>Feature sequence01 1438 1566 gene locus_tag LOCUS_00010 1438 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2444 1563 gene locus_tag LOCUS_00020 2444 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2963 2490 gene locus_tag LOCUS_00030 2963 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3646 4359 gene locus_tag LOCUS_00040 3646 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4471 4557 gene locus_tag LOCUS_t00010 4471 4557 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5034 6404 gene locus_tag LOCUS_00050 5034 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 8094 7006 gene locus_tag LOCUS_00060 8094 7006 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393378.1 protein_id gnl|my_center|LOCUS_00060 8659 8153 gene locus_tag LOCUS_00070 8659 8153 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903666.1 protein_id gnl|my_center|LOCUS_00070 9265 9648 gene locus_tag LOCUS_00080 9265 9648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156007889.1 protein_id gnl|my_center|LOCUS_00080 9815 10618 gene locus_tag LOCUS_00090 9815 10618 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020491.1 protein_id gnl|my_center|LOCUS_00090 10759 11403 gene locus_tag LOCUS_00100 10759 11403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11427 11615 gene locus_tag LOCUS_00110 11427 11615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11660 11787 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13128 12028 gene locus_tag LOCUS_00120 13128 12028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00120 14911 13436 gene locus_tag LOCUS_00130 14911 13436 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392880.1 protein_id gnl|my_center|LOCUS_00130 15055 15591 gene locus_tag LOCUS_00140 15055 15591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16549 15554 gene locus_tag LOCUS_00150 16549 15554 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061040.1 protein_id gnl|my_center|LOCUS_00150 17484 16546 gene locus_tag LOCUS_00160 17484 16546 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979315.1 protein_id gnl|my_center|LOCUS_00160 17627 18481 gene locus_tag LOCUS_00170 17627 18481 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707642.1 protein_id gnl|my_center|LOCUS_00170 19055 18483 gene locus_tag LOCUS_00180 19055 18483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270483.1 protein_id gnl|my_center|LOCUS_00180 19842 19057 gene locus_tag LOCUS_00190 19842 19057 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878806.1 protein_id gnl|my_center|LOCUS_00190 20544 19870 gene locus_tag LOCUS_00200 20544 19870 CDS product NAAT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871201.1 protein_id gnl|my_center|LOCUS_00200 20768 21439 gene locus_tag LOCUS_00210 20768 21439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 21442 22146 gene locus_tag LOCUS_00220 21442 22146 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867382.1 protein_id gnl|my_center|LOCUS_00220 22198 23235 gene locus_tag LOCUS_00230 22198 23235 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380272.1 protein_id gnl|my_center|LOCUS_00230 23271 23876 gene locus_tag LOCUS_00240 23271 23876 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_00240 23894 25297 gene locus_tag LOCUS_00250 gene pap 23894 25297 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065389.1 protein_id gnl|my_center|LOCUS_00250 25426 27603 gene locus_tag LOCUS_00260 25426 27603 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104337.1 protein_id gnl|my_center|LOCUS_00260 27733 28299 gene locus_tag LOCUS_00270 gene rpoE 27733 28299 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878613.1 protein_id gnl|my_center|LOCUS_00270 28296 28484 gene locus_tag LOCUS_00280 28296 28484 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868804.1 protein_id gnl|my_center|LOCUS_00280 28525 29007 gene locus_tag LOCUS_00290 28525 29007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 29004 29336 gene locus_tag LOCUS_00300 29004 29336 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023602.1 protein_id gnl|my_center|LOCUS_00300 29333 29572 gene locus_tag LOCUS_00310 29333 29572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 29655 30461 gene locus_tag LOCUS_00320 gene proG 29655 30461 CDS product pyrroline-5-carboxylate reductase ProG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232626.1 protein_id gnl|my_center|LOCUS_00320 30546 30627 gene locus_tag LOCUS_t00020 30546 30627 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 32438 30630 gene locus_tag LOCUS_00330 32438 30630 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768314.1 protein_id gnl|my_center|LOCUS_00330 32998 32564 gene locus_tag LOCUS_00340 32998 32564 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023986.1 protein_id gnl|my_center|LOCUS_00340 34727 33060 gene locus_tag LOCUS_00350 34727 33060 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437634.1 protein_id gnl|my_center|LOCUS_00350 35369 34746 gene locus_tag LOCUS_00360 35369 34746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 35401 35728 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35795 36958 gene locus_tag LOCUS_00370 35795 36958 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870830.1 protein_id gnl|my_center|LOCUS_00370 36955 37731 gene locus_tag LOCUS_00380 36955 37731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 41899 37724 gene locus_tag LOCUS_00390 41899 37724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 43026 41983 gene locus_tag LOCUS_00400 gene fen 43026 41983 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250232.1 protein_id gnl|my_center|LOCUS_00400 43247 43071 gene locus_tag LOCUS_00410 43247 43071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 43953 43276 gene locus_tag LOCUS_00420 gene rpe 43953 43276 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811794.1 protein_id gnl|my_center|LOCUS_00420 44068 44262 gene locus_tag LOCUS_00430 44068 44262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 44348 44509 gene locus_tag LOCUS_00440 44348 44509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 44550 45467 gene locus_tag LOCUS_00450 gene rnz 44550 45467 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 protein_id gnl|my_center|LOCUS_00450 45507 46784 gene locus_tag LOCUS_00460 45507 46784 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146541.1 protein_id gnl|my_center|LOCUS_00460 46791 47375 gene locus_tag LOCUS_00470 46791 47375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 49405 47372 gene locus_tag LOCUS_00480 49405 47372 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_00480 49486 49773 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51296 49782 gene locus_tag LOCUS_00490 51296 49782 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546886.1 protein_id gnl|my_center|LOCUS_00490 51880 52158 gene locus_tag LOCUS_00500 51880 52158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 52253 53209 gene locus_tag LOCUS_00510 gene menA 52253 53209 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081897.1 protein_id gnl|my_center|LOCUS_00510 54116 53169 gene locus_tag LOCUS_00520 54116 53169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 55195 54170 gene locus_tag LOCUS_00530 55195 54170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990679.1 protein_id gnl|my_center|LOCUS_00530 56322 55315 gene locus_tag LOCUS_00540 56322 55315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 56792 57322 gene locus_tag LOCUS_00550 56792 57322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 57326 58459 gene locus_tag LOCUS_00560 57326 58459 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337358.1 protein_id gnl|my_center|LOCUS_00560 58469 59212 gene locus_tag LOCUS_00570 58469 59212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 59214 60218 gene locus_tag LOCUS_00580 59214 60218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 60215 60808 gene locus_tag LOCUS_00590 60215 60808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 60923 61396 gene locus_tag LOCUS_00600 60923 61396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 61409 62500 gene locus_tag LOCUS_00610 61409 62500 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902193.1 protein_id gnl|my_center|LOCUS_00610 62685 63404 gene locus_tag LOCUS_00620 62685 63404 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081034.1 protein_id gnl|my_center|LOCUS_00620 63409 66402 gene locus_tag LOCUS_00630 63409 66402 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975721.1 protein_id gnl|my_center|LOCUS_00630 66496 67719 gene locus_tag LOCUS_00640 66496 67719 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583929.1 protein_id gnl|my_center|LOCUS_00640 67745 68116 gene locus_tag LOCUS_00650 67745 68116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 68190 69596 gene locus_tag LOCUS_00660 68190 69596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 69601 70524 gene locus_tag LOCUS_00670 gene twy1 69601 70524 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193384983.1 protein_id gnl|my_center|LOCUS_00670 71143 70565 gene locus_tag LOCUS_00680 71143 70565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 73153 71243 gene locus_tag LOCUS_00690 73153 71243 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023770.1 protein_id gnl|my_center|LOCUS_00690 73875 73213 gene locus_tag LOCUS_00700 gene psmB 73875 73213 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094873.1 protein_id gnl|my_center|LOCUS_00700 74956 74453 gene locus_tag LOCUS_00710 74956 74453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 75157 75579 gene locus_tag LOCUS_00720 75157 75579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 77302 75545 gene locus_tag LOCUS_00730 77302 75545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 79016 77289 gene locus_tag LOCUS_00740 79016 77289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 79572 79003 gene locus_tag LOCUS_00750 79572 79003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 79653 81578 gene locus_tag LOCUS_00760 79653 81578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 81639 82088 gene locus_tag LOCUS_00770 81639 82088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 82073 82531 gene locus_tag LOCUS_00780 82073 82531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 82888 82532 gene locus_tag LOCUS_00790 82888 82532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 84124 82892 gene locus_tag LOCUS_00800 84124 82892 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877199.1 protein_id gnl|my_center|LOCUS_00800 84557 84174 gene locus_tag LOCUS_00810 84557 84174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 85747 84689 gene locus_tag LOCUS_00820 85747 84689 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393776.1 protein_id gnl|my_center|LOCUS_00820 86301 86702 gene locus_tag LOCUS_00830 86301 86702 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065151.1 protein_id gnl|my_center|LOCUS_00830 86786 87532 gene locus_tag LOCUS_00840 86786 87532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 87989 87558 gene locus_tag LOCUS_00850 87989 87558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 88548 88120 gene locus_tag LOCUS_00860 88548 88120 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171561.1 protein_id gnl|my_center|LOCUS_00860 89121 88681 gene locus_tag LOCUS_00870 89121 88681 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990797.1 protein_id gnl|my_center|LOCUS_00870 89446 89147 gene locus_tag LOCUS_00880 89446 89147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 89725 89450 gene locus_tag LOCUS_00890 89725 89450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 90106 89729 gene locus_tag LOCUS_00900 90106 89729 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393515.1 protein_id gnl|my_center|LOCUS_00900 90523 90158 gene locus_tag LOCUS_00910 90523 90158 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021844.1 protein_id gnl|my_center|LOCUS_00910 90843 91847 gene locus_tag LOCUS_00920 90843 91847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 92047 92586 gene locus_tag LOCUS_00930 92047 92586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 93574 92789 gene locus_tag LOCUS_00940 gene trpA 93574 92789 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022930.1 protein_id gnl|my_center|LOCUS_00940 94761 93571 gene locus_tag LOCUS_00950 gene trpB 94761 93571 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867583.1 protein_id gnl|my_center|LOCUS_00950 95375 94752 gene locus_tag LOCUS_00960 95375 94752 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867584.1 protein_id gnl|my_center|LOCUS_00960 96142 95372 gene locus_tag LOCUS_00970 gene trpC 96142 95372 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894608.1 protein_id gnl|my_center|LOCUS_00970 97133 96147 gene locus_tag LOCUS_00980 gene trpD 97133 96147 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_00980 97711 97130 gene locus_tag LOCUS_00990 97711 97130 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174596.1 protein_id gnl|my_center|LOCUS_00990 99054 97708 gene locus_tag LOCUS_01000 gene trpE 99054 97708 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877263.1 protein_id gnl|my_center|LOCUS_01000 99628 100245 gene locus_tag LOCUS_01010 99628 100245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 100685 100239 gene locus_tag LOCUS_01020 100685 100239 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061237.1 protein_id gnl|my_center|LOCUS_01020 100828 101376 gene locus_tag LOCUS_01030 100828 101376 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868483.1 protein_id gnl|my_center|LOCUS_01030 101377 101652 gene locus_tag LOCUS_01040 101377 101652 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868482.1 protein_id gnl|my_center|LOCUS_01040 101649 102824 gene locus_tag LOCUS_01050 gene porA 101649 102824 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877345.1 protein_id gnl|my_center|LOCUS_01050 102826 103737 gene locus_tag LOCUS_01060 102826 103737 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250931.1 protein_id gnl|my_center|LOCUS_01060 103742 105559 gene locus_tag LOCUS_01070 gene iorA 103742 105559 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877454.1 protein_id gnl|my_center|LOCUS_01070 105556 106149 gene locus_tag LOCUS_01080 105556 106149 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249090.1 protein_id gnl|my_center|LOCUS_01080 107245 106157 gene locus_tag LOCUS_01090 107245 106157 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705766.1 protein_id gnl|my_center|LOCUS_01090 108148 107342 gene locus_tag LOCUS_01100 108148 107342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 108625 108248 gene locus_tag LOCUS_01110 108625 108248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 108991 111876 gene locus_tag LOCUS_01120 gene leuS 108991 111876 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021621.1 protein_id gnl|my_center|LOCUS_01120 112391 113578 gene locus_tag LOCUS_01130 112391 113578 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545988.1 protein_id gnl|my_center|LOCUS_01130 114193 113651 gene locus_tag LOCUS_01140 114193 113651 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249464.1 protein_id gnl|my_center|LOCUS_01140 114896 115324 gene locus_tag LOCUS_01150 114896 115324 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877224.1 protein_id gnl|my_center|LOCUS_01150 115337 115678 gene locus_tag LOCUS_01160 115337 115678 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024007.1 protein_id gnl|my_center|LOCUS_01160 115844 116116 gene locus_tag LOCUS_01170 115844 116116 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877220.1 protein_id gnl|my_center|LOCUS_01170 116126 116782 gene locus_tag LOCUS_01180 116126 116782 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879557.1 protein_id gnl|my_center|LOCUS_01180 117685 116936 gene locus_tag LOCUS_01190 117685 116936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 117992 117675 gene locus_tag LOCUS_01200 117992 117675 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112383.1 protein_id gnl|my_center|LOCUS_01200 118837 117989 gene locus_tag LOCUS_01210 118837 117989 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817328.1 protein_id gnl|my_center|LOCUS_01210 119927 119292 gene locus_tag LOCUS_01220 119927 119292 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583839.1 protein_id gnl|my_center|LOCUS_01220 120798 119932 gene locus_tag LOCUS_01230 120798 119932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 120952 122100 gene locus_tag LOCUS_01240 120952 122100 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879550.1 protein_id gnl|my_center|LOCUS_01240 122106 122780 gene locus_tag LOCUS_01250 122106 122780 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022401.1 protein_id gnl|my_center|LOCUS_01250 123135 125012 gene locus_tag LOCUS_01260 123135 125012 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879263.1 protein_id gnl|my_center|LOCUS_01260 125824 126159 gene locus_tag LOCUS_01270 125824 126159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 126125 127198 gene locus_tag LOCUS_01280 126125 127198 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240148.1 protein_id gnl|my_center|LOCUS_01280 127201 128709 gene locus_tag LOCUS_01290 127201 128709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 128706 129812 gene locus_tag LOCUS_01300 128706 129812 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081444.1 protein_id gnl|my_center|LOCUS_01300 129815 130108 gene locus_tag LOCUS_01310 129815 130108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 130248 130628 gene locus_tag LOCUS_01320 130248 130628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 130693 132276 gene locus_tag LOCUS_01330 130693 132276 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878819.1 protein_id gnl|my_center|LOCUS_01330 132537 132277 gene locus_tag LOCUS_01340 132537 132277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 134771 132666 gene locus_tag LOCUS_01350 gene nrdD 134771 132666 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869385.1 protein_id gnl|my_center|LOCUS_01350 135251 135892 gene locus_tag LOCUS_01360 135251 135892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022949.1 protein_id gnl|my_center|LOCUS_01360 135917 136948 gene locus_tag LOCUS_01370 135917 136948 CDS product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024078.1 protein_id gnl|my_center|LOCUS_01370 137085 137288 gene locus_tag LOCUS_01380 137085 137288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 137651 137370 gene locus_tag LOCUS_01390 137651 137370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 137995 137702 gene locus_tag LOCUS_01400 137995 137702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 138269 138973 gene locus_tag LOCUS_01410 138269 138973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 138996 140042 gene locus_tag LOCUS_01420 gene pdhA 138996 140042 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535910.1 protein_id gnl|my_center|LOCUS_01420 140039 141016 gene locus_tag LOCUS_01430 140039 141016 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943294.1 protein_id gnl|my_center|LOCUS_01430 141028 142257 gene locus_tag LOCUS_01440 141028 142257 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943295.1 protein_id gnl|my_center|LOCUS_01440 142952 142254 gene locus_tag LOCUS_01450 142952 142254 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867800.1 protein_id gnl|my_center|LOCUS_01450 143257 142991 gene locus_tag LOCUS_01460 143257 142991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 143532 143242 gene locus_tag LOCUS_01470 143532 143242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 143977 143537 gene locus_tag LOCUS_01480 143977 143537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 144372 144106 gene locus_tag LOCUS_01490 144372 144106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 144694 145056 gene locus_tag LOCUS_01500 144694 145056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 145064 145489 gene locus_tag LOCUS_01510 145064 145489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 145504 146019 gene locus_tag LOCUS_01520 145504 146019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 146663 146127 gene locus_tag LOCUS_01530 146663 146127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 147200 146712 gene locus_tag LOCUS_01540 147200 146712 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_01540 147646 147200 gene locus_tag LOCUS_01550 147646 147200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 147758 148123 gene locus_tag LOCUS_01560 147758 148123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 148479 148198 gene locus_tag LOCUS_01570 148479 148198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 148913 148527 gene locus_tag LOCUS_01580 148913 148527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 148947 150200 gene locus_tag LOCUS_01590 gene hisD 148947 150200 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023136.1 protein_id gnl|my_center|LOCUS_01590 150859 150203 gene locus_tag LOCUS_01600 150859 150203 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080855.1 protein_id gnl|my_center|LOCUS_01600 150932 151432 gene locus_tag LOCUS_01610 150932 151432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 151480 151893 gene locus_tag LOCUS_01620 151480 151893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 >Feature sequence02 76 1 gene locus_tag LOCUS_t00030 76 1 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 304 113 gene locus_tag LOCUS_01630 304 113 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867658.1 protein_id gnl|my_center|LOCUS_01630 711 310 gene locus_tag LOCUS_01640 711 310 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061175.1 protein_id gnl|my_center|LOCUS_01640 1135 716 gene locus_tag LOCUS_01650 gene rplM 1135 716 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878624.1 protein_id gnl|my_center|LOCUS_01650 1503 1141 gene locus_tag LOCUS_01660 1503 1141 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869688.1 protein_id gnl|my_center|LOCUS_01660 6227 1593 gene locus_tag LOCUS_01670 6227 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 6464 7609 gene locus_tag LOCUS_01680 6464 7609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 7612 8166 gene locus_tag LOCUS_01690 gene hxlB 7612 8166 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879292.1 protein_id gnl|my_center|LOCUS_01690 8850 8203 gene locus_tag LOCUS_01700 8850 8203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 9350 8847 gene locus_tag LOCUS_01710 9350 8847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 9591 9337 gene locus_tag LOCUS_01720 9591 9337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 10453 9641 gene locus_tag LOCUS_01730 gene moeB 10453 9641 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705494.1 protein_id gnl|my_center|LOCUS_01730 10560 11681 gene locus_tag LOCUS_01740 10560 11681 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762209.1 protein_id gnl|my_center|LOCUS_01740 11684 12082 gene locus_tag LOCUS_01750 11684 12082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 12134 13654 gene locus_tag LOCUS_01760 12134 13654 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020229.1 protein_id gnl|my_center|LOCUS_01760 14909 13632 gene locus_tag LOCUS_01770 14909 13632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 16236 14947 gene locus_tag LOCUS_01780 16236 14947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 16390 17223 gene locus_tag LOCUS_01790 16390 17223 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022038.1 protein_id gnl|my_center|LOCUS_01790 17734 17237 gene locus_tag LOCUS_01800 17734 17237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 18501 17794 gene locus_tag LOCUS_01810 gene pyrH 18501 17794 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496770.1 protein_id gnl|my_center|LOCUS_01810 19521 19822 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19833 19994 gene locus_tag LOCUS_01820 19833 19994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 