tag LOCUS_02130 2076 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 2374 3978 gene locus_tag LOCUS_02140 2374 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 4366 8673 gene locus_tag LOCUS_02150 4366 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 9483 8818 gene locus_tag LOCUS_02160 gene radB 9483 8818 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860416.1 protein_id gnl|my_center|LOCUS_02160 10114 9521 gene locus_tag LOCUS_02170 10114 9521 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879329.1 protein_id gnl|my_center|LOCUS_02170 10983 10111 gene locus_tag LOCUS_02180 10983 10111 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020739.1 protein_id gnl|my_center|LOCUS_02180 11948 10980 gene locus_tag LOCUS_02190 11948 10980 CDS product methanogenesis marker 9 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020738.1 protein_id gnl|my_center|LOCUS_02190 12195 12073 gene locus_tag LOCUS_02200 12195 12073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 13045 12254 gene locus_tag LOCUS_02210 13045 12254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 14537 13101 gene locus_tag LOCUS_02220 14537 13101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 14749 15351 gene locus_tag LOCUS_02230 14749 15351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 16209 15415 gene locus_tag LOCUS_02240 16209 15415 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021804.1 protein_id gnl|my_center|LOCUS_02240 17332 16244 gene locus_tag LOCUS_02250 17332 16244 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_02250 17725 17507 gene locus_tag LOCUS_02260 gene secE2 17725 17507 CDS product calcium dodecin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401885.1 protein_id gnl|my_center|LOCUS_02260 17963 19438 gene locus_tag LOCUS_02270 17963 19438 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064974.1 protein_id gnl|my_center|LOCUS_02270 19814 19368 gene locus_tag LOCUS_02280 19814 19368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 20752 19838 gene locus_tag LOCUS_02290 gene dapF 20752 19838 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878250.1 protein_id gnl|my_center|LOCUS_02290 >Feature sequence009 420 866 gene locus_tag LOCUS_02300 420 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048124573.1 protein_id gnl|my_center|LOCUS_02300 904 1719 gene locus_tag LOCUS_02310 904 1719 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065531.1 protein_id gnl|my_center|LOCUS_02310 3726 1729 gene locus_tag LOCUS_02320 3726 1729 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021214.1 protein_id gnl|my_center|LOCUS_02320 3880 4872 gene locus_tag LOCUS_02330 3880 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 9408 4996 gene locus_tag LOCUS_02340 9408 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 11016 9409 gene locus_tag LOCUS_02350 11016 9409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 11965 11774 gene locus_tag LOCUS_02360 11965 11774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 12189 12515 gene locus_tag LOCUS_02370 12189 12515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 12811 13275 gene locus_tag LOCUS_02380 12811 13275 CDS product DUF2240 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064346.1 protein_id gnl|my_center|LOCUS_02380 13463 13861 gene locus_tag LOCUS_02390 13463 13861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 14826 13858 gene locus_tag LOCUS_02400 14826 13858 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930650.1 protein_id gnl|my_center|LOCUS_02400 14992 15717 gene locus_tag LOCUS_02410 14992 15717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 15861 16847 gene locus_tag LOCUS_02420 15861 16847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 17093 18262 gene locus_tag LOCUS_02430 gene ftsZ 17093 18262 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024152.1 protein_id gnl|my_center|LOCUS_02430 18668 18342 gene locus_tag LOCUS_02440 18668 18342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 19110 19409 gene locus_tag LOCUS_02450 19110 19409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289276.1 protein_id gnl|my_center|LOCUS_02450 19416 20678 gene locus_tag LOCUS_02460 19416 20678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 >Feature sequence010 169 1260 gene locus_tag LOCUS_02470 gene thiI 169 1260 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877292.1 protein_id gnl|my_center|LOCUS_02470 1301 2461 gene locus_tag LOCUS_02480 gene nifS 1301 2461 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_02480 2501 2893 gene locus_tag LOCUS_02490 gene nifU 2501 2893 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_02490 6232 3188 gene locus_tag LOCUS_02500 6232 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 6418 6546 gene locus_tag LOCUS_02510 6418 6546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 6596 7636 gene locus_tag LOCUS_02520 6596 7636 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583646.1 protein_id gnl|my_center|LOCUS_02520 8902 7652 gene locus_tag LOCUS_02530 8902 7652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02530 9236 8976 gene locus_tag LOCUS_02540 9236 8976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 9636 9226 gene locus_tag LOCUS_02550 9636 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 10065 9880 gene locus_tag LOCUS_02560 10065 9880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 9995 11455 gene locus_tag LOCUS_02570 9995 11455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 11523 12941 gene locus_tag LOCUS_02580 11523 12941 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875712.1 protein_id gnl|my_center|LOCUS_02580 12982 14040 gene locus_tag LOCUS_02590 12982 14040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 14117 14542 gene locus_tag LOCUS_02600 14117 14542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02600 14463 15263 gene locus_tag LOCUS_02610 14463 15263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02610 15436 15834 gene locus_tag LOCUS_02620 15436 15834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 15797 16018 gene locus_tag LOCUS_02630 15797 16018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 16985 16056 gene locus_tag LOCUS_02640 16985 16056 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391304.1 protein_id gnl|my_center|LOCUS_02640 17258 16986 gene locus_tag LOCUS_02650 17258 16986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 17870 17703 gene locus_tag LOCUS_02660 17870 17703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 19673 18114 gene locus_tag LOCUS_02670 19673 18114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 <20976 20012 gene locus_tag LOCUS_02680 <20976 20012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023754.1:methanogenesis marker 12 protein >Feature sequence011 801 568 gene locus_tag LOCUS_02690 gene mtrG 801 568 CDS product tetrahydromethanopterin S-methyltransferase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020328.1 protein_id gnl|my_center|LOCUS_02690 1095 814 gene locus_tag LOCUS_02700 1095 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 1825 1097 gene locus_tag LOCUS_02710 gene mtrA 1825 1097 CDS product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020330.1 protein_id gnl|my_center|LOCUS_02710 2137 1826 gene locus_tag LOCUS_02720 2137 1826 CDS product tetrahydromethanopterin S-methyltransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020331.1 protein_id gnl|my_center|LOCUS_02720 2944 2138 gene locus_tag LOCUS_02730 gene mtrC 2944 2138 CDS product tetrahydromethanopterin S-methyltransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020332.1 protein_id gnl|my_center|LOCUS_02730 3638 2946 gene locus_tag LOCUS_02740 gene mtrD 3638 2946 CDS product tetrahydromethanopterin S-methyltransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020333.1 protein_id gnl|my_center|LOCUS_02740 4546 3635 gene locus_tag LOCUS_02750 gene mtrE 4546 3635 CDS product tetrahydromethanopterin S-methyltransferase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020334.1 protein_id gnl|my_center|LOCUS_02750 5444 4899 gene locus_tag LOCUS_02760 5444 4899 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023239.1 protein_id gnl|my_center|LOCUS_02760 5956 6645 gene locus_tag LOCUS_02770 5956 6645 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023933.1 protein_id gnl|my_center|LOCUS_02770 6630 7667 gene locus_tag LOCUS_02780 6630 7667 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023934.1 protein_id gnl|my_center|LOCUS_02780 7672 8835 gene locus_tag LOCUS_02790 7672 8835 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_02790 8840 9244 gene locus_tag LOCUS_02800 8840 9244 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023936.1 protein_id gnl|my_center|LOCUS_02800 9597 11495 gene locus_tag LOCUS_02810 gene gyrB 9597 11495 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021594.1 protein_id gnl|my_center|LOCUS_02810 11505 13892 gene locus_tag LOCUS_02820 gene gyrA 11505 13892 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021593.1 protein_id gnl|my_center|LOCUS_02820 14109 13906 gene locus_tag LOCUS_02830 14109 13906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 14206 14502 gene locus_tag LOCUS_02840 14206 14502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 15809 14529 gene locus_tag LOCUS_02850 15809 14529 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003128157.1 protein_id gnl|my_center|LOCUS_02850 15916 16701 gene locus_tag LOCUS_02860 15916 16701 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_02860 16750 16824 gene locus_tag LOCUS_t00030 16750 16824 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 17293 17099 gene locus_tag LOCUS_02870 17293 17099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 17549 18526 gene locus_tag LOCUS_02880 17549 18526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 18875 19291 gene locus_tag LOCUS_02890 18875 19291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 19864 20304 gene locus_tag LOCUS_02900 19864 20304 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023134.1 protein_id gnl|my_center|LOCUS_02900 20434 20276 gene locus_tag LOCUS_02910 20434 20276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 >Feature sequence012 62 1216 gene locus_tag LOCUS_02920 62 1216 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020271.1 protein_id gnl|my_center|LOCUS_02920 1392 2273 gene locus_tag LOCUS_02930 gene map 1392 2273 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020270.1 protein_id gnl|my_center|LOCUS_02930 2945 2340 gene locus_tag LOCUS_02940 2945 2340 CDS product DUF2150 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023591.1 protein_id gnl|my_center|LOCUS_02940 3446 2955 gene locus_tag LOCUS_02950 gene cgi121 3446 2955 CDS product KEOPS complex subunit Cgi121 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021174.1 protein_id gnl|my_center|LOCUS_02950 4264 3578 gene locus_tag LOCUS_02960 4264 3578 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021328.1 protein_id gnl|my_center|LOCUS_02960 5225 4365 gene locus_tag LOCUS_02970 5225 4365 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024306.1 protein_id gnl|my_center|LOCUS_02970 6399 7307 gene locus_tag LOCUS_02980 6399 7307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 7469 8170 gene locus_tag LOCUS_02990 7469 8170 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022401.1 protein_id gnl|my_center|LOCUS_02990 8931 8218 gene locus_tag LOCUS_03000 gene tmk 8931 8218 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903416.1 protein_id gnl|my_center|LOCUS_03000 9437 10060 gene locus_tag LOCUS_03010 9437 10060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 9997 10023 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10048 10263 gene locus_tag LOCUS_03020 10048 10263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 11546 10290 gene locus_tag LOCUS_03030 11546 10290 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066507.1 protein_id gnl|my_center|LOCUS_03030 11589 12521 gene locus_tag LOCUS_03040 11589 12521 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023440.1 protein_id gnl|my_center|LOCUS_03040 12584 13558 gene locus_tag LOCUS_03050 12584 13558 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928941.1 protein_id gnl|my_center|LOCUS_03050 14093 13593 gene locus_tag LOCUS_03060 14093 13593 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876457.1 protein_id gnl|my_center|LOCUS_03060 14878 14177 gene locus_tag LOCUS_03070 14878 14177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 15013 15624 gene locus_tag LOCUS_03080 15013 15624 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879461.1 protein_id gnl|my_center|LOCUS_03080 16983 15688 gene locus_tag LOCUS_03090 gene thiC 16983 15688 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021793.1 protein_id gnl|my_center|LOCUS_03090 17040 17687 gene locus_tag LOCUS_03100 17040 17687 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878079.1 protein_id gnl|my_center|LOCUS_03100 17739 18353 gene locus_tag LOCUS_03110 17739 18353 CDS product protein-S-isoprenylcysteine O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022658.1 protein_id gnl|my_center|LOCUS_03110 19132 18455 gene locus_tag LOCUS_03120 19132 18455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 <19951 19344 gene locus_tag LOCUS_03130 <19951 19344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258074.1:calcium/sodium antiporter >Feature sequence013 335 54 gene locus_tag LOCUS_03140 335 54 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021663.1 protein_id gnl|my_center|LOCUS_03140 1261 476 gene locus_tag LOCUS_03150 1261 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 1575 1587 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1590 2159 gene locus_tag LOCUS_03160 1590 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 2165 2554 gene locus_tag LOCUS_03170 2165 2554 CDS product DUF473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024293.1 protein_id gnl|my_center|LOCUS_03170 3463 2636 gene locus_tag LOCUS_03180 gene arsM 3463 2636 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023683.1 protein_id gnl|my_center|LOCUS_03180 3812 3513 gene locus_tag LOCUS_03190 3812 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 4742 4008 gene locus_tag LOCUS_03200 4742 4008 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920153.1 protein_id gnl|my_center|LOCUS_03200 6640 4850 gene locus_tag LOCUS_03210 6640 4850 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528118.1 protein_id gnl|my_center|LOCUS_03210 7968 6685 gene locus_tag LOCUS_03220 7968 6685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 8848 7952 gene locus_tag LOCUS_03230 8848 7952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528117.1 protein_id gnl|my_center|LOCUS_03230 9167 9033 gene locus_tag LOCUS_03240 9167 9033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 9365 9207 gene locus_tag LOCUS_03250 9365 9207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 9521 9372 gene locus_tag LOCUS_03260 9521 9372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 11492 9582 gene locus_tag LOCUS_03270 11492 9582 CDS product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528116.1 protein_id gnl|my_center|LOCUS_03270 11846 11505 gene locus_tag LOCUS_03280 11846 11505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 12201 11911 gene locus_tag LOCUS_03290 12201 11911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 12413 13267 gene locus_tag LOCUS_03300 12413 13267 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_03300 13264 14259 gene locus_tag LOCUS_03310 13264 14259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 14442 15239 gene locus_tag LOCUS_03320 14442 15239 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020491.1 protein_id gnl|my_center|LOCUS_03320 15353 16504 gene locus_tag LOCUS_03330 15353 16504 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066363.1 protein_id gnl|my_center|LOCUS_03330 16670 17815 gene locus_tag LOCUS_03340 16670 17815 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066363.1 protein_id gnl|my_center|LOCUS_03340 17984 19144 gene locus_tag LOCUS_03350 17984 19144 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065645.1 protein_id gnl|my_center|LOCUS_03350 >Feature sequence014 2321 372 gene locus_tag LOCUS_03360 2321 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 2780 2944 gene locus_tag LOCUS_03370 2780 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 3060 3869 gene locus_tag LOCUS_03380 3060 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 4077 4322 gene locus_tag LOCUS_03390 4077 4322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 4371 4715 gene locus_tag LOCUS_03400 4371 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 5041 4790 gene locus_tag LOCUS_03410 5041 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 5454 5023 gene locus_tag LOCUS_03420 5454 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 6644 5619 gene locus_tag LOCUS_03430 6644 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 7488 7276 gene locus_tag LOCUS_03440 7488 7276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 8201 10882 gene locus_tag LOCUS_03450 8201 10882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 11304 11065 gene locus_tag LOCUS_03460 11304 11065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 11951 12118 gene locus_tag LOCUS_03470 11951 12118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 13936 12392 gene locus_tag LOCUS_03480 13936 12392 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860413.1 protein_id gnl|my_center|LOCUS_03480 14286 16082 gene locus_tag LOCUS_03490 14286 16082 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870139.1 protein_id gnl|my_center|LOCUS_03490 16599 16135 gene locus_tag LOCUS_03500 16599 16135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 18398 16680 gene locus_tag LOCUS_03510 gene polX 18398 16680 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_03510 >Feature sequence015 1669 893 gene locus_tag LOCUS_03520 1669 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 2377 1781 gene locus_tag LOCUS_03530 2377 1781 CDS product HisA/HisF-related TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024313.1 protein_id gnl|my_center|LOCUS_03530 2213 2231 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2405 3106 gene locus_tag LOCUS_03540 2405 3106 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024314.1 protein_id gnl|my_center|LOCUS_03540 4685 3114 gene locus_tag LOCUS_03550 gene serA 4685 3114 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020641.1 protein_id gnl|my_center|LOCUS_03550 5164 4793 gene locus_tag LOCUS_03560 5164 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 6544 5324 gene locus_tag LOCUS_03570 gene pan 6544 5324 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879468.1 protein_id gnl|my_center|LOCUS_03570 6604 7089 gene locus_tag LOCUS_03580 6604 7089 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065943.1 protein_id gnl|my_center|LOCUS_03580 7086 7670 gene locus_tag LOCUS_03590 7086 7670 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903724.1 protein_id gnl|my_center|LOCUS_03590 7667 8605 gene locus_tag LOCUS_03600 7667 8605 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065056.1 protein_id gnl|my_center|LOCUS_03600 8560 9363 gene locus_tag LOCUS_03610 8560 9363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 9468 11003 gene locus_tag LOCUS_03620 9468 11003 CDS product AMP phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023176.1 protein_id gnl|my_center|LOCUS_03620 11053 11901 gene locus_tag LOCUS_03630 11053 11901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 11908 12765 gene locus_tag LOCUS_03640 11908 12765 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496419.1 protein_id gnl|my_center|LOCUS_03640 13482 12784 gene locus_tag LOCUS_03650 13482 12784 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878032.1 protein_id gnl|my_center|LOCUS_03650 14095 13505 gene locus_tag LOCUS_03660 14095 13505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 14227 15876 gene locus_tag LOCUS_03670 14227 15876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 17773 15944 gene locus_tag LOCUS_03680 17773 15944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 17979 18599 gene locus_tag LOCUS_03690 gene trmY 17979 18599 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066221.1 protein_id gnl|my_center|LOCUS_03690 >Feature sequence016 <1 1084 gene locus_tag LOCUS_03700 <1 1084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065661.1:TldD/PmbA family protein 1154 2008 gene locus_tag LOCUS_03710 1154 2008 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021191.1 protein_id gnl|my_center|LOCUS_03710 2451 2035 gene locus_tag LOCUS_03720 2451 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 2563 3645 gene locus_tag LOCUS_03730 gene aroC 2563 3645 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_03730 3683 5485 gene locus_tag LOCUS_03740 3683 5485 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024230.1 protein_id gnl|my_center|LOCUS_03740 5691 6209 gene locus_tag LOCUS_03750 5691 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 6902 6429 gene locus_tag LOCUS_03760 6902 6429 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023561.1 protein_id gnl|my_center|LOCUS_03760 7900 6899 gene locus_tag LOCUS_03770 gene priL 7900 6899 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020168.1 protein_id gnl|my_center|LOCUS_03770 8640 7897 gene locus_tag LOCUS_03780 8640 7897 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020169.1 protein_id gnl|my_center|LOCUS_03780 9000 8719 gene locus_tag LOCUS_03790 9000 8719 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020171.1 protein_id gnl|my_center|LOCUS_03790 9132 9788 gene locus_tag LOCUS_03800 9132 9788 CDS product DUF5612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878900.1 protein_id gnl|my_center|LOCUS_03800 10089 9838 gene locus_tag LOCUS_03810 10089 9838 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064801.1 protein_id gnl|my_center|LOCUS_03810 10480 10130 gene locus_tag LOCUS_03820 10480 10130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 10851 11084 gene locus_tag LOCUS_03830 gene hpkA 10851 11084 CDS product archaeal histone HpkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250364.1 protein_id gnl|my_center|LOCUS_03830 11125 13014 gene locus_tag LOCUS_03840 gene gatE 11125 13014 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022814.1 protein_id gnl|my_center|LOCUS_03840 13144 14292 gene locus_tag LOCUS_03850 13144 14292 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020144.1 protein_id gnl|my_center|LOCUS_03850 14389 15249 gene locus_tag LOCUS_03860 14389 15249 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_03860 16318 15377 gene locus_tag LOCUS_03870 16318 15377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 >Feature sequence017 159 653 gene locus_tag LOCUS_03880 159 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03880 638 895 gene locus_tag LOCUS_03890 638 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03890 965 2158 gene locus_tag LOCUS_03900 965 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 2293 3393 gene locus_tag LOCUS_03910 2293 3393 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066160.1 protein_id gnl|my_center|LOCUS_03910 4221 3457 gene locus_tag LOCUS_03920 4221 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875877.1 protein_id gnl|my_center|LOCUS_03920 5458 4373 gene locus_tag LOCUS_03930 5458 4373 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066217.1 protein_id gnl|my_center|LOCUS_03930 5475 6032 gene locus_tag LOCUS_03940 5475 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 7256 6036 gene locus_tag LOCUS_03950 gene thiC 7256 6036 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024209.1 protein_id gnl|my_center|LOCUS_03950 8593 7388 gene locus_tag LOCUS_03960 8593 7388 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065684.1 protein_id gnl|my_center|LOCUS_03960 9934 8744 gene locus_tag LOCUS_03970 9934 8744 CDS product bifunctional 5,6,7,8-tetrahydromethanopterin hydro-lyase/3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024481.1 protein_id gnl|my_center|LOCUS_03970 10703 