19994 21709 gene locus_tag LOCUS_01830 gene argS 19994 21709 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877057.1 protein_id gnl|my_center|LOCUS_01830 21711 22196 gene locus_tag LOCUS_01840 21711 22196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 22923 22198 gene locus_tag LOCUS_01850 22923 22198 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867800.1 protein_id gnl|my_center|LOCUS_01850 24091 22934 gene locus_tag LOCUS_01860 24091 22934 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023596.1 protein_id gnl|my_center|LOCUS_01860 25319 24144 gene locus_tag LOCUS_01870 25319 24144 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750457.1 protein_id gnl|my_center|LOCUS_01870 25576 26196 gene locus_tag LOCUS_01880 25576 26196 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877014.1 protein_id gnl|my_center|LOCUS_01880 26199 26789 gene locus_tag LOCUS_01890 26199 26789 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867340.1 protein_id gnl|my_center|LOCUS_01890 26876 26803 gene locus_tag LOCUS_t00040 26876 26803 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 27594 26956 gene locus_tag LOCUS_01900 27594 26956 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_01900 27691 28221 gene locus_tag LOCUS_01910 27691 28221 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459818.1 protein_id gnl|my_center|LOCUS_01910 28218 28736 gene locus_tag LOCUS_01920 gene speG 28218 28736 CDS product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524603.1 protein_id gnl|my_center|LOCUS_01920 28733 29770 gene locus_tag LOCUS_01930 28733 29770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 29884 30279 gene locus_tag LOCUS_01940 29884 30279 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878974.1 protein_id gnl|my_center|LOCUS_01940 30738 30328 gene locus_tag LOCUS_01950 30738 30328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 30936 32375 gene locus_tag LOCUS_01960 30936 32375 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545342.1 protein_id gnl|my_center|LOCUS_01960 33039 32383 gene locus_tag LOCUS_01970 33039 32383 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061267.1 protein_id gnl|my_center|LOCUS_01970 33194 34243 gene locus_tag LOCUS_01980 33194 34243 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392337.1 protein_id gnl|my_center|LOCUS_01980 34288 36171 gene locus_tag LOCUS_01990 34288 36171 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022843.1 protein_id gnl|my_center|LOCUS_01990 36204 36959 gene locus_tag LOCUS_02000 36204 36959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 36987 38081 gene locus_tag LOCUS_02010 36987 38081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 38454 38041 gene locus_tag LOCUS_02020 38454 38041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 38924 38454 gene locus_tag LOCUS_02030 38924 38454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 39838 39077 gene locus_tag LOCUS_02040 39838 39077 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876917.1 protein_id gnl|my_center|LOCUS_02040 40091 39942 gene locus_tag LOCUS_02050 40091 39942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 40036 41226 gene locus_tag LOCUS_02060 40036 41226 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_02060 41678 41232 gene locus_tag LOCUS_02070 41678 41232 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021168.1 protein_id gnl|my_center|LOCUS_02070 41810 42634 gene locus_tag LOCUS_02080 41810 42634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 42716 43225 gene locus_tag LOCUS_02090 gene hdrC 42716 43225 CDS product CoB--CoM heterodisulfide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261191.1 protein_id gnl|my_center|LOCUS_02090 43222 44079 gene locus_tag LOCUS_02100 gene hdrB 43222 44079 CDS product CoB--CoM heterodisulfide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870378.1 protein_id gnl|my_center|LOCUS_02100 44327 45109 gene locus_tag LOCUS_02110 44327 45109 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250205.1 protein_id gnl|my_center|LOCUS_02110 45329 46495 gene locus_tag LOCUS_02120 45329 46495 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256035.1 protein_id gnl|my_center|LOCUS_02120 46497 46856 gene locus_tag LOCUS_02130 46497 46856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 47447 46857 gene locus_tag LOCUS_02140 47447 46857 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878350.1 protein_id gnl|my_center|LOCUS_02140 47684 48262 gene locus_tag LOCUS_02150 47684 48262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 48324 48926 gene locus_tag LOCUS_02160 48324 48926 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496635.1 protein_id gnl|my_center|LOCUS_02160 48928 50187 gene locus_tag LOCUS_02170 48928 50187 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020936.1 protein_id gnl|my_center|LOCUS_02170 50168 51289 gene locus_tag LOCUS_02180 50168 51289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 51348 51563 gene locus_tag LOCUS_02190 51348 51563 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878376.1 protein_id gnl|my_center|LOCUS_02190 51748 53166 gene locus_tag LOCUS_02200 gene purF 51748 53166 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065634.1 protein_id gnl|my_center|LOCUS_02200 53368 53441 gene locus_tag LOCUS_t00050 53368 53441 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 55045 53957 gene locus_tag LOCUS_02210 55045 53957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 56016 55228 gene locus_tag LOCUS_02220 56016 55228 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990612.1 protein_id gnl|my_center|LOCUS_02220 57194 56013 gene locus_tag LOCUS_02230 57194 56013 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869579.1 protein_id gnl|my_center|LOCUS_02230 57873 57289 gene locus_tag LOCUS_02240 57873 57289 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020569.1 protein_id gnl|my_center|LOCUS_02240 58877 57870 gene locus_tag LOCUS_02250 58877 57870 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020570.1 protein_id gnl|my_center|LOCUS_02250 59541 58882 gene locus_tag LOCUS_02260 59541 58882 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024140.1 protein_id gnl|my_center|LOCUS_02260 60244 59489 gene locus_tag LOCUS_02270 gene cobJ 60244 59489 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024141.1 protein_id gnl|my_center|LOCUS_02270 61124 60258 gene locus_tag LOCUS_02280 gene cbiG 61124 60258 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903134.1 protein_id gnl|my_center|LOCUS_02280 61840 61121 gene locus_tag LOCUS_02290 61840 61121 CDS product cobalt-precorrin-4/precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024142.1 protein_id gnl|my_center|LOCUS_02290 62450 61842 gene locus_tag LOCUS_02300 62450 61842 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024143.1 protein_id gnl|my_center|LOCUS_02300 62938 62450 gene locus_tag LOCUS_02310 gene cbiT 62938 62450 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024144.1 protein_id gnl|my_center|LOCUS_02310 63166 63317 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 63502 63843 gene locus_tag LOCUS_02320 63502 63843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 64428 63880 gene locus_tag LOCUS_02330 64428 63880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 64595 64431 gene locus_tag LOCUS_02340 64595 64431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 64737 65105 gene locus_tag LOCUS_02350 64737 65105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 65852 65115 gene locus_tag LOCUS_02360 65852 65115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 67375 65849 gene locus_tag LOCUS_02370 67375 65849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 67732 67415 gene locus_tag LOCUS_02380 67732 67415 CDS product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229731.1 protein_id gnl|my_center|LOCUS_02380 67819 68709 gene locus_tag LOCUS_02390 67819 68709 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184138029.1 protein_id gnl|my_center|LOCUS_02390 69221 69054 gene locus_tag LOCUS_02400 69221 69054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 69625 69206 gene locus_tag LOCUS_02410 69625 69206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02410 69710 69883 gene locus_tag LOCUS_02420 69710 69883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 70578 70282 gene locus_tag LOCUS_02430 70578 70282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 70948 71718 gene locus_tag LOCUS_02440 gene heR 70948 71718 CDS product heliorhodopsin HeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296133.1 protein_id gnl|my_center|LOCUS_02440 71741 72595 gene locus_tag LOCUS_02450 71741 72595 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_02450 72977 73984 gene locus_tag LOCUS_02460 72977 73984 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_02460 73990 74778 gene locus_tag LOCUS_02470 73990 74778 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057164.1 protein_id gnl|my_center|LOCUS_02470 75089 75664 gene locus_tag LOCUS_02480 75089 75664 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810481.1 protein_id gnl|my_center|LOCUS_02480 76949 76014 gene locus_tag LOCUS_02490 76949 76014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 78570 77008 gene locus_tag LOCUS_02500 gene cimA 78570 77008 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146979.1 protein_id gnl|my_center|LOCUS_02500 79678 78659 gene locus_tag LOCUS_02510 79678 78659 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022537.1 protein_id gnl|my_center|LOCUS_02510 80172 79678 gene locus_tag LOCUS_02520 80172 79678 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878434.1 protein_id gnl|my_center|LOCUS_02520 80341 80255 gene locus_tag LOCUS_t00060 80341 80255 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 81195 80368 gene locus_tag LOCUS_02530 81195 80368 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027793.1 protein_id gnl|my_center|LOCUS_02530 81274 82074 gene locus_tag LOCUS_02540 81274 82074 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061072.1 protein_id gnl|my_center|LOCUS_02540 82551 82024 gene locus_tag LOCUS_02550 82551 82024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 82660 82735 gene locus_tag LOCUS_t00070 82660 82735 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 82952 83287 gene locus_tag LOCUS_02560 gene cutA 82952 83287 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250982.1 protein_id gnl|my_center|LOCUS_02560 84792 83617 gene locus_tag LOCUS_02570 84792 83617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 84975 85610 gene locus_tag LOCUS_02580 84975 85610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 85765 86748 gene locus_tag LOCUS_02590 85765 86748 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250976.1 protein_id gnl|my_center|LOCUS_02590 86741 87559 gene locus_tag LOCUS_02600 86741 87559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 87561 88370 gene locus_tag LOCUS_02610 87561 88370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 88501 88659 gene locus_tag LOCUS_02620 88501 88659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 88664 89791 gene locus_tag LOCUS_02630 88664 89791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 90396 89866 gene locus_tag LOCUS_02640 90396 89866 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875902.1 protein_id gnl|my_center|LOCUS_02640 90663 90493 gene locus_tag LOCUS_02650 90663 90493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 91002 90724 gene locus_tag LOCUS_02660 91002 90724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 91350 92801 gene locus_tag LOCUS_02670 gene lysS 91350 92801 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583287.1 protein_id gnl|my_center|LOCUS_02670 93717 92782 gene locus_tag LOCUS_02680 93717 92782 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065770.1 protein_id gnl|my_center|LOCUS_02680 94640 93909 gene locus_tag LOCUS_02690 94640 93909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 95781 94765 gene locus_tag LOCUS_02700 95781 94765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 <96555 96025 gene locus_tag LOCUS_02710 <96555 96025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878440.1:DNA topoisomerase IV subunit A >Feature sequence03 407 1075 gene locus_tag LOCUS_02720 407 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02720 1072 1545 gene locus_tag LOCUS_02730 1072 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 1550 1906 gene locus_tag LOCUS_02740 1550 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 2560 1928 gene locus_tag LOCUS_02750 2560 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 2725 4671 gene locus_tag LOCUS_02760 2725 4671 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271940.1 protein_id gnl|my_center|LOCUS_02760 4721 6769 gene locus_tag LOCUS_02770 4721 6769 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271940.1 protein_id gnl|my_center|LOCUS_02770 6975 7265 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7280 7660 gene locus_tag LOCUS_02780 7280 7660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 8778 7657 gene locus_tag LOCUS_02790 8778 7657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876041.1 protein_id gnl|my_center|LOCUS_02790 9904 8945 gene locus_tag LOCUS_02800 9904 8945 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319540.1 protein_id gnl|my_center|LOCUS_02800 10921 9962 gene locus_tag LOCUS_02810 gene mvaD 10921 9962 CDS product phosphomevalonate decarboxylase MvaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289187.1 protein_id gnl|my_center|LOCUS_02810 11325 10918 gene locus_tag LOCUS_02820 11325 10918 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867748.1 protein_id gnl|my_center|LOCUS_02820 11440 12258 gene locus_tag LOCUS_02830 11440 12258 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 protein_id gnl|my_center|LOCUS_02830 12757 12404 gene locus_tag LOCUS_02840 12757 12404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 12967 13725 gene locus_tag LOCUS_02850 gene purN 12967 13725 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_02850 13765 14853 gene locus_tag LOCUS_02860 13765 14853 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965395.1 protein_id gnl|my_center|LOCUS_02860 14856 16232 gene locus_tag LOCUS_02870 14856 16232 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876489.1 protein_id gnl|my_center|LOCUS_02870 16233 17369 gene locus_tag LOCUS_02880 16233 17369 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065661.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02880 17312 17581 gene locus_tag LOCUS_02890 17312 17581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 18061 17588 gene locus_tag LOCUS_02900 18061 17588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 18432 18058 gene locus_tag LOCUS_02910 18432 18058 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081563.1 protein_id gnl|my_center|LOCUS_02910 18543 19388 gene locus_tag LOCUS_02920 18543 19388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 20469 19477 gene locus_tag LOCUS_02930 gene ilvC 20469 19477 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496863.1 protein_id gnl|my_center|LOCUS_02930 20844 20479 gene locus_tag LOCUS_02940 20844 20479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 21113 20832 gene locus_tag LOCUS_02950 21113 20832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 21118 21276 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23449 23616 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23646 24224 gene locus_tag LOCUS_02960 23646 24224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 25417 24302 gene locus_tag LOCUS_02970 25417 24302 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256178.1 protein_id gnl|my_center|LOCUS_02970 26028 25585 gene locus_tag LOCUS_02980 26028 25585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 27649 26363 gene locus_tag LOCUS_02990 27649 26363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 27982 29196 gene locus_tag LOCUS_03000 27982 29196 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496567.1 protein_id gnl|my_center|LOCUS_03000 29843 29193 gene locus_tag LOCUS_03010 29843 29193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 30000 30227 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31344 30514 gene locus_tag LOCUS_03020 gene dapF 31344 30514 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768322.1 protein_id gnl|my_center|LOCUS_03020 32600 31341 gene locus_tag LOCUS_03030 gene lysA 32600 31341 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_03030 33956 32601 gene locus_tag LOCUS_03040 33956 32601 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870075.1 protein_id gnl|my_center|LOCUS_03040 34732 33953 gene locus_tag LOCUS_03050 gene dapB 34732 33953 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024350.1 protein_id gnl|my_center|LOCUS_03050 35617 34745 gene locus_tag LOCUS_03060 gene dapA 35617 34745 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878410.1 protein_id gnl|my_center|LOCUS_03060 36041 35619 gene locus_tag LOCUS_03070 36041 35619 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903327.1 protein_id gnl|my_center|LOCUS_03070 37098 36184 gene locus_tag LOCUS_03080 37098 36184 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879191.1 protein_id gnl|my_center|LOCUS_03080 38048 37095 gene locus_tag LOCUS_03090 38048 37095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 38769 38029 gene locus_tag LOCUS_03100 38769 38029 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978563.1 protein_id gnl|my_center|LOCUS_03100 39384 38878 gene locus_tag LOCUS_03110 39384 38878 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583273.1 protein_id gnl|my_center|LOCUS_03110 41027 39450 gene locus_tag LOCUS_03120 41027 39450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 41194 42063 gene locus_tag LOCUS_03130 41194 42063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 42694 42002 gene locus_tag LOCUS_03140 42694 42002 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870952.1 protein_id gnl|my_center|LOCUS_03140 43739 42699 gene locus_tag LOCUS_03150 gene amrS 43739 42699 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023404.1 protein_id gnl|my_center|LOCUS_03150 44703 43744 gene locus_tag LOCUS_03160 gene thiL 44703 43744 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877008.1 protein_id gnl|my_center|LOCUS_03160 45215 44793 gene locus_tag LOCUS_03170 45215 44793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 45573 45259 gene locus_tag LOCUS_03180 gene hgcB 45573 45259 CDS product mercury methylation ferredoxin HgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942087.1 protein_id gnl|my_center|LOCUS_03180 46544 45573 gene locus_tag LOCUS_03190 gene hgcA 46544 45573 CDS product mercury methylation corrinoid protein HgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942086.1 protein_id gnl|my_center|LOCUS_03190 46815 46549 gene locus_tag LOCUS_03200 46815 46549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 46922 47830 gene locus_tag LOCUS_03210 46922 47830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 47992 48387 gene locus_tag LOCUS_03220 47992 48387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 48384 48911 gene locus_tag LOCUS_03230 48384 48911 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226004.1 protein_id gnl|my_center|LOCUS_03230 50018 48921 gene locus_tag LOCUS_03240 gene proB 50018 48921 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023993.1 protein_id gnl|my_center|LOCUS_03240 51304 50015 gene locus_tag LOCUS_03250 51304 50015 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023992.1 protein_id gnl|my_center|LOCUS_03250 52079 51432 gene locus_tag LOCUS_03260 gene fsa 52079 51432 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083013.1 protein_id gnl|my_center|LOCUS_03260 53023 52076 gene locus_tag LOCUS_03270 53023 52076 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_03270 53826 53020 gene locus_tag LOCUS_03280 53826 53020 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_03280 53930 54196 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 54469 54740 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 55491 55156 gene locus_tag LOCUS_03290 55491 55156 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249488.1 protein_id gnl|my_center|LOCUS_03290 56453 55554 gene locus_tag LOCUS_03300 56453 55554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 56919 56560 gene locus_tag LOCUS_03310 56919 56560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 57022 57501 gene locus_tag LOCUS_03320 57022 57501 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404578.1 protein_id gnl|my_center|LOCUS_03320 57513 58763 gene locus_tag LOCUS_03330 57513 58763 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878039.1 protein_id gnl|my_center|LOCUS_03330 58802 59626 gene locus_tag LOCUS_03340 gene nadC 58802 59626 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877434.1 protein_id gnl|my_center|LOCUS_03340 59789 59977 gene locus_tag LOCUS_03350 59789 59977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 60083 60784 gene locus_tag LOCUS_03360 60083 60784 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869386.1 protein_id gnl|my_center|LOCUS_03360 60864 61589 gene locus_tag LOCUS_03370 60864 61589 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013805.1 protein_id gnl|my_center|LOCUS_03370 61600 63054 gene locus_tag LOCUS_03380 61600 63054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 63173 63246 gene locus_tag LOCUS_t00080 63173 63246 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 63381 63737 gene locus_tag LOCUS_03390 63381 63737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 63884 65302 gene locus_tag LOCUS_03400 63884 65302 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022183.1 protein_id gnl|my_center|LOCUS_03400 65310 66761 gene locus_tag LOCUS_03410 65310 66761 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064847.1 protein_id gnl|my_center|LOCUS_03410 66855 67169 gene locus_tag LOCUS_03420 66855 67169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 68248 67187 gene locus_tag LOCUS_03430 68248 67187 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256070.1 protein_id gnl|my_center|LOCUS_03430 68616 68245 gene locus_tag LOCUS_03440 68616 68245 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902731.1 protein_id gnl|my_center|LOCUS_03440 69635 68616 gene locus_tag LOCUS_03450 69635 68616 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404258.1 protein_id gnl|my_center|LOCUS_03450 69808 70452 gene locus_tag LOCUS_03460 69808 70452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 70478 71548 gene locus_tag LOCUS_03470 70478 71548 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122599.1 protein_id gnl|my_center|LOCUS_03470 71559 72128 gene locus_tag LOCUS_03480 71559 72128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 72998 72189 gene locus_tag LOCUS_03490 72998 72189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939108.1 protein_id gnl|my_center|LOCUS_03490 74517 73000 gene locus_tag LOCUS_03500 74517 73000 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392806.1 protein_id gnl|my_center|LOCUS_03500 75746 74514 gene locus_tag LOCUS_03510 75746 74514 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392807.1 protein_id gnl|my_center|LOCUS_03510 76217 76849 gene locus_tag LOCUS_03520 76217 76849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 76856 77449 gene locus_tag LOCUS_03530 76856 77449 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020764.1 protein_id gnl|my_center|LOCUS_03530 77466 78023 gene locus_tag LOCUS_03540 77466 78023 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876931.1 protein_id gnl|my_center|LOCUS_03540 78087 78290 gene locus_tag LOCUS_03550 78087 78290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 78365 78997 gene locus_tag LOCUS_03560 78365 78997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 79220 78969 gene locus_tag LOCUS_03570 79220 78969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 79290 79763 gene locus_tag