10113 gene locus_tag LOCUS_03980 10703 10113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 10887 12380 gene locus_tag LOCUS_03990 10887 12380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 12527 14164 gene locus_tag LOCUS_04000 12527 14164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 14190 16094 gene locus_tag LOCUS_04010 14190 16094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 16106 16654 gene locus_tag LOCUS_04020 16106 16654 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881077.1 protein_id gnl|my_center|LOCUS_04020 <17407 16716 gene locus_tag LOCUS_04030 <17407 16716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037396377.1:ABC transporter substrate-binding protein >Feature sequence018 86 1753 gene locus_tag LOCUS_04040 86 1753 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878252.1 protein_id gnl|my_center|LOCUS_04040 1750 2163 gene locus_tag LOCUS_04050 1750 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04050 2175 2552 gene locus_tag LOCUS_04060 2175 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04060 2842 3003 gene locus_tag LOCUS_04070 2842 3003 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940442.1 protein_id gnl|my_center|LOCUS_04070 3018 3548 gene locus_tag LOCUS_04080 3018 3548 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 protein_id gnl|my_center|LOCUS_04080 3819 4769 gene locus_tag LOCUS_04090 gene gnd 3819 4769 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392797.1 protein_id gnl|my_center|LOCUS_04090 5008 4853 gene locus_tag LOCUS_04100 5008 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 5127 6284 gene locus_tag LOCUS_04110 5127 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 6876 6397 gene locus_tag LOCUS_04120 6876 6397 CDS product MSMEG_6728 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971750.1 protein_id gnl|my_center|LOCUS_04120 7616 6894 gene locus_tag LOCUS_04130 7616 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 7878 8168 gene locus_tag LOCUS_04140 7878 8168 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022117.1 protein_id gnl|my_center|LOCUS_04140 8165 8539 gene locus_tag LOCUS_04150 8165 8539 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_04150 8928 10247 gene locus_tag LOCUS_04160 8928 10247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 10262 11107 gene locus_tag LOCUS_04170 10262 11107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 11073 12620 gene locus_tag LOCUS_04180 11073 12620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 12624 12696 gene locus_tag LOCUS_t00040 12624 12696 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 12824 13786 gene locus_tag LOCUS_04190 12824 13786 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879220.1 protein_id gnl|my_center|LOCUS_04190 13867 14892 gene locus_tag LOCUS_04200 gene argC 13867 14892 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065747.1 protein_id gnl|my_center|LOCUS_04200 14954 15442 gene locus_tag LOCUS_04210 14954 15442 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065746.1 protein_id gnl|my_center|LOCUS_04210 15429 16601 gene locus_tag LOCUS_04220 gene argJ 15429 16601 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023478.1 protein_id gnl|my_center|LOCUS_04220 16621 17229 gene locus_tag LOCUS_04230 16621 17229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 17078 17102 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence019 1443 2669 gene locus_tag LOCUS_04240 1443 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 3137 2613 gene locus_tag LOCUS_04250 3137 2613 CDS product DUF123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902479.1 protein_id gnl|my_center|LOCUS_04250 4331 3252 gene locus_tag LOCUS_04260 4331 3252 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066036.1 protein_id gnl|my_center|LOCUS_04260 5785 4328 gene locus_tag LOCUS_04270 5785 4328 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066616.1 protein_id gnl|my_center|LOCUS_04270 7600 5930 gene locus_tag LOCUS_04280 7600 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 8534 8343 gene locus_tag LOCUS_04290 8534 8343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 9458 8739 gene locus_tag LOCUS_04300 9458 8739 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546873.1 protein_id gnl|my_center|LOCUS_04300 10466 10894 gene locus_tag LOCUS_04310 10466 10894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 11941 11243 gene locus_tag LOCUS_04320 11941 11243 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878933.1 protein_id gnl|my_center|LOCUS_04320 13543 11990 gene locus_tag LOCUS_04330 13543 11990 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868685.1 protein_id gnl|my_center|LOCUS_04330 14259 13777 gene locus_tag LOCUS_04340 14259 13777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 15118 14321 gene locus_tag LOCUS_04350 15118 14321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 16116 15199 gene locus_tag LOCUS_04360 gene purC 16116 15199 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582681.1 protein_id gnl|my_center|LOCUS_04360 16839 16255 gene locus_tag LOCUS_04370 16839 16255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 17208 16936 gene locus_tag LOCUS_04380 17208 16936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 >Feature sequence020 1965 1042 gene locus_tag LOCUS_04390 gene arcC 1965 1042 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_04390 3346 1967 gene locus_tag LOCUS_04400 3346 1967 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147002.1 protein_id gnl|my_center|LOCUS_04400 3401 5275 gene locus_tag LOCUS_04410 3401 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 5523 5544 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6590 5793 gene locus_tag LOCUS_04420 6590 5793 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024464.1 protein_id gnl|my_center|LOCUS_04420 6710 6934 gene locus_tag LOCUS_04430 6710 6934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 6978 7736 gene locus_tag LOCUS_04440 6978 7736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 8003 9253 gene locus_tag LOCUS_04450 8003 9253 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064633.1 protein_id gnl|my_center|LOCUS_04450 9307 9690 gene locus_tag LOCUS_04460 9307 9690 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023598.1 protein_id gnl|my_center|LOCUS_04460 9690 10262 gene locus_tag LOCUS_04470 9690 10262 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023599.1 protein_id gnl|my_center|LOCUS_04470 10259 10444 gene locus_tag LOCUS_04480 10259 10444 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023600.1 protein_id gnl|my_center|LOCUS_04480 10447 11004 gene locus_tag LOCUS_04490 10447 11004 CDS product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023601.1 protein_id gnl|my_center|LOCUS_04490 10985 11284 gene locus_tag LOCUS_04500 10985 11284 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023602.1 protein_id gnl|my_center|LOCUS_04500 11286 11435 gene locus_tag LOCUS_04510 11286 11435 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011032551.1 protein_id gnl|my_center|LOCUS_04510 11585 12361 gene locus_tag LOCUS_04520 11585 12361 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020954.1 protein_id gnl|my_center|LOCUS_04520 12403 13728 gene locus_tag LOCUS_04530 12403 13728 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020953.1 protein_id gnl|my_center|LOCUS_04530 13736 13969 gene locus_tag LOCUS_04540 13736 13969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 13974 15140 gene locus_tag LOCUS_04550 13974 15140 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368910.1 protein_id gnl|my_center|LOCUS_04550 15709 15987 gene locus_tag LOCUS_04560 15709 15987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04560 16602 16156 gene locus_tag LOCUS_04570 16602 16156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 >Feature sequence021 <1 1386 gene locus_tag LOCUS_04580 <1 1386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023474.1:HEAT repeat domain-containing protein 1741 1436 gene locus_tag LOCUS_04590 1741 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 2031 1789 gene locus_tag LOCUS_04600 2031 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 2469 3506 gene locus_tag LOCUS_04610 2469 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 4391 3588 gene locus_tag LOCUS_04620 gene mtxX 4391 3588 CDS product methanogenesis marker protein Mmp4/MtxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065223.1 protein_id gnl|my_center|LOCUS_04620 5361 4396 gene locus_tag LOCUS_04630 5361 4396 CDS product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024078.1 protein_id gnl|my_center|LOCUS_04630 6376 5414 gene locus_tag LOCUS_04640 6376 5414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 6691 9819 gene locus_tag LOCUS_04650 6691 9819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 11043 9859 gene locus_tag LOCUS_04660 11043 9859 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176674.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04660 11764 11186 gene locus_tag LOCUS_04670 11764 11186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 11829 13985 gene locus_tag LOCUS_04680 11829 13985 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020344.1 protein_id gnl|my_center|LOCUS_04680 13661 13782 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14046 15101 gene locus_tag LOCUS_04690 14046 15101 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064850.1 protein_id gnl|my_center|LOCUS_04690 >Feature sequence022 <1 1332 gene locus_tag LOCUS_04700 <1 1332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941764.1:AMP-binding protein 1778 4018 gene locus_tag LOCUS_04710 1778 4018 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990705.1 protein_id gnl|my_center|LOCUS_04710 4842 4030 gene locus_tag LOCUS_04720 4842 4030 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020389.1 protein_id gnl|my_center|LOCUS_04720 5140 4940 gene locus_tag LOCUS_04730 5140 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 6227 5535 gene locus_tag LOCUS_04740 6227 5535 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877278.1 protein_id gnl|my_center|LOCUS_04740 6997 6299 gene locus_tag LOCUS_04750 6997 6299 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402640.1 protein_id gnl|my_center|LOCUS_04750 7764 6994 gene locus_tag LOCUS_04760 7764 6994 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877280.1 protein_id gnl|my_center|LOCUS_04760 9038 7764 gene locus_tag LOCUS_04770 9038 7764 CDS product cysteate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066469.1 protein_id gnl|my_center|LOCUS_04770 11312 9336 gene locus_tag LOCUS_04780 11312 9336 CDS product type B DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878196.1 protein_id gnl|my_center|LOCUS_04780 11577 11299 gene locus_tag LOCUS_04790 11577 11299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064268.1 protein_id gnl|my_center|LOCUS_04790 12086 11577 gene locus_tag LOCUS_04800 12086 11577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064269.1 protein_id gnl|my_center|LOCUS_04800 12415 14151 gene locus_tag LOCUS_04810 12415 14151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 14414 14758 gene locus_tag LOCUS_04820 14414 14758 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064179.1 protein_id gnl|my_center|LOCUS_04820 14807 16174 gene locus_tag LOCUS_04830 14807 16174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 >Feature sequence023 2063 381 gene locus_tag LOCUS_04840 2063 381 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022536.1 protein_id gnl|my_center|LOCUS_04840 3075 2074 gene locus_tag LOCUS_04850 3075 2074 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022537.1 protein_id gnl|my_center|LOCUS_04850 3578 3072 gene locus_tag LOCUS_04860 3578 3072 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065441.1 protein_id gnl|my_center|LOCUS_04860 3682 4440 gene locus_tag LOCUS_04870 3682 4440 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023442.1 protein_id gnl|my_center|LOCUS_04870 4531 5688 gene locus_tag LOCUS_04880 4531 5688 CDS product Vms1/Ankzf1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546631.1 protein_id gnl|my_center|LOCUS_04880 5869 9465 gene locus_tag LOCUS_04890 5869 9465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 9480 10139 gene locus_tag LOCUS_04900 9480 10139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 11207 10224 gene locus_tag LOCUS_04910 11207 10224 CDS product UbiA prenyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065984.1 protein_id gnl|my_center|LOCUS_04910 11966 11250 gene locus_tag LOCUS_04920 11966 11250 CDS product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020865.1 protein_id gnl|my_center|LOCUS_04920 12660 12208 gene locus_tag LOCUS_04930 12660 12208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 13282 12773 gene locus_tag LOCUS_04940 13282 12773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 13941 13402 gene locus_tag LOCUS_04950 13941 13402 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867611.1 protein_id gnl|my_center|LOCUS_04950 14636 13926 gene locus_tag LOCUS_04960 14636 13926 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065423.1 protein_id gnl|my_center|LOCUS_04960 14457 14498 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15358 14633 gene locus_tag LOCUS_04970 15358 14633 CDS product DUF166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024310.1 protein_id gnl|my_center|LOCUS_04970 >Feature sequence024 139 296 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 297 1355 gene locus_tag LOCUS_04980 297 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 1352 2194 gene locus_tag LOCUS_04990 1352 2194 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022038.1 protein_id gnl|my_center|LOCUS_04990 2610 3641 gene locus_tag LOCUS_05000 2610 3641 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_05000 3706 4815 gene locus_tag LOCUS_05010 gene trpD 3706 4815 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877269.1 protein_id gnl|my_center|LOCUS_05010 5495 4935 gene locus_tag LOCUS_05020 5495 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 5730 6551 gene locus_tag LOCUS_05030 5730 6551 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020999.1 protein_id gnl|my_center|LOCUS_05030 6916 6650 gene locus_tag LOCUS_05040 6916 6650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 7535 6948 gene locus_tag LOCUS_05050 7535 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 7831 7616 gene locus_tag LOCUS_05060 7831 7616 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393298.1 protein_id gnl|my_center|LOCUS_05060 8027 7791 gene locus_tag LOCUS_05070 8027 7791 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532021.1 protein_id gnl|my_center|LOCUS_05070 9856 8159 gene locus_tag LOCUS_05080 9856 8159 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064918.1 protein_id gnl|my_center|LOCUS_05080 10274 9885 gene locus_tag LOCUS_05090 10274 9885 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020172.1 protein_id gnl|my_center|LOCUS_05090 10495 11193 gene locus_tag LOCUS_05100 10495 11193 CDS product amino acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021487.1 protein_id gnl|my_center|LOCUS_05100 11389 11634 gene locus_tag LOCUS_05110 11389 11634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 11660 11731 gene locus_tag LOCUS_t00050 11660 11731 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 12172 11783 gene locus_tag LOCUS_05120 12172 11783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 13318 12260 gene locus_tag LOCUS_05130 gene endA 13318 12260 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023532.1 protein_id gnl|my_center|LOCUS_05130 14486 13332 gene locus_tag LOCUS_05140 14486 13332 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870657.1 protein_id gnl|my_center|LOCUS_05140 15093 14548 gene locus_tag LOCUS_05150 15093 14548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 >Feature sequence025 <1 785 gene locus_tag LOCUS_05160 <1 785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066027.1:ABC transporter permease 788 2539 gene locus_tag LOCUS_05170 788 2539 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020888.1 protein_id gnl|my_center|LOCUS_05170 3028 2690 gene locus_tag LOCUS_05180 3028 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 4035 3352 gene locus_tag LOCUS_05190 4035 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 4778 5440 gene locus_tag LOCUS_05200 4778 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 5523 5972 gene locus_tag LOCUS_05210 5523 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 6986 6117 gene locus_tag LOCUS_05220 6986 6117 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838714.1 protein_id gnl|my_center|LOCUS_05220 7390 7307 gene locus_tag LOCUS_t00060 7390 7307 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8360 7458 gene locus_tag LOCUS_05230 gene argF 8360 7458 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023243.1 protein_id gnl|my_center|LOCUS_05230 8771 8379 gene locus_tag LOCUS_05240 8771 8379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 9992 8772 gene locus_tag LOCUS_05250 9992 8772 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065549.1 protein_id gnl|my_center|LOCUS_05250 10469 10002 gene locus_tag LOCUS_05260 10469 10002 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022827.1 protein_id gnl|my_center|LOCUS_05260 10607 12355 gene locus_tag LOCUS_05270 10607 12355 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023084.1 protein_id gnl|my_center|LOCUS_05270 12352 14739 gene locus_tag LOCUS_05280 12352 14739 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023083.1 protein_id gnl|my_center|LOCUS_05280 15017 15334 gene locus_tag LOCUS_05290 gene yciH 15017 15334 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023951.1 protein_id gnl|my_center|LOCUS_05290 >Feature sequence026 848 96 gene locus_tag LOCUS_05300 848 96 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023864.1 protein_id gnl|my_center|LOCUS_05300 1018 872 gene locus_tag LOCUS_05310 1018 872 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065861.1 protein_id gnl|my_center|LOCUS_05310 1363 2583 gene locus_tag LOCUS_05320 gene maeB 1363 2583 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229415.1 protein_id gnl|my_center|LOCUS_05320 4036 3305 gene locus_tag LOCUS_05330 4036 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 5660 5151 gene locus_tag LOCUS_05340 5660 5151 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141447.1 protein_id gnl|my_center|LOCUS_05340 5876 6175 gene locus_tag LOCUS_05350 5876 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 6345 7103 gene locus_tag LOCUS_05360 6345 7103 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021582.1 protein_id gnl|my_center|LOCUS_05360 7890 7177 gene locus_tag LOCUS_05370 7890 7177 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066013.1 protein_id gnl|my_center|LOCUS_05370 7978 8460 gene locus_tag LOCUS_05380 7978 8460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 8533 9063 gene locus_tag LOCUS_05390 8533 9063 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878235.1 protein_id gnl|my_center|LOCUS_05390 9149 9760 gene locus_tag LOCUS_05400 9149 9760 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024143.1 protein_id gnl|my_center|LOCUS_05400 9768 10514 gene locus_tag LOCUS_05410 9768 10514 CDS product cobalt-precorrin-4/precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024142.1 protein_id gnl|my_center|LOCUS_05410 10667 11392 gene locus_tag LOCUS_05420 gene cbiG 10667 11392 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903134.1 protein_id gnl|my_center|LOCUS_05420 11376 12941 gene locus_tag LOCUS_05430 11376 12941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 12967 13605 gene locus_tag LOCUS_05440 12967 13605 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024140.1 protein_id gnl|my_center|LOCUS_05440 13586 14704 gene locus_tag LOCUS_05450 13586 14704 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020570.1 protein_id gnl|my_center|LOCUS_05450 >Feature sequence027 468 1226 gene locus_tag LOCUS_05460 468 1226 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020633.1 protein_id gnl|my_center|LOCUS_05460 1246 1968 gene locus_tag LOCUS_05470 1246 1968 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020634.1 protein_id gnl|my_center|LOCUS_05470 3160 2099 gene locus_tag LOCUS_05480 3160 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065646.1 protein_id gnl|my_center|LOCUS_05480 3860 3360 gene locus_tag LOCUS_05490 3860 3360 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065176.1 protein_id gnl|my_center|LOCUS_05490 4355 4188 gene locus_tag LOCUS_05500 4355 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 4656 4405 gene locus_tag LOCUS_05510 4656 4405 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023444.1 protein_id gnl|my_center|LOCUS_05510 6881 4671 gene locus_tag LOCUS_05520 6881 4671 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903216.1 protein_id gnl|my_center|LOCUS_05520 7116 7520 gene locus_tag LOCUS_05530 7116 7520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 7531 8760 gene locus_tag LOCUS_05540 7531 8760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 8760 9929 gene locus_tag LOCUS_05550 8760 9929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 9943 10941 gene locus_tag LOCUS_05560 9943 10941 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020662.1 protein_id gnl|my_center|LOCUS_05560 12648 11440 gene locus_tag LOCUS_05570 12648 11440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 13090 12680 gene locus_tag LOCUS_05580 13090 12680 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069168156.1 protein_id gnl|my_center|LOCUS_05580 13244 13080 gene locus_tag LOCUS_05590 13244 13080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 14629 13493 gene locus_tag LOCUS_05600 14629 13493 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021821.1 protein_id gnl|my_center|LOCUS_05600 >Feature sequence028 579 250 gene locus_tag LOCUS_05610 579 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 1138 1338 gene locus_tag LOCUS_05620 1138 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 2412 1447 gene locus_tag LOCUS_05630 gene hemB 2412 1447 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020627.1 protein_id gnl|my_center|LOCUS_05630 3640 2384 gene locus_tag LOCUS_05640 gene hemA 3640 2384 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020626.1 protein_id gnl|my_center|LOCUS_05640 4172 3600 gene locus_tag LOCUS_05650 4172 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 4636 4286 gene locus_tag LOCUS_05660 gene ahbB 4636 4286 CDS product siroheme decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064915.1 protein_id gnl|my_center|LOCUS_05660 7125 4768 gene locus_tag LOCUS_05670 7125 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 7274 8503 gene locus_tag LOCUS_05680 7274 8503 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943170.1 protein_id gnl|my_center|LOCUS_05680 9127 8519 gene locus_tag LOCUS_05690 9127 8519 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020322.1 protein_id gnl|my_center|LOCUS_05690 9430 9333 gene locus_tag LOCUS_t00070 9430 9333 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10687 9623 gene locus_tag LOCUS_05700 gene hisC 10687 9623 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064817.1 protein_id gnl|my_center|LOCUS_05700 11903 10662 gene locus_tag LOCUS_05710 11903 10662 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066055.1 protein_id gnl|my_center|LOCUS_05710 12541 11900 gene locus_tag LOCUS_05720 12541 11900 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878079.1 protein_id gnl|my_center|LOCUS_05720 12723 13208 gene locus_tag LOCUS_05730 12723 13208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 13372 13136 gene locus_tag LOCUS_05740 13372 13136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 13481 14290 gene locus_tag LOCUS_05750 13481 14290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 >Feature sequence029 <1 758 gene locus_tag LOCUS_05760 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021679.1:ABC transporter permease 809 1534 gene locus_tag LOCUS_05770 809 1534 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021673.1 protein_id gnl|my_center|LOCUS_05770 1633 1878 gene locus_tag LOCUS_05780 1633 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 2218 3180 gene locus_tag LOCUS_05790 2218 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 4265 3300 gene locus_tag LOCUS_05800 4265 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 4728 5042 gene locus_tag LOCUS_05810 4728 5042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 5223 6593 gene locus_tag LOCUS_05820 5223 6593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 6707 7846 gene locus_tag LOCUS_05830 6707 7846 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108945.1 protein_id gnl|my_center|LOCUS_05830 8013 9905 gene locus_tag LOCUS_05840 8013 9905 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021871.1 protein_id gnl|my_center|LOCUS_05840 12051 9994 gene locus_tag LOCUS_05850 12051 9994 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035498.1 protein_id gnl|my_center|LOCUS_05850 12852 12202 gene locus_tag LOCUS_05860 12852 12202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 >Feature sequence030 3 137 gene locus_tag LOCUS_05870 3 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 166 1500 gene locus_tag LOCUS_05880 166 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 1846 1583 gene locus_tag LOCUS_05890 1846 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 4721 1794 gene locus_tag LOCUS_05900 4721 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 4884 5678 gene locus_tag LOCUS_05910 gene cfbC 4884 5678 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase ATP-dependent reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023535.1 protein_id gnl|my_center|LOCUS_05910 5675 7066 gene locus_tag LOCUS_05920 gene cfbB 5675 7066 CDS product Ni-sirohydrochlorin a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023534.1 protein_id gnl|my_center|LOCUS_05920 7098 7502 gene locus_tag LOCUS_05930 7098 7502 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024076.1 protein_id gnl|my_center|LOCUS_05930 7778 8182 gene locus_tag LOCUS_05940 7778 8182 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022524.1 protein_id gnl|my_center|LOCUS_05940 8308 8601 gene locus_tag LOCUS_05950 8308 8601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 8904 8686 gene locus_tag LOCUS_05960 8904 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 9114 9572 gene locus_tag LOCUS_05970 9114 9572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 9755 10879 gene locus_tag LOCUS_05980 9755 10879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 10839 11030 gene locus_tag LOCUS_05990 10839 11030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 11584 11027 gene locus_tag LOCUS_06000 11584 11027 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022955.1 protein_id gnl|my_center|LOCUS_06000 12771 11581 gene locus_tag LOCUS_06010 12771 11581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 >Feature sequence031 465 235 gene locus_tag LOCUS_06020 465 235 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021598.1 protein_id gnl|my_center|LOCUS_06020 1417 545 gene locus_tag LOCUS_06030 1417 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 2663 1419 gene locus_tag LOCUS_06040 2663 1419 CDS product replication protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022958.1 protein_id gnl|my_center|LOCUS_06040 2782 3735 gene locus_tag LOCUS_06050 2782 3735 CDS product NOP5/NOP56 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902847.1 protein_id gnl|my_center|LOCUS_06050 3805 4353 gene locus_tag LOCUS_06060 3805 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 4397 5026 gene locus_tag LOCUS_06070 4397 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 5892 5050 gene locus_tag LOCUS_06080 5892 5050 CDS product DUF2099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022219.1 protein_id gnl|my_center|LOCUS_06080 6173 6562 gene locus_tag LOCUS_06090 6173 6562 CDS product transcriptional regulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065665.1 protein_id gnl|my_center|LOCUS_06090 7272 6682 gene locus_tag LOCUS_06100 gene afpA 7272 6682 CDS product archaeoflavoprotein AfpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064401.1 protein_id gnl|my_center|LOCUS_06100 7910 7314 gene locus_tag LOCUS_06110 7910 7314 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879016.1 protein_id gnl|my_center|LOCUS_06110 8225 9607 gene locus_tag LOCUS_06120 8225 9607 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_06120 10412 9753 gene locus_tag LOCUS_06130 10412 9753 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868327.1 protein_id gnl|my_center|LOCUS_06130 10797 10561 gene locus_tag LOCUS_06140 10797 10561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 12217 11060 gene locus_tag LOCUS_06150 12217 11060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 <13183 12461 gene locus_tag LOCUS_06160 <13183 12461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021688.1:aspartate--tRNA(Asn) ligase >Feature sequence032 829 68 gene locus_tag LOCUS_06170 829 68 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065164.1 protein_id gnl|my_center|LOCUS_06170 1773 826 gene locus_tag LOCUS_06180 1773 826 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021606.1 protein_id gnl|my_center|LOCUS_06180 1802 2068 gene locus_tag LOCUS_06190 1802 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 2434 2709 gene locus_tag LOCUS_06200 2434 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 3198 2854 gene locus_tag LOCUS_06210 3198 2854 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061032.1 protein_id gnl|my_center|LOCUS_06210 3553 3224 gene locus_tag LOCUS_06220 3553 3224 CDS product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065848.1 protein_id gnl|my_center|LOCUS_06220 3862 3626 gene locus_tag LOCUS_06230 3862 3626 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943587.1 protein_id gnl|my_center|LOCUS_06230 5572 3935 gene locus_tag LOCUS_06240 5572 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 6717 5620 gene locus_tag LOCUS_06250 6717 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 7414 6848 gene locus_tag LOCUS_06260 7414 6848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 8553 7474 gene locus_tag LOCUS_06270 8553 7474 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023833.1 protein_id gnl|my_center|LOCUS_06270 8991 8632 gene locus_tag LOCUS_06280 8991 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 9286 9149 gene locus_tag LOCUS_06290 9286 9149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 10727 9360 gene locus_tag LOCUS_06300 10727 9360 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022297.1 protein_id gnl|my_center|LOCUS_06300 11064 10882 gene locus_tag LOCUS_06310 11064 10882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 11370 11155 gene locus_tag LOCUS_06320 11370 11155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 >Feature sequence033 257 24 gene locus_tag LOCUS_06330 257 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 1116 544 gene locus_tag LOCUS_06340 1116 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 1925 1167 gene locus_tag LOCUS_06350 1925 1167 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867813.1 protein_id gnl|my_center|LOCUS_06350 2607 1918 gene locus_tag LOCUS_06360 2607 1918 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879142.1 protein_id gnl|my_center|LOCUS_06360 2987 2745 gene locus_tag LOCUS_06370 2987 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06370 3892 3023 gene locus_tag LOCUS_06380 3892 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06380 4281 6653 gene locus_tag LOCUS_06390 gene hdrA2 4281 6653 CDS product CoB-CoM heterodisulfide reductase HdrA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022820.1 protein_id gnl|my_center|LOCUS_06390 6653 7999 gene locus_tag LOCUS_06400 6653 7999 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022819.1 protein_id gnl|my_center|LOCUS_06400 7996 8646 gene locus_tag LOCUS_06410 7996 8646 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939676.1 protein_id gnl|my_center|LOCUS_06410 8643 9560 gene locus_tag LOCUS_06420 8643 9560 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_06420 11389 9896 gene locus_tag LOCUS_06430 11389 9896 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932736.1 protein_id gnl|my_center|LOCUS_06430 11446 11727 gene locus_tag LOCUS_06440 11446 11727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 11756 12592 gene locus_tag LOCUS_06450 11756 12592 CDS product DUF166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021826.1 protein_id gnl|my_center|LOCUS_06450 >Feature sequence034 636 196 gene locus_tag LOCUS_06460 636 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06460 667 849 gene locus_tag LOCUS_06470 667 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 1158 1334 gene locus_tag LOCUS_06480 1158 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 1406 1756 gene locus_tag LOCUS_06490 1406 1756 CDS product tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065620.1 protein_id gnl|my_center|LOCUS_06490 1753 2334 gene locus_tag LOCUS_06500 1753 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 2568 3692 gene locus_tag LOCUS_06510 gene acuC 2568 3692 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092826.1 protein_id gnl|my_center|LOCUS_06510 5722 3815 gene locus_tag LOCUS_06520 5722 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 5860 7071 gene locus_tag LOCUS_06530 5860 7071 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584144.1 protein_id gnl|my_center|LOCUS_06530 7071 7760 gene locus_tag LOCUS_06540 7071 7760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 8403 7753 gene locus_tag LOCUS_06550 8403 7753 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016533.1 protein_id gnl|my_center|LOCUS_06550 9236 9051 gene locus_tag LOCUS_06560 9236 9051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 9733 9518 gene locus_tag LOCUS_06570 9733 9518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 10752 9757 gene locus_tag LOCUS_06580 10752 9757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 <12574 11093 gene locus_tag LOCUS_06590 <12574 11093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001211395.1:acetyl-CoA hydrolase/transferase C-terminal domain-containing protein 11813 11885 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence035 882 247 gene locus_tag LOCUS_06600 882 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 1231 899 gene locus_tag LOCUS_06610 1231 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 1586 4270 gene locus_tag LOCUS_06620 1586 4270 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023974.1 protein_id gnl|my_center|LOCUS_06620 4788 4354 gene locus_tag LOCUS_06630 4788 4354 CDS product UPF0146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878243.1 protein_id gnl|my_center|LOCUS_06630 5579 4800 gene locus_tag LOCUS_06640 5579 4800 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022803.1 protein_id gnl|my_center|LOCUS_06640 5733 6770 gene locus_tag LOCUS_06650 gene ftsZ 5733 6770 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023772.1 protein_id gnl|my_center|LOCUS_06650 8052 6790 gene locus_tag LOCUS_06660 8052 6790 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020304.1 protein_id gnl|my_center|LOCUS_06660 8800 8093 gene locus_tag LOCUS_06670 8800 8093 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064937.1 protein_id gnl|my_center|LOCUS_06670 8974 9786 gene locus_tag LOCUS_06680 8974 9786 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582908.1 protein_id gnl|my_center|LOCUS_06680 10141 9866 gene locus_tag LOCUS_06690 10141 9866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 11646 10537 gene locus_tag LOCUS_06700 11646 10537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 11859 12422 gene locus_tag LOCUS_06710 11859 12422 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762930.1 protein_id gnl|my_center|LOCUS_06710 >Feature sequence036 970 263 gene locus_tag LOCUS_06720 970 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 1368 1292 gene locus_tag LOCUS_t00080 1368 1292 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1592 1520 gene locus_tag LOCUS_t00090 1592 1520 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1685 2677 gene locus_tag LOCUS_06730 1685 2677 CDS product DUF128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065980.1 protein_id gnl|my_center|LOCUS_06730 2723 3907 gene locus_tag LOCUS_06740 2723 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 3996 4385 gene locus_tag LOCUS_06750 3996 4385 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021540.1 protein_id gnl|my_center|LOCUS_06750 4561 5871 gene locus_tag LOCUS_06760 4561 5871 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750457.1 protein_id gnl|my_center|LOCUS_06760 7121 5985 gene locus_tag LOCUS_06770 7121 5985 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023790.1 protein_id gnl|my_center|LOCUS_06770 9093 7174 gene locus_tag LOCUS_06780 9093 7174 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020337.1 protein_id gnl|my_center|LOCUS_06780 9303 10949 gene locus_tag LOCUS_06790 gene ilvD 9303 10949 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021805.1 protein_id gnl|my_center|LOCUS_06790 10957 11553 gene locus_tag LOCUS_06800 gene thpR 10957 11553 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066123.1 protein_id gnl|my_center|LOCUS_06800 >Feature sequence037 19 426 gene locus_tag LOCUS_06810 19 426 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024057.1 protein_id gnl|my_center|LOCUS_06810 677 1555 gene locus_tag LOCUS_06820 677 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 1712 2575 gene locus_tag LOCUS_06830 1712 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 3339 2665 gene locus_tag LOCUS_06840 3339 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 4268 3489 gene locus_tag LOCUS_06850 gene cbiQ 4268 3489 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975656.1 protein_id gnl|my_center|LOCUS_06850 4734 4318 gene locus_tag LOCUS_06860 4734 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 5138 4731 gene locus_tag LOCUS_06870 5138 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 5764 5135 gene locus_tag LOCUS_06880 gene cbiM 5764 5135 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546305.1 protein_id gnl|my_center|LOCUS_06880 6565 5783 gene locus_tag LOCUS_06890 6565 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 7538 6780 gene locus_tag LOCUS_06900 7538 6780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 8563 7769 gene locus_tag LOCUS_06910 8563 7769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 11100 8878 gene locus_tag LOCUS_06920 11100 8878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 >Feature sequence038 <1 783 gene locus_tag LOCUS_06930 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010869822.1:EF-Tu/IF-2/RF-3 family GTPase 1117 839 gene locus_tag LOCUS_06940 1117 839 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160731.1 protein_id gnl|my_center|LOCUS_06940 1399 1887 gene locus_tag LOCUS_06950 1399 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 3407 2613 gene locus_tag LOCUS_06960 3407 2613 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020123.1 protein_id gnl|my_center|LOCUS_06960 4414 3428 gene locus_tag LOCUS_06970 4414 3428 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020124.1 protein_id gnl|my_center|LOCUS_06970 4542 5036 gene locus_tag LOCUS_06980 4542 5036 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020126.1 protein_id gnl|my_center|LOCUS_06980 5131 5580 gene locus_tag LOCUS_06990 5131 5580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 5593 6189 gene locus_tag LOCUS_07000 5593 6189 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941409.1 protein_id gnl|my_center|LOCUS_07000 6839 6264 gene locus_tag LOCUS_07010 6839 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 7558 6836 gene locus_tag LOCUS_07020 7558 6836 CDS product TIGR01458 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971814.1 protein_id gnl|my_center|LOCUS_07020 8571 8011 gene locus_tag LOCUS_07030 8571 8011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 9641 8841 gene locus_tag LOCUS_07040 9641 8841 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023894.1 protein_id gnl|my_center|LOCUS_07040 9765 10106 gene locus_tag LOCUS_07050 9765 10106 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877101.1 protein_id gnl|my_center|LOCUS_07050 11091 10135 gene locus_tag LOCUS_07060 11091 10135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 >Feature sequence039 <1 999 gene locus_tag LOCUS_07070 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022838.1:histone deacetylase 1032 1511 gene locus_tag LOCUS_07080 1032 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 1643 2344 gene locus_tag LOCUS_07090 1643 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 3828 2542 gene locus_tag LOCUS_07100 3828 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 3935 5548 gene locus_tag LOCUS_07110 gene sepS 3935 5548 CDS product O-phosphoserine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020149.1 protein_id gnl|my_center|LOCUS_07110 5611 6303 gene locus_tag LOCUS_07120 gene rpiA 5611 6303 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021687.1 protein_id gnl|my_center|LOCUS_07120 6308 7330 gene locus_tag LOCUS_07130 6308 7330 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064802.1 protein_id gnl|my_center|LOCUS_07130 8555 7563 gene locus_tag LOCUS_07140 8555 7563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 8973 10517 gene locus_tag LOCUS_07150 8973 10517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 10555 10815 gene locus_tag LOCUS_07160 10555 10815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 >Feature sequence040 1330 164 gene locus_tag LOCUS_07170 1330 164 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880128.1 protein_id gnl|my_center|LOCUS_07170 1458 3557 gene locus_tag LOCUS_07180 1458 3557 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023138.1 protein_id gnl|my_center|LOCUS_07180 3622 4482 gene locus_tag LOCUS_07190 3622 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 4479 5060 gene locus_tag LOCUS_07200 4479 5060 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024528.1 protein_id gnl|my_center|LOCUS_07200 5740 5543 gene locus_tag LOCUS_07210 5740 5543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 5811 6992 gene locus_tag LOCUS_07220 5811 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 7503 7132 gene locus_tag LOCUS_07230 7503 7132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 7693 8298 gene locus_tag LOCUS_07240 7693 8298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 10663 9053 gene locus_tag LOCUS_07250 10663 9053 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020870.1 protein_id gnl|my_center|LOCUS_07250 11178 10660 gene locus_tag LOCUS_07260 11178 10660 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877737.1 protein_id gnl|my_center|LOCUS_07260 >Feature sequence041 <1 3962 gene locus_tag LOCUS_07270 <1 3962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001123098.1:DUF11 domain-containing protein 4054 4554 gene locus_tag LOCUS_07280 gene hacB 4054 4554 CDS product homoaconitase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065791.1 protein_id gnl|my_center|LOCUS_07280 4551 5378 gene locus_tag LOCUS_07290 4551 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023654.1 protein_id gnl|my_center|LOCUS_07290 5706 6326 gene locus_tag LOCUS_07300 5706 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07300 7975 6323 gene locus_tag LOCUS_07310 7975 6323 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582481.1 protein_id gnl|my_center|LOCUS_07310 8189 8455 gene locus_tag LOCUS_07320 8189 8455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 9603 8500 gene locus_tag LOCUS_07330 gene cfbD 9603 8500 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023536.1 protein_id gnl|my_center|LOCUS_07330 10829 9609 gene locus_tag LOCUS_07340 gene cfbE 10829 9609 CDS product coenzyme F430 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023538.1 protein_id gnl|my_center|LOCUS_07340 11233 10838 gene locus_tag LOCUS_07350 gene cfbA 11233 10838 CDS product sirohydrochlorin nickelochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023539.1 protein_id gnl|my_center|LOCUS_07350 >Feature sequence042 84 839 gene locus_tag LOCUS_07360 84 839 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022932.1 protein_id gnl|my_center|LOCUS_07360 897 2096 gene locus_tag LOCUS_07370 gene trpB 897 2096 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022931.1 protein_id gnl|my_center|LOCUS_07370 2093 2860 gene locus_tag LOCUS_07380 gene trpA 2093 2860 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022930.1 protein_id gnl|my_center|LOCUS_07380 3894 2998 gene locus_tag LOCUS_07390 3894 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 5687 3987 gene locus_tag LOCUS_07400 gene argS 5687 3987 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064797.1 protein_id gnl|my_center|LOCUS_07400 5848 7086 gene locus_tag LOCUS_07410 5848 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 7596 7162 gene locus_tag LOCUS_07420 7596 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 8953 7640 gene locus_tag LOCUS_07430 8953 7640 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020936.1 protein_id gnl|my_center|LOCUS_07430 9432 8950 gene locus_tag LOCUS_07440 9432 8950 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941845.1 protein_id gnl|my_center|LOCUS_07440 9627 10823 gene locus_tag LOCUS_07450 9627 10823 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021450.1 protein_id gnl|my_center|LOCUS_07450 11046 10870 gene locus_tag LOCUS_07460 11046 10870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 >Feature sequence043 1276 176 gene locus_tag LOCUS_07470 gene mfnA 1276 176 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020065.1 protein_id gnl|my_center|LOCUS_07470 2343 1345 gene locus_tag LOCUS_07480 2343 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07480 3616 2291 gene locus_tag LOCUS_07490 3616 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07490 3812 4990 gene locus_tag LOCUS_07500 3812 4990 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023979.1 protein_id gnl|my_center|LOCUS_07500 5112 5273 gene locus_tag LOCUS_07510 5112 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 5283 5588 gene locus_tag LOCUS_07520 5283 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 5594 6265 gene locus_tag LOCUS_07530 5594 6265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 6267 6611 gene locus_tag LOCUS_07540 6267 6611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 6944 7984 gene locus_tag LOCUS_07550 6944 7984 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023783.1 protein_id gnl|my_center|LOCUS_07550 8173 9348 gene locus_tag LOCUS_07560 8173 9348 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022844.1 protein_id gnl|my_center|LOCUS_07560 9410 10645 gene locus_tag LOCUS_07570 9410 10645 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868848.1 protein_id gnl|my_center|LOCUS_07570 >Feature sequence044 <1 692 gene locus_tag LOCUS_07580 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876118.1:substrate-binding domain-containing protein 753 1448 gene locus_tag LOCUS_07590 753 1448 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060828.1 protein_id gnl|my_center|LOCUS_07590 1445 2206 gene locus_tag LOCUS_07600 1445 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 2246 2914 gene locus_tag LOCUS_07610 2246 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07610 3138 4400 gene locus_tag LOCUS_07620 3138 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 4473 4940 gene locus_tag LOCUS_07630 4473 4940 CDS product Tfx family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496415.1 protein_id gnl|my_center|LOCUS_07630 4987 5334 gene locus_tag LOCUS_07640 4987 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065385.1 protein_id gnl|my_center|LOCUS_07640 5331 5708 gene locus_tag LOCUS_07650 5331 5708 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240352.1 protein_id gnl|my_center|LOCUS_07650 