LOCUS_03580 79290 79763 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249292.1 protein_id gnl|my_center|LOCUS_03580 79769 80041 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 81951 81022 gene locus_tag LOCUS_03590 gene ispB 81951 81022 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216396.1 protein_id gnl|my_center|LOCUS_03590 82093 82518 gene locus_tag LOCUS_03600 82093 82518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 83984 82515 gene locus_tag LOCUS_03610 gene fpoN 83984 82515 CDS product F(420)H(2) dehydrogenase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021520.1 protein_id gnl|my_center|LOCUS_03610 85503 83986 gene locus_tag LOCUS_03620 gene fpoM 85503 83986 CDS product F(420)H(2) dehydrogenase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021519.1 protein_id gnl|my_center|LOCUS_03620 87484 85505 gene locus_tag LOCUS_03630 gene fpoL 87484 85505 CDS product F420H2 dehydrogenase subunit FpoL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021518.1 protein_id gnl|my_center|LOCUS_03630 87789 87487 gene locus_tag LOCUS_03640 gene nuoK 87789 87487 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902440.1 protein_id gnl|my_center|LOCUS_03640 88016 87786 gene locus_tag LOCUS_03650 88016 87786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 88293 88009 gene locus_tag LOCUS_03660 88293 88009 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048140880.1 protein_id gnl|my_center|LOCUS_03660 <89012 88293 gene locus_tag LOCUS_03670 <89012 88293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056515.1:NAD(P)H-quinone oxidoreductase subunit I >Feature sequence04 54 686 gene locus_tag LOCUS_03680 54 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 799 1680 gene locus_tag LOCUS_03690 gene htpX 799 1680 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360263.1 protein_id gnl|my_center|LOCUS_03690 2398 1712 gene locus_tag LOCUS_03700 2398 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 3657 2380 gene locus_tag LOCUS_03710 3657 2380 CDS product bifunctional hexulose-6-phosphate synthase/ribonuclease regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878362.1 protein_id gnl|my_center|LOCUS_03710 3762 4508 gene locus_tag LOCUS_03720 3762 4508 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867382.1 protein_id gnl|my_center|LOCUS_03720 4508 5080 gene locus_tag LOCUS_03730 4508 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 5216 5644 gene locus_tag LOCUS_03740 5216 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 5680 5922 gene locus_tag LOCUS_03750 5680 5922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 5954 6736 gene locus_tag LOCUS_03760 5954 6736 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907889.1 protein_id gnl|my_center|LOCUS_03760 7235 6738 gene locus_tag LOCUS_03770 7235 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 7498 7938 gene locus_tag LOCUS_03780 7498 7938 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_03780 9177 7939 gene locus_tag LOCUS_03790 9177 7939 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020830.1 protein_id gnl|my_center|LOCUS_03790 9176 9811 gene locus_tag LOCUS_03800 9176 9811 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065425.1 protein_id gnl|my_center|LOCUS_03800 10244 15124 gene locus_tag LOCUS_03810 10244 15124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 15121 15420 gene locus_tag LOCUS_03820 15121 15420 CDS product DUF424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868107.1 protein_id gnl|my_center|LOCUS_03820 15458 16504 gene locus_tag LOCUS_03830 15458 16504 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903850.1 protein_id gnl|my_center|LOCUS_03830 17240 16491 gene locus_tag LOCUS_03840 17240 16491 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868711.1 protein_id gnl|my_center|LOCUS_03840 18079 17237 gene locus_tag LOCUS_03850 18079 17237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 19016 18084 gene locus_tag LOCUS_03860 19016 18084 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878632.1 protein_id gnl|my_center|LOCUS_03860 19561 20403 gene locus_tag LOCUS_03870 19561 20403 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065423.1 protein_id gnl|my_center|LOCUS_03870 20393 20983 gene locus_tag LOCUS_03880 20393 20983 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064673.1 protein_id gnl|my_center|LOCUS_03880 22000 20972 gene locus_tag LOCUS_03890 22000 20972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 22138 27522 gene locus_tag LOCUS_03900 22138 27522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 27806 28189 gene locus_tag LOCUS_03910 27806 28189 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933225.1 protein_id gnl|my_center|LOCUS_03910 28988 28143 gene locus_tag LOCUS_03920 28988 28143 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 protein_id gnl|my_center|LOCUS_03920 29743 28985 gene locus_tag LOCUS_03930 29743 28985 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257316.1 protein_id gnl|my_center|LOCUS_03930 30236 29751 gene locus_tag LOCUS_03940 30236 29751 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899658.1 protein_id gnl|my_center|LOCUS_03940 30190 31116 gene locus_tag LOCUS_03950 30190 31116 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060947.1 protein_id gnl|my_center|LOCUS_03950 31203 32192 gene locus_tag LOCUS_03960 31203 32192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 33627 32365 gene locus_tag LOCUS_03970 gene thiC 33627 32365 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941266.1 protein_id gnl|my_center|LOCUS_03970 33904 37110 gene locus_tag LOCUS_03980 33904 37110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 37122 39656 gene locus_tag LOCUS_03990 gene gyrA 37122 39656 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021593.1 protein_id gnl|my_center|LOCUS_03990 39723 40469 gene locus_tag LOCUS_04000 39723 40469 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250861.1 protein_id gnl|my_center|LOCUS_04000 40525 41616 gene locus_tag LOCUS_04010 40525 41616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 41764 47754 gene locus_tag LOCUS_04020 41764 47754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 49584 47905 gene locus_tag LOCUS_04030 49584 47905 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878496.1 protein_id gnl|my_center|LOCUS_04030 50489 49584 gene locus_tag LOCUS_04040 50489 49584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 51531 50491 gene locus_tag LOCUS_04050 51531 50491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 53269 51521 gene locus_tag LOCUS_04060 53269 51521 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878496.1 protein_id gnl|my_center|LOCUS_04060 54216 53278 gene locus_tag LOCUS_04070 54216 53278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020287.1 protein_id gnl|my_center|LOCUS_04070 54394 54467 gene locus_tag LOCUS_t00090 54394 54467 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 54533 54964 gene locus_tag LOCUS_04080 54533 54964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 56859 55126 gene locus_tag LOCUS_04090 56859 55126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 57053 57223 gene locus_tag LOCUS_04100 57053 57223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 57381 58403 gene locus_tag LOCUS_04110 57381 58403 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639944.1 protein_id gnl|my_center|LOCUS_04110 58467 59033 gene locus_tag LOCUS_04120 58467 59033 CDS product DUF531 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868567.1 protein_id gnl|my_center|LOCUS_04120 60050 59040 gene locus_tag LOCUS_04130 gene purM 60050 59040 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879189.1 protein_id gnl|my_center|LOCUS_04130 60169 60831 gene locus_tag LOCUS_04140 gene rrmJ 60169 60831 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870893.1 protein_id gnl|my_center|LOCUS_04140 60889 61122 gene locus_tag LOCUS_04150 60889 61122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022956.1 protein_id gnl|my_center|LOCUS_04150 61122 61754 gene locus_tag LOCUS_04160 61122 61754 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868512.1 protein_id gnl|my_center|LOCUS_04160 64492 61751 gene locus_tag LOCUS_04170 64492 61751 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020807.1 protein_id gnl|my_center|LOCUS_04170 65784 64570 gene locus_tag LOCUS_04180 65784 64570 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020733.1 protein_id gnl|my_center|LOCUS_04180 66445 65906 gene locus_tag LOCUS_04190 66445 65906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 66659 68719 gene locus_tag LOCUS_04200 gene hyfB 66659 68719 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393678.1 protein_id gnl|my_center|LOCUS_04200 68716 69651 gene locus_tag LOCUS_04210 68716 69651 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089080.1 protein_id gnl|my_center|LOCUS_04210 69667 70317 gene locus_tag LOCUS_04220 69667 70317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542749.1 protein_id gnl|my_center|LOCUS_04220 70314 71786 gene locus_tag LOCUS_04230 70314 71786 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816730.1 protein_id gnl|my_center|LOCUS_04230 72967 73233 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 73261 73518 gene locus_tag LOCUS_04240 73261 73518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 73528 73848 gene locus_tag LOCUS_04250 73528 73848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 73841 74305 gene locus_tag LOCUS_04260 73841 74305 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089084.1 protein_id gnl|my_center|LOCUS_04260 74741 74316 gene locus_tag LOCUS_04270 74741 74316 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876531.1 protein_id gnl|my_center|LOCUS_04270 74846 76714 gene locus_tag LOCUS_04280 74846 76714 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937741.1 protein_id gnl|my_center|LOCUS_04280 76714 77562 gene locus_tag LOCUS_04290 76714 77562 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937740.1 protein_id gnl|my_center|LOCUS_04290 77562 78011 gene locus_tag LOCUS_04300 77562 78011 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937739.1 protein_id gnl|my_center|LOCUS_04300 78008 78349 gene locus_tag LOCUS_04310 78008 78349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 78346 79422 gene locus_tag LOCUS_04320 78346 79422 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937737.1 protein_id gnl|my_center|LOCUS_04320 79427 79816 gene locus_tag LOCUS_04330 79427 79816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 79902 80309 gene locus_tag LOCUS_04340 79902 80309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 80380 81444 gene locus_tag LOCUS_04350 80380 81444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 81683 82963 gene locus_tag LOCUS_04360 81683 82963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 83215 82964 gene locus_tag LOCUS_04370 83215 82964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 83762 83277 gene locus_tag LOCUS_04380 83762 83277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 84072 83740 gene locus_tag LOCUS_04390 84072 83740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 >Feature sequence05 2493 1438 gene locus_tag LOCUS_04400 gene amrS 2493 1438 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_04400 3708 2560 gene locus_tag LOCUS_04410 gene hmgA 3708 2560 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249865.1 protein_id gnl|my_center|LOCUS_04410 3966 4553 gene locus_tag LOCUS_04420 3966 4553 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876433.1 protein_id gnl|my_center|LOCUS_04420 4973 5395 gene locus_tag LOCUS_04430 4973 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 5608 5444 gene locus_tag LOCUS_04440 5608 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 5671 5748 gene locus_tag LOCUS_t00100 5671 5748 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 7367 6342 gene locus_tag LOCUS_04450 7367 6342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 7719 7441 gene locus_tag LOCUS_04460 7719 7441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 8979 8839 gene locus_tag LOCUS_04470 8979 8839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 9251 9030 gene locus_tag LOCUS_04480 9251 9030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 9385 9248 gene locus_tag LOCUS_04490 9385 9248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 9624 9418 gene locus_tag LOCUS_04500 9624 9418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 12700 10052 gene locus_tag LOCUS_04510 12700 10052 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964263.1 protein_id gnl|my_center|LOCUS_04510 14417 12702 gene locus_tag LOCUS_04520 14417 12702 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964265.1 protein_id gnl|my_center|LOCUS_04520 15318 15118 gene locus_tag LOCUS_04530 15318 15118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 15609 15376 gene locus_tag LOCUS_04540 15609 15376 CDS product DUF2164 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810437.1 protein_id gnl|my_center|LOCUS_04540 16161 15808 gene locus_tag LOCUS_04550 16161 15808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 16810 16436 gene locus_tag LOCUS_04560 16810 16436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 16960 17178 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17516 17181 gene locus_tag LOCUS_04570 17516 17181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 17703 17533 gene locus_tag LOCUS_04580 17703 17533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 17733 18026 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19010 20776 gene locus_tag LOCUS_04590 19010 20776 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099684.1 protein_id gnl|my_center|LOCUS_04590 20983 20822 gene locus_tag LOCUS_04600 20983 20822 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_04600 21531 20980 gene locus_tag LOCUS_04610 21531 20980 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965783.1 protein_id gnl|my_center|LOCUS_04610 22045 21578 gene locus_tag LOCUS_04620 22045 21578 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147291.1 protein_id gnl|my_center|LOCUS_04620 22573 22055 gene locus_tag LOCUS_04630 22573 22055 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147291.1 protein_id gnl|my_center|LOCUS_04630 23721 22681 gene locus_tag LOCUS_04640 23721 22681 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905888.1 protein_id gnl|my_center|LOCUS_04640 24149 23724 gene locus_tag LOCUS_04650 24149 23724 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023752.1 protein_id gnl|my_center|LOCUS_04650 25450 24149 gene locus_tag LOCUS_04660 25450 24149 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879167.1 protein_id gnl|my_center|LOCUS_04660 25584 26054 gene locus_tag LOCUS_04670 25584 26054 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971103.1 protein_id gnl|my_center|LOCUS_04670 26215 26472 gene locus_tag LOCUS_04680 26215 26472 CDS product cytochrome b5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642199.1 protein_id gnl|my_center|LOCUS_04680 26643 28949 gene locus_tag LOCUS_04690 26643 28949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 30483 28960 gene locus_tag LOCUS_04700 30483 28960 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065911.1 protein_id gnl|my_center|LOCUS_04700 30835 31230 gene locus_tag LOCUS_04710 gene crcB 30835 31230 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969203.1 protein_id gnl|my_center|LOCUS_04710 34363 32354 gene locus_tag LOCUS_04720 34363 32354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 35185 37140 gene locus_tag LOCUS_04730 35185 37140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 38412 37837 gene locus_tag LOCUS_04740 38412 37837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 39548 38751 gene locus_tag LOCUS_04750 39548 38751 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903562.1 protein_id gnl|my_center|LOCUS_04750 40404 39589 gene locus_tag LOCUS_04760 40404 39589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 41200 40397 gene locus_tag LOCUS_04770 41200 40397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 41422 41859 gene locus_tag LOCUS_04780 41422 41859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 43562 42171 gene locus_tag LOCUS_04790 43562 42171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 45381 43720 gene locus_tag LOCUS_04800 gene thsB 45381 43720 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878948.1 protein_id gnl|my_center|LOCUS_04800 46400 45561 gene locus_tag LOCUS_04810 46400 45561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04810 47688 46393 gene locus_tag LOCUS_04820 47688 46393 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763075.1 protein_id gnl|my_center|LOCUS_04820 48653 47748 gene locus_tag LOCUS_04830 gene ispB 48653 47748 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216396.1 protein_id gnl|my_center|LOCUS_04830 49593 48655 gene locus_tag LOCUS_04840 49593 48655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 51052 50114 gene locus_tag LOCUS_04850 51052 50114 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878151.1 protein_id gnl|my_center|LOCUS_04850 52118 51147 gene locus_tag LOCUS_04860 52118 51147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 53793 52129 gene locus_tag LOCUS_04870 gene polX 53793 52129 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228471.1 protein_id gnl|my_center|LOCUS_04870 54624 53803 gene locus_tag LOCUS_04880 gene larB 54624 53803 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061016.1 protein_id gnl|my_center|LOCUS_04880 54753 55604 gene locus_tag LOCUS_04890 gene larE 54753 55604 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461498.1 protein_id gnl|my_center|LOCUS_04890 55668 55889 gene locus_tag LOCUS_04900 55668 55889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 55882 56502 gene locus_tag LOCUS_04910 55882 56502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 56746 56961 gene locus_tag LOCUS_04920 56746 56961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 57252 58664 gene locus_tag LOCUS_04930 57252 58664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 58675 60204 gene locus_tag LOCUS_04940 58675 60204 CDS product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876525.1 protein_id gnl|my_center|LOCUS_04940 60668 60207 gene locus_tag LOCUS_04950 gene rimI 60668 60207 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251164.1 protein_id gnl|my_center|LOCUS_04950 62634 60649 gene locus_tag LOCUS_04960 62634 60649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 63366 62689 gene locus_tag LOCUS_04970 gene tpiA 63366 62689 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868855.1 protein_id gnl|my_center|LOCUS_04970 64501 63359 gene locus_tag LOCUS_04980 gene fbp 64501 63359 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877293.1 protein_id gnl|my_center|LOCUS_04980 64788 65088 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 66301 66864 gene locus_tag LOCUS_04990 66301 66864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 68279 68581 gene locus_tag LOCUS_05000 68279 68581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 69317 69087 gene locus_tag LOCUS_05010 69317 69087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 69418 70734 gene locus_tag LOCUS_05020 gene aspS 69418 70734 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868079.1 protein_id gnl|my_center|LOCUS_05020 70815 71261 gene locus_tag LOCUS_05030 70815 71261 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967591.1 protein_id gnl|my_center|LOCUS_05030 >Feature sequence06 74 158 gene locus_tag LOCUS_t00110 74 158 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 901 2256 gene locus_tag LOCUS_05040 901 2256 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065247.1 protein_id gnl|my_center|LOCUS_05040 2780 3382 gene locus_tag LOCUS_05050 2780 3382 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065212.1 protein_id gnl|my_center|LOCUS_05050 4007 4384 gene locus_tag LOCUS_05060 4007 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 4546 4980 gene locus_tag LOCUS_05070 4546 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 5394 4981 gene locus_tag LOCUS_05080 5394 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 5455 5686 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5984 6193 gene locus_tag LOCUS_05090 5984 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 6878 6552 gene locus_tag LOCUS_05100 6878 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 7714 6878 gene locus_tag LOCUS_05110 7714 6878 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541103.1 protein_id gnl|my_center|LOCUS_05110 7787 8635 gene locus_tag LOCUS_05120 7787 8635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 8716 12492 gene locus_tag LOCUS_05130 8716 12492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 13169 12528 gene locus_tag LOCUS_05140 13169 12528 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870497.1 protein_id gnl|my_center|LOCUS_05140 13739 13320 gene locus_tag LOCUS_05150 13739 13320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 16232 13809 gene locus_tag LOCUS_05160 16232 13809 CDS product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980151.1 protein_id gnl|my_center|LOCUS_05160 17428 16238 gene locus_tag LOCUS_05170 17428 16238 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061074.1 protein_id gnl|my_center|LOCUS_05170 18369 17608 gene locus_tag LOCUS_05180 18369 17608 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065422.1 protein_id gnl|my_center|LOCUS_05180 19232 18429 gene locus_tag LOCUS_05190 gene rsmA 19232 18429 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990848.1 protein_id gnl|my_center|LOCUS_05190 19777 19229 gene locus_tag LOCUS_05200 19777 19229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 20114 19794 gene locus_tag LOCUS_05210 20114 19794 CDS product RNA polymerase Rpb4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064405.1 protein_id gnl|my_center|LOCUS_05210 20417 20124 gene locus_tag LOCUS_05220 20417 20124 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869531.1 protein_id gnl|my_center|LOCUS_05220 21659 20421 gene locus_tag LOCUS_05230 21659 20421 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021461.1 protein_id gnl|my_center|LOCUS_05230 22313 21777 gene locus_tag LOCUS_05240 22313 21777 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867717.1 protein_id gnl|my_center|LOCUS_05240 23092 22310 gene locus_tag LOCUS_05250 23092 22310 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020938.1 protein_id gnl|my_center|LOCUS_05250 23423 23097 gene locus_tag LOCUS_05260 gene eif1A 23423 23097 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064286.1 protein_id gnl|my_center|LOCUS_05260 24782 23592 gene locus_tag LOCUS_05270 24782 23592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 24959 25576 gene locus_tag LOCUS_05280 24959 25576 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 protein_id gnl|my_center|LOCUS_05280 26074 25580 gene locus_tag LOCUS_05290 26074 25580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 26442 26071 gene locus_tag LOCUS_05300 26442 26071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 27110 26442 gene locus_tag LOCUS_05310 27110 26442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 27238 27432 gene locus_tag LOCUS_05320 27238 27432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 28014 27478 gene locus_tag LOCUS_05330 28014 27478 CDS product DUF2148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545519.1 protein_id gnl|my_center|LOCUS_05330 28207 28282 gene locus_tag LOCUS_t00120 28207 28282 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 28371 28655 gene locus_tag LOCUS_05340 28371 28655 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_05340 29229 28732 gene locus_tag LOCUS_05350 29229 28732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 29906 29334 gene locus_tag LOCUS_05360 29906 29334 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096079.1 protein_id gnl|my_center|LOCUS_05360 30223 30813 gene locus_tag LOCUS_05370 