6167 5724 gene locus_tag LOCUS_07660 6167 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 7303 6299 gene locus_tag LOCUS_07670 7303 6299 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250918.1 protein_id gnl|my_center|LOCUS_07670 8055 7324 gene locus_tag LOCUS_07680 8055 7324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 8134 8197 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8725 10035 gene locus_tag LOCUS_07690 8725 10035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 10159 10755 gene locus_tag LOCUS_07700 10159 10755 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023341.1 protein_id gnl|my_center|LOCUS_07700 >Feature sequence045 285 845 gene locus_tag LOCUS_07710 285 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 1581 922 gene locus_tag LOCUS_07720 1581 922 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022229.1 protein_id gnl|my_center|LOCUS_07720 2258 1641 gene locus_tag LOCUS_07730 2258 1641 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022229.1 protein_id gnl|my_center|LOCUS_07730 2783 2319 gene locus_tag LOCUS_07740 2783 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 2998 2780 gene locus_tag LOCUS_07750 2998 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 5916 3025 gene locus_tag LOCUS_07760 5916 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 6945 6013 gene locus_tag LOCUS_07770 6945 6013 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868810.1 protein_id gnl|my_center|LOCUS_07770 7575 6955 gene locus_tag LOCUS_07780 7575 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 9002 7593 gene locus_tag LOCUS_07790 gene hmgB 9002 7593 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903175.1 protein_id gnl|my_center|LOCUS_07790 9072 9380 gene locus_tag LOCUS_07800 9072 9380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 9551 10042 gene locus_tag LOCUS_07810 9551 10042 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876721.1 protein_id gnl|my_center|LOCUS_07810 10902 11020 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence046 2553 2191 gene locus_tag LOCUS_07820 2553 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 3085 2555 gene locus_tag LOCUS_07830 gene pdxT 3085 2555 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021577.1 protein_id gnl|my_center|LOCUS_07830 4034 3141 gene locus_tag LOCUS_07840 gene pdxS 4034 3141 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065155.1 protein_id gnl|my_center|LOCUS_07840 7743 4171 gene locus_tag LOCUS_07850 7743 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 9091 7988 gene locus_tag LOCUS_07860 9091 7988 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496792.1 protein_id gnl|my_center|LOCUS_07860 9301 9681 gene locus_tag LOCUS_07870 9301 9681 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020961.1 protein_id gnl|my_center|LOCUS_07870 9711 9923 gene locus_tag LOCUS_07880 9711 9923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 10052 10501 gene locus_tag LOCUS_07890 10052 10501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 >Feature sequence047 <1 653 gene locus_tag LOCUS_07900 <1 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021474.1:PspA/IM30 family protein 650 928 gene locus_tag LOCUS_07910 650 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021475.1 protein_id gnl|my_center|LOCUS_07910 1545 964 gene locus_tag LOCUS_07920 1545 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022099.1 protein_id gnl|my_center|LOCUS_07920 2601 1612 gene locus_tag LOCUS_07930 gene htpX 2601 1612 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022098.1 protein_id gnl|my_center|LOCUS_07930 5169 2626 gene locus_tag LOCUS_07940 5169 2626 CDS product DUF3160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023262.1 protein_id gnl|my_center|LOCUS_07940 5661 5260 gene locus_tag LOCUS_07950 5661 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07950 6785 5658 gene locus_tag LOCUS_07960 6785 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07960 6916 7689 gene locus_tag LOCUS_07970 6916 7689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 7730 8653 gene locus_tag LOCUS_07980 gene pyrB 7730 8653 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024378.1 protein_id gnl|my_center|LOCUS_07980 8646 9116 gene locus_tag LOCUS_07990 gene pyrI 8646 9116 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251145.1 protein_id gnl|my_center|LOCUS_07990 9167 9928 gene locus_tag LOCUS_08000 9167 9928 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022767.1 protein_id gnl|my_center|LOCUS_08000 10389 10057 gene locus_tag LOCUS_08010 10389 10057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 >Feature sequence048 2710 752 gene locus_tag LOCUS_08020 gene fpoL 2710 752 CDS product F420H2 dehydrogenase subunit FpoL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021518.1 protein_id gnl|my_center|LOCUS_08020 3017 2715 gene locus_tag LOCUS_08030 gene fpoK 3017 2715 CDS product F420H2 dehydrogenase subunit FpoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589525.1 protein_id gnl|my_center|LOCUS_08030 3306 3040 gene locus_tag LOCUS_08040 3306 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 3598 3299 gene locus_tag LOCUS_08050 3598 3299 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048140880.1 protein_id gnl|my_center|LOCUS_08050 4170 3619 gene locus_tag LOCUS_08060 4170 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 5228 4182 gene locus_tag LOCUS_08070 gene fpoH 5228 4182 CDS product F420H2 dehydrogenase subunit FpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065137.1 protein_id gnl|my_center|LOCUS_08070 6956 5241 gene locus_tag LOCUS_08080 6956 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 7544 6972 gene locus_tag LOCUS_08090 gene fpoB 7544 6972 CDS product F(420)H(2) dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021510.1 protein_id gnl|my_center|LOCUS_08090 7930 7535 gene locus_tag LOCUS_08100 gene fpoA 7930 7535 CDS product F420H2 dehydrogenase subunit FpoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021509.1 protein_id gnl|my_center|LOCUS_08100 8075 8995 gene locus_tag LOCUS_08110 8075 8995 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021005.1 protein_id gnl|my_center|LOCUS_08110 9056 9652 gene locus_tag LOCUS_08120 9056 9652 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020756.1 protein_id gnl|my_center|LOCUS_08120 9658 9831 gene locus_tag LOCUS_08130 9658 9831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 >Feature sequence049 <1 1109 gene locus_tag LOCUS_08140 <1 1109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879245.1:ammonium transporter 1167 1496 gene locus_tag LOCUS_08150 1167 1496 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064662.1 protein_id gnl|my_center|LOCUS_08150 2481 1567 gene locus_tag LOCUS_08160 2481 1567 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941492.1 protein_id gnl|my_center|LOCUS_08160 4016 2571 gene locus_tag LOCUS_08170 4016 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 3925 4227 gene locus_tag LOCUS_08180 3925 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 4387 6123 gene locus_tag LOCUS_08190 4387 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 6527 7315 gene locus_tag LOCUS_08200 6527 7315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 8959 7526 gene locus_tag LOCUS_08210 8959 7526 CDS product C45 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022064.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence050 584 1021 gene locus_tag LOCUS_08220 584 1021 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769565.1 protein_id gnl|my_center|LOCUS_08220 2665 1076 gene locus_tag LOCUS_08230 2665 1076 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877458.1 protein_id gnl|my_center|LOCUS_08230 2850 2662 gene locus_tag LOCUS_08240 2850 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877459.1 protein_id gnl|my_center|LOCUS_08240 3372 4157 gene locus_tag LOCUS_08250 3372 4157 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_08250 4692 4252 gene locus_tag LOCUS_08260 gene mscL 4692 4252 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_08260 5997 4924 gene locus_tag LOCUS_08270 5997 4924 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942697.1 protein_id gnl|my_center|LOCUS_08270 7807 6134 gene locus_tag LOCUS_08280 7807 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 9155 7830 gene locus_tag LOCUS_08290 9155 7830 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189169.1 protein_id gnl|my_center|LOCUS_08290 9149 9388 gene locus_tag LOCUS_08300 9149 9388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 >Feature sequence051 515 30 gene locus_tag LOCUS_08310 515 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 733 2472 gene locus_tag LOCUS_08320 733 2472 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249837.1 protein_id gnl|my_center|LOCUS_08320 4331 2586 gene locus_tag LOCUS_08330 4331 2586 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878912.1 protein_id gnl|my_center|LOCUS_08330 4538 5092 gene locus_tag LOCUS_08340 4538 5092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 5354 6382 gene locus_tag LOCUS_08350 gene asd 5354 6382 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020482.1 protein_id gnl|my_center|LOCUS_08350 6383 7369 gene locus_tag LOCUS_08360 gene ahbD 6383 7369 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_08360 7374 7967 gene locus_tag LOCUS_08370 7374 7967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 9849 8122 gene locus_tag LOCUS_08380 9849 8122 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943274.1 protein_id gnl|my_center|LOCUS_08380 >Feature sequence052 941 1804 gene locus_tag LOCUS_08390 941 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 1856 2806 gene locus_tag LOCUS_08400 1856 2806 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023086.1 protein_id gnl|my_center|LOCUS_08400 2816 3673 gene locus_tag LOCUS_08410 2816 3673 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023085.1 protein_id gnl|my_center|LOCUS_08410 3675 4892 gene locus_tag LOCUS_08420 gene larA 3675 4892 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860456.1 protein_id gnl|my_center|LOCUS_08420 5310 4969 gene locus_tag LOCUS_08430 5310 4969 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_08430 5594 5307 gene locus_tag LOCUS_08440 5594 5307 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869934.1 protein_id gnl|my_center|LOCUS_08440 5859 6134 gene locus_tag LOCUS_08450 5859 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 6245 6553 gene locus_tag LOCUS_08460 6245 6553 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228510.1 protein_id gnl|my_center|LOCUS_08460 6686 7450 gene locus_tag LOCUS_08470 6686 7450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 8563 7568 gene locus_tag LOCUS_08480 gene ilvC 8563 7568 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023690.1 protein_id gnl|my_center|LOCUS_08480 9236 8739 gene locus_tag LOCUS_08490 gene ilvN 9236 8739 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_08490 <10442 9233 gene locus_tag LOCUS_08500 <10442 9233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023692.1:acetolactate synthase large subunit >Feature sequence053 <1 696 gene locus_tag LOCUS_08510 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021309.1:23S rRNA (uridine(2552)-2'-O)-methyltransferase 790 2076 gene locus_tag LOCUS_08520 gene glmM 790 2076 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250059.1 protein_id gnl|my_center|LOCUS_08520 2170 3087 gene locus_tag LOCUS_08530 gene aglJ 2170 3087 CDS product S-layer glycoprotein N-glycosyltransferase AglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024210.1 protein_id gnl|my_center|LOCUS_08530 3976 3095 gene locus_tag LOCUS_08540 3976 3095 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546652.1 protein_id gnl|my_center|LOCUS_08540 4986 3973 gene locus_tag LOCUS_08550 4986 3973 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_08550 7010 4983 gene locus_tag LOCUS_08560 gene fdhF 7010 4983 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774551.1 protein_id gnl|my_center|LOCUS_08560 7231 8505 gene locus_tag LOCUS_08570 7231 8505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 8666 9613 gene locus_tag LOCUS_08580 8666 9613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 >Feature sequence054 1787 1044 gene locus_tag LOCUS_08590 1787 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 2628 2140 gene locus_tag LOCUS_08600 2628 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 2805 3614 gene locus_tag LOCUS_08610 2805 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 3666 4349 gene locus_tag LOCUS_08620 3666 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 5416 4421 gene locus_tag LOCUS_08630 gene rtcA 5416 4421 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024505.1 protein_id gnl|my_center|LOCUS_08630 5688 5413 gene locus_tag LOCUS_08640 5688 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 6248 5685 gene locus_tag LOCUS_08650 6248 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 6849 6256 gene locus_tag LOCUS_08660 6849 6256 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020764.1 protein_id gnl|my_center|LOCUS_08660 6848 7000 gene locus_tag LOCUS_08670 6848 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 9328 6941 gene locus_tag LOCUS_08680 9328 6941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 9602 10036 gene locus_tag LOCUS_08690 9602 10036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 >Feature sequence055 431 1291 gene locus_tag LOCUS_08700 431 1291 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_08700 1611 1348 gene locus_tag LOCUS_08710 1611 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 1879 2793 gene locus_tag LOCUS_08720 gene pstC 1879 2793 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_08720 3396 2983 gene locus_tag LOCUS_08730 3396 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 4121 3396 gene locus_tag LOCUS_08740 4121 3396 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296408.1 protein_id gnl|my_center|LOCUS_08740 4813 4118 gene locus_tag LOCUS_08750 4813 4118 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296409.1 protein_id gnl|my_center|LOCUS_08750 5432 5698 gene locus_tag LOCUS_08760 5432 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 6255 5806 gene locus_tag LOCUS_08770 6255 5806 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_08770 6307 7407 gene locus_tag LOCUS_08780 6307 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08780 7377 9311 gene locus_tag LOCUS_08790 7377 9311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08790 9419 10078 gene locus_tag LOCUS_08800 gene hisA 9419 10078 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020276.1 protein_id gnl|my_center|LOCUS_08800 >Feature sequence056 2164 419 gene locus_tag LOCUS_08810 2164 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 2273 3049 gene locus_tag LOCUS_08820 2273 3049 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020095.1 protein_id gnl|my_center|LOCUS_08820 3943 3251 gene locus_tag LOCUS_08830 3943 3251 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020399.1 protein_id gnl|my_center|LOCUS_08830 4420 3998 gene locus_tag LOCUS_08840 gene nikR 4420 3998 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023967.1 protein_id gnl|my_center|LOCUS_08840 4650 5213 gene locus_tag LOCUS_08850 4650 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066058.1 protein_id gnl|my_center|LOCUS_08850 5234 5650 gene locus_tag LOCUS_08860 5234 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 5778 7094 gene locus_tag LOCUS_08870 5778 7094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 7166 7933 gene locus_tag LOCUS_08880 7166 7933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022686.1 protein_id gnl|my_center|LOCUS_08880 8014 8535 gene locus_tag LOCUS_08890 8014 8535 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258997.1 protein_id gnl|my_center|LOCUS_08890 8540 8731 gene locus_tag LOCUS_08900 8540 8731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 9263 8871 gene locus_tag LOCUS_08910 9263 8871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 9438 9277 gene locus_tag LOCUS_08920 9438 9277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 9872 9453 gene locus_tag LOCUS_08930 9872 9453 CDS product DUF61 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250746.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence057 2860 908 gene locus_tag LOCUS_08940 2860 908 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064995.1 protein_id gnl|my_center|LOCUS_08940 4395 2857 gene locus_tag LOCUS_08950 4395 2857 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_08950 4571 5893 gene locus_tag LOCUS_08960 4571 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 6044 6772 gene locus_tag LOCUS_08970 6044 6772 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146498.1 protein_id gnl|my_center|LOCUS_08970 6796 8640 gene locus_tag LOCUS_08980 6796 8640 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023586.1 protein_id gnl|my_center|LOCUS_08980 8621 9868 gene locus_tag LOCUS_08990 8621 9868 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871132.1 protein_id gnl|my_center|LOCUS_08990 >Feature sequence058 361 537 gene locus_tag LOCUS_09000 361 537 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020483.1 protein_id gnl|my_center|LOCUS_09000 928 3561 gene locus_tag LOCUS_09010 928 3561 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392653.1 protein_id gnl|my_center|LOCUS_09010 4365 3634 gene locus_tag LOCUS_09020 4365 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 4603 5019 gene locus_tag LOCUS_09030 4603 5019 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020987.1 protein_id gnl|my_center|LOCUS_09030 5009 6256 gene locus_tag LOCUS_09040 5009 6256 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023357.1 protein_id gnl|my_center|LOCUS_09040 6253 6474 gene locus_tag LOCUS_09050 6253 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 6471 7958 gene locus_tag LOCUS_09060 gene serS 6471 7958 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876746.1 protein_id gnl|my_center|LOCUS_09060 8380 9855 gene locus_tag LOCUS_09070 8380 9855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022222.1 protein_id gnl|my_center|LOCUS_09070 >Feature sequence059 723 139 gene locus_tag LOCUS_09080 723 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 2049 832 gene locus_tag LOCUS_09090 gene priS 2049 832 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020695.1 protein_id gnl|my_center|LOCUS_09090 2856 2119 gene locus_tag LOCUS_09100 2856 2119 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066008.1 protein_id gnl|my_center|LOCUS_09100 2977 3837 gene locus_tag LOCUS_09110 2977 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 3985 4173 gene locus_tag LOCUS_09120 3985 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 4336 4494 gene locus_tag LOCUS_09130 4336 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 4629 5360 gene locus_tag LOCUS_09140 gene gpmA 4629 5360 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807430.1 protein_id gnl|my_center|LOCUS_09140 5895 5389 gene locus_tag LOCUS_09150 5895 5389 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020492.1 protein_id gnl|my_center|LOCUS_09150 6055 6849 gene locus_tag LOCUS_09160 6055 6849 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064937.1 protein_id gnl|my_center|LOCUS_09160 7253 6999 gene locus_tag LOCUS_09170 7253 6999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 <9890 7267 gene locus_tag LOCUS_09180 <9890 7267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942076.1:SpoIIE family protein phosphatase >Feature sequence060 1204 245 gene locus_tag LOCUS_09190 1204 245 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439262.1 protein_id gnl|my_center|LOCUS_09190 1500 1201 gene locus_tag LOCUS_09200 1500 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 1555 1752 gene locus_tag LOCUS_09210 1555 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 1768 1923 gene locus_tag LOCUS_09220 1768 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 1910 2590 gene locus_tag LOCUS_09230 1910 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 4881 2716 gene locus_tag LOCUS_09240 4881 2716 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_09240 5631 6062 gene locus_tag LOCUS_09250 5631 6062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 6269 6197 gene locus_tag LOCUS_t00100 6269 6197 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6440 6255 gene locus_tag LOCUS_09260 6440 6255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 6527 7282 gene locus_tag LOCUS_09270 6527 7282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 8495 7317 gene locus_tag LOCUS_09280 8495 7317 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065771.1 protein_id gnl|my_center|LOCUS_09280 <9500 8773 gene locus_tag LOCUS_09290 <9500 8773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023587.1:DUF4921 family protein >Feature sequence061 349 35 gene locus_tag LOCUS_09300 349 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 606 1556 gene locus_tag LOCUS_09310 606 1556 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967612.1 protein_id gnl|my_center|LOCUS_09310 2109 1864 gene locus_tag LOCUS_09320 2109 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 2984 3922 gene locus_tag LOCUS_09330 2984 3922 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203335.1 protein_id gnl|my_center|LOCUS_09330 4048 5079 gene locus_tag LOCUS_09340 4048 5079 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021661.1 protein_id gnl|my_center|LOCUS_09340 5275 6987 gene locus_tag LOCUS_09350 gene glgP 5275 6987 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584150.1 protein_id gnl|my_center|LOCUS_09350 8395 7043 gene locus_tag LOCUS_09360 8395 7043 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860275.1 protein_id gnl|my_center|LOCUS_09360 9083 8718 gene locus_tag LOCUS_09370 9083 8718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 >Feature sequence062 514 11 gene locus_tag LOCUS_09380 514 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 654 899 gene locus_tag LOCUS_09390 654 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 992 1279 gene locus_tag LOCUS_09400 992 1279 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393300.1 protein_id gnl|my_center|LOCUS_09400 1276 1503 gene locus_tag LOCUS_09410 1276 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 2136 1771 gene locus_tag LOCUS_09420 2136 1771 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_09420 2423 2133 gene locus_tag LOCUS_09430 2423 2133 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_09430 3152 2637 gene locus_tag LOCUS_09440 3152 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 3299 3478 gene locus_tag LOCUS_09450 3299 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 3508 3852 gene locus_tag LOCUS_09460 3508 3852 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250020.1 protein_id gnl|my_center|LOCUS_09460 8211 4045 gene locus_tag LOCUS_09470 8211 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 8643 8422 gene locus_tag LOCUS_09480 8643 8422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 >Feature sequence063 95 1213 gene locus_tag LOCUS_09490 95 1213 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936854.1 protein_id gnl|my_center|LOCUS_09490 1206 1889 gene locus_tag LOCUS_09500 1206 1889 CDS product RelA/SpoT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204953.1 protein_id gnl|my_center|LOCUS_09500 2939 1929 gene locus_tag LOCUS_09510 2939 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 4428 3001 gene locus_tag LOCUS_09520 gene purD 4428 3001 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878654.1 protein_id gnl|my_center|LOCUS_09520 4624 5949 gene locus_tag LOCUS_09530 gene glnA 4624 5949 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393265.1 protein_id gnl|my_center|LOCUS_09530 6094 6168 gene locus_tag LOCUS_t00110 6094 6168 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 6404 6724 gene locus_tag LOCUS_09540 6404 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 7010 7858 gene locus_tag LOCUS_09550 7010 7858 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_09550 7859 8602 gene locus_tag LOCUS_09560 7859 8602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 >Feature sequence064 <1 797 gene locus_tag LOCUS_09570 <1 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941766.1:Xaa-Pro peptidase family protein 1708 947 gene locus_tag LOCUS_09580 1708 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 2783 1995 gene locus_tag LOCUS_09590 2783 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 3422 3081 gene locus_tag LOCUS_09600 3422 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 4085 3459 gene locus_tag LOCUS_09610 4085 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 4009 4176 gene locus_tag LOCUS_09620 4009 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 4249 5544 gene locus_tag LOCUS_09630 gene aspC 4249 5544 CDS product aspartate/prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227669.1 protein_id gnl|my_center|LOCUS_09630 7270 5639 gene locus_tag LOCUS_09640 7270 5639 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020198.1 protein_id gnl|my_center|LOCUS_09640 8160 7267 gene locus_tag LOCUS_09650 8160 7267 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020197.