30223 30813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 31225 30839 gene locus_tag LOCUS_05380 31225 30839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 32027 31287 gene locus_tag LOCUS_05390 32027 31287 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020938.1 protein_id gnl|my_center|LOCUS_05390 32631 32200 gene locus_tag LOCUS_05400 32631 32200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 32660 32889 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33884 33552 gene locus_tag LOCUS_05410 33884 33552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 35584 34124 gene locus_tag LOCUS_05420 gene cls 35584 34124 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243311.1 protein_id gnl|my_center|LOCUS_05420 36203 35634 gene locus_tag LOCUS_05430 36203 35634 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879239.1 protein_id gnl|my_center|LOCUS_05430 36335 37630 gene locus_tag LOCUS_05440 gene hcp 36335 37630 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391685.1 protein_id gnl|my_center|LOCUS_05440 37776 38450 gene locus_tag LOCUS_05450 37776 38450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 38501 39106 gene locus_tag LOCUS_05460 38501 39106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 40746 39166 gene locus_tag LOCUS_05470 40746 39166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 40859 41077 gene locus_tag LOCUS_05480 40859 41077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 41074 42285 gene locus_tag LOCUS_05490 41074 42285 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969670.1 protein_id gnl|my_center|LOCUS_05490 42285 42653 gene locus_tag LOCUS_05500 42285 42653 CDS product sensory rhodopsin transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975018.1 protein_id gnl|my_center|LOCUS_05500 42758 43012 gene locus_tag LOCUS_05510 42758 43012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 43220 43038 gene locus_tag LOCUS_05520 43220 43038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 43384 44367 gene locus_tag LOCUS_05530 43384 44367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546406.1 protein_id gnl|my_center|LOCUS_05530 44373 45125 gene locus_tag LOCUS_05540 44373 45125 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061125.1 protein_id gnl|my_center|LOCUS_05540 45231 46118 gene locus_tag LOCUS_05550 45231 46118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 46102 47019 gene locus_tag LOCUS_05560 46102 47019 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258329.1 protein_id gnl|my_center|LOCUS_05560 47016 47933 gene locus_tag LOCUS_05570 47016 47933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 48075 48881 gene locus_tag LOCUS_05580 48075 48881 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250014.1 protein_id gnl|my_center|LOCUS_05580 50550 49225 gene locus_tag LOCUS_05590 gene acsC 50550 49225 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392715.1 protein_id gnl|my_center|LOCUS_05590 51499 50552 gene locus_tag LOCUS_05600 51499 50552 CDS product acetyl-CoA decarbonylase/synthase complex subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944232.1 protein_id gnl|my_center|LOCUS_05600 53655 51511 gene locus_tag LOCUS_05610 gene acsB 53655 51511 CDS product acetyl-CoA decarbonylase/synthase complex subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392716.1 protein_id gnl|my_center|LOCUS_05610 54713 53781 gene locus_tag LOCUS_05620 54713 53781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 54966 55532 gene locus_tag LOCUS_05630 54966 55532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 55529 56527 gene locus_tag LOCUS_05640 55529 56527 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582485.1 protein_id gnl|my_center|LOCUS_05640 56550 57347 gene locus_tag LOCUS_05650 56550 57347 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979837.1 protein_id gnl|my_center|LOCUS_05650 58021 57575 gene locus_tag LOCUS_05660 58021 57575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 58108 59442 gene locus_tag LOCUS_05670 58108 59442 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147002.1 protein_id gnl|my_center|LOCUS_05670 60018 59461 gene locus_tag LOCUS_05680 gene hpt 60018 59461 CDS product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020762.1 protein_id gnl|my_center|LOCUS_05680 61660 60044 gene locus_tag LOCUS_05690 gene ade 61660 60044 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876499.1 protein_id gnl|my_center|LOCUS_05690 62482 61898 gene locus_tag LOCUS_05700 62482 61898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 62646 62732 gene locus_tag LOCUS_t00130 62646 62732 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 63029 63943 gene locus_tag LOCUS_05710 63029 63943 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546059.1 protein_id gnl|my_center|LOCUS_05710 64660 64028 gene locus_tag LOCUS_05720 64660 64028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 65160 66224 gene locus_tag LOCUS_05730 65160 66224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 66350 66784 gene locus_tag LOCUS_05740 66350 66784 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971103.1 protein_id gnl|my_center|LOCUS_05740 67271 66834 gene locus_tag LOCUS_05750 67271 66834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 67428 68198 gene locus_tag LOCUS_05760 67428 68198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 68600 68295 gene locus_tag LOCUS_05770 68600 68295 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582621.1 protein_id gnl|my_center|LOCUS_05770 68958 69797 gene locus_tag LOCUS_05780 68958 69797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763462.1 protein_id gnl|my_center|LOCUS_05780 >Feature sequence07 195 902 gene locus_tag LOCUS_05790 195 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 1170 1844 gene locus_tag LOCUS_05800 1170 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 2964 2017 gene locus_tag LOCUS_05810 2964 2017 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 protein_id gnl|my_center|LOCUS_05810 3409 2942 gene locus_tag LOCUS_05820 3409 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 3996 3706 gene locus_tag LOCUS_05830 3996 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 4451 4017 gene locus_tag LOCUS_05840 4451 4017 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065467.1 protein_id gnl|my_center|LOCUS_05840 5989 4841 gene locus_tag LOCUS_05850 5989 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 6743 6270 gene locus_tag LOCUS_05860 6743 6270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 7455 6865 gene locus_tag LOCUS_05870 7455 6865 CDS product TIGR00454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052457366.1 protein_id gnl|my_center|LOCUS_05870 8267 7482 gene locus_tag LOCUS_05880 gene cobS 8267 7482 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496830.1 protein_id gnl|my_center|LOCUS_05880 9433 8270 gene locus_tag LOCUS_05890 9433 8270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 10427 9438 gene locus_tag LOCUS_05900 gene cbiB 10427 9438 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877021.1 protein_id gnl|my_center|LOCUS_05900 11550 10429 gene locus_tag LOCUS_05910 gene cobD 11550 10429 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392618.1 protein_id gnl|my_center|LOCUS_05910 12347 11547 gene locus_tag LOCUS_05920 12347 11547 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027507.1 protein_id gnl|my_center|LOCUS_05920 13383 12337 gene locus_tag LOCUS_05930 13383 12337 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948092.1 protein_id gnl|my_center|LOCUS_05930 14512 13400 gene locus_tag LOCUS_05940 14512 13400 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243040.1 protein_id gnl|my_center|LOCUS_05940 15727 14666 gene locus_tag LOCUS_05950 15727 14666 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_05950 16303 15833 gene locus_tag LOCUS_05960 16303 15833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 16409 16930 gene locus_tag LOCUS_05970 gene dcd 16409 16930 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868899.1 protein_id gnl|my_center|LOCUS_05970 17905 16877 gene locus_tag LOCUS_05980 17905 16877 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249452.1 protein_id gnl|my_center|LOCUS_05980 17907 18701 gene locus_tag LOCUS_05990 gene dph5 17907 18701 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877476.1 protein_id gnl|my_center|LOCUS_05990 19603 18698 gene locus_tag LOCUS_06000 gene ftsZ 19603 18698 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867128.1 protein_id gnl|my_center|LOCUS_06000 20392 20018 gene locus_tag LOCUS_06010 20392 20018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 21455 20721 gene locus_tag LOCUS_06020 21455 20721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 21521 21691 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21776 22036 gene locus_tag LOCUS_06030 21776 22036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 22167 23255 gene locus_tag LOCUS_06040 22167 23255 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289085.1 protein_id gnl|my_center|LOCUS_06040 23343 24470 gene locus_tag LOCUS_06050 23343 24470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 24473 26305 gene locus_tag LOCUS_06060 24473 26305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065991.1 protein_id gnl|my_center|LOCUS_06060 27190 26432 gene locus_tag LOCUS_06070 27190 26432 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202282.1 protein_id gnl|my_center|LOCUS_06070 28303 27314 gene locus_tag LOCUS_06080 28303 27314 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094902.1 protein_id gnl|my_center|LOCUS_06080 29609 28314 gene locus_tag LOCUS_06090 29609 28314 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545193.1 protein_id gnl|my_center|LOCUS_06090 30523 29588 gene locus_tag LOCUS_06100 30523 29588 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049979583.1 protein_id gnl|my_center|LOCUS_06100 31390 30614 gene locus_tag LOCUS_06110 31390 30614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 32845 31544 gene locus_tag LOCUS_06120 32845 31544 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147032.1 protein_id gnl|my_center|LOCUS_06120 34194 32905 gene locus_tag LOCUS_06130 34194 32905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 34603 35847 gene locus_tag LOCUS_06140 34603 35847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 35870 36991 gene locus_tag LOCUS_06150 35870 36991 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143828.1 protein_id gnl|my_center|LOCUS_06150 38014 37016 gene locus_tag LOCUS_06160 38014 37016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 39244 38120 gene locus_tag LOCUS_06170 39244 38120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 41819 39561 gene locus_tag LOCUS_06180 41819 39561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 42307 43848 gene locus_tag LOCUS_06190 42307 43848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 43990 45120 gene locus_tag LOCUS_06200 43990 45120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 45195 47522 gene locus_tag LOCUS_06210 45195 47522 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876179.1 protein_id gnl|my_center|LOCUS_06210 48443 47532 gene locus_tag LOCUS_06220 48443 47532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 49441 48440 gene locus_tag LOCUS_06230 49441 48440 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545048.1 protein_id gnl|my_center|LOCUS_06230 51537 49438 gene locus_tag LOCUS_06240 51537 49438 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_06240 52453 51575 gene locus_tag LOCUS_06250 52453 51575 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880570.1 protein_id gnl|my_center|LOCUS_06250 53510 52869 gene locus_tag LOCUS_06260 53510 52869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 53695 54282 gene locus_tag LOCUS_06270 53695 54282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 55260 54283 gene locus_tag LOCUS_06280 55260 54283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 56039 55320 gene locus_tag LOCUS_06290 56039 55320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 56235 57173 gene locus_tag LOCUS_06300 56235 57173 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065440.1 protein_id gnl|my_center|LOCUS_06300 57629 57183 gene locus_tag LOCUS_06310 57629 57183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 57750 58073 gene locus_tag LOCUS_06320 gene iscA 57750 58073 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301571.1 protein_id gnl|my_center|LOCUS_06320 58176 58346 gene locus_tag LOCUS_06330 58176 58346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 58409 59101 gene locus_tag LOCUS_06340 58409 59101 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582974.1 protein_id gnl|my_center|LOCUS_06340 59160 60758 gene locus_tag LOCUS_06350 59160 60758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 60818 62569 gene locus_tag LOCUS_06360 60818 62569 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762861.1 protein_id gnl|my_center|LOCUS_06360 62590 62886 gene locus_tag LOCUS_06370 62590 62886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 62889 64190 gene locus_tag LOCUS_06380 gene truD 62889 64190 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065655.1 protein_id gnl|my_center|LOCUS_06380 64953 64360 gene locus_tag LOCUS_06390 64953 64360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 >Feature sequence08 334 1629 gene locus_tag LOCUS_06400 gene gatD 334 1629 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867819.1 protein_id gnl|my_center|LOCUS_06400 1626 3482 gene locus_tag LOCUS_06410 gene gatE 1626 3482 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249862.1 protein_id gnl|my_center|LOCUS_06410 4166 3492 gene locus_tag LOCUS_06420 4166 3492 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061290.1 protein_id gnl|my_center|LOCUS_06420 4165 5070 gene locus_tag LOCUS_06430 4165 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 5067 5645 gene locus_tag LOCUS_06440 5067 5645 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496456.1 protein_id gnl|my_center|LOCUS_06440 5686 6285 gene locus_tag LOCUS_06450 5686 6285 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876461.1 protein_id gnl|my_center|LOCUS_06450 6288 6932 gene locus_tag LOCUS_06460 6288 6932 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876460.1 protein_id gnl|my_center|LOCUS_06460 7588 6929 gene locus_tag LOCUS_06470 7588 6929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 7636 8352 gene locus_tag LOCUS_06480 7636 8352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 8385 9062 gene locus_tag LOCUS_06490 gene thyX 8385 9062 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459086.1 protein_id gnl|my_center|LOCUS_06490 9151 9342 gene locus_tag LOCUS_06500 9151 9342 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251242.1 protein_id gnl|my_center|LOCUS_06500 9398 10333 gene locus_tag LOCUS_06510 9398 10333 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285058.1 protein_id gnl|my_center|LOCUS_06510 10330 11142 gene locus_tag LOCUS_06520 10330 11142 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582436.1 protein_id gnl|my_center|LOCUS_06520 11133 11993 gene locus_tag LOCUS_06530 11133 11993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582435.1 protein_id gnl|my_center|LOCUS_06530 12316 11990 gene locus_tag LOCUS_06540 12316 11990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 12446 12522 gene locus_tag LOCUS_t00140 12446 12522 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14444 12528 gene locus_tag LOCUS_06550 gene rqcH 14444 12528 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867817.1 protein_id gnl|my_center|LOCUS_06550 14534 14908 gene locus_tag LOCUS_06560 14534 14908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 15058 15132 gene locus_tag LOCUS_t00150 15058 15132 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 15196 16812 gene locus_tag LOCUS_06570 15196 16812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 18337 17099 gene locus_tag LOCUS_06580 18337 17099 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_06580 19044 19441 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20206 20604 gene locus_tag LOCUS_06590 20206 20604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 20589 20831 gene locus_tag LOCUS_06600 20589 20831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 21963 20866 gene locus_tag LOCUS_06610 21963 20866 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_06610 22487 21945 gene locus_tag LOCUS_06620 22487 21945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 22925 22770 gene locus_tag LOCUS_06630 22925 22770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 23009 23232 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24777 25409 gene locus_tag LOCUS_06640 24777 25409 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 protein_id gnl|my_center|LOCUS_06640 25530 26363 gene locus_tag LOCUS_06650 25530 26363 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065416.1 protein_id gnl|my_center|LOCUS_06650 27620 26952 gene locus_tag LOCUS_06660 27620 26952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 28284 28622 gene locus_tag LOCUS_06670 28284 28622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 28993 29604 gene locus_tag LOCUS_06680 28993 29604 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261778.1 protein_id gnl|my_center|LOCUS_06680 29705 30805 gene locus_tag LOCUS_06690 29705 30805 CDS product MtaA/CmuA family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020204.1 protein_id gnl|my_center|LOCUS_06690 31330 31257 gene locus_tag LOCUS_t00160 31330 31257 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 31466 32059 gene locus_tag LOCUS_06700 31466 32059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 33106 32060 gene locus_tag LOCUS_06710 gene hypE 33106 32060 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060768.1 protein_id gnl|my_center|LOCUS_06710 33542 33180 gene locus_tag LOCUS_06720 33542 33180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 33779 33854 gene locus_tag LOCUS_t00170 33779 33854 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 33903 34856 gene locus_tag LOCUS_06730 33903 34856 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210120.1 protein_id gnl|my_center|LOCUS_06730 34868 35383 gene locus_tag LOCUS_06740 34868 35383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 35592 35404 gene locus_tag LOCUS_06750 35592 35404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 36557 35661 gene locus_tag LOCUS_06760 36557 35661 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530904.1 protein_id gnl|my_center|LOCUS_06760 36702 37547 gene locus_tag LOCUS_06770 36702 37547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 37856 37674 gene locus_tag LOCUS_06780 37856 37674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 39010 37892 gene locus_tag LOCUS_06790 39010 37892 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_06790 39089 39814 gene locus_tag LOCUS_06800 39089 39814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 41150 39804 gene locus_tag LOCUS_06810 41150 39804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 42760 41150 gene locus_tag LOCUS_06820 42760 41150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 43122 42754 gene locus_tag LOCUS_06830 43122 42754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 44479 43160 gene locus_tag LOCUS_06840 44479 43160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 44652 45287 gene locus_tag LOCUS_06850 44652 45287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 45536 45904 gene locus_tag LOCUS_06860 45536 45904 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986701.1 protein_id gnl|my_center|LOCUS_06860 45926 46285 gene locus_tag LOCUS_06870 45926 46285 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065940.1 protein_id gnl|my_center|LOCUS_06870 46313 47143 gene locus_tag LOCUS_06880 46313 47143 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_06880 47152 48021 gene locus_tag LOCUS_06890 47152 48021 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_06890 48829 47999 gene locus_tag LOCUS_06900 48829 47999 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024128.1 protein_id gnl|my_center|LOCUS_06900 49189 49001 gene locus_tag LOCUS_06910 49189 49001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 49699 49241 gene locus_tag LOCUS_06920 49699 49241 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966645.1 protein_id gnl|my_center|LOCUS_06920 49784 50863 gene locus_tag LOCUS_06930 gene thrC 49784 50863 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167827705.1 protein_id gnl|my_center|LOCUS_06930 50924 52369 gene locus_tag LOCUS_06940 gene cls 50924 52369 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571549.1 protein_id gnl|my_center|LOCUS_06940 53224 52343 gene locus_tag LOCUS_06950 53224 52343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 53946 53266 gene locus_tag LOCUS_06960 53946 53266 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770491.1 protein_id gnl|my_center|LOCUS_06960 54762 53968 gene locus_tag LOCUS_06970 54762 53968 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403240.1 protein_id gnl|my_center|LOCUS_06970 56221 54788 gene locus_tag LOCUS_06980 56221 54788 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876185.1 protein_id gnl|my_center|LOCUS_06980 57009 56299 gene locus_tag LOCUS_06990 57009 56299 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811176.1 protein_id gnl|my_center|LOCUS_06990 57138 57347 gene locus_tag LOCUS_07000 57138 57347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 57676 57350 gene locus_tag LOCUS_07010 57676 57350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 58367 57756 gene locus_tag LOCUS_07020 58367 57756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 58724 59362 gene locus_tag LOCUS_07030 58724 59362 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172636477.1 protein_id gnl|my_center|LOCUS_07030 59390 61087 gene locus_tag LOCUS_07040 59390 61087 CDS product beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271984.1 protein_id gnl|my_center|LOCUS_07040 61071 61688 gene locus_tag LOCUS_07050 61071 61688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 61739 62233 gene locus_tag LOCUS_07060 61739 62233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 >Feature sequence09 2437 686 gene locus_tag LOCUS_07070 gene infB 2437 686 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065143.1 protein_id gnl|my_center|LOCUS_07070 3041 2589 gene locus_tag LOCUS_07080 gene ndk 3041 2589 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056122.1 protein_id gnl|my_center|LOCUS_07080 3375 3046 gene locus_tag LOCUS_07090 3375 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 3596 3381 gene locus_tag LOCUS_07100 3596 3381 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878268.1 protein_id gnl|my_center|LOCUS_07100 3980 3609 gene locus_tag LOCUS_07110 gene rpl7ae 3980 3609 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053845.1 protein_id gnl|my_center|LOCUS_07110 4942 4154 gene locus_tag LOCUS_07120 4942 4154 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320550.1 protein_id gnl|my_center|LOCUS_07120 5964 4984 gene locus_tag LOCUS_07130 gene porB 5964 4984 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496444.1 protein_id gnl|my_center|LOCUS_07130 7136 5961 gene locus_tag LOCUS_07140 gene porA 7136 5961 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877345.1 protein_id gnl|my_center|LOCUS_07140 8038 7127 gene locus_tag LOCUS_07150 8038 7127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 8600 8085 gene locus_tag LOCUS_07160 8600 8085 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876457.1 protein_id gnl|my_center|LOCUS_07160 9644 8643 gene locus_tag LOCUS_07170 9644 8643 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926019.1 protein_id gnl|my_center|LOCUS_07170 10418 9654 gene locus_tag LOCUS_07180 10418 9654 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724134.1 protein_id gnl|my_center|LOCUS_07180 