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence065 33 332 gene locus_tag LOCUS_09660 33 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 489 1340 gene locus_tag LOCUS_09670 489 1340 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929171.1 protein_id gnl|my_center|LOCUS_09670 1572 1351 gene locus_tag LOCUS_09680 1572 1351 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022122.1 protein_id gnl|my_center|LOCUS_09680 2644 1691 gene locus_tag LOCUS_09690 2644 1691 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020859.1 protein_id gnl|my_center|LOCUS_09690 2795 3034 gene locus_tag LOCUS_09700 2795 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 3103 3273 gene locus_tag LOCUS_09710 3103 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 3342 3524 gene locus_tag LOCUS_09720 3342 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 4134 3445 gene locus_tag LOCUS_09730 4134 3445 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021972.1 protein_id gnl|my_center|LOCUS_09730 4703 4110 gene locus_tag LOCUS_09740 4703 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 5581 4730 gene locus_tag LOCUS_09750 5581 4730 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023435.1 protein_id gnl|my_center|LOCUS_09750 6822 5578 gene locus_tag LOCUS_09760 6822 5578 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 protein_id gnl|my_center|LOCUS_09760 6949 7416 gene locus_tag LOCUS_09770 6949 7416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020180.1 protein_id gnl|my_center|LOCUS_09770 7575 7835 gene locus_tag LOCUS_09780 7575 7835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 7873 7948 gene locus_tag LOCUS_t00120 7873 7948 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8267 8554 gene locus_tag LOCUS_09790 8267 8554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 >Feature sequence066 126 620 gene locus_tag LOCUS_09800 126 620 CDS product Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066022.1 protein_id gnl|my_center|LOCUS_09800 780 628 gene locus_tag LOCUS_09810 780 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1250 855 gene locus_tag LOCUS_09820 1250 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 2002 1364 gene locus_tag LOCUS_09830 2002 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 2387 3298 gene locus_tag LOCUS_09840 2387 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 5156 3372 gene locus_tag LOCUS_09850 5156 3372 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_09850 5672 5280 gene locus_tag LOCUS_09860 5672 5280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09860 5644 5841 gene locus_tag LOCUS_09870 5644 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 5878 6753 gene locus_tag LOCUS_09880 5878 6753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 6683 6925 gene locus_tag LOCUS_09890 6683 6925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 6901 7155 gene locus_tag LOCUS_09900 6901 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 7603 7322 gene locus_tag LOCUS_09910 7603 7322 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938763.1 protein_id gnl|my_center|LOCUS_09910 <8666 7648 gene locus_tag LOCUS_09920 <8666 7648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402930.1:PAS domain S-box protein >Feature sequence067 854 525 gene locus_tag LOCUS_09930 854 525 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020176.1 protein_id gnl|my_center|LOCUS_09930 1489 812 gene locus_tag LOCUS_09940 1489 812 CDS product archaetidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020175.1 protein_id gnl|my_center|LOCUS_09940 2073 1486 gene locus_tag LOCUS_09950 2073 1486 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020174.1 protein_id gnl|my_center|LOCUS_09950 2849 2070 gene locus_tag LOCUS_09960 gene artA 2849 2070 CDS product archaeosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879538.1 protein_id gnl|my_center|LOCUS_09960 2987 6367 gene locus_tag LOCUS_09970 2987 6367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 6790 7155 gene locus_tag LOCUS_09980 6790 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence068 2187 112 gene locus_tag LOCUS_09990 2187 112 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228571.1 protein_id gnl|my_center|LOCUS_09990 3340 2174 gene locus_tag LOCUS_10000 3340 2174 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909096.1 protein_id gnl|my_center|LOCUS_10000 5013 3352 gene locus_tag LOCUS_10010 5013 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10010 6040 5015 gene locus_tag LOCUS_10020 6040 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 7081 6095 gene locus_tag LOCUS_10030 7081 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 7277 8308 gene locus_tag LOCUS_10040 7277 8308 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530666.1 protein_id gnl|my_center|LOCUS_10040 >Feature sequence069 1328 354 gene locus_tag LOCUS_10050 1328 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 1920 1609 gene locus_tag LOCUS_10060 1920 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 2096 2371 gene locus_tag LOCUS_10070 2096 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 4778 2418 gene locus_tag LOCUS_10080 4778 2418 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903758.1 protein_id gnl|my_center|LOCUS_10080 5262 4789 gene locus_tag LOCUS_10090 5262 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 6059 5259 gene locus_tag LOCUS_10100 6059 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 <8338 6056 gene locus_tag LOCUS_10110 <8338 6056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947405.1:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence070 <1 1099 gene locus_tag LOCUS_10120 <1 1099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020630.1:glutamate-1-semialdehyde 2,1-aminomutase 1102 2007 gene locus_tag LOCUS_10130 gene hemC 1102 2007 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020631.1 protein_id gnl|my_center|LOCUS_10130 1994 3466 gene locus_tag LOCUS_10140 gene cobA 1994 3466 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_10140 3463 4632 gene locus_tag LOCUS_10150 gene ahbC 3463 4632 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938157.1 protein_id gnl|my_center|LOCUS_10150 5206 7308 gene locus_tag LOCUS_10160 5206 7308 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023875.1 protein_id gnl|my_center|LOCUS_10160 7866 7931 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence071 398 883 gene locus_tag LOCUS_10170 398 883 CDS product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065830.1 protein_id gnl|my_center|LOCUS_10170 1078 1797 gene locus_tag LOCUS_10180 1078 1797 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148183444.1 protein_id gnl|my_center|LOCUS_10180 1910 3466 gene locus_tag LOCUS_10190 1910 3466 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878560.1 protein_id gnl|my_center|LOCUS_10190 4675 3500 gene locus_tag LOCUS_10200 4675 3500 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870834.1 protein_id gnl|my_center|LOCUS_10200 4911 5513 gene locus_tag LOCUS_10210 4911 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 5557 6732 gene locus_tag LOCUS_10220 5557 6732 CDS product lpg1639 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947366.1 protein_id gnl|my_center|LOCUS_10220 6936 7238 gene locus_tag LOCUS_10230 6936 7238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10230 7847 7299 gene locus_tag LOCUS_10240 7847 7299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 8080 7940 gene locus_tag LOCUS_10250 8080 7940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence072 <1 854 gene locus_tag LOCUS_10260 <1 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023473.1:CCA tRNA nucleotidyltransferase 1902 880 gene locus_tag LOCUS_10270 1902 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1903 2121 gene locus_tag LOCUS_10280 1903 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 2285 4387 gene locus_tag LOCUS_10290 2285 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 4719 5720 gene locus_tag LOCUS_10300 gene amrS 4719 5720 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546747.1 protein_id gnl|my_center|LOCUS_10300 5814 7079 gene locus_tag LOCUS_10310 gene thiC 5814 7079 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020319.1 protein_id gnl|my_center|LOCUS_10310 7898 7242 gene locus_tag LOCUS_10320 7898 7242 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064948.1 protein_id gnl|my_center|LOCUS_10320 >Feature sequence073 3291 1096 gene locus_tag LOCUS_10330 3291 1096 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021278.1 protein_id gnl|my_center|LOCUS_10330 3646 5076 gene locus_tag LOCUS_10340 3646 5076 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020190.1 protein_id gnl|my_center|LOCUS_10340 5088 6080 gene locus_tag LOCUS_10350 gene purM 5088 6080 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066059.1 protein_id gnl|my_center|LOCUS_10350 6455 6192 gene locus_tag LOCUS_10360 6455 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 6653 6456 gene locus_tag LOCUS_10370 6653 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 7479 6799 gene locus_tag LOCUS_10380 7479 6799 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082088944.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence074 552 10 gene locus_tag LOCUS_10390 552 10 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021137.1 protein_id gnl|my_center|LOCUS_10390 1023 568 gene locus_tag LOCUS_10400 1023 568 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066175.1 protein_id gnl|my_center|LOCUS_10400 2466 1204 gene locus_tag LOCUS_10410 gene aroA 2466 1204 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024417.1 protein_id gnl|my_center|LOCUS_10410 3270 2539 gene locus_tag LOCUS_10420 gene rsmA 3270 2539 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876939.1 protein_id gnl|my_center|LOCUS_10420 3919 3335 gene locus_tag LOCUS_10430 3919 3335 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065124.1 protein_id gnl|my_center|LOCUS_10430 4289 3942 gene locus_tag LOCUS_10440 4289 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 4581 4291 gene locus_tag LOCUS_10450 4581 4291 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021460.1 protein_id gnl|my_center|LOCUS_10450 5902 4547 gene locus_tag LOCUS_10460 5902 4547 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021461.1 protein_id gnl|my_center|LOCUS_10460 6647 6042 gene locus_tag LOCUS_10470 gene trmY 6647 6042 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066221.1 protein_id gnl|my_center|LOCUS_10470 6796 7383 gene locus_tag LOCUS_10480 6796 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 >Feature sequence075 50 505 gene locus_tag LOCUS_10490 50 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 722 901 gene locus_tag LOCUS_10500 722 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 1875 919 gene locus_tag LOCUS_10510 1875 919 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023811.1 protein_id gnl|my_center|LOCUS_10510 2143 2808 gene locus_tag LOCUS_10520 2143 2808 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877484.1 protein_id gnl|my_center|LOCUS_10520 2909 3325 gene locus_tag LOCUS_10530 2909 3325 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002489699.1 protein_id gnl|my_center|LOCUS_10530 4379 3411 gene locus_tag LOCUS_10540 4379 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 4695 4864 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5421 5239 gene locus_tag LOCUS_10550 5421 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 5741 5346 gene locus_tag LOCUS_10560 5741 5346 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892103.1 protein_id gnl|my_center|LOCUS_10560 6277 6834 gene locus_tag LOCUS_10570 6277 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence076 <1 684 gene locus_tag LOCUS_10580 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023893.1:methyl coenzyme M reductase system, component A2 686 2212 gene locus_tag LOCUS_10590 686 2212 CDS product methanogenesis marker 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023892.1 protein_id gnl|my_center|LOCUS_10590 2213 2638 gene locus_tag LOCUS_10600 2213 2638 CDS product methanogenesis marker 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065869.1 protein_id gnl|my_center|LOCUS_10600 2648 3085 gene locus_tag LOCUS_10610 2648 3085 CDS product methanogenesis marker 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066559.1 protein_id gnl|my_center|LOCUS_10610 3082 4308 gene locus_tag LOCUS_10620 3082 4308 CDS product methanogenesis marker 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023889.1 protein_id gnl|my_center|LOCUS_10620 4310 4885 gene locus_tag LOCUS_10630 4310 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 4878 5801 gene locus_tag LOCUS_10640 4878 5801 CDS product methanogenesis marker 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023887.1 protein_id gnl|my_center|LOCUS_10640 5811 6254 gene locus_tag LOCUS_10650 5811 6254 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065868.1 protein_id gnl|my_center|LOCUS_10650 6700 6341 gene locus_tag LOCUS_10660 6700 6341 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065940.1 protein_id gnl|my_center|LOCUS_10660 7487 6954 gene locus_tag LOCUS_10670 7487 6954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 >Feature sequence077 315 995 gene locus_tag LOCUS_10680 315 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 1389 988 gene locus_tag LOCUS_10690 1389 988 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316403.1 protein_id gnl|my_center|LOCUS_10690 2509 1583 gene locus_tag LOCUS_10700 gene twy1 2509 1583 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020099.1 protein_id gnl|my_center|LOCUS_10700 2629 3357 gene locus_tag LOCUS_10710 2629 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 3526 3723 gene locus_tag LOCUS_10720 3526 3723 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 protein_id gnl|my_center|LOCUS_10720 4630 3887 gene locus_tag LOCUS_10730 4630 3887 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_10730 4960 4667 gene locus_tag LOCUS_10740 4960 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10740 5906 4962 gene locus_tag LOCUS_10750 5906 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10750 7449 5974 gene locus_tag LOCUS_10760 7449 5974 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932766.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence078 21 3245 gene locus_tag LOCUS_10770 21 3245 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024425.1 protein_id gnl|my_center|LOCUS_10770 5013 3427 gene locus_tag LOCUS_10780 5013 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 5226 6443 gene locus_tag LOCUS_10790 5226 6443 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142886.1 protein_id gnl|my_center|LOCUS_10790 6840 6496 gene locus_tag LOCUS_10800 6840 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 <7494 6875 gene locus_tag LOCUS_10810 <7494 6875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021337.1:argininosuccinate lyase >Feature sequence079 3483 1669 gene locus_tag LOCUS_10820 gene rpoB 3483 1669 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021285.1 protein_id gnl|my_center|LOCUS_10820 4966 3476 gene locus_tag LOCUS_10830 4966 3476 CDS product DNA-directed RNA polymerase subunit B'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755883.1 protein_id gnl|my_center|LOCUS_10830 5278 4982 gene locus_tag LOCUS_10840 5278 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 6495 5410 gene locus_tag LOCUS_10850 6495 5410 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020259.1 protein_id gnl|my_center|LOCUS_10850 6980 6492 gene locus_tag LOCUS_10860 6980 6492 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878133.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence080 731 261 gene locus_tag LOCUS_10870 731 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10870 1622 909 gene locus_tag LOCUS_10880 1622 909 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942367.1 protein_id gnl|my_center|LOCUS_10880 4354 1619 gene locus_tag LOCUS_10890 4354 1619 CDS product oligosaccharyl transferase, archaeosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065792.1 protein_id gnl|my_center|LOCUS_10890 5187 4519 gene locus_tag LOCUS_10900 5187 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942499.1 protein_id gnl|my_center|LOCUS_10900 5384 5845 gene locus_tag LOCUS_10910 5384 5845 CDS product DUF2124 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021715.1 protein_id gnl|my_center|LOCUS_10910 6004 5927 gene locus_tag LOCUS_t00130 6004 5927 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 6217 6597 gene locus_tag LOCUS_10920 6217 6597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 <7246 6746 gene locus_tag LOCUS_10930 <7246 6746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060998.1:7-carboxy-7-deazaguanine synthase QueE >Feature sequence081 1425 769 gene locus_tag LOCUS_10940 1425 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 3216 1483 gene locus_tag LOCUS_10950 gene glyS 3216 1483 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020156.1 protein_id gnl|my_center|LOCUS_10950 3451 3819 gene locus_tag LOCUS_10960 3451 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 5184 3946 gene locus_tag LOCUS_10970 5184 3946 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_10970 5445 6536 gene locus_tag LOCUS_10980 gene carA 5445 6536 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022130.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence082 684 932 gene locus_tag LOCUS_10990 684 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 1648 1217 gene locus_tag LOCUS_11000 1648 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 2365 1949 gene locus_tag LOCUS_11010 2365 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 2888 4765 gene locus_tag LOCUS_11020 gene cooS 2888 4765 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_11020 4798 5313 gene locus_tag LOCUS_11030 4798 5313 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023216.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence083 754 1971 gene locus_tag LOCUS_11040 gene pgk 754 1971 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022629.1 protein_id gnl|my_center|LOCUS_11040 3025 2087 gene locus_tag LOCUS_11050 3025 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 3177 4502 gene locus_tag LOCUS_11060 gene trkA 3177 4502 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021496.1 protein_id gnl|my_center|LOCUS_11060 5131 4433 gene locus_tag LOCUS_11070 5131 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 5201 5434 gene locus_tag LOCUS_11080 5201 5434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 6705 5437 gene locus_tag LOCUS_11090 6705 5437 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978812.1 protein_id gnl|my_center|LOCUS_11090 >Feature sequence084 21 1442 gene locus_tag LOCUS_11100 21 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 2290 1580 gene locus_tag LOCUS_11110 gene npdG 2290 1580 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279215.1 protein_id gnl|my_center|LOCUS_11110 3738 2659 gene locus_tag LOCUS_11120 3738 2659 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021469.1 protein_id gnl|my_center|LOCUS_11120 3942 3745 gene locus_tag LOCUS_11130 3942 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 4883 4002 gene locus_tag LOCUS_11140 4883 4002 CDS product presenilin family intramembrane aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065870.1 protein_id gnl|my_center|LOCUS_11140 5397 4873 gene locus_tag LOCUS_11150 gene cyaB 5397 4873 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879480.1 protein_id gnl|my_center|LOCUS_11150 <7048 5394 gene locus_tag LOCUS_11160 <7048 5394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022991.1:valine--tRNA ligase >Feature sequence085 1089 628 gene locus_tag LOCUS_11170 1089 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1279 1405 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2765 1914 gene locus_tag LOCUS_11180 gene pheA 2765 1914 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066451.1 protein_id gnl|my_center|LOCUS_11180 3925 2762 gene locus_tag LOCUS_11190 3925 2762 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966033.1 protein_id gnl|my_center|LOCUS_11190 4079 5638 gene locus_tag LOCUS_11200 4079 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 5696 6754 gene locus_tag LOCUS_11210 5696 6754 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065828.1 protein_id gnl|my_center|LOCUS_11210 >Feature sequence086 431 1075 gene locus_tag LOCUS_11220 431 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 1950 1216 gene locus_tag LOCUS_11230 1950 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 2478 2197 gene locus_tag LOCUS_11240 2478 2197 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064812.1 protein_id gnl|my_center|LOCUS_11240 3540 2986 gene locus_tag LOCUS_11250 3540 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 4262 3876 gene locus_tag LOCUS_11260 4262 3876 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064682.1 protein_id gnl|my_center|LOCUS_11260 5752 4259 gene locus_tag LOCUS_11270 5752 4259 CDS product L-aspartate semialdehyde sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021823.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence087 1918 902 gene locus_tag LOCUS_11280 1918 902 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020233.1 protein_id gnl|my_center|LOCUS_11280 1996 2134 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2195 3166 gene locus_tag LOCUS_11290 2195 3166 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022128.1 protein_id gnl|my_center|LOCUS_11290 3207 3587 gene locus_tag LOCUS_11300 3207 3587 CDS product DUF2111 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589540.1 protein_id gnl|my_center|LOCUS_11300 3584 4015 gene locus_tag LOCUS_11310 3584 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 >Feature sequence088 9 728 gene locus_tag LOCUS_11320 9 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1013 1441 gene locus_tag LOCUS_11330 1013 1441 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061215.1 protein_id gnl|my_center|LOCUS_11330 1553 2344 gene locus_tag LOCUS_11340 1553 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 2338 4200 gene locus_tag LOCUS_11350 2338 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 5547 4207 gene locus_tag LOCUS_11360 5547 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 >Feature sequence089 858 94 gene locus_tag LOCUS_11370 gene rrp41 858 94 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878000.1 protein_id gnl|my_center|LOCUS_11370 1532 855 gene locus_tag LOCUS_11380 gene rrp4 1532 855 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021780.1 protein_id gnl|my_center|LOCUS_11380 2252 1554 gene locus_tag LOCUS_11390 2252 1554 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021781.1 protein_id gnl|my_center|LOCUS_11390 3007 2255 gene locus_tag LOCUS_11400 gene psmA 3007 2255 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_11400 3515 2979 gene locus_tag LOCUS_11410 3515 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 4195 3512 gene locus_tag LOCUS_11420 4195 3512 CDS product ribonuclease P protein component 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876327.1 protein_id gnl|my_center|LOCUS_11420 4608 4192 gene locus_tag LOCUS_11430 4608 4192 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755897.1 protein_id gnl|my_center|LOCUS_11430 5197 4610 gene locus_tag LOCUS_11440 5197 4610 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021787.1 protein_id gnl|my_center|LOCUS_11440 5874 5398 gene locus_tag LOCUS_11450 5874 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023756.1 protein_id gnl|my_center|LOCUS_11450 <6805 5961 gene locus_tag LOCUS_11460 <6805 5961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024395.1:methanogenesis marker 14 protein >Feature sequence090 301 981 gene locus_tag LOCUS_11470 301 981 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876071.1 protein_id gnl|my_center|LOCUS_11470 978 1538 gene locus_tag LOCUS_11480 978 1538 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024463.1 protein_id gnl|my_center|LOCUS_11480 2494 1766 gene locus_tag LOCUS_11490 2494 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 3278 2481 gene locus_tag LOCUS_11500 3278 2481 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393323.1 protein_id gnl|my_center|LOCUS_11500 4207 3410 gene locus_tag LOCUS_11510 4207 3410 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894390.1 protein_id gnl|my_center|LOCUS_11510 5169 4321 gene locus_tag LOCUS_11520 gene modA 5169 4321 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393324.1 protein_id gnl|my_center|LOCUS_11520 5909 5361 gene locus_tag LOCUS_11530 5909 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11530 <6646 5906 gene locus_tag LOCUS_11540 <6646 5906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193589538.1:aldehyde dehydrogenase family protein note possible pseudo, frameshifted >Feature sequence091 151 360 gene locus_tag LOCUS_11550 151 360 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065891.1 protein_id gnl|my_center|LOCUS_11550 1215 508 gene locus_tag LOCUS_11560 1215 508 CDS product heparan-alpha-glucosaminide N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065998.1 protein_id gnl|my_center|LOCUS_11560 1831 1367 gene locus_tag LOCUS_11570 1831 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 2334 1915 gene locus_tag LOCUS_11580 2334 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 2914 2459 gene locus_tag LOCUS_11590 gene tsaA 2914 2459 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249662.1 protein_id gnl|my_center|LOCUS_11590 3458 3027 gene locus_tag LOCUS_11600 3458 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 3662 3465 gene locus_tag LOCUS_11610 3662 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 3786 5549 gene locus_tag LOCUS_11620 3786 5549 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024450.1 protein_id gnl|my_center|LOCUS_11620 5594 5767 gene locus_tag LOCUS_11630 5594 5767 CDS product preprotein translocase subunit Sec61beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064461.1 protein_id gnl|my_center|LOCUS_11630 6622 5855 gene locus_tag LOCUS_11640 6622 5855 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869781.1 protein_id gnl|my_center|LOCUS_11640 >Feature sequence092 1302 757 gene locus_tag LOCUS_11650 gene cdhB 1302 757 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879885.1 protein_id gnl|my_center|LOCUS_11650 3748 1316 gene locus_tag LOCUS_11660 gene cdhA 3748 1316 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879884.1 protein_id gnl|my_center|LOCUS_11660 4092 5138 gene locus_tag LOCUS_11670 4092 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11670 5126 5368 gene locus_tag LOCUS_11680 5126 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11680 5406 6377 gene locus_tag LOCUS_11690 5406 6377 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020979.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence093 <1 717 gene locus_tag LOCUS_11700 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963619.1:ketoacyl-ACP synthase III 844 1227 gene locus_tag LOCUS_11710 844 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1378 2172 gene locus_tag LOCUS_11720 1378 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 2205 3461 gene locus_tag LOCUS_11730 gene eno 2205 3461 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065179.1 protein_id gnl|my_center|LOCUS_11730 3510 3818 gene locus_tag LOCUS_11740 3510 3818 CDS product DUF5611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065922.1 protein_id gnl|my_center|LOCUS_11740 5067 3970 gene locus_tag LOCUS_11750 5067 3970 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870720.1 protein_id gnl|my_center|LOCUS_11750 5307 6569 gene locus_tag LOCUS_11760 5307 6569 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289167.1 protein_id gnl|my_center|LOCUS_11760 >Feature sequence094 385 1242 gene locus_tag LOCUS_11770 385 1242 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939747.1 protein_id gnl|my_center|LOCUS_11770 2304 1327 gene locus_tag LOCUS_11780 2304 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 2614 3465 gene locus_tag LOCUS_11790 2614 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 3712 4038 gene locus_tag LOCUS_11800 3712 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 4206 4454 gene locus_tag LOCUS_11810 4206 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 4454 4681 gene locus_tag LOCUS_11820 4454 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 4818 5780 gene locus_tag LOCUS_11830 4818 5780 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021606.1 protein_id gnl|my_center|LOCUS_11830 5777 6508 gene locus_tag LOCUS_11840 5777 6508 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062387006.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence095 493 993 gene locus_tag LOCUS_11850 493 993 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_11850 1962 1516 gene locus_tag LOCUS_11860 1962 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 3121 1979 gene locus_tag LOCUS_11870 3121 1979 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023596.1 protein_id gnl|my_center|LOCUS_11870 3970 3197 gene locus_tag LOCUS_11880 3970 3197 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020876.1 protein_id gnl|my_center|LOCUS_11880 5656 3971 gene locus_tag LOCUS_11890 5656 3971 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064976.1 protein_id gnl|my_center|LOCUS_11890 <6577 5646 gene locus_tag LOCUS_11900 <6577 5646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020878.1:formylmethanofuran dehydrogenase subunit B >Feature sequence096 171 548 gene locus_tag LOCUS_11910 171 548 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021123.1 protein_id gnl|my_center|LOCUS_11910 545 2158 gene locus_tag LOCUS_11920 gene secY 545 2158 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021124.1 protein_id gnl|my_center|LOCUS_11920 2161 2766 gene locus_tag LOCUS_11930 2161 2766 CDS product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021131.1 protein_id gnl|my_center|LOCUS_11930 2766 3305 gene locus_tag LOCUS_11940 2766 3305 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868267.1 protein_id gnl|my_center|LOCUS_11940 3283 4281 gene locus_tag LOCUS_11950 3283 4281 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021133.1 protein_id gnl|my_center|LOCUS_11950 4703 5314 gene locus_tag LOCUS_11960 4703 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11960 5341 5856 gene locus_tag LOCUS_11970 5341 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11970 5853 6353 gene locus_tag LOCUS_11980 5853 6353 CDS product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544978.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence097 <1 1379 gene locus_tag LOCUS_11990 <1 1379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942715.1:putative Ig domain-containing protein 1793 2056 gene locus_tag LOCUS_12000 1793 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 2037 2852 gene locus_tag LOCUS_12010 2037 2852 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_12010 2865 3116 gene locus_tag LOCUS_12020 2865 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 3785 3126 gene locus_tag LOCUS_12030 3785 3126 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065106.1 protein_id gnl|my_center|LOCUS_12030 4342 3791 gene locus_tag LOCUS_12040 4342 3791 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024463.1 protein_id gnl|my_center|LOCUS_12040 5150 4464 gene locus_tag LOCUS_12050 5150 4464 CDS product dihydromethanopterin reductase (acceptor) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020741.1 protein_id gnl|my_center|LOCUS_12050 5323 5829 gene locus_tag LOCUS_12060 gene fae 5323 5829 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022945.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence098 1254 223 gene locus_tag LOCUS_12070 1254 223 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023900.1 protein_id gnl|my_center|LOCUS_12070 1391 1786 gene locus_tag LOCUS_12080 1391 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1827 2624 gene locus_tag LOCUS_12090 1827 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 3238 3852 gene locus_tag LOCUS_12100 3238 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 3965 4468 gene locus_tag LOCUS_12110 3965 4468 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022308.1 protein_id gnl|my_center|LOCUS_12110 4962 4579 gene locus_tag LOCUS_12120 4962 4579 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020403.1 protein_id gnl|my_center|LOCUS_12120 5627 4959 gene locus_tag LOCUS_12130 5627 4959 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013194697.1 protein_id gnl|my_center|LOCUS_12130 6307 5624 gene locus_tag LOCUS_12140 6307 5624 CDS product DUF2162 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066038.1 protein_id gnl|my_center|LOCUS_12140 >Feature sequence099 593 36 gene locus_tag LOCUS_12150 593 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 1198 611 gene locus_tag LOCUS_12160 1198 611 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021058.1 protein_id gnl|my_center|LOCUS_12160 3000 1195 gene locus_tag LOCUS_12170 gene iorA 3000 1195 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065029.1 protein_id gnl|my_center|LOCUS_12170 3214 4023 gene locus_tag LOCUS_12180 gene alsD 3214 4023 CDS product alpha-acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215019.1 protein_id gnl|my_center|LOCUS_12180 4285 6228 gene locus_tag LOCUS_12190 4285 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 >Feature sequence100 919 353 gene locus_tag LOCUS_12200 919 353 CDS product DUF3786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768312.1 protein_id gnl|my_center|LOCUS_12200 1430 933 gene locus_tag LOCUS_12210 1430 933 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251065.1 protein_id gnl|my_center|LOCUS_12210 1705 1427 gene locus_tag LOCUS_12220 gene moaD 1705 1427 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251068.1 protein_id gnl|my_center|LOCUS_12220 1904 1737 gene locus_tag LOCUS_12230 1904 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 2798 2007 gene locus_tag LOCUS_12240 2798 2007 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020795.1 protein_id gnl|my_center|LOCUS_12240 2943 3182 gene locus_tag LOCUS_12250 2943 3182 CDS product MTH865 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022202.1 protein_id gnl|my_center|LOCUS_12250 3321 3650 gene locus_tag LOCUS_12260 3321 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 3690 4496 gene locus_tag LOCUS_12270 gene larE 3690 4496 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080596.1 protein_id gnl|my_center|LOCUS_12270 4493 5671 gene locus_tag LOCUS_12280 4493 5671 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061297.1 protein_id gnl|my_center|LOCUS_12280 >Feature sequence101 892 2481 gene locus_tag LOCUS_12290 892 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 3754 2519 gene locus_tag LOCUS_12300 3754 2519 CDS product endonuclease Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020688.1 protein_id gnl|my_center|LOCUS_12300 3783 4562 gene locus_tag LOCUS_12310 gene larB 3783 4562 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020480.1 protein_id gnl|my_center|LOCUS_12310 5908 4853 gene locus_tag LOCUS_12320 5908 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12320 >Feature sequence102 2252 78 gene locus_tag LOCUS_12330 2252 78 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024448.1 protein_id gnl|my_center|LOCUS_12330 2928 2269 gene locus_tag LOCUS_12340 2928 2269 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024449.1 protein_id gnl|my_center|LOCUS_12340 4392 3082 gene locus_tag LOCUS_12350 4392 3082 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140384.1 protein_id gnl|my_center|LOCUS_12350 5375 4542 gene locus_tag LOCUS_12360 gene htpX 5375 4542 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024415.1 protein_id gnl|my_center|LOCUS_12360 <6288 5444 gene locus_tag LOCUS_12370 <6288 5444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875712.1:tetratricopeptide repeat protein >Feature sequence103 236 364 gene locus_tag LOCUS_12380 236 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 403 726 gene locus_tag LOCUS_12390 403 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1554 763 gene locus_tag LOCUS_12400 1554 763 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020795.1 protein_id gnl|my_center|LOCUS_12400 1699 1938 gene locus_tag LOCUS_12410 1699 1938 CDS product MTH865 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022202.1 protein_id gnl|my_center|LOCUS_12410 1990 2697 gene locus_tag LOCUS_12420 1990 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 2731 3081 gene locus_tag LOCUS_12430 2731 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 3600 3241 gene locus_tag LOCUS_12440 3600 3241 CDS product DUF1894 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020188.1 protein_id gnl|my_center|LOCUS_12440 4022 3597 gene locus_tag LOCUS_12450 4022 3597 CDS product DUF1890 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020187.1 protein_id gnl|my_center|LOCUS_12450 4315 5223 gene locus_tag LOCUS_12460 4315 5223 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879092.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence104 3665 4636 gene locus_tag LOCUS_12470 3665 4636 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 protein_id gnl|my_center|LOCUS_12470 6043 4775 gene locus_tag LOCUS_12480 6043 4775 CDS product TIGR04083 family peptide-modifying radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023249.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence105 <1 926 gene locus_tag LOCUS_12490 <1 926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020659.1:transcription initiation factor IIB 1734 934 gene locus_tag LOCUS_12500 gene truA 1734 934 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020266.1 protein_id gnl|my_center|LOCUS_12500 3072 1810 gene locus_tag LOCUS_12510 3072 1810 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589524.1 protein_id gnl|my_center|LOCUS_12510 3196 4473 gene locus_tag LOCUS_12520 3196 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 4681 6033 gene locus_tag LOCUS_12530 4681 6033 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065635.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence106 566 90 gene locus_tag LOCUS_12540 566 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1656 559 gene locus_tag LOCUS_12550 1656 559 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140271.1 protein_id gnl|my_center|LOCUS_12550 1801 1885 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1934 2440 gene locus_tag LOCUS_12560 1934 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 2655 3497 gene locus_tag LOCUS_12570 2655 3497 CDS product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879419.1 protein_id gnl|my_center|LOCUS_12570 3612 4505 gene locus_tag LOCUS_12580 gene rpl3p 3612 4505 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879418.1 protein_id gnl|my_center|LOCUS_12580 4505 5269 gene locus_tag LOCUS_12590 gene rpl4p 4505 5269 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021102.1 protein_id gnl|my_center|LOCUS_12590 5259 5507 gene locus_tag LOCUS_12600 5259 5507 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869673.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence107 614 1732 gene locus_tag LOCUS_12610 614 1732 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876364.1 protein_id gnl|my_center|LOCUS_12610 2074 1697 gene locus_tag LOCUS_12620 2074 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 2479 2303 gene locus_tag LOCUS_12630 2479 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 2396 4195 gene locus_tag LOCUS_12640 2396 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 5268 4336 gene locus_tag LOCUS_12650 gene mch 5268 4336 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021714.1 protein_id gnl|my_center|LOCUS_12650 5522 5938 gene locus_tag LOCUS_12660 5522 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 >Feature sequence108 497 309 gene locus_tag LOCUS_12670 497 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1785 883 gene locus_tag LOCUS_12680 1785 883 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461750.1 protein_id gnl|my_center|LOCUS_12680 1900 3192 gene locus_tag LOCUS_12690 1900 3192 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023306.1 protein_id gnl|my_center|LOCUS_12690 3728 3264 gene locus_tag LOCUS_12700 3728 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 5385 3766 gene locus_tag LOCUS_12710 5385 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 <6140 5452 gene locus_tag LOCUS_12720 <6140 5452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023957.1:MBL fold metallo-hydrolase >Feature sequence109 472 1098 gene locus_tag LOCUS_12730 472 1098 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020593.1 protein_id gnl|my_center|LOCUS_12730 1143 2660 gene locus_tag LOCUS_12740 gene gpmI 1143 2660 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943825.1 protein_id gnl|my_center|LOCUS_12740 2701 3279 gene locus_tag LOCUS_12750 2701 3279 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878134.1 protein_id gnl|my_center|LOCUS_12750 3361 4848 gene locus_tag LOCUS_12760 3361 4848 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_12760 4923 5396 gene locus_tag LOCUS_12770 4923 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 >Feature sequence110 871 368 gene locus_tag LOCUS_12780 871 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 1005 2345 gene locus_tag LOCUS_12790 1005 2345 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_12790 2469 2828 gene locus_tag LOCUS_12800 2469 2828 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227906.1 protein_id gnl|my_center|LOCUS_12800 3244 3008 gene locus_tag LOCUS_12810 3244 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 3614 3348 gene locus_tag LOCUS_12820 3614 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 4204 3746 gene locus_tag LOCUS_12830 4204 3746 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172598099.1 protein_id gnl|my_center|LOCUS_12830 5365 4280 gene locus_tag LOCUS_12840 5365 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 5589 5981 gene locus_tag LOCUS_12850 5589 5981 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868534.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence111 1001 2248 gene locus_tag LOCUS_12860 gene gatD 1001 2248 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021336.1 protein_id gnl|my_center|LOCUS_12860 2361 2876 gene locus_tag LOCUS_12870 2361 2876 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020241.1 protein_id gnl|my_center|LOCUS_12870 2898 3524 gene locus_tag LOCUS_12880 2898 3524 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020240.1 protein_id gnl|my_center|LOCUS_12880 3540 3773 gene locus_tag LOCUS_12890 3540 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 3798 4544 gene locus_tag LOCUS_12900 3798 4544 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903932.1 protein_id gnl|my_center|LOCUS_12900 4551 5225 gene locus_tag LOCUS_12910 gene cofC 4551 5225 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021502.1 protein_id gnl|my_center|LOCUS_12910 5744 5241 gene locus_tag LOCUS_12920 5744 5241 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021413.1 protein_id gnl|my_center|LOCUS_12920 >Feature sequence112 1164 724 gene locus_tag LOCUS_12930 1164 724 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024057.1 protein_id gnl|my_center|LOCUS_12930 2333 1314 gene locus_tag LOCUS_12940 2333 1314 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020113.1 protein_id gnl|my_center|LOCUS_12940 3702 2347 gene locus_tag LOCUS_12950 gene thrC 3702 2347 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_12950 4049 3732 gene locus_tag LOCUS_12960 4049 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 4212 4424 gene locus_tag LOCUS_12970 4212 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 4414 4626 gene locus_tag LOCUS_12980 4414 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 4846 5100 gene locus_tag LOCUS_12990 4846 5100 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022120.1 protein_id gnl|my_center|LOCUS_12990 5632 5333 gene locus_tag LOCUS_13000 5632 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 5870 5691 gene locus_tag LOCUS_13010 5870 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 >Feature sequence113 2395 1703 gene locus_tag LOCUS_13020 2395 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 2701 3702 gene locus_tag LOCUS_13030 2701 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 3699 4850 gene locus_tag LOCUS_13040 3699 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 4869 5843 gene locus_tag LOCUS_13050 4869 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence114 507 1550 gene locus_tag LOCUS_13060 507 1550 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022952.1 protein_id gnl|my_center|LOCUS_13060 2285 1605 gene locus_tag LOCUS_13070 2285 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 2672 3325 gene locus_tag LOCUS_13080 2672 3325 CDS product DUF2589 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877924.1 protein_id gnl|my_center|LOCUS_13080 3452 4201 gene locus_tag LOCUS_13090 3452 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 4214 4786 gene locus_tag LOCUS_13100 4214 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 5068 4883 gene locus_tag LOCUS_13110 5068 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 5188 5112 gene locus_tag LOCUS_t00140 5188 5112 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5597 5235 gene locus_tag LOCUS_13120 5597 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 5821 5594 gene locus_tag LOCUS_13130 5821 5594 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021744.1 protein_id gnl|my_center|LOCUS_13130 >Feature sequence115 227 1999 gene locus_tag LOCUS_13140 227 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13140 1935 3416 gene locus_tag LOCUS_13150 1935 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13150 3450 3923 gene locus_tag LOCUS_13160 3450 3923 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020591.