11092 10415 gene locus_tag LOCUS_07190 11092 10415 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887671.1 protein_id gnl|my_center|LOCUS_07190 11963 11148 gene locus_tag LOCUS_07200 11963 11148 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081258.1 protein_id gnl|my_center|LOCUS_07200 13054 12173 gene locus_tag LOCUS_07210 13054 12173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 13257 14066 gene locus_tag LOCUS_07220 13257 14066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 14278 14036 gene locus_tag LOCUS_07230 14278 14036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 14330 14548 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16610 15201 gene locus_tag LOCUS_07240 16610 15201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 17494 16613 gene locus_tag LOCUS_07250 17494 16613 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143639.1 protein_id gnl|my_center|LOCUS_07250 17617 18009 gene locus_tag LOCUS_07260 17617 18009 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_07260 18884 18006 gene locus_tag LOCUS_07270 18884 18006 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814724.1 protein_id gnl|my_center|LOCUS_07270 19067 20089 gene locus_tag LOCUS_07280 19067 20089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 21209 20133 gene locus_tag LOCUS_07290 21209 20133 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867600.1 protein_id gnl|my_center|LOCUS_07290 22247 21318 gene locus_tag LOCUS_07300 22247 21318 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878600.1 protein_id gnl|my_center|LOCUS_07300 22274 24472 gene locus_tag LOCUS_07310 22274 24472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 25357 24473 gene locus_tag LOCUS_07320 25357 24473 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879792.1 protein_id gnl|my_center|LOCUS_07320 26064 25345 gene locus_tag LOCUS_07330 26064 25345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 26180 26425 gene locus_tag LOCUS_07340 26180 26425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 26860 26453 gene locus_tag LOCUS_07350 gene msrB 26860 26453 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002070109.1 protein_id gnl|my_center|LOCUS_07350 28416 26905 gene locus_tag LOCUS_07360 28416 26905 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879889.1 protein_id gnl|my_center|LOCUS_07360 28733 28452 gene locus_tag LOCUS_07370 28733 28452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 29185 28730 gene locus_tag LOCUS_07380 29185 28730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 29429 30535 gene locus_tag LOCUS_07390 29429 30535 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064263.1 protein_id gnl|my_center|LOCUS_07390 30678 31493 gene locus_tag LOCUS_07400 30678 31493 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145679980.1 protein_id gnl|my_center|LOCUS_07400 31490 32248 gene locus_tag LOCUS_07410 31490 32248 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_07410 32766 32245 gene locus_tag LOCUS_07420 32766 32245 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020126.1 protein_id gnl|my_center|LOCUS_07420 33653 32766 gene locus_tag LOCUS_07430 gene trxB 33653 32766 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846363.1 protein_id gnl|my_center|LOCUS_07430 34171 33782 gene locus_tag LOCUS_07440 gene trxA 34171 33782 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878779.1 protein_id gnl|my_center|LOCUS_07440 34384 34644 gene locus_tag LOCUS_07450 34384 34644 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902697.1 protein_id gnl|my_center|LOCUS_07450 34664 35170 gene locus_tag LOCUS_07460 34664 35170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867695.1 protein_id gnl|my_center|LOCUS_07460 35664 35185 gene locus_tag LOCUS_07470 35664 35185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07470 36259 35729 gene locus_tag LOCUS_07480 36259 35729 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053622.1 protein_id gnl|my_center|LOCUS_07480 36766 36269 gene locus_tag LOCUS_07490 36766 36269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 36885 37097 gene locus_tag LOCUS_07500 36885 37097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 37752 37174 gene locus_tag LOCUS_07510 37752 37174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 39203 37749 gene locus_tag LOCUS_07520 39203 37749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 39918 39190 gene locus_tag LOCUS_07530 39918 39190 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022197.1 protein_id gnl|my_center|LOCUS_07530 40053 40541 gene locus_tag LOCUS_07540 40053 40541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 40591 40986 gene locus_tag LOCUS_07550 40591 40986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274390.1 protein_id gnl|my_center|LOCUS_07550 41132 41551 gene locus_tag LOCUS_07560 41132 41551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 41578 42063 gene locus_tag LOCUS_07570 41578 42063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 42083 42898 gene locus_tag LOCUS_07580 42083 42898 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405447.1 protein_id gnl|my_center|LOCUS_07580 43134 42925 gene locus_tag LOCUS_07590 43134 42925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 43266 43574 gene locus_tag LOCUS_07600 43266 43574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289276.1 protein_id gnl|my_center|LOCUS_07600 43675 43771 gene locus_tag LOCUS_t00180 43675 43771 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 44648 43824 gene locus_tag LOCUS_07610 gene pgoN 44648 43824 CDS product glyoxal/methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243374.1 protein_id gnl|my_center|LOCUS_07610 45341 44658 gene locus_tag LOCUS_07620 45341 44658 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462052.1 protein_id gnl|my_center|LOCUS_07620 45849 45370 gene locus_tag LOCUS_07630 gene msrA 45849 45370 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021447.1 protein_id gnl|my_center|LOCUS_07630 47291 46317 gene locus_tag LOCUS_07640 47291 46317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 47304 47550 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 48603 48235 gene locus_tag LOCUS_07650 48603 48235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 49016 48612 gene locus_tag LOCUS_07660 49016 48612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 49038 49282 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 50410 49508 gene locus_tag LOCUS_07670 50410 49508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 50553 51902 gene locus_tag LOCUS_07680 gene trkA 50553 51902 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021496.1 protein_id gnl|my_center|LOCUS_07680 51907 53526 gene locus_tag LOCUS_07690 51907 53526 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 protein_id gnl|my_center|LOCUS_07690 55259 53517 gene locus_tag LOCUS_07700 55259 53517 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870139.1 protein_id gnl|my_center|LOCUS_07700 55717 55505 gene locus_tag LOCUS_07710 55717 55505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 55734 55966 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 56911 57155 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 57281 58210 gene locus_tag LOCUS_07720 57281 58210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 58560 58803 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 59324 60013 gene locus_tag LOCUS_07730 59324 60013 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496950.1 protein_id gnl|my_center|LOCUS_07730 >Feature sequence10 1228 2622 gene locus_tag LOCUS_07740 1228 2622 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805147.1 protein_id gnl|my_center|LOCUS_07740 3446 3033 gene locus_tag LOCUS_07750 3446 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 3471 4757 gene locus_tag LOCUS_07760 3471 4757 CDS product methanogenesis marker 16 metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023232.1 protein_id gnl|my_center|LOCUS_07760 5283 4726 gene locus_tag LOCUS_07770 gene comE 5283 4726 CDS product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876831.1 protein_id gnl|my_center|LOCUS_07770 5777 5280 gene locus_tag LOCUS_07780 gene comD 5777 5280 CDS product sulfopyruvate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876830.1 protein_id gnl|my_center|LOCUS_07780 6421 5774 gene locus_tag LOCUS_07790 6421 5774 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877278.1 protein_id gnl|my_center|LOCUS_07790 7116 6418 gene locus_tag LOCUS_07800 7116 6418 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402640.1 protein_id gnl|my_center|LOCUS_07800 7877 7113 gene locus_tag LOCUS_07810 7877 7113 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877280.1 protein_id gnl|my_center|LOCUS_07810 9133 7874 gene locus_tag LOCUS_07820 9133 7874 CDS product cysteate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066469.1 protein_id gnl|my_center|LOCUS_07820 10457 9528 gene locus_tag LOCUS_07830 10457 9528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 10487 10730 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11820 10867 gene locus_tag LOCUS_07840 11820 10867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584075.1 protein_id gnl|my_center|LOCUS_07840 11920 12246 gene locus_tag LOCUS_07850 11920 12246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 12775 12467 gene locus_tag LOCUS_07860 gene rpl12p 12775 12467 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868901.1 protein_id gnl|my_center|LOCUS_07860 13801 12800 gene locus_tag LOCUS_07870 13801 12800 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250367.1 protein_id gnl|my_center|LOCUS_07870 14452 13814 gene locus_tag LOCUS_07880 14452 13814 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878987.1 protein_id gnl|my_center|LOCUS_07880 15034 14558 gene locus_tag LOCUS_07890 15034 14558 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869872.1 protein_id gnl|my_center|LOCUS_07890 15896 15069 gene locus_tag LOCUS_07900 15896 15069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 16193 15969 gene locus_tag LOCUS_07910 16193 15969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 17341 16238 gene locus_tag LOCUS_07920 gene ftsZ 17341 16238 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024152.1 protein_id gnl|my_center|LOCUS_07920 18660 17530 gene locus_tag LOCUS_07930 gene ftsZ 18660 17530 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024152.1 protein_id gnl|my_center|LOCUS_07930 18757 19044 gene locus_tag LOCUS_07940 18757 19044 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545551.1 protein_id gnl|my_center|LOCUS_07940 19836 19045 gene locus_tag LOCUS_07950 19836 19045 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876199.1 protein_id gnl|my_center|LOCUS_07950 20450 19887 gene locus_tag LOCUS_07960 20450 19887 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903666.1 protein_id gnl|my_center|LOCUS_07960 20761 21072 gene locus_tag LOCUS_07970 20761 21072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 21089 22132 gene locus_tag LOCUS_07980 gene ftsZ 21089 22132 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289116.1 protein_id gnl|my_center|LOCUS_07980 22849 22133 gene locus_tag LOCUS_07990 22849 22133 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064947.1 protein_id gnl|my_center|LOCUS_07990 22907 23680 gene locus_tag LOCUS_08000 gene truA 22907 23680 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249878.1 protein_id gnl|my_center|LOCUS_08000 23955 24482 gene locus_tag LOCUS_08010 23955 24482 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879493.1 protein_id gnl|my_center|LOCUS_08010 24500 25108 gene locus_tag LOCUS_08020 24500 25108 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020322.1 protein_id gnl|my_center|LOCUS_08020 26132 25059 gene locus_tag LOCUS_08030 gene priL 26132 25059 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020168.1 protein_id gnl|my_center|LOCUS_08030 27797 26175 gene locus_tag LOCUS_08040 27797 26175 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249848.1 protein_id gnl|my_center|LOCUS_08040 28118 29434 gene locus_tag LOCUS_08050 28118 29434 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064444.1 protein_id gnl|my_center|LOCUS_08050 29467 29910 gene locus_tag LOCUS_08060 29467 29910 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932389.1 protein_id gnl|my_center|LOCUS_08060 29956 30675 gene locus_tag LOCUS_08070 gene budA 29956 30675 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723157.1 protein_id gnl|my_center|LOCUS_08070 30975 30709 gene locus_tag LOCUS_08080 30975 30709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 31156 30986 gene locus_tag LOCUS_08090 31156 30986 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021486.1 protein_id gnl|my_center|LOCUS_08090 32174 31197 gene locus_tag LOCUS_08100 gene corA 32174 31197 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942048.1 protein_id gnl|my_center|LOCUS_08100 32288 33016 gene locus_tag LOCUS_08110 32288 33016 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969534.1 protein_id gnl|my_center|LOCUS_08110 33427 33696 gene locus_tag LOCUS_08120 33427 33696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 33704 37300 gene locus_tag LOCUS_08130 33704 37300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 37297 40077 gene locus_tag LOCUS_08140 37297 40077 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879381.1 protein_id gnl|my_center|LOCUS_08140 40077 41519 gene locus_tag LOCUS_08150 gene rpoA2 40077 41519 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879382.1 protein_id gnl|my_center|LOCUS_08150 41516 41794 gene locus_tag LOCUS_08160 41516 41794 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879383.1 protein_id gnl|my_center|LOCUS_08160 41799 42227 gene locus_tag LOCUS_08170 41799 42227 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978223.1 protein_id gnl|my_center|LOCUS_08170 43269 42214 gene locus_tag LOCUS_08180 43269 42214 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023617.1 protein_id gnl|my_center|LOCUS_08180 43416 43943 gene locus_tag LOCUS_08190 43416 43943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 43998 44648 gene locus_tag LOCUS_08200 gene pyrF 43998 44648 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065013.1 protein_id gnl|my_center|LOCUS_08200 44781 51224 gene locus_tag LOCUS_08210 44781 51224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 51221 51964 gene locus_tag LOCUS_08220 51221 51964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 52139 52468 gene locus_tag LOCUS_08230 52139 52468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 53082 52465 gene locus_tag LOCUS_08240 53082 52465 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020150.1 protein_id gnl|my_center|LOCUS_08240 54432 53110 gene locus_tag LOCUS_08250 gene purD 54432 53110 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868755.1 protein_id gnl|my_center|LOCUS_08250 55207 54467 gene locus_tag LOCUS_08260 gene hypB 55207 54467 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876419.1 protein_id gnl|my_center|LOCUS_08260 >Feature sequence11 869 144 gene locus_tag LOCUS_08270 869 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 1434 964 gene locus_tag LOCUS_08280 1434 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 2249 1431 gene locus_tag LOCUS_08290 2249 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 2474 2755 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2878 3372 gene locus_tag LOCUS_08300 2878 3372 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876288.1 protein_id gnl|my_center|LOCUS_08300 3427 3846 gene locus_tag LOCUS_08310 3427 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 3898 5208 gene locus_tag LOCUS_08320 3898 5208 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249495.1 protein_id gnl|my_center|LOCUS_08320 8066 5205 gene locus_tag LOCUS_08330 8066 5205 CDS product intein-containing RctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870187.1 protein_id gnl|my_center|LOCUS_08330 8200 9306 gene locus_tag LOCUS_08340 8200 9306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 9378 10529 gene locus_tag LOCUS_08350 9378 10529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 10624 10549 gene locus_tag LOCUS_t00190 10624 10549 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 10866 11774 gene locus_tag LOCUS_08360 gene argF 10866 11774 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584136.1 protein_id gnl|my_center|LOCUS_08360 13326 11764 gene locus_tag LOCUS_08370 13326 11764 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903741.1 protein_id gnl|my_center|LOCUS_08370 14111 13323 gene locus_tag LOCUS_08380 14111 13323 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545335.1 protein_id gnl|my_center|LOCUS_08380 14225 14950 gene locus_tag LOCUS_08390 14225 14950 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878652.1 protein_id gnl|my_center|LOCUS_08390 15204 15842 gene locus_tag LOCUS_08400 15204 15842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 15967 16878 gene locus_tag LOCUS_08410 gene ligD 15967 16878 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863172.1 protein_id gnl|my_center|LOCUS_08410 17125 18123 gene locus_tag LOCUS_08420 17125 18123 CDS product MtaA/CmuA family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020204.1 protein_id gnl|my_center|LOCUS_08420 19213 18179 gene locus_tag LOCUS_08430 gene mtaA 19213 18179 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020823.1 protein_id gnl|my_center|LOCUS_08430 19343 20983 gene locus_tag LOCUS_08440 19343 20983 CDS product methylamine methyltransferase corrinoid protein reductive activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065863.1 protein_id gnl|my_center|LOCUS_08440 21466 21732 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22653 21823 gene locus_tag LOCUS_08450 22653 21823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 22736 23938 gene locus_tag LOCUS_08460 22736 23938 CDS product YcaO-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876618.1 protein_id gnl|my_center|LOCUS_08460 24070 24576 gene locus_tag LOCUS_08470 24070 24576 CDS product TfuA-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020222.1 protein_id gnl|my_center|LOCUS_08470 24826 26145 gene locus_tag LOCUS_08480 gene mcrB 24826 26145 CDS product coenzyme-B sulfoethylthiotransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061283.1 protein_id gnl|my_center|LOCUS_08480 26162 26584 gene locus_tag LOCUS_08490 gene mcrD 26162 26584 CDS product methyl-coenzyme M reductase operon protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869611.1 protein_id gnl|my_center|LOCUS_08490 26586 27359 gene locus_tag LOCUS_08500 gene mcrG 26586 27359 CDS product coenzyme-B sulfoethylthiotransferase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870359.1 protein_id gnl|my_center|LOCUS_08500 27364 29211 gene locus_tag LOCUS_08510 gene mcrA 27364 29211 CDS product coenzyme-B sulfoethylthiotransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870360.1 protein_id gnl|my_center|LOCUS_08510 29217 29495 gene locus_tag LOCUS_08520 29217 29495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 30175 29666 gene locus_tag LOCUS_08530 30175 29666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 30327 30635 gene locus_tag LOCUS_08540 30327 30635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 30976 30632 gene locus_tag LOCUS_08550 30976 30632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809368.1 protein_id gnl|my_center|LOCUS_08550 32009 31050 gene locus_tag LOCUS_08560 32009 31050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 33488 32238 gene locus_tag LOCUS_08570 33488 32238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 34928 33552 gene locus_tag LOCUS_08580 gene mtmB 34928 33552 CDS product monomethylamine methyltransferase MtmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:P58969 transl_except (pos:complement(34323..34325),aa:Pyl) note codon on position 202 is pyrrolysine amber codon. protein_id gnl|my_center|LOCUS_08580 35574 34933 gene locus_tag LOCUS_08590 35574 34933 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020578.1 protein_id gnl|my_center|LOCUS_08590 35987 36058 gene locus_tag LOCUS_t00200 35987 36058 tRNA product tRNA-Pyl inference COORDINATES:profile:Aragorn:1.2.38 36091 36918 gene locus_tag LOCUS_08600 gene pylSc 36091 36918 CDS product pyrrolysine--tRNA(Pyl) ligase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462270.1 protein_id gnl|my_center|LOCUS_08600 36932 37999 gene locus_tag LOCUS_08610 gene pylB 36932 37999 CDS product methylornithine synthase PylB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945507.1 protein_id gnl|my_center|LOCUS_08610 38002 39168 gene locus_tag LOCUS_08620 gene pylC 38002 39168 CDS product 3-methylornithine--L-lysine ligase PylC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462268.1 protein_id gnl|my_center|LOCUS_08620 39165 40025 gene locus_tag LOCUS_08630 gene pylD 39165 40025 CDS product 3-methylornithyl-N6-L-lysine dehydrogenase PylD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462267.1 protein_id gnl|my_center|LOCUS_08630 40022 41641 gene locus_tag LOCUS_08640 40022 41641 CDS product methylamine methyltransferase corrinoid protein reductive activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020893.1 protein_id gnl|my_center|LOCUS_08640 41857 42498 gene locus_tag LOCUS_08650 41857 42498 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020578.1 protein_id gnl|my_center|LOCUS_08650 42515 43894 gene locus_tag LOCUS_08660 gene mtmB 42515 43894 CDS product monomethylamine methyltransferase MtmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:P58866 transl_except (pos:43121..43123,aa:Pyl) note codon on position 203 is pyrrolysine amber codon. protein_id gnl|my_center|LOCUS_08660 44069 45694 gene locus_tag LOCUS_08670 gene atwA 44069 45694 CDS product methyl coenzyme M reductase system, component A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060951.1 protein_id gnl|my_center|LOCUS_08670 45691 46293 gene locus_tag LOCUS_08680 gene mcrC 45691 46293 CDS product methyl-coenzyme M reductase I operon protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876790.1 protein_id gnl|my_center|LOCUS_08680 46842 46294 gene locus_tag LOCUS_08690 46842 46294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 46968 48674 gene locus_tag LOCUS_08700 46968 48674 CDS product methanogenesis marker 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061161.1 protein_id gnl|my_center|LOCUS_08700 48671 49072 gene locus_tag LOCUS_08710 48671 49072 CDS product methanogenesis marker 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061162.1 protein_id gnl|my_center|LOCUS_08710 49069 49503 gene locus_tag LOCUS_08720 49069 49503 CDS product methanogenesis marker 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869903.1 protein_id gnl|my_center|LOCUS_08720 49500 50732 gene locus_tag LOCUS_08730 49500 50732 CDS product methanogenesis marker 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877471.1 protein_id gnl|my_center|LOCUS_08730 50732 51292 gene locus_tag LOCUS_08740 50732 51292 CDS product methanogenesis marker 17 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023888.1 protein_id gnl|my_center|LOCUS_08740 51292 52203 gene locus_tag LOCUS_08750 51292 52203 CDS product methanogenesis marker 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496388.1 protein_id gnl|my_center|LOCUS_08750 52204 52656 gene locus_tag LOCUS_08760 52204 52656 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583024.1 protein_id gnl|my_center|LOCUS_08760 53143 54750 gene locus_tag LOCUS_08770 53143 54750 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545342.1 protein_id gnl|my_center|LOCUS_08770 54853 55380 gene locus_tag LOCUS_08780 54853 55380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 55581 55435 gene locus_tag LOCUS_08790 55581 55435 CDS product YHS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583928.1 protein_id gnl|my_center|LOCUS_08790 58040 55581 gene locus_tag LOCUS_08800 58040 55581 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 protein_id gnl|my_center|LOCUS_08800 58256 58849 gene locus_tag LOCUS_08810 58256 58849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 59580 58816 gene locus_tag LOCUS_08820 59580 58816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 >Feature sequence12 449 1840 gene locus_tag LOCUS_08830 449 1840 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021657.1 protein_id gnl|my_center|LOCUS_08830 2748 1834 gene locus_tag LOCUS_08840 2748 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 3325 2810 gene locus_tag LOCUS_08850 3325 2810 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867433.1 protein_id gnl|my_center|LOCUS_08850 3413 4672 gene locus_tag LOCUS_08860 gene metK 3413 4672 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947992.1 protein_id gnl|my_center|LOCUS_08860 5857 4679 gene locus_tag LOCUS_08870 5857 4679 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065790.1 protein_id gnl|my_center|LOCUS_08870 7708 5942 gene locus_tag LOCUS_08880 7708 5942 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023139.1 protein_id gnl|my_center|LOCUS_08880 7823 10033 gene locus_tag LOCUS_08890 gene metG 7823 10033 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876226.1 protein_id gnl|my_center|LOCUS_08890 10030 10680 gene locus_tag LOCUS_08900 10030 10680 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289241.1 protein_id gnl|my_center|LOCUS_08900 11040 10681 gene locus_tag LOCUS_08910 11040 10681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 11239 12420 gene locus_tag LOCUS_08920 11239 12420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 12508 13710 gene locus_tag LOCUS_08930 gene ftsZ 12508 13710 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064630.1 protein_id gnl|my_center|LOCUS_08930 15571 13766 gene locus_tag LOCUS_08940 15571 13766 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250266.1 protein_id gnl|my_center|LOCUS_08940 17011 15800 gene locus_tag LOCUS_08950 17011 15800 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922308.1 protein_id gnl|my_center|LOCUS_08950 17234 18352 gene locus_tag LOCUS_08960 17234 18352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 18321 18587 gene locus_tag LOCUS_08970 18321 18587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 19831 18596 gene locus_tag LOCUS_08980 19831 18596 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728183.1 protein_id gnl|my_center|LOCUS_08980 19984 21174 gene locus_tag LOCUS_08990 19984 21174 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867946.1 protein_id gnl|my_center|LOCUS_08990 22080 21178 gene locus_tag LOCUS_09000 22080 21178 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030042.1 protein_id gnl|my_center|LOCUS_09000 22660 22250 gene locus_tag LOCUS_09010 gene ribH 22660 22250 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877002.1 protein_id gnl|my_center|LOCUS_09010 23134 22667 gene locus_tag LOCUS_09020 gene ribC 23134 22667 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870697.1 protein_id gnl|my_center|LOCUS_09020 23583 23131 gene locus_tag LOCUS_09030 23583 23131 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876477.1 protein_id gnl|my_center|LOCUS_09030 24278 23571 gene locus_tag LOCUS_09040 gene ribB 24278 23571 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869547.1 protein_id gnl|my_center|LOCUS_09040 24421 25455 gene locus_tag LOCUS_09050 24421 25455 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_09050 25570 26847 gene locus_tag LOCUS_09060 25570 26847 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249483.1 protein_id gnl|my_center|LOCUS_09060 27858 26926 gene locus_tag LOCUS_09070 27858 26926 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879092.1 protein_id gnl|my_center|LOCUS_09070 28549 27896 gene locus_tag LOCUS_09080 28549 27896 CDS product NAAT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871201.1 protein_id gnl|my_center|LOCUS_09080 29131 28649 gene locus_tag LOCUS_09090 29131 28649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 29613 29224 gene locus_tag LOCUS_09100 29613 29224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 30092 29661 gene locus_tag LOCUS_09110 30092 29661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 30730 30332 gene locus_tag LOCUS_09120 30730 30332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 30983 31954 gene locus_tag LOCUS_09130 30983 31954 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_09130 32279 33274 gene locus_tag LOCUS_09140 32279 33274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 33321 34616 gene locus_tag LOCUS_09150 gene eno 33321 34616 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147178.1 protein_id gnl|my_center|LOCUS_09150 35545 36801 gene locus_tag LOCUS_09160 35545 36801 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250627.1 protein_id gnl|my_center|LOCUS_09160 36801 37259 gene locus_tag LOCUS_09170 36801 37259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 37620 37820 gene locus_tag LOCUS_09180 37620 37820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 37945 38544 gene locus_tag LOCUS_09190 37945 38544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 38541 39026 gene locus_tag LOCUS_09200 38541 39026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 41704 39017 gene locus_tag LOCUS_09210 41704 39017 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010916276.1 protein_id gnl|my_center|LOCUS_09210 39093 39296 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42223 41777 gene locus_tag LOCUS_09220 gene nikR 42223 41777 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943609.1 protein_id gnl|my_center|LOCUS_09220 42301 43074 gene locus_tag LOCUS_09230 42301 43074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 43115 44401 gene locus_tag LOCUS_09240 43115 44401 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_09240 44385 45050 gene locus_tag LOCUS_09250 44385 45050 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485759.1 protein_id gnl|my_center|LOCUS_09250 45271 45047 gene locus_tag LOCUS_09260 45271 45047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 45523 45912 gene locus_tag LOCUS_09270 gene hypA 45523 45912 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869710.1 protein_id gnl|my_center|LOCUS_09270 46237 46450 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 47167 47853 gene locus_tag LOCUS_09280 47167 47853 CDS product heparan-alpha-glucosaminide N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065998.1 protein_id gnl|my_center|LOCUS_09280 47896 48540 gene locus_tag LOCUS_09290 47896 48540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 48623 50044 gene locus_tag LOCUS_09300 48623 50044 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272339.1 protein_id gnl|my_center|LOCUS_09300 50362 50048 gene locus_tag LOCUS_09310 50362 50048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 51123 50464 gene locus_tag LOCUS_09320 51123 50464 CDS product undecaprenyl diphosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964741.1 protein_id gnl|my_center|LOCUS_09320 51214 51423 gene locus_tag LOCUS_09330 51214 51423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 52716 51454 gene locus_tag LOCUS_09340 52716 51454 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081357.1 protein_id gnl|my_center|LOCUS_09340 53375 52713 gene locus_tag LOCUS_09350 53375 52713 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146593.1 protein_id gnl|my_center|LOCUS_09350 53531 53830 gene locus_tag LOCUS_09360 53531 53830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 54105 53827 gene locus_tag LOCUS_09370 54105 53827 CDS product 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877331.1 protein_id gnl|my_center|LOCUS_09370 54176 54823 gene locus_tag LOCUS_09380 54176 54823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 56070 54820 gene locus_tag LOCUS_09390 56070 54820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 57046 56201 gene locus_tag LOCUS_09400 57046 56201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 <58740 57043 gene locus_tag LOCUS_09410 <58740 57043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023184.1:cobyric acid synthase >Feature sequence13 816 1072 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1321 1578 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2894 3853 gene locus_tag LOCUS_09420 2894 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 4604 3858 gene locus_tag LOCUS_09430 gene phoU 4604 3858 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545517.1 protein_id gnl|my_center|LOCUS_09430 5356 4604 gene locus_tag LOCUS_09440 gene pstB 5356 4604 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020934.1 protein_id gnl|my_center|LOCUS_09440 6220 5360 gene locus_tag LOCUS_09450 gene pstA 6220 5360 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990843.1 protein_id gnl|my_center|LOCUS_09450 7146 6217 gene locus_tag LOCUS_09460 gene pstC 7146 6217 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_09460 8112 7213 gene locus_tag LOCUS_09470 8112 7213 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_09470 8345 9361 gene locus_tag LOCUS_09480 8345 9361 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020910.1 protein_id gnl|my_center|LOCUS_09480 9895 9374 gene locus_tag LOCUS_09490 9895 9374 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583979.1 protein_id gnl|my_center|LOCUS_09490 11145 9892 gene locus_tag LOCUS_09500 11145 9892 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583978.1 protein_id gnl|my_center|LOCUS_09500 12357 11152 gene locus_tag LOCUS_09510 gene nifV 12357 11152 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583977.1 protein_id gnl|my_center|LOCUS_09510 13633 12641 gene locus_tag LOCUS_09520 13633 12641 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020699.1 protein_id gnl|my_center|LOCUS_09520 13992 15071 gene locus_tag LOCUS_09530 gene carA 13992 15071 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878768.1 protein_id gnl|my_center|LOCUS_09530 15068 18292 gene locus_tag LOCUS_09540 gene carB 15068 18292 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022129.1 protein_id gnl|my_center|LOCUS_09540 19094 18243 gene locus_tag LOCUS_09550 19094 18243 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944001.1 protein_id gnl|my_center|LOCUS_09550 19641 19141 gene locus_tag LOCUS_09560 19641 19141 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021413.1 protein_id gnl|my_center|LOCUS_09560 19801 20592 gene locus_tag LOCUS_09570 19801 20592 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876218.1 protein_id gnl|my_center|LOCUS_09570 20592 21617 gene locus_tag LOCUS_09580 20592 21617 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060849.1 protein_id gnl|my_center|LOCUS_09580 21617 23074 gene locus_tag LOCUS_09590 gene aroE 21617 23074 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327789.1 protein_id gnl|my_center|LOCUS_09590 23071 23922 gene locus_tag LOCUS_09600 23071 23922 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021396.1 protein_id gnl|my_center|LOCUS_09600 23919 25187 gene locus_tag LOCUS_09610 gene aroA 23919 25187 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496517.1 protein_id gnl|my_center|LOCUS_09610 25184 26272 gene locus_tag LOCUS_09620 gene aroC 25184 26272 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061243.1 protein_id gnl|my_center|LOCUS_09620 26253 27326 gene locus_tag LOCUS_09630 gene tyrA 26253 27326 CDS product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257629.1 protein_id gnl|my_center|LOCUS_09630 27323 28384 gene locus_tag LOCUS_09640 gene asd 27323 28384 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256126.1 protein_id gnl|my_center|LOCUS_09640 28393 29559 gene locus_tag LOCUS_09650 28393 29559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 29559 29963 gene locus_tag LOCUS_09660 29559 29963 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876487.1 protein_id gnl|my_center|LOCUS_09660 29960 30697 gene locus_tag LOCUS_09670 29960 30697 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021719.1 protein_id gnl|my_center|LOCUS_09670 30746 31053 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31078 32121 gene locus_tag LOCUS_09680 31078 32121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 32338 33537 gene locus_tag LOCUS_09690 32338 33537 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176674.1 protein_id gnl|my_center|LOCUS_09690 34974 33559 gene locus_tag LOCUS_09700 34974 33559 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_09700 35150 36016 gene locus_tag LOCUS_09710 gene hisG 35150 36016 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020275.1 protein_id gnl|my_center|LOCUS_09710 36025 37071 gene locus_tag LOCUS_09720 gene hisC 36025 37071 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889400.1 protein_id gnl|my_center|LOCUS_09720 37065 37730 gene locus_tag LOCUS_09730 gene hisH 37065 37730 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249201.1 protein_id gnl|my_center|LOCUS_09730 37727 38434 gene locus_tag LOCUS_09740 gene hisA 37727 38434 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871056.1 protein_id gnl|my_center|LOCUS_09740 38431 38979 gene locus_tag LOCUS_09750 gene hisB 38431 38979 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774805.1 protein_id gnl|my_center|LOCUS_09750 38982 39734 gene locus_tag LOCUS_09760 gene hisF 38982 39734 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989517.1 protein_id gnl|my_center|LOCUS_09760 39731 40342 gene locus_tag LOCUS_09770 gene hisIE 39731 40342 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131119.1 protein_id gnl|my_center|LOCUS_09770 40342 41001 gene locus_tag LOCUS_09780 40342 41001 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060848.1 protein_id gnl|my_center|LOCUS_09780 40998 42365 gene locus_tag LOCUS_09790 40998 42365 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870075.1 protein_id gnl|my_center|LOCUS_09790 42346 43206 gene locus_tag LOCUS_09800 gene pheA 42346 43206 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038038884.1 protein_id gnl|my_center|LOCUS_09800 44274 43195 gene locus_tag LOCUS_09810 44274 43195 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531362.1 protein_id gnl|my_center|LOCUS_09810 44795 44274 gene locus_tag LOCUS_09820 44795 44274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 44884 45669 gene locus_tag LOCUS_09830 44884 45669 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250846.1 protein_id gnl|my_center|LOCUS_09830 46129 45731 gene locus_tag LOCUS_09840 gene gcvH 46129 45731 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393442.1 protein_id gnl|my_center|LOCUS_09840 46248 48419 gene locus_tag LOCUS_09850 gene hypF 46248 48419 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250947.1 protein_id gnl|my_center|LOCUS_09850 48864 48424 gene locus_tag LOCUS_09860 48864 48424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 49606 49256 gene locus_tag LOCUS_09870 49606 49256 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_09870 49760 50818 gene locus_tag LOCUS_09880 49760 50818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 50885 51991 gene locus_tag LOCUS_09890 50885 51991 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061048.1 protein_id gnl|my_center|LOCUS_09890 53515 52262 gene locus_tag LOCUS_09900 53515 52262 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369608.1 protein_id gnl|my_center|LOCUS_09900 53528 53833 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence14 7878 6931 gene locus_tag LOCUS_09910 gene guaA 7878 6931 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867924.1 protein_id gnl|my_center|LOCUS_09910 8344 7871 gene locus_tag LOCUS_09920 gene purE 8344 7871 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870121.1 protein_id gnl|my_center|LOCUS_09920 8698 8408 gene locus_tag LOCUS_09930 8698 8408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 8946 8713 gene locus_tag LOCUS_09940 8946 8713 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878901.1 protein_id gnl|my_center|LOCUS_09940 9943 9023 gene locus_tag LOCUS_09950 9943 9023 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877153.1 protein_id gnl|my_center|LOCUS_09950 11178 9940 gene locus_tag LOCUS_09960 gene ahcY 11178 9940 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870905.1 protein_id gnl|my_center|LOCUS_09960 11955 11212 gene locus_tag LOCUS_09970 11955 11212 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902141.1 protein_id gnl|my_center|LOCUS_09970 12136 12396 gene locus_tag LOCUS_09980 12136 12396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 12362 13294 gene locus_tag LOCUS_09990 12362 13294 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020659.1 protein_id gnl|my_center|LOCUS_09990 13433 14329 gene locus_tag LOCUS_10000 13433 14329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 13971 14052 gene locus_tag LOCUS_t00210 13971 14052 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15381 14326 gene locus_tag LOCUS_10010 gene endA 15381 14326 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023532.1 protein_id gnl|my_center|LOCUS_10010 15501 16127 gene locus_tag LOCUS_10020 15501 16127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 16133 16423 gene locus_tag LOCUS_10030 16133 16423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 16689 18875 gene locus_tag LOCUS_10040 16689 18875 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_10040 18881 19408 gene locus_tag LOCUS_10050 18881 19408 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878792.1 protein_id gnl|my_center|LOCUS_10050 19538 20473 gene locus_tag LOCUS_10060 19538 20473 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023440.1 protein_id gnl|my_center|LOCUS_10060 20454 21077 gene locus_tag LOCUS_10070 20454 21077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 21109 22770 gene locus_tag LOCUS_10080 21109 22770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 23950 22751 gene locus_tag LOCUS_10090 23950 22751 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020737.1 protein_id gnl|my_center|LOCUS_10090 28322 23955 gene locus_tag LOCUS_10100 28322 23955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 28515 29033 gene locus_tag LOCUS_10110 gene cyaB 28515 29033 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023937.1 protein_id gnl|my_center|LOCUS_10110 29284 29030 gene locus_tag LOCUS_10120 29284 29030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 29391 30725 gene locus_tag LOCUS_10130 29391 30725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 31477 30722 gene locus_tag LOCUS_10140 31477 30722 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024526.1 protein_id gnl|my_center|LOCUS_10140 31851 31474 gene locus_tag LOCUS_10150 31851 31474 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978945.1 protein_id gnl|my_center|LOCUS_10150 31963 33405 gene locus_tag LOCUS_10160 31963 33405 CDS product DNA-directed DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879286.1 protein_id gnl|my_center|LOCUS_10160 33553 33410 gene locus_tag LOCUS_10170 33553 33410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 34289 33636 gene locus_tag LOCUS_10180 34289 33636 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024048.1 protein_id gnl|my_center|LOCUS_10180 35677 34286 gene locus_tag LOCUS_10190 35677 34286 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024047.1 protein_id gnl|my_center|LOCUS_10190 37605 35674 gene locus_tag LOCUS_10200 37605 35674 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024046.1 protein_id gnl|my_center|LOCUS_10200 35941 36114 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37913 37608 gene locus_tag LOCUS_10210 37913 37608 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024045.1 protein_id gnl|my_center|LOCUS_10210 38972 37914 gene locus_tag LOCUS_10220 38972 37914 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024044.1 protein_id gnl|my_center|LOCUS_10220 39547 38990 gene locus_tag LOCUS_10230 39547 38990 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024043.1 protein_id gnl|my_center|LOCUS_10230 39797 39573 gene locus_tag LOCUS_10240 39797 39573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 41900 39801 gene locus_tag LOCUS_10250 41900 39801 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589509.1 protein_id gnl|my_center|LOCUS_10250 42219 41875 gene locus_tag LOCUS_10260 42219 41875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 42819 42361 gene locus_tag LOCUS_10270 42819 42361 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879260.1 protein_id gnl|my_center|LOCUS_10270 42916 43827 gene locus_tag LOCUS_10280 42916 43827 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020095.1 protein_id gnl|my_center|LOCUS_10280 45168 43828 gene locus_tag LOCUS_10290 45168 43828 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064787.1 protein_id gnl|my_center|LOCUS_10290 45498 46760 gene locus_tag LOCUS_10300 gene hflX 45498 46760 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755955.