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence116 1783 563 gene locus_tag LOCUS_13170 1783 563 CDS product YcaO-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876618.1 protein_id gnl|my_center|LOCUS_13170 3246 1969 gene locus_tag LOCUS_13180 3246 1969 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020830.1 protein_id gnl|my_center|LOCUS_13180 3967 3326 gene locus_tag LOCUS_13190 3967 3326 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020150.1 protein_id gnl|my_center|LOCUS_13190 4737 3964 gene locus_tag LOCUS_13200 4737 3964 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024526.1 protein_id gnl|my_center|LOCUS_13200 5140 4730 gene locus_tag LOCUS_13210 5140 4730 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066042.1 protein_id gnl|my_center|LOCUS_13210 <5859 5149 gene locus_tag LOCUS_13220 <5859 5149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020101.1:peptide chain release factor aRF-1 >Feature sequence117 1530 1111 gene locus_tag LOCUS_13230 1530 1111 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020196.1 protein_id gnl|my_center|LOCUS_13230 1748 3241 gene locus_tag LOCUS_13240 gene lysS 1748 3241 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066108.1 protein_id gnl|my_center|LOCUS_13240 3266 3718 gene locus_tag LOCUS_13250 3266 3718 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023482.1 protein_id gnl|my_center|LOCUS_13250 3743 4525 gene locus_tag LOCUS_13260 3743 4525 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020802.1 protein_id gnl|my_center|LOCUS_13260 4561 5115 gene locus_tag LOCUS_13270 gene pyrE 4561 5115 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057665.1 protein_id gnl|my_center|LOCUS_13270 5482 5108 gene locus_tag LOCUS_13280 5482 5108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence118 717 40 gene locus_tag LOCUS_13290 717 40 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024003.1 protein_id gnl|my_center|LOCUS_13290 967 695 gene locus_tag LOCUS_13300 967 695 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879558.1 protein_id gnl|my_center|LOCUS_13300 1127 978 gene locus_tag LOCUS_13310 1127 978 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250270.1 protein_id gnl|my_center|LOCUS_13310 1720 1124 gene locus_tag LOCUS_13320 1720 1124 CDS product alpha hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024006.1 protein_id gnl|my_center|LOCUS_13320 2070 1717 gene locus_tag LOCUS_13330 2070 1717 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024007.1 protein_id gnl|my_center|LOCUS_13330 2523 2074 gene locus_tag LOCUS_13340 2523 2074 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024008.1 protein_id gnl|my_center|LOCUS_13340 3917 2718 gene locus_tag LOCUS_13350 gene serB 3917 2718 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064533.1 protein_id gnl|my_center|LOCUS_13350 >Feature sequence119 302 1471 gene locus_tag LOCUS_13360 gene rbcL 302 1471 CDS product type III ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024428.1 protein_id gnl|my_center|LOCUS_13360 1616 1942 gene locus_tag LOCUS_13370 gene ahaH 1616 1942 CDS product ATP synthase archaeal subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015591748.1 protein_id gnl|my_center|LOCUS_13370 1935 4001 gene locus_tag LOCUS_13380 1935 4001 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589509.1 protein_id gnl|my_center|LOCUS_13380 4033 4290 gene locus_tag LOCUS_13390 4033 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 4320 4868 gene locus_tag LOCUS_13400 4320 4868 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878659.1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence120 5115 4711 gene locus_tag LOCUS_13410 5115 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 >Feature sequence121 537 136 gene locus_tag LOCUS_13420 537 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022359.1 protein_id gnl|my_center|LOCUS_13420 857 534 gene locus_tag LOCUS_13430 857 534 CDS product DUF2551 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065388.1 protein_id gnl|my_center|LOCUS_13430 1171 1821 gene locus_tag LOCUS_13440 1171 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 1910 2641 gene locus_tag LOCUS_13450 1910 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 3045 2734 gene locus_tag LOCUS_13460 3045 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 3712 3053 gene locus_tag LOCUS_13470 3712 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 4728 3709 gene locus_tag LOCUS_13480 4728 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence122 71 232 gene locus_tag LOCUS_13490 71 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13490 826 404 gene locus_tag LOCUS_13500 gene tsaA 826 404 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082829.1 protein_id gnl|my_center|LOCUS_13500 1327 1518 gene locus_tag LOCUS_13510 1327 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 2106 1873 gene locus_tag LOCUS_13520 2106 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13520 2676 2419 gene locus_tag LOCUS_13530 2676 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 2841 2677 gene locus_tag LOCUS_13540 2841 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 3454 2828 gene locus_tag LOCUS_13550 gene pncA 3454 2828 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404207.1 protein_id gnl|my_center|LOCUS_13550 <5657 3591 gene locus_tag LOCUS_13560 <5657 3591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021621.1:leucine--tRNA ligase >Feature sequence123 3 728 gene locus_tag LOCUS_13570 3 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 1123 1473 gene locus_tag LOCUS_13580 1123 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 1501 3237 gene locus_tag LOCUS_13590 1501 3237 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022903.1 protein_id gnl|my_center|LOCUS_13590 3228 4169 gene locus_tag LOCUS_13600 gene pfkB 3228 4169 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963555.1 protein_id gnl|my_center|LOCUS_13600 4175 5101 gene locus_tag LOCUS_13610 4175 5101 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065835.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence124 703 1809 gene locus_tag LOCUS_13620 703 1809 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023369.1 protein_id gnl|my_center|LOCUS_13620 1952 4018 gene locus_tag LOCUS_13630 1952 4018 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879431.1 protein_id gnl|my_center|LOCUS_13630 4690 4205 gene locus_tag LOCUS_13640 4690 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 5245 4778 gene locus_tag LOCUS_13650 5245 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 >Feature sequence125 350 733 gene locus_tag LOCUS_13660 350 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 794 1285 gene locus_tag LOCUS_13670 794 1285 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064945.1 protein_id gnl|my_center|LOCUS_13670 1410 3209 gene locus_tag LOCUS_13680 1410 3209 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839181.1 protein_id gnl|my_center|LOCUS_13680 4104 3214 gene locus_tag LOCUS_13690 4104 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 4269 4799 gene locus_tag LOCUS_13700 4269 4799 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942947.1 protein_id gnl|my_center|LOCUS_13700 4799 5374 gene locus_tag LOCUS_13710 4799 5374 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942948.1 protein_id gnl|my_center|LOCUS_13710 >Feature sequence126 <1 825 gene locus_tag LOCUS_13720 <1 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066092.1:radical SAM protein 948 1035 gene locus_tag LOCUS_t00150 948 1035 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1916 1203 gene locus_tag LOCUS_13730 1916 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 2210 1974 gene locus_tag LOCUS_13740 2210 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 2291 3790 gene locus_tag LOCUS_13750 2291 3790 CDS product dihydropteroate synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023773.1 protein_id gnl|my_center|LOCUS_13750 3819 4703 gene locus_tag LOCUS_13760 3819 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 4804 5172 gene locus_tag LOCUS_13770 gene rpl7ae 4804 5172 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053601.1 protein_id gnl|my_center|LOCUS_13770 5185 5400 gene locus_tag LOCUS_13780 5185 5400 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065141.1 protein_id gnl|my_center|LOCUS_13780 >Feature sequence127 495 2933 gene locus_tag LOCUS_13790 gene cdhA 495 2933 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879884.1 protein_id gnl|my_center|LOCUS_13790 2947 3492 gene locus_tag LOCUS_13800 gene cdhB 2947 3492 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879885.1 protein_id gnl|my_center|LOCUS_13800 3951 4109 gene locus_tag LOCUS_13810 3951 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 4303 5058 gene locus_tag LOCUS_13820 4303 5058 CDS product disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064949.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence128 1168 818 gene locus_tag LOCUS_13830 1168 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1628 1395 gene locus_tag LOCUS_13840 1628 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 2279 1749 gene locus_tag LOCUS_13850 2279 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 2614 2288 gene locus_tag LOCUS_13860 2614 2288 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021428.1 protein_id gnl|my_center|LOCUS_13860 3102 3680 gene locus_tag LOCUS_13870 3102 3680 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082088841.1 protein_id gnl|my_center|LOCUS_13870 4401 3607 gene locus_tag LOCUS_13880 4401 3607 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022348.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence129 1305 2159 gene locus_tag LOCUS_13890 1305 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 2290 3822 gene locus_tag LOCUS_13900 2290 3822 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860413.1 protein_id gnl|my_center|LOCUS_13900 4107 5183 gene locus_tag LOCUS_13910 4107 5183 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020886.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence130 1245 265 gene locus_tag LOCUS_13920 gene radA 1245 265 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023460.1 protein_id gnl|my_center|LOCUS_13920 2402 1296 gene locus_tag LOCUS_13930 2402 1296 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024513.1 protein_id gnl|my_center|LOCUS_13930 4137 2413 gene locus_tag LOCUS_13940 4137 2413 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060755.1 protein_id gnl|my_center|LOCUS_13940 <5223 4328 gene locus_tag LOCUS_13950 <5223 4328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065884.1:methionine--tRNA ligase >Feature sequence131 113 346 gene locus_tag LOCUS_13960 113 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 425 754 gene locus_tag LOCUS_13970 425 754 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_13970 751 1107 gene locus_tag LOCUS_13980 751 1107 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058065.1 protein_id gnl|my_center|LOCUS_13980 1408 1596 gene locus_tag LOCUS_13990 1408 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1798 4197 gene locus_tag LOCUS_14000 1798 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 <5214 4286 gene locus_tag LOCUS_14010 <5214 4286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083156.1:threonine ammonia-lyase >Feature sequence132 304 1374 gene locus_tag LOCUS_14020 304 1374 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023593.1 protein_id gnl|my_center|LOCUS_14020 1397 1846 gene locus_tag LOCUS_14030 1397 1846 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023592.1 protein_id gnl|my_center|LOCUS_14030 1917 2912 gene locus_tag LOCUS_14040 gene cofG 1917 2912 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755891.1 protein_id gnl|my_center|LOCUS_14040 2943 3128 gene locus_tag LOCUS_14050 2943 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 3183 3545 gene locus_tag LOCUS_14060 3183 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 3542 4120 gene locus_tag LOCUS_14070 3542 4120 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023781.1 protein_id gnl|my_center|LOCUS_14070 4127 5092 gene locus_tag LOCUS_14080 gene cofD 4127 5092 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878417.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence133 1673 522 gene locus_tag LOCUS_14090 1673 522 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065913.1 protein_id gnl|my_center|LOCUS_14090 2503 1646 gene locus_tag LOCUS_14100 2503 1646 CDS product geranylfarnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024038.1 protein_id gnl|my_center|LOCUS_14100 3101 4318 gene locus_tag LOCUS_14110 3101 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 >Feature sequence134 449 3265 gene locus_tag LOCUS_14120 449 3265 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064990.1 protein_id gnl|my_center|LOCUS_14120 3918 3343 gene locus_tag LOCUS_14130 3918 3343 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020385.1 protein_id gnl|my_center|LOCUS_14130 <5067 3925 gene locus_tag LOCUS_14140 <5067 3925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064814.1:cobyrinate a,c-diamide synthase >Feature sequence135 <1 519 gene locus_tag LOCUS_14150 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880440.1:cytochrome c biogenesis protein CcdA 570 1364 gene locus_tag LOCUS_14160 570 1364 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066548.1 protein_id gnl|my_center|LOCUS_14160 1379 1741 gene locus_tag LOCUS_14170 1379 1741 CDS product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755961.1 protein_id gnl|my_center|LOCUS_14170 1738 2088 gene locus_tag LOCUS_14180 1738 2088 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023823.1 protein_id gnl|my_center|LOCUS_14180 2100 2411 gene locus_tag LOCUS_14190 gene tusB 2100 2411 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023824.1 protein_id gnl|my_center|LOCUS_14190 2439 2684 gene locus_tag LOCUS_14200 2439 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 2698 3189 gene locus_tag LOCUS_14210 2698 3189 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023042.1 protein_id gnl|my_center|LOCUS_14210 3418 3927 gene locus_tag LOCUS_14220 3418 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence136 1333 1869 gene locus_tag LOCUS_14230 1333 1869 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023175.1 protein_id gnl|my_center|LOCUS_14230 1859 3001 gene locus_tag LOCUS_14240 1859 3001 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023766.1 protein_id gnl|my_center|LOCUS_14240 3173 3018 gene locus_tag LOCUS_14250 3173 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 4651 3530 gene locus_tag LOCUS_14260 4651 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence137 1186 356 gene locus_tag LOCUS_14270 1186 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 1683 1378 gene locus_tag LOCUS_14280 gene rpl12p 1683 1378 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250366.1 protein_id gnl|my_center|LOCUS_14280 2684 1707 gene locus_tag LOCUS_14290 2684 1707 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024157.1 protein_id gnl|my_center|LOCUS_14290 3324 2686 gene locus_tag LOCUS_14300 3324 2686 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024156.1 protein_id gnl|my_center|LOCUS_14300 3889 3419 gene locus_tag LOCUS_14310 3889 3419 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024155.1 protein_id gnl|my_center|LOCUS_14310 4356 3895 gene locus_tag LOCUS_14320 4356 3895 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065945.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence138 27 1187 gene locus_tag LOCUS_14330 27 1187 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022225.1 protein_id gnl|my_center|LOCUS_14330 1557 1267 gene locus_tag LOCUS_14340 1557 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 3217 1607 gene locus_tag LOCUS_14350 3217 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 3490 3332 gene locus_tag LOCUS_14360 3490 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 3581 4153 gene locus_tag LOCUS_14370 3581 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 <4775 4092 gene locus_tag LOCUS_14380 <4775 4092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021498.1:digeranylgeranylglycerophospholipid reductase >Feature sequence139 411 977 gene locus_tag LOCUS_14390 411 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 940 1104 gene locus_tag LOCUS_14400 940 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 1317 1138 gene locus_tag LOCUS_14410 1317 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 2307 1441 gene locus_tag LOCUS_14420 gene nadA 2307 1441 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583121.1 protein_id gnl|my_center|LOCUS_14420 4367 2400 gene locus_tag LOCUS_14430 4367 2400 CDS product DUF460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990592.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence140 1373 2809 gene locus_tag LOCUS_14440 gene gltA 1373 2809 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023687.1 protein_id gnl|my_center|LOCUS_14440 3005 3793 gene locus_tag LOCUS_14450 3005 3793 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393681.1 protein_id gnl|my_center|LOCUS_14450 4271 3945 gene locus_tag LOCUS_14460 4271 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence141 1337 753 gene locus_tag LOCUS_14470 1337 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 1616 2281 gene locus_tag LOCUS_14480 1616 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 2361 2810 gene locus_tag LOCUS_14490 2361 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 3815 2955 gene locus_tag LOCUS_14500 3815 2955 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838714.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence142 437 853 gene locus_tag LOCUS_14510 437 853 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066255.1 protein_id gnl|my_center|LOCUS_14510 828 1286 gene locus_tag LOCUS_14520 828 1286 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021822.1 protein_id gnl|my_center|LOCUS_14520 1372 1839 gene locus_tag LOCUS_14530 1372 1839 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023461.1 protein_id gnl|my_center|LOCUS_14530 1969 3297 gene locus_tag LOCUS_14540 1969 3297 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875712.1 protein_id gnl|my_center|LOCUS_14540 3818 3309 gene locus_tag LOCUS_14550 3818 3309 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902177.1 protein_id gnl|my_center|LOCUS_14550 <4591 3815 gene locus_tag LOCUS_14560 <4591 3815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023637.1:5,10-methylenetetrahydromethanopterin reductase >Feature sequence143 414 1037 gene locus_tag LOCUS_14570 414 1037 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020957.1 protein_id gnl|my_center|LOCUS_14570 1258 1782 gene locus_tag LOCUS_14580 1258 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 2236 1835 gene locus_tag LOCUS_14590 gene trxA 2236 1835 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878779.1 protein_id gnl|my_center|LOCUS_14590 2812 2240 gene locus_tag LOCUS_14600 2812 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 3813 2866 gene locus_tag LOCUS_14610 gene ala 3813 2866 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023186.1 protein_id gnl|my_center|LOCUS_14610 >Feature sequence144 552 1247 gene locus_tag LOCUS_14620 552 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 1381 2457 gene locus_tag LOCUS_14630 1381 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 2582 2493 gene locus_tag LOCUS_t00160 2582 2493 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3122 2673 gene locus_tag LOCUS_14640 3122 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 <4550 3334 gene locus_tag LOCUS_14650 <4550 3334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021951.1:phenylalanine--tRNA ligase subunit beta >Feature sequence145 900 556 gene locus_tag LOCUS_14660 900 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1462 1019 gene locus_tag LOCUS_14670 1462 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1646 2650 gene locus_tag LOCUS_14680 gene thiL 1646 2650 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066048.1 protein_id gnl|my_center|LOCUS_14680 3626 2697 gene locus_tag LOCUS_14690 gene moaA 3626 2697 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020164.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence146 <1 680 gene locus_tag LOCUS_14700 <1 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024419.1:coenzyme-B sulfoethylthiotransferase subunit alpha 1628 1170 gene locus_tag LOCUS_14710 1628 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 2974 1706 gene locus_tag LOCUS_14720 2974 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 4003 3149 gene locus_tag LOCUS_14730 4003 3149 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_14730 >Feature sequence147 426 1208 gene locus_tag LOCUS_14740 426 1208 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 protein_id gnl|my_center|LOCUS_14740 1700 1257 gene locus_tag LOCUS_14750 1700 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 2220 2426 gene locus_tag LOCUS_14760 2220 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 3685 2408 gene locus_tag LOCUS_14770 3685 2408 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990611.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence148 886 1278 gene locus_tag LOCUS_14780 886 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 4351 1403 gene locus_tag LOCUS_14790 4351 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 >Feature sequence149 <1 1103 gene locus_tag LOCUS_14800 <1 1103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020733.1:(Fe-S)-binding protein 1884 1252 gene locus_tag LOCUS_14810 1884 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 2308 2090 gene locus_tag LOCUS_14820 2308 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 2190 3116 gene locus_tag LOCUS_14830 2190 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14830 3168 3581 gene locus_tag LOCUS_14840 3168 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 3622 4197 gene locus_tag LOCUS_14850 3622 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 >Feature sequence150 430 849 gene locus_tag LOCUS_14860 430 849 CDS product DUF2209 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023531.1 protein_id gnl|my_center|LOCUS_14860 846 2120 gene locus_tag LOCUS_14870 gene hflX 846 2120 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755955.1 protein_id gnl|my_center|LOCUS_14870 2128 2859 gene locus_tag LOCUS_14880 2128 2859 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021719.1 protein_id gnl|my_center|LOCUS_14880 3140 2934 gene locus_tag LOCUS_14890 3140 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence151 <1 964 gene locus_tag LOCUS_14900 <1 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895577.1:ATP-NAD kinase family protein 1224 1048 gene locus_tag LOCUS_14910 1224 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 1936 1247 gene locus_tag LOCUS_14920 1936 1247 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024048.1 protein_id gnl|my_center|LOCUS_14920 3323 1941 gene locus_tag LOCUS_14930 3323 1941 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024047.1 protein_id gnl|my_center|LOCUS_14930 3974 3336 gene locus_tag LOCUS_14940 3974 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14940 >Feature sequence152 1805 1341 gene locus_tag LOCUS_14950 1805 1341 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569926.1 protein_id gnl|my_center|LOCUS_14950 3072 1909 gene locus_tag LOCUS_14960 3072 1909 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022250.1 protein_id gnl|my_center|LOCUS_14960 <4324 3140 gene locus_tag LOCUS_14970 <4324 3140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021657.1:dihydrolipoyl dehydrogenase >Feature sequence153 830 192 gene locus_tag LOCUS_14980 830 192 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855217.1 protein_id gnl|my_center|LOCUS_14980 1080 841 gene locus_tag LOCUS_14990 1080 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 2362 1166 gene locus_tag LOCUS_15000 gene xseA 2362 1166 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_15000 2420 3157 gene locus_tag LOCUS_15010 gene sfsA 2420 3157 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391969.1 protein_id gnl|my_center|LOCUS_15010 3208 3945 gene locus_tag LOCUS_15020 3208 3945 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023469.1 protein_id gnl|my_center|LOCUS_15020 3942 4223 gene locus_tag LOCUS_15030 3942 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 >Feature sequence154 813 328 gene locus_tag LOCUS_15040 813 328 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730198.1 protein_id gnl|my_center|LOCUS_15040 1352 810 gene locus_tag LOCUS_15050 1352 810 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024085.1 protein_id gnl|my_center|LOCUS_15050 1531 1584 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2324 1911 gene locus_tag LOCUS_15060 2324 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 <4307 2622 gene locus_tag LOCUS_15070 <4307 2622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027480160.1:biosynthetic arginine decarboxylase >Feature sequence155 2117 366 gene locus_tag LOCUS_15080 2117 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 2570 3355 gene locus_tag LOCUS_15090 2570 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 4017 3547 gene locus_tag LOCUS_15100 4017 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 4152 4163 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence156 <1 708 gene locus_tag LOCUS_15110 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918720.1:DEAD/DEAH box helicase 993 802 gene locus_tag LOCUS_15120 993 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1599 1831 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgatgaacgatttgggtaacgaatcga 3580 2783 gene locus_tag LOCUS_15130 3580 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 >Feature sequence157 314 120 gene locus_tag LOCUS_15140 314 120 CDS product methytransferase partner Trm112 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023214.1 protein_id gnl|my_center|LOCUS_15140 1149 352 gene locus_tag LOCUS_15150 1149 352 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_15150 2281 1199 gene locus_tag LOCUS_15160 2281 1199 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065160.1 protein_id gnl|my_center|LOCUS_15160 4117 2282 gene locus_tag LOCUS_15170 4117 2282 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021597.