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence15 1167 181 gene locus_tag LOCUS_10310 1167 181 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949075.1 protein_id gnl|my_center|LOCUS_10310 1441 1671 gene locus_tag LOCUS_10320 1441 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 1676 1855 gene locus_tag LOCUS_10330 1676 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 2496 2020 gene locus_tag LOCUS_10340 2496 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 2559 2839 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5912 3825 gene locus_tag LOCUS_10350 5912 3825 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_10350 6610 6218 gene locus_tag LOCUS_10360 6610 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 6757 7278 gene locus_tag LOCUS_10370 6757 7278 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_10370 7495 7241 gene locus_tag LOCUS_10380 7495 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 7538 7845 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8615 7935 gene locus_tag LOCUS_10390 8615 7935 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066212.1 protein_id gnl|my_center|LOCUS_10390 8753 8908 gene locus_tag LOCUS_10400 8753 8908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 8908 9618 gene locus_tag LOCUS_10410 8908 9618 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530431.1 protein_id gnl|my_center|LOCUS_10410 9615 10298 gene locus_tag LOCUS_10420 gene rpiA 9615 10298 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140034.1 protein_id gnl|my_center|LOCUS_10420 10657 10286 gene locus_tag LOCUS_10430 10657 10286 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064265.1 protein_id gnl|my_center|LOCUS_10430 11055 11333 gene locus_tag LOCUS_10440 11055 11333 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868833.1 protein_id gnl|my_center|LOCUS_10440 11339 11518 gene locus_tag LOCUS_10450 11339 11518 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878831.1 protein_id gnl|my_center|LOCUS_10450 11521 12300 gene locus_tag LOCUS_10460 11521 12300 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061020.1 protein_id gnl|my_center|LOCUS_10460 12531 13289 gene locus_tag LOCUS_10470 12531 13289 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878032.1 protein_id gnl|my_center|LOCUS_10470 14035 13796 gene locus_tag LOCUS_10480 14035 13796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 15718 14435 gene locus_tag LOCUS_10490 15718 14435 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_10490 15820 16647 gene locus_tag LOCUS_10500 15820 16647 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868837.1 protein_id gnl|my_center|LOCUS_10500 16725 17321 gene locus_tag LOCUS_10510 16725 17321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 17318 17725 gene locus_tag LOCUS_10520 17318 17725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 17734 19368 gene locus_tag LOCUS_10530 17734 19368 CDS product methylamine methyltransferase corrinoid protein reductive activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020208.1 protein_id gnl|my_center|LOCUS_10530 21050 19632 gene locus_tag LOCUS_10540 gene mtaB 21050 19632 CDS product methanol--corrinoid protein co-methyltransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021626.1 protein_id gnl|my_center|LOCUS_10540 21836 21054 gene locus_tag LOCUS_10550 gene mtaC 21836 21054 CDS product methanol--corrinoid protein MtaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024270.1 protein_id gnl|my_center|LOCUS_10550 22362 23687 gene locus_tag LOCUS_10560 gene cca 22362 23687 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902052.1 protein_id gnl|my_center|LOCUS_10560 24052 23690 gene locus_tag LOCUS_10570 24052 23690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 24334 25275 gene locus_tag LOCUS_10580 gene radA 24334 25275 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023460.1 protein_id gnl|my_center|LOCUS_10580 25247 26311 gene locus_tag LOCUS_10590 25247 26311 CDS product TRM11 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020267.1 protein_id gnl|my_center|LOCUS_10590 27740 26298 gene locus_tag LOCUS_10600 27740 26298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 27840 28430 gene locus_tag LOCUS_10610 27840 28430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 29048 28431 gene locus_tag LOCUS_10620 29048 28431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 29133 29948 gene locus_tag LOCUS_10630 29133 29948 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020999.1 protein_id gnl|my_center|LOCUS_10630 29945 30679 gene locus_tag LOCUS_10640 29945 30679 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249977.1 protein_id gnl|my_center|LOCUS_10640 31266 30676 gene locus_tag LOCUS_10650 gene pdxT 31266 30676 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878016.1 protein_id gnl|my_center|LOCUS_10650 32735 31263 gene locus_tag LOCUS_10660 32735 31263 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023751.1 protein_id gnl|my_center|LOCUS_10660 34920 32761 gene locus_tag LOCUS_10670 34920 32761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 34960 35253 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35955 36242 gene locus_tag LOCUS_10680 35955 36242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 36724 37497 gene locus_tag LOCUS_10690 36724 37497 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012468436.1 protein_id gnl|my_center|LOCUS_10690 37547 37852 gene locus_tag LOCUS_10700 37547 37852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 39347 37977 gene locus_tag LOCUS_10710 39347 37977 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812866.1 protein_id gnl|my_center|LOCUS_10710 39925 39479 gene locus_tag LOCUS_10720 39925 39479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 41051 39936 gene locus_tag LOCUS_10730 41051 39936 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064979.1 protein_id gnl|my_center|LOCUS_10730 41721 41296 gene locus_tag LOCUS_10740 41721 41296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 42071 41808 gene locus_tag LOCUS_10750 gene sugE 42071 41808 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528463.1 protein_id gnl|my_center|LOCUS_10750 42216 42929 gene locus_tag LOCUS_10760 42216 42929 CDS product MtnX-like HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816647.1 protein_id gnl|my_center|LOCUS_10760 43499 42933 gene locus_tag LOCUS_10770 43499 42933 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023860.1 protein_id gnl|my_center|LOCUS_10770 43665 43901 gene locus_tag LOCUS_10780 gene vorC 43665 43901 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876342.1 protein_id gnl|my_center|LOCUS_10780 43898 44953 gene locus_tag LOCUS_10790 43898 44953 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022859.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence16 226 1005 gene locus_tag LOCUS_10800 226 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 2175 1012 gene locus_tag LOCUS_10810 2175 1012 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064238.1 protein_id gnl|my_center|LOCUS_10810 2233 3297 gene locus_tag LOCUS_10820 2233 3297 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023593.1 protein_id gnl|my_center|LOCUS_10820 3308 3733 gene locus_tag LOCUS_10830 3308 3733 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876248.1 protein_id gnl|my_center|LOCUS_10830 4890 3985 gene locus_tag LOCUS_10840 gene purC 4890 3985 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878767.1 protein_id gnl|my_center|LOCUS_10840 5034 6068 gene locus_tag LOCUS_10850 5034 6068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 6776 6069 gene locus_tag LOCUS_10860 6776 6069 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403380.1 protein_id gnl|my_center|LOCUS_10860 6861 7901 gene locus_tag LOCUS_10870 6861 7901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 8266 11379 gene locus_tag LOCUS_10880 8266 11379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 12321 11344 gene locus_tag LOCUS_10890 12321 11344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 13226 12429 gene locus_tag LOCUS_10900 13226 12429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 13440 13228 gene locus_tag LOCUS_10910 13440 13228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 14357 13416 gene locus_tag LOCUS_10920 14357 13416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 15477 14350 gene locus_tag LOCUS_10930 15477 14350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 16658 15474 gene locus_tag LOCUS_10940 16658 15474 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030721.1 protein_id gnl|my_center|LOCUS_10940 18210 16660 gene locus_tag LOCUS_10950 18210 16660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 18231 18472 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18652 19353 gene locus_tag LOCUS_10960 18652 19353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 19535 20347 gene locus_tag LOCUS_10970 19535 20347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 20356 21543 gene locus_tag LOCUS_10980 20356 21543 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485734.1 protein_id gnl|my_center|LOCUS_10980 21540 22970 gene locus_tag LOCUS_10990 21540 22970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 22979 24154 gene locus_tag LOCUS_11000 22979 24154 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140466.1 protein_id gnl|my_center|LOCUS_11000 24151 25542 gene locus_tag LOCUS_11010 24151 25542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 25545 26708 gene locus_tag LOCUS_11020 25545 26708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 27752 26718 gene locus_tag LOCUS_11030 27752 26718 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528582.1 protein_id gnl|my_center|LOCUS_11030 28494 27799 gene locus_tag LOCUS_11040 28494 27799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 29338 28499 gene locus_tag LOCUS_11050 29338 28499 CDS product HtlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903270.1 protein_id gnl|my_center|LOCUS_11050 29928 29509 gene locus_tag LOCUS_11060 29928 29509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 30521 29982 gene locus_tag LOCUS_11070 30521 29982 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870045.1 protein_id gnl|my_center|LOCUS_11070 32615 30642 gene locus_tag LOCUS_11080 gene lonB 32615 30642 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877871.1 protein_id gnl|my_center|LOCUS_11080 32869 34038 gene locus_tag LOCUS_11090 32869 34038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 34112 36325 gene locus_tag LOCUS_11100 34112 36325 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023138.1 protein_id gnl|my_center|LOCUS_11100 36332 36545 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37488 36553 gene locus_tag LOCUS_11110 37488 36553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 37507 37889 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38858 37923 gene locus_tag LOCUS_11120 38858 37923 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903313.1 protein_id gnl|my_center|LOCUS_11120 39160 38939 gene locus_tag LOCUS_11130 39160 38939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 39074 39517 gene locus_tag LOCUS_11140 39074 39517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 >Feature sequence17 96 1625 gene locus_tag LOCUS_11150 gene gcvPB 96 1625 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868896.1 protein_id gnl|my_center|LOCUS_11150 1628 2281 gene locus_tag LOCUS_11160 gene tmk 1628 2281 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024311.1 protein_id gnl|my_center|LOCUS_11160 2320 3507 gene locus_tag LOCUS_11170 gene coaBC 2320 3507 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249472.1 protein_id gnl|my_center|LOCUS_11170 3512 4366 gene locus_tag LOCUS_11180 3512 4366 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892274.1 protein_id gnl|my_center|LOCUS_11180 4643 4350 gene locus_tag LOCUS_11190 4643 4350 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250146.1 protein_id gnl|my_center|LOCUS_11190 6271 4640 gene locus_tag LOCUS_11200 6271 4640 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878560.1 protein_id gnl|my_center|LOCUS_11200 6442 7269 gene locus_tag LOCUS_11210 6442 7269 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868818.1 protein_id gnl|my_center|LOCUS_11210 7313 8710 gene locus_tag LOCUS_11220 gene proS 7313 8710 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249505.1 protein_id gnl|my_center|LOCUS_11220 8863 8720 gene locus_tag LOCUS_11230 8863 8720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 9284 9072 gene locus_tag LOCUS_11240 9284 9072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 9911 10669 gene locus_tag LOCUS_11250 9911 10669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 10725 11636 gene locus_tag LOCUS_11260 10725 11636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 11651 12538 gene locus_tag LOCUS_11270 11651 12538 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878632.1 protein_id gnl|my_center|LOCUS_11270 12535 13446 gene locus_tag LOCUS_11280 12535 13446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 13611 14393 gene locus_tag LOCUS_11290 gene trmI 13611 14393 CDS product tRNA (adenine(57)-N(1)/adenine(58)-N(1))-methyltransferase TrmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867553.1 protein_id gnl|my_center|LOCUS_11290 14586 14834 gene locus_tag LOCUS_11300 gene purS 14586 14834 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879434.1 protein_id gnl|my_center|LOCUS_11300 14834 17158 gene locus_tag LOCUS_11310 gene purL 14834 17158 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879433.1 protein_id gnl|my_center|LOCUS_11310 17158 17991 gene locus_tag LOCUS_11320 gene purQ 17158 17991 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878755.1 protein_id gnl|my_center|LOCUS_11320 18660 17992 gene locus_tag LOCUS_11330 18660 17992 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319832.1 protein_id gnl|my_center|LOCUS_11330 19068 18853 gene locus_tag LOCUS_11340 19068 18853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 19354 20181 gene locus_tag LOCUS_11350 19354 20181 CDS product DUF2099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061092.1 protein_id gnl|my_center|LOCUS_11350 20531 20178 gene locus_tag LOCUS_11360 20531 20178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 21761 20538 gene locus_tag LOCUS_11370 21761 20538 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496772.1 protein_id gnl|my_center|LOCUS_11370 22156 21761 gene locus_tag LOCUS_11380 22156 21761 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021540.1 protein_id gnl|my_center|LOCUS_11380 22443 22898 gene locus_tag LOCUS_11390 22443 22898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 25185 22921 gene locus_tag LOCUS_11400 25185 22921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 25581 25982 gene locus_tag LOCUS_11410 25581 25982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 26114 30223 gene locus_tag LOCUS_11420 26114 30223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 30220 30477 gene locus_tag LOCUS_11430 30220 30477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 30517 31014 gene locus_tag LOCUS_11440 30517 31014 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920697.1 protein_id gnl|my_center|LOCUS_11440 31051 31596 gene locus_tag LOCUS_11450 31051 31596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 33373 31562 gene locus_tag LOCUS_11460 33373 31562 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 protein_id gnl|my_center|LOCUS_11460 34190 33408 gene locus_tag LOCUS_11470 34190 33408 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062281570.1 protein_id gnl|my_center|LOCUS_11470 35649 34192 gene locus_tag LOCUS_11480 35649 34192 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021434.1 protein_id gnl|my_center|LOCUS_11480 36212 35646 gene locus_tag LOCUS_11490 36212 35646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 36237 36517 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37199 36696 gene locus_tag LOCUS_11500 37199 36696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 >Feature sequence18 353 144 gene locus_tag LOCUS_11510 353 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 747 663 gene locus_tag LOCUS_t00220 747 663 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 966 3008 gene locus_tag LOCUS_11520 gene ppk1 966 3008 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755861.1 protein_id gnl|my_center|LOCUS_11520 3001 4500 gene locus_tag LOCUS_11530 3001 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 4497 6059 gene locus_tag LOCUS_11540 4497 6059 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020142.1 protein_id gnl|my_center|LOCUS_11540 6088 6543 gene locus_tag LOCUS_11550 6088 6543 CDS product DNA polymerase ligase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023353.1 protein_id gnl|my_center|LOCUS_11550 6852 6631 gene locus_tag LOCUS_11560 6852 6631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 7107 8405 gene locus_tag LOCUS_11570 gene glmM 7107 8405 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065583.1 protein_id gnl|my_center|LOCUS_11570 8402 9628 gene locus_tag LOCUS_11580 8402 9628 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022964.1 protein_id gnl|my_center|LOCUS_11580 10002 9625 gene locus_tag LOCUS_11590 10002 9625 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879687.1 protein_id gnl|my_center|LOCUS_11590 10805 9999 gene locus_tag LOCUS_11600 10805 9999 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251074.1 protein_id gnl|my_center|LOCUS_11600 11575 10802 gene locus_tag LOCUS_11610 11575 10802 CDS product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023274.1 protein_id gnl|my_center|LOCUS_11610 11668 12048 gene locus_tag LOCUS_11620 11668 12048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 12310 12065 gene locus_tag LOCUS_11630 12310 12065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 12582 12307 gene locus_tag LOCUS_11640 12582 12307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 13094 12639 gene locus_tag LOCUS_11650 13094 12639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 13188 13856 gene locus_tag LOCUS_11660 13188 13856 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876839.1 protein_id gnl|my_center|LOCUS_11660 13853 14212 gene locus_tag LOCUS_11670 13853 14212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 14289 14744 gene locus_tag LOCUS_11680 14289 14744 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869527.1 protein_id gnl|my_center|LOCUS_11680 14750 16105 gene locus_tag LOCUS_11690 14750 16105 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023357.1 protein_id gnl|my_center|LOCUS_11690 17087 16107 gene locus_tag LOCUS_11700 17087 16107 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251076.1 protein_id gnl|my_center|LOCUS_11700 17347 17105 gene locus_tag LOCUS_11710 17347 17105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 17489 17842 gene locus_tag LOCUS_11720 17489 17842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 17900 18619 gene locus_tag LOCUS_11730 17900 18619 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479707.1 protein_id gnl|my_center|LOCUS_11730 18623 18862 gene locus_tag LOCUS_11740 18623 18862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 19020 19093 gene locus_tag LOCUS_t00230 19020 19093 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 20124 19132 gene locus_tag LOCUS_11750 20124 19132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 22606 23013 gene locus_tag LOCUS_11760 22606 23013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 23722 23057 gene locus_tag LOCUS_11770 23722 23057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 23880 24068 gene locus_tag LOCUS_11780 23880 24068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 24100 24390 gene locus_tag LOCUS_11790 24100 24390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 24342 24542 gene locus_tag LOCUS_11800 24342 24542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 25023 24658 gene locus_tag LOCUS_11810 25023 24658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 25249 26160 gene locus_tag LOCUS_11820 25249 26160 CDS product IS5-like element IS903B family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654812.1 protein_id gnl|my_center|LOCUS_11820 27656 28444 gene locus_tag LOCUS_11830 27656 28444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 30419 29625 gene locus_tag LOCUS_11840 30419 29625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 31387 31548 gene locus_tag LOCUS_11850 31387 31548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 31916 32215 gene locus_tag LOCUS_11860 31916 32215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 33394 32360 gene locus_tag LOCUS_11870 33394 32360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052351.1 protein_id gnl|my_center|LOCUS_11870 33737 33378 gene locus_tag LOCUS_11880 33737 33378 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380304.1 protein_id gnl|my_center|LOCUS_11880 34574 33930 gene locus_tag LOCUS_11890 34574 33930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 34786 35466 gene locus_tag LOCUS_11900 34786 35466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 35586 36161 gene locus_tag LOCUS_11910 35586 36161 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141799.1 protein_id gnl|my_center|LOCUS_11910 >Feature sequence19 231 1484 gene locus_tag LOCUS_11920 gene gdhA 231 1484 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080520.1 protein_id gnl|my_center|LOCUS_11920 1496 2134 gene locus_tag LOCUS_11930 1496 2134 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096121.1 protein_id gnl|my_center|LOCUS_11930 2173 2469 gene locus_tag LOCUS_11940 gene albA 2173 2469 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867516.1 protein_id gnl|my_center|LOCUS_11940 3158 2451 gene locus_tag LOCUS_11950 3158 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 3279 3923 gene locus_tag LOCUS_11960 3279 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 3933 5450 gene locus_tag LOCUS_11970 3933 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 6463 5447 gene locus_tag LOCUS_11980 6463 5447 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249026.1 protein_id gnl|my_center|LOCUS_11980 7689 6487 gene locus_tag LOCUS_11990 7689 6487 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022842.1 protein_id gnl|my_center|LOCUS_11990 9541 7712 gene locus_tag LOCUS_12000 9541 7712 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544976.1 protein_id gnl|my_center|LOCUS_12000 11267 9801 gene locus_tag LOCUS_12010 gene ppcA 11267 9801 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060929.1 protein_id gnl|my_center|LOCUS_12010 13029 11476 gene locus_tag LOCUS_12020 gene purH 13029 11476 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745444.1 protein_id gnl|my_center|LOCUS_12020 13478 13143 gene locus_tag LOCUS_12030 13478 13143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 13620 14396 gene locus_tag LOCUS_12040 13620 14396 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392711.1 protein_id gnl|my_center|LOCUS_12040 14714 14412 gene locus_tag LOCUS_12050 14714 14412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 14827 15648 gene locus_tag LOCUS_12060 14827 15648 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856159.1 protein_id gnl|my_center|LOCUS_12060 15804 17795 gene locus_tag LOCUS_12070 15804 17795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 19130 18219 gene locus_tag LOCUS_12080 19130 18219 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392705.1 protein_id gnl|my_center|LOCUS_12080 19828 19127 gene locus_tag LOCUS_12090 19828 19127 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392706.1 protein_id gnl|my_center|LOCUS_12090 20229 19825 gene locus_tag LOCUS_12100 20229 19825 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011018997.1 protein_id gnl|my_center|LOCUS_12100 21212 20226 gene locus_tag LOCUS_12110 21212 20226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 22204 21209 gene locus_tag LOCUS_12120 22204 21209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 22314 23168 gene locus_tag LOCUS_12130 22314 23168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 23119 23799 gene locus_tag LOCUS_12140 23119 23799 CDS product DUF3786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813269.1 protein_id gnl|my_center|LOCUS_12140 25478 23796 gene locus_tag LOCUS_12150 25478 23796 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_12150 25573 26451 gene locus_tag LOCUS_12160 gene folD 25573 26451 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_12160 26518 26877 gene locus_tag LOCUS_12170 26518 26877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 27033 27623 gene locus_tag LOCUS_12180 27033 27623 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877913.1 protein_id gnl|my_center|LOCUS_12180 27660 28625 gene locus_tag LOCUS_12190 27660 28625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 28730 29686 gene locus_tag LOCUS_12200 28730 29686 CDS product DUF1743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877003.1 protein_id gnl|my_center|LOCUS_12200 29692 30501 gene locus_tag LOCUS_12210 gene uppS 29692 30501 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250124.1 protein_id gnl|my_center|LOCUS_12210 30552 32276 gene locus_tag LOCUS_12220 30552 32276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 33086 32277 gene locus_tag LOCUS_12230 gene proC 33086 32277 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_12230 33696 33187 gene locus_tag LOCUS_12240 gene pfpI 33696 33187 CDS product deglycase PfpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867593.1 protein_id gnl|my_center|LOCUS_12240 >Feature sequence20 1339 170 gene locus_tag LOCUS_12250 1339 170 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021821.1 protein_id gnl|my_center|LOCUS_12250 2265 1423 gene locus_tag LOCUS_12260 2265 1423 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925959.1 protein_id gnl|my_center|LOCUS_12260 2401 3309 gene locus_tag LOCUS_12270 gene pdxS 2401 3309 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876304.1 protein_id gnl|my_center|LOCUS_12270 3706 3395 gene locus_tag LOCUS_12280 3706 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 4383 3781 gene locus_tag LOCUS_12290 gene nep1 4383 3781 CDS product 16S rRNA (pseudouridine-N1-)-methyltransferase Nep1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878237.1 protein_id gnl|my_center|LOCUS_12290 5456 4383 gene locus_tag LOCUS_12300 5456 4383 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064840.1 protein_id gnl|my_center|LOCUS_12300 6019 5495 gene locus_tag LOCUS_12310 6019 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 6240 6854 gene locus_tag LOCUS_12320 6240 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 7050 8393 gene locus_tag LOCUS_12330 7050 8393 CDS product Single-stranded DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289299.1 protein_id gnl|my_center|LOCUS_12330 8393 9280 gene locus_tag LOCUS_12340 8393 9280 CDS product RPA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064919.1 protein_id gnl|my_center|LOCUS_12340 9982 9311 gene locus_tag LOCUS_12350 9982 9311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 9921 10079 gene locus_tag LOCUS_12360 9921 10079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 10980 10159 gene locus_tag LOCUS_12370 10980 10159 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020650.1 protein_id gnl|my_center|LOCUS_12370 11734 11123 gene locus_tag LOCUS_12380 gene rpsB 11734 11123 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878629.1 protein_id gnl|my_center|LOCUS_12380 12145 11744 gene locus_tag LOCUS_12390 12145 11744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 12202 13911 gene locus_tag LOCUS_12400 12202 13911 CDS product histidine kinase N-terminal 7TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064963.1 protein_id gnl|my_center|LOCUS_12400 14377 13880 gene locus_tag LOCUS_12410 gene leuD 14377 13880 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_12410 15635 14379 gene locus_tag LOCUS_12420 gene hacA 15635 14379 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876998.1 protein_id gnl|my_center|LOCUS_12420 15933 17651 gene locus_tag LOCUS_12430 gene acsA 15933 17651 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862049.1 protein_id gnl|my_center|LOCUS_12430 18123 17719 gene locus_tag LOCUS_12440 18123 17719 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023551.1 protein_id gnl|my_center|LOCUS_12440 18652 18266 gene locus_tag LOCUS_12450 18652 18266 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224278.1 protein_id gnl|my_center|LOCUS_12450 18816 19346 gene locus_tag LOCUS_12460 18816 19346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 19404 20960 gene locus_tag LOCUS_12470 19404 20960 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868685.1 protein_id gnl|my_center|LOCUS_12470 21703 20948 gene locus_tag LOCUS_12480 21703 20948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 22288 21770 gene locus_tag LOCUS_12490 22288 21770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 22777 22358 gene locus_tag LOCUS_12500 22777 22358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 22835 23067 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23151 23558 gene locus_tag LOCUS_12510 23151 23558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 23750 24697 gene locus_tag LOCUS_12520 23750 24697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 24756 25910 gene locus_tag LOCUS_12530 24756 25910 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088548.1 protein_id gnl|my_center|LOCUS_12530 26335 26653 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27457 27716 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28922 27975 gene locus_tag LOCUS_12540 28922 27975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 29504 29118 gene locus_tag LOCUS_12550 29504 29118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12550 29834 29625 gene locus_tag LOCUS_12560 29834 29625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 31025 29988 gene locus_tag LOCUS_12570 31025 29988 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879796.