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence158 1904 723 gene locus_tag LOCUS_15180 1904 723 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024465.1 protein_id gnl|my_center|LOCUS_15180 1987 3153 gene locus_tag LOCUS_15190 1987 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 4150 3359 gene locus_tag LOCUS_15200 4150 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence159 397 2688 gene locus_tag LOCUS_15210 397 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 2807 3343 gene locus_tag LOCUS_15220 2807 3343 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251049.1 protein_id gnl|my_center|LOCUS_15220 3441 4049 gene locus_tag LOCUS_15230 3441 4049 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589510.1 protein_id gnl|my_center|LOCUS_15230 >Feature sequence160 <1 1562 gene locus_tag LOCUS_15240 <1 1562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928645.1:transglutaminase domain-containing protein 3287 1809 gene locus_tag LOCUS_15250 gene fpoN 3287 1809 CDS product F(420)H(2) dehydrogenase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021520.1 protein_id gnl|my_center|LOCUS_15250 <4061 3289 gene locus_tag LOCUS_15260 <4061 3289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021519.1:F(420)H(2) dehydrogenase subunit M >Feature sequence161 1 903 gene locus_tag LOCUS_15270 1 903 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_15270 921 1607 gene locus_tag LOCUS_15280 921 1607 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080883.1 protein_id gnl|my_center|LOCUS_15280 1787 2092 gene locus_tag LOCUS_15290 1787 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 2119 2607 gene locus_tag LOCUS_15300 2119 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 4032 2761 gene locus_tag LOCUS_15310 4032 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence162 <1 630 gene locus_tag LOCUS_15320 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065054.1:oligosaccharyl transferase, archaeosortase A system-associated 1086 670 gene locus_tag LOCUS_15330 1086 670 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365680.1 protein_id gnl|my_center|LOCUS_15330 2099 1083 gene locus_tag LOCUS_15340 2099 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 3176 2217 gene locus_tag LOCUS_15350 3176 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 >Feature sequence163 427 666 gene locus_tag LOCUS_15360 427 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 840 1049 gene locus_tag LOCUS_15370 840 1049 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065315.1 protein_id gnl|my_center|LOCUS_15370 1589 2455 gene locus_tag LOCUS_15380 1589 2455 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021656.1 protein_id gnl|my_center|LOCUS_15380 2758 3075 gene locus_tag LOCUS_15390 2758 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15390 3248 3565 gene locus_tag LOCUS_15400 3248 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence164 <1 2526 gene locus_tag LOCUS_15410 <1 2526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582976.1:M6 family metalloprotease domain-containing protein 2533 3303 gene locus_tag LOCUS_15420 2533 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 >Feature sequence165 1219 410 gene locus_tag LOCUS_15430 1219 410 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064947.1 protein_id gnl|my_center|LOCUS_15430 2637 1216 gene locus_tag LOCUS_15440 2637 1216 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020324.1 protein_id gnl|my_center|LOCUS_15440 3087 2647 gene locus_tag LOCUS_15450 3087 2647 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020323.1 protein_id gnl|my_center|LOCUS_15450 3270 3818 gene locus_tag LOCUS_15460 3270 3818 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876339.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence166 357 4 gene locus_tag LOCUS_15470 357 4 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061058.1 protein_id gnl|my_center|LOCUS_15470 2218 407 gene locus_tag LOCUS_15480 2218 407 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020947.1 protein_id gnl|my_center|LOCUS_15480 2994 2272 gene locus_tag LOCUS_15490 2994 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 3116 3655 gene locus_tag LOCUS_15500 3116 3655 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_15500 3652 3882 gene locus_tag LOCUS_15510 gene porD 3652 3882 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869765.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence167 217 699 gene locus_tag LOCUS_15520 217 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 828 1298 gene locus_tag LOCUS_15530 828 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 1387 2241 gene locus_tag LOCUS_15540 1387 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 2238 3611 gene locus_tag LOCUS_15550 2238 3611 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141291.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence168 <1 1763 gene locus_tag LOCUS_15560 <1 1763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065557.1:AMP-binding protein 1768 2751 gene locus_tag LOCUS_15570 1768 2751 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022859.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence169 252 1109 gene locus_tag LOCUS_15580 252 1109 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024518.1 protein_id gnl|my_center|LOCUS_15580 1112 1888 gene locus_tag LOCUS_15590 1112 1888 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589511.1 protein_id gnl|my_center|LOCUS_15590 1885 3006 gene locus_tag LOCUS_15600 1885 3006 CDS product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024521.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence170 869 2401 gene locus_tag LOCUS_15610 869 2401 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860413.1 protein_id gnl|my_center|LOCUS_15610 2707 3762 gene locus_tag LOCUS_15620 2707 3762 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020886.1 protein_id gnl|my_center|LOCUS_15620 >Feature sequence171 <1 798 gene locus_tag LOCUS_15630 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902971.1:lysine 2,3-aminomutase 800 1807 gene locus_tag LOCUS_15640 800 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1804 3360 gene locus_tag LOCUS_15650 1804 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence172 1433 387 gene locus_tag LOCUS_15660 1433 387 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020699.1 protein_id gnl|my_center|LOCUS_15660 1490 1562 gene locus_tag LOCUS_t00170 1490 1562 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1581 1657 gene locus_tag LOCUS_t00180 1581 1657 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 <3836 1677 gene locus_tag LOCUS_15670 <3836 1677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022481.1:DNA topoisomerase I >Feature sequence173 <1 778 gene locus_tag LOCUS_15680 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065998.1:heparan-alpha-glucosaminide N-acetyltransferase 1130 930 gene locus_tag LOCUS_15690 1130 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 2175 1192 gene locus_tag LOCUS_15700 2175 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 >Feature sequence174 1863 1498 gene locus_tag LOCUS_15710 1863 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 <3797 1878 gene locus_tag LOCUS_15720 <3797 1878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083755888.1:VWA domain-containing protein >Feature sequence175 645 1118 gene locus_tag LOCUS_15730 645 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 2159 2251 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2294 3463 gene locus_tag LOCUS_15740 2294 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 >Feature sequence176 2701 3396 gene locus_tag LOCUS_15750 2701 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence177 2041 1175 gene locus_tag LOCUS_15760 gene hisF 2041 1175 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878322.1 protein_id gnl|my_center|LOCUS_15760 2901 2194 gene locus_tag LOCUS_15770 2901 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 3685 3146 gene locus_tag LOCUS_15780 3685 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 >Feature sequence178 480 3176 gene locus_tag LOCUS_15790 480 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 >Feature sequence179 2061 559 gene locus_tag LOCUS_15800 2061 559 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589535.1 protein_id gnl|my_center|LOCUS_15800 2275 3612 gene locus_tag LOCUS_15810 2275 3612 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023956.1 protein_id gnl|my_center|LOCUS_15810 >Feature sequence180 124 537 gene locus_tag LOCUS_15820 124 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 592 1152 gene locus_tag LOCUS_15830 592 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 1156 2535 gene locus_tag LOCUS_15840 gene thiD 1156 2535 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023132.1 protein_id gnl|my_center|LOCUS_15840 2581 2772 gene locus_tag LOCUS_15850 2581 2772 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251242.1 protein_id gnl|my_center|LOCUS_15850 2778 3653 gene locus_tag LOCUS_15860 gene dapA 2778 3653 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024349.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence181 220 313 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 707 822 gene locus_tag LOCUS_r00010 707 822 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1984 974 gene locus_tag LOCUS_15870 gene dph2 1984 974 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020763.1 protein_id gnl|my_center|LOCUS_15870 2963 1953 gene locus_tag LOCUS_15880 gene fen 2963 1953 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877775.1 protein_id gnl|my_center|LOCUS_15880 3099 3446 gene locus_tag LOCUS_15890 gene erpA 3099 3446 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881213.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence182 76 375 gene locus_tag LOCUS_15900 76 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 401 709 gene locus_tag LOCUS_15910 gene rpsJ 401 709 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021276.1 protein_id gnl|my_center|LOCUS_15910 712 786 gene locus_tag LOCUS_t00190 712 786 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1002 1265 gene locus_tag LOCUS_15920 gene gatC 1002 1265 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024398.1 protein_id gnl|my_center|LOCUS_15920 1271 2719 gene locus_tag LOCUS_15930 gene gatA 1271 2719 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066007.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence183 470 1093 gene locus_tag LOCUS_15940 470 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 1756 1478 gene locus_tag LOCUS_15950 1756 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1929 2372 gene locus_tag LOCUS_15960 gene paaI 1929 2372 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391943.1 protein_id gnl|my_center|LOCUS_15960 2869 2468 gene locus_tag LOCUS_15970 2869 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 3098 2871 gene locus_tag LOCUS_15980 3098 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 3551 3321 gene locus_tag LOCUS_15990 3551 3321 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064798.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence184 810 2024 gene locus_tag LOCUS_16000 810 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 2281 3195 gene locus_tag LOCUS_16010 gene guaA 2281 3195 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024387.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence185 403 209 gene locus_tag LOCUS_16020 403 209 CDS product Sm protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021429.1 protein_id gnl|my_center|LOCUS_16020 791 561 gene locus_tag LOCUS_16030 791 561 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_16030 1121 798 gene locus_tag LOCUS_16040 1121 798 CDS product MJ1244 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870756.1 protein_id gnl|my_center|LOCUS_16040 1263 1703 gene locus_tag LOCUS_16050 gene cobZ 1263 1703 CDS product alpha-ribazole phosphatase CobZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065005.1 protein_id gnl|my_center|LOCUS_16050 1769 2482 gene locus_tag LOCUS_16060 gene cobS 1769 2482 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020977.1 protein_id gnl|my_center|LOCUS_16060 2482 3075 gene locus_tag LOCUS_16070 2482 3075 CDS product TIGR00454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052457366.1 protein_id gnl|my_center|LOCUS_16070 3092 3442 gene locus_tag LOCUS_16080 3092 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990763.1 protein_id gnl|my_center|LOCUS_16080 >Feature sequence186 793 605 gene locus_tag LOCUS_16090 793 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1176 2438 gene locus_tag LOCUS_16100 gene aspS 1176 2438 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021688.1 protein_id gnl|my_center|LOCUS_16100 2686 3336 gene locus_tag LOCUS_16110 2686 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 3250 3272 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence187 2007 19 gene locus_tag LOCUS_16120 gene rqcH 2007 19 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020698.1 protein_id gnl|my_center|LOCUS_16120 2078 2527 gene locus_tag LOCUS_16130 2078 2527 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249247.1 protein_id gnl|my_center|LOCUS_16130 >Feature sequence188 1543 314 gene locus_tag LOCUS_16140 gene folP 1543 314 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065738.1 protein_id gnl|my_center|LOCUS_16140 2388 1603 gene locus_tag LOCUS_16150 2388 1603 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095630.1 protein_id gnl|my_center|LOCUS_16150 3295 2372 gene locus_tag LOCUS_16160 3295 2372 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878797.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence189 52 1149 gene locus_tag LOCUS_16170 52 1149 CDS product DUF2117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990783.1 protein_id gnl|my_center|LOCUS_16170 3200 1197 gene locus_tag LOCUS_16180 3200 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence190 819 1301 gene locus_tag LOCUS_16190 819 1301 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022180.1 protein_id gnl|my_center|LOCUS_16190 1372 2910 gene locus_tag LOCUS_16200 1372 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence191 531 1754 gene locus_tag LOCUS_16210 gene mmp10 531 1754 CDS product methyl coenzyme M reductase-arginine methyltransferase Mmp10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024424.1 protein_id gnl|my_center|LOCUS_16210 2396 1980 gene locus_tag LOCUS_16220 2396 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence192 208 627 gene locus_tag LOCUS_16230 208 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990637.1 protein_id gnl|my_center|LOCUS_16230 643 2406 gene locus_tag LOCUS_16240 643 2406 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023139.1 protein_id gnl|my_center|LOCUS_16240 2521 2997 gene locus_tag LOCUS_16250 2521 2997 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939839.1 protein_id gnl|my_center|LOCUS_16250 >Feature sequence193 768 1229 gene locus_tag LOCUS_16260 768 1229 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393221.1 protein_id gnl|my_center|LOCUS_16260 1238 3151 gene locus_tag LOCUS_16270 gene nuoF 1238 3151 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_16270 >Feature sequence194 1465 440 gene locus_tag LOCUS_16280 gene trpD 1465 440 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022929.1 protein_id gnl|my_center|LOCUS_16280 1673 1909 gene locus_tag LOCUS_16290 1673 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 2177 2758 gene locus_tag LOCUS_16300 2177 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 >Feature sequence195 125 168 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 547 1809 gene locus_tag LOCUS_16310 547 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence196 >Feature sequence197 728 33 gene locus_tag LOCUS_16320 728 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 942 2642 gene locus_tag LOCUS_16330 942 2642 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948105.1 protein_id gnl|my_center|LOCUS_16330 3075 2620 gene locus_tag LOCUS_16340 3075 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence198 581 985 gene locus_tag LOCUS_16350 581 985 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023134.1 protein_id gnl|my_center|LOCUS_16350 1124 1528 gene locus_tag LOCUS_16360 1124 1528 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023134.1 protein_id gnl|my_center|LOCUS_16360 2516 1566 gene locus_tag LOCUS_16370 2516 1566 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589523.1 protein_id gnl|my_center|LOCUS_16370 2639 2917 gene locus_tag LOCUS_16380 2639 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 >Feature sequence199 <1 533 gene locus_tag LOCUS_16390 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024423.1:coenzyme-B sulfoethylthiotransferase subunit beta 549 1043 gene locus_tag LOCUS_16400 gene mcrD 549 1043 CDS product methyl-coenzyme M reductase operon protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024422.1 protein_id gnl|my_center|LOCUS_16400 1069 1836 gene locus_tag LOCUS_16410 gene mcrG 1069 1836 CDS product coenzyme-B sulfoethylthiotransferase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024420.1 protein_id gnl|my_center|LOCUS_16410 2179 2213 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence200 957 1712 gene locus_tag LOCUS_16420 957 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 2228 1881 gene locus_tag LOCUS_16430 2228 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 >Feature sequence201 222 512 gene locus_tag LOCUS_16440 222 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 1808 585 gene locus_tag LOCUS_16450 gene dnaJ 1808 585 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876908.1 protein_id gnl|my_center|LOCUS_16450 <2819 1915 gene locus_tag LOCUS_16460 <2819 1915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021492.1:molecular chaperone DnaK >Feature sequence202 <1 935 gene locus_tag LOCUS_16470 <1 935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064996.1:DHH family phosphoesterase 1050 1388 gene locus_tag LOCUS_16480 1050 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 2533 1379 gene locus_tag LOCUS_16490 2533 1379 CDS product TIGR04013 family B12-binding domain/radical SAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020300.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence203 4 531 gene locus_tag LOCUS_16500 4 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 467 1948 gene locus_tag LOCUS_16510 467 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 2667 1945 gene locus_tag LOCUS_16520 2667 1945 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 protein_id gnl|my_center|LOCUS_16520 >Feature sequence204 749 69 gene locus_tag LOCUS_16530 749 69 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877951.1 protein_id gnl|my_center|LOCUS_16530 1726 746 gene locus_tag LOCUS_16540 gene radA 1726 746 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023460.1 protein_id gnl|my_center|LOCUS_16540 2757 1777 gene locus_tag LOCUS_16550 2757 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 >Feature sequence205 566 1366 gene locus_tag LOCUS_16560 gene dph5 566 1366 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021388.1 protein_id gnl|my_center|LOCUS_16560 1433 1615 gene locus_tag LOCUS_16570 1433 1615 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020114.1 protein_id gnl|my_center|LOCUS_16570 1612 1962 gene locus_tag LOCUS_16580 gene queD 1612 1962 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065925.1 protein_id gnl|my_center|LOCUS_16580 1959 2636 gene locus_tag LOCUS_16590 gene queC 1959 2636 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876732.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence206 708 166 gene locus_tag LOCUS_16600 708 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence207 <1 756 gene locus_tag LOCUS_16610 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021969.1:TIGR00269 family protein 781 856 gene locus_tag LOCUS_t00200 781 856 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 886 1221 gene locus_tag LOCUS_16620 886 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 1341 1832 gene locus_tag LOCUS_16630 1341 1832 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020962.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence208 1079 375 gene locus_tag LOCUS_16640 1079 375 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021113.1 protein_id gnl|my_center|LOCUS_16640 1444 1085 gene locus_tag LOCUS_16650 gene rplX 1444 1085 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065039.1 protein_id gnl|my_center|LOCUS_16650 1839 1441 gene locus_tag LOCUS_16660 gene rpl14p 1839 1441 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021111.1 protein_id gnl|my_center|LOCUS_16660 2165 1836 gene locus_tag LOCUS_16670 2165 1836 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011696863.1 protein_id gnl|my_center|LOCUS_16670 2446 2153 gene locus_tag LOCUS_16680 2446 2153 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869964.1 protein_id gnl|my_center|LOCUS_16680 2646 2443 gene locus_tag LOCUS_16690 gene rpmC 2646 2443 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021108.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence209 1070 834 gene locus_tag LOCUS_16700 1070 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 1099 1650 gene locus_tag LOCUS_16710 1099 1650 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227382.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence210 1738 2 gene locus_tag LOCUS_16720 1738 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 1849 2460 gene locus_tag LOCUS_16730 1849 2460 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496456.1 protein_id gnl|my_center|LOCUS_16730 >Feature sequence211 357 363 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 392 1051 gene locus_tag LOCUS_16740 gene phoU 392 1051 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_16740 1203 1257 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1391 1969 gene locus_tag LOCUS_16750 1391 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 >Feature sequence212 337 1089 gene locus_tag LOCUS_16760 gene mtnP 337 1089 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021425.1 protein_id gnl|my_center|LOCUS_16760 1576 1202 gene locus_tag LOCUS_16770 1576 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 2362 1589 gene locus_tag LOCUS_16780 2362 1589 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023761.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence213 <1 977 gene locus_tag LOCUS_16790 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002399936.1:SMC family ATPase 2228 1029 gene locus_tag LOCUS_16800 2228 1029 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022842.1 protein_id gnl|my_center|LOCUS_16800