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence21 3072 1075 gene locus_tag LOCUS_12580 3072 1075 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021597.1 protein_id gnl|my_center|LOCUS_12580 4120 3131 gene locus_tag LOCUS_12590 4120 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 4222 5154 gene locus_tag LOCUS_12600 gene arcC 4222 5154 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_12600 5163 6278 gene locus_tag LOCUS_12610 5163 6278 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496792.1 protein_id gnl|my_center|LOCUS_12610 6326 7507 gene locus_tag LOCUS_12620 6326 7507 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932383.1 protein_id gnl|my_center|LOCUS_12620 8107 7496 gene locus_tag LOCUS_12630 8107 7496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 8305 9507 gene locus_tag LOCUS_12640 gene hisS 8305 9507 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061190.1 protein_id gnl|my_center|LOCUS_12640 10191 9757 gene locus_tag LOCUS_12650 10191 9757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 10565 10188 gene locus_tag LOCUS_12660 10565 10188 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027487.1 protein_id gnl|my_center|LOCUS_12660 10713 11645 gene locus_tag LOCUS_12670 10713 11645 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105569.1 protein_id gnl|my_center|LOCUS_12670 11728 12768 gene locus_tag LOCUS_12680 11728 12768 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460055.1 protein_id gnl|my_center|LOCUS_12680 12770 13564 gene locus_tag LOCUS_12690 12770 13564 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023815.1 protein_id gnl|my_center|LOCUS_12690 13561 13890 gene locus_tag LOCUS_12700 13561 13890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020960.1 protein_id gnl|my_center|LOCUS_12700 13936 15030 gene locus_tag LOCUS_12710 13936 15030 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846769.1 protein_id gnl|my_center|LOCUS_12710 15124 15049 gene locus_tag LOCUS_t00240 15124 15049 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 15310 16110 gene locus_tag LOCUS_12720 15310 16110 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876899.1 protein_id gnl|my_center|LOCUS_12720 18503 16203 gene locus_tag LOCUS_12730 gene ppsA 18503 16203 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846514.1 protein_id gnl|my_center|LOCUS_12730 18883 19398 gene locus_tag LOCUS_12740 18883 19398 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582671.1 protein_id gnl|my_center|LOCUS_12740 19398 19661 gene locus_tag LOCUS_12750 gene porD 19398 19661 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082458.1 protein_id gnl|my_center|LOCUS_12750 19658 20818 gene locus_tag LOCUS_12760 gene porA 19658 20818 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082460.1 protein_id gnl|my_center|LOCUS_12760 20815 21756 gene locus_tag LOCUS_12770 20815 21756 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545618.1 protein_id gnl|my_center|LOCUS_12770 21881 22534 gene locus_tag LOCUS_12780 21881 22534 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943939.1 protein_id gnl|my_center|LOCUS_12780 22646 23776 gene locus_tag LOCUS_12790 22646 23776 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064979.1 protein_id gnl|my_center|LOCUS_12790 24014 24571 gene locus_tag LOCUS_12800 24014 24571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 24798 24568 gene locus_tag LOCUS_12810 24798 24568 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250951.1 protein_id gnl|my_center|LOCUS_12810 25146 24805 gene locus_tag LOCUS_12820 25146 24805 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875816.1 protein_id gnl|my_center|LOCUS_12820 26517 25255 gene locus_tag LOCUS_12830 26517 25255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 27942 26596 gene locus_tag LOCUS_12840 gene glnA 27942 26596 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723435.1 protein_id gnl|my_center|LOCUS_12840 28143 29108 gene locus_tag LOCUS_12850 28143 29108 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393472.1 protein_id gnl|my_center|LOCUS_12850 29108 29899 gene locus_tag LOCUS_12860 29108 29899 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393473.1 protein_id gnl|my_center|LOCUS_12860 29904 30932 gene locus_tag LOCUS_12870 29904 30932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 >Feature sequence22 <1 846 gene locus_tag LOCUS_12880 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257983.1:glycosyltransferase 1070 1344 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1369 1935 gene locus_tag LOCUS_12890 1369 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 2831 3077 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3502 4362 gene locus_tag LOCUS_12900 3502 4362 CDS product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920700.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12900 4362 5438 gene locus_tag LOCUS_12910 4362 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 6522 5419 gene locus_tag LOCUS_12920 6522 5419 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797113.1 protein_id gnl|my_center|LOCUS_12920 7565 6594 gene locus_tag LOCUS_12930 7565 6594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 7756 8688 gene locus_tag LOCUS_12940 7756 8688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 9124 8957 gene locus_tag LOCUS_12950 9124 8957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 9352 10398 gene locus_tag LOCUS_12960 gene gmd 9352 10398 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546080.1 protein_id gnl|my_center|LOCUS_12960 10398 11339 gene locus_tag LOCUS_12970 10398 11339 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_12970 12169 11642 gene locus_tag LOCUS_12980 12169 11642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 12915 12403 gene locus_tag LOCUS_12990 12915 12403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 13808 13224 gene locus_tag LOCUS_13000 13808 13224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 15098 14082 gene locus_tag LOCUS_13010 15098 14082 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876013.1 protein_id gnl|my_center|LOCUS_13010 15406 15702 gene locus_tag LOCUS_13020 15406 15702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 18040 15890 gene locus_tag LOCUS_13030 18040 15890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 18240 19490 gene locus_tag LOCUS_13040 18240 19490 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147032.1 protein_id gnl|my_center|LOCUS_13040 20923 19520 gene locus_tag LOCUS_13050 20923 19520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 22653 20968 gene locus_tag LOCUS_13060 22653 20968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 23866 22733 gene locus_tag LOCUS_13070 23866 22733 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142859.1 protein_id gnl|my_center|LOCUS_13070 24974 23841 gene locus_tag LOCUS_13080 24974 23841 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296321.1 protein_id gnl|my_center|LOCUS_13080 25969 24956 gene locus_tag LOCUS_13090 25969 24956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 27143 25962 gene locus_tag LOCUS_13100 27143 25962 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876015.1 protein_id gnl|my_center|LOCUS_13100 28141 27146 gene locus_tag LOCUS_13110 28141 27146 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060801.1 protein_id gnl|my_center|LOCUS_13110 29084 28143 gene locus_tag LOCUS_13120 29084 28143 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060800.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence23 1801 2029 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2546 3193 gene locus_tag LOCUS_13130 2546 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 3409 3197 gene locus_tag LOCUS_13140 3409 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 4464 3442 gene locus_tag LOCUS_13150 4464 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 4775 4464 gene locus_tag LOCUS_13160 4775 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 4835 5059 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7248 5728 gene locus_tag LOCUS_13170 gene glpA 7248 5728 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815350.1 protein_id gnl|my_center|LOCUS_13170 7374 7640 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8005 7930 gene locus_tag LOCUS_t00250 8005 7930 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8350 9756 gene locus_tag LOCUS_13180 8350 9756 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172728.1 protein_id gnl|my_center|LOCUS_13180 9753 10589 gene locus_tag LOCUS_13190 9753 10589 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022132.1 protein_id gnl|my_center|LOCUS_13190 10729 10954 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11843 12481 gene locus_tag LOCUS_13200 11843 12481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 12890 12552 gene locus_tag LOCUS_13210 12890 12552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 13129 12887 gene locus_tag LOCUS_13220 13129 12887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 13133 13371 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13804 14904 gene locus_tag LOCUS_13230 13804 14904 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460725.1 protein_id gnl|my_center|LOCUS_13230 15026 16042 gene locus_tag LOCUS_13240 15026 16042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 16118 17023 gene locus_tag LOCUS_13250 gene mptA 16118 17023 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876820.1 protein_id gnl|my_center|LOCUS_13250 19387 17030 gene locus_tag LOCUS_13260 19387 17030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 19698 20369 gene locus_tag LOCUS_13270 19698 20369 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877951.1 protein_id gnl|my_center|LOCUS_13270 20495 20376 gene locus_tag LOCUS_13280 20495 20376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 20517 20770 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21156 21428 gene locus_tag LOCUS_13290 21156 21428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 21425 22753 gene locus_tag LOCUS_13300 gene gatA 21425 22753 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_13300 22750 24096 gene locus_tag LOCUS_13310 gene gatB 22750 24096 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902210.1 protein_id gnl|my_center|LOCUS_13310 25126 24107 gene locus_tag LOCUS_13320 25126 24107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 25140 25391 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26652 26188 gene locus_tag LOCUS_13330 26652 26188 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867606.1 protein_id gnl|my_center|LOCUS_13330 27017 26754 gene locus_tag LOCUS_13340 27017 26754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 27114 28301 gene locus_tag LOCUS_13350 27114 28301 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250558.1 protein_id gnl|my_center|LOCUS_13350 >Feature sequence24 <1 780 gene locus_tag LOCUS_13360 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061731.1:DegT/DnrJ/EryC1/StrS family aminotransferase 777 1736 gene locus_tag LOCUS_13370 777 1736 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061730.1 protein_id gnl|my_center|LOCUS_13370 1738 2853 gene locus_tag LOCUS_13380 1738 2853 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392195.1 protein_id gnl|my_center|LOCUS_13380 3701 2850 gene locus_tag LOCUS_13390 3701 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 4012 7617 gene locus_tag LOCUS_13400 gene smc 4012 7617 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024214.1 protein_id gnl|my_center|LOCUS_13400 7614 8513 gene locus_tag LOCUS_13410 7614 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 8515 9018 gene locus_tag LOCUS_13420 gene scpB 8515 9018 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879077.1 protein_id gnl|my_center|LOCUS_13420 9020 9265 gene locus_tag LOCUS_13430 9020 9265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 9345 9560 gene locus_tag LOCUS_13440 9345 9560 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295846.1 protein_id gnl|my_center|LOCUS_13440 9577 10539 gene locus_tag LOCUS_13450 9577 10539 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485794.1 protein_id gnl|my_center|LOCUS_13450 10620 12269 gene locus_tag LOCUS_13460 10620 12269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 12344 13363 gene locus_tag LOCUS_13470 12344 13363 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383472.1 protein_id gnl|my_center|LOCUS_13470 13364 14449 gene locus_tag LOCUS_13480 13364 14449 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528932.1 protein_id gnl|my_center|LOCUS_13480 14442 15131 gene locus_tag LOCUS_13490 14442 15131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 15133 16485 gene locus_tag LOCUS_13500 gene glmM 15133 16485 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877965.1 protein_id gnl|my_center|LOCUS_13500 16993 16610 gene locus_tag LOCUS_13510 gene eif5A 16993 16610 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878148.1 protein_id gnl|my_center|LOCUS_13510 18197 17094 gene locus_tag LOCUS_13520 18197 17094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 18855 18226 gene locus_tag LOCUS_13530 18855 18226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 19877 18852 gene locus_tag LOCUS_13540 gene mtnA 19877 18852 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166394793.1 protein_id gnl|my_center|LOCUS_13540 20001 20750 gene locus_tag LOCUS_13550 20001 20750 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021472.1 protein_id gnl|my_center|LOCUS_13550 21805 20768 gene locus_tag LOCUS_13560 21805 20768 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986796.1 protein_id gnl|my_center|LOCUS_13560 22224 21940 gene locus_tag LOCUS_13570 22224 21940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 22805 23035 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23084 23815 gene locus_tag LOCUS_13580 23084 23815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 23818 24237 gene locus_tag LOCUS_13590 23818 24237 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876487.1 protein_id gnl|my_center|LOCUS_13590 25296 24241 gene locus_tag LOCUS_13600 25296 24241 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_13600 26168 25293 gene locus_tag LOCUS_13610 26168 25293 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933176.1 protein_id gnl|my_center|LOCUS_13610 26789 26253 gene locus_tag LOCUS_13620 26789 26253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 >Feature sequence25 2369 2442 gene locus_tag LOCUS_t00260 2369 2442 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2762 2550 gene locus_tag LOCUS_13630 2762 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 3458 3075 gene locus_tag LOCUS_13640 3458 3075 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258443.1 protein_id gnl|my_center|LOCUS_13640 3965 3501 gene locus_tag LOCUS_13650 3965 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 5488 4247 gene locus_tag LOCUS_13660 5488 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 5576 5907 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6549 6190 gene locus_tag LOCUS_13670 6549 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 6729 7092 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7796 7386 gene locus_tag LOCUS_13680 7796 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13680 8097 7873 gene locus_tag LOCUS_13690 gene tusA 8097 7873 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_13690 8197 8556 gene locus_tag LOCUS_13700 8197 8556 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020964.1 protein_id gnl|my_center|LOCUS_13700 8619 9548 gene locus_tag LOCUS_13710 gene pyrB 8619 9548 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 protein_id gnl|my_center|LOCUS_13710 9549 10004 gene locus_tag LOCUS_13720 gene pyrI 9549 10004 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060913.1 protein_id gnl|my_center|LOCUS_13720 10456 10067 gene locus_tag LOCUS_13730 10456 10067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 10590 11156 gene locus_tag LOCUS_13740 10590 11156 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146776.1 protein_id gnl|my_center|LOCUS_13740 11150 11428 gene locus_tag LOCUS_13750 11150 11428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 11591 12301 gene locus_tag LOCUS_13760 11591 12301 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877200.1 protein_id gnl|my_center|LOCUS_13760 12355 12470 gene locus_tag LOCUS_r00010 12355 12470 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 12596 13429 gene locus_tag LOCUS_13770 12596 13429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 13521 14300 gene locus_tag LOCUS_13780 13521 14300 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875687.1 protein_id gnl|my_center|LOCUS_13780 14297 15358 gene locus_tag LOCUS_13790 gene fni 14297 15358 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064552.1 protein_id gnl|my_center|LOCUS_13790 15361 16356 gene locus_tag LOCUS_13800 15361 16356 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066119.1 protein_id gnl|my_center|LOCUS_13800 17021 16353 gene locus_tag LOCUS_13810 gene radB 17021 16353 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860416.1 protein_id gnl|my_center|LOCUS_13810 18307 17051 gene locus_tag LOCUS_13820 18307 17051 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061243.1 protein_id gnl|my_center|LOCUS_13820 18443 20218 gene locus_tag LOCUS_13830 18443 20218 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948260.1 protein_id gnl|my_center|LOCUS_13830 20314 22575 gene locus_tag LOCUS_13840 20314 22575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 22625 23257 gene locus_tag LOCUS_13850 22625 23257 CDS product Kae1-associated kinase Bud32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249630.1 protein_id gnl|my_center|LOCUS_13850 23254 23808 gene locus_tag LOCUS_13860 23254 23808 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251061.1 protein_id gnl|my_center|LOCUS_13860 23808 24761 gene locus_tag LOCUS_13870 23808 24761 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_13870 25924 24758 gene locus_tag LOCUS_13880 25924 24758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 26037 26114 gene locus_tag LOCUS_t00270 26037 26114 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence26 767 180 gene locus_tag LOCUS_13890 767 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 1525 839 gene locus_tag LOCUS_13900 1525 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 3207 1630 gene locus_tag LOCUS_13910 gene pruA 3207 1630 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259550.1 protein_id gnl|my_center|LOCUS_13910 4520 3267 gene locus_tag LOCUS_13920 4520 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 4665 5927 gene locus_tag LOCUS_13930 4665 5927 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064256.1 protein_id gnl|my_center|LOCUS_13930 6012 6291 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7531 6923 gene locus_tag LOCUS_13940 7531 6923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 8055 7531 gene locus_tag LOCUS_13950 8055 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 8852 8043 gene locus_tag LOCUS_13960 8852 8043 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545447.1 protein_id gnl|my_center|LOCUS_13960 9104 10012 gene locus_tag LOCUS_13970 9104 10012 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877324.1 protein_id gnl|my_center|LOCUS_13970 10324 10686 gene locus_tag LOCUS_13980 10324 10686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 11577 10687 gene locus_tag LOCUS_13990 11577 10687 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024341.1 protein_id gnl|my_center|LOCUS_13990 11789 12721 gene locus_tag LOCUS_14000 11789 12721 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_14000 12733 12966 gene locus_tag LOCUS_14010 12733 12966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 13075 14529 gene locus_tag LOCUS_14020 13075 14529 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878099.1 protein_id gnl|my_center|LOCUS_14020 14833 15147 gene locus_tag LOCUS_14030 14833 15147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 17247 15307 gene locus_tag LOCUS_14040 gene cooS 17247 15307 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_14040 18098 17313 gene locus_tag LOCUS_14050 18098 17313 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060971.1 protein_id gnl|my_center|LOCUS_14050 18290 18099 gene locus_tag LOCUS_14060 18290 18099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 18763 18356 gene locus_tag LOCUS_14070 18763 18356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 19080 19469 gene locus_tag LOCUS_14080 19080 19469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 19709 19461 gene locus_tag LOCUS_14090 19709 19461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 22007 19806 gene locus_tag LOCUS_14100 22007 19806 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013171298.1 protein_id gnl|my_center|LOCUS_14100 22480 22812 gene locus_tag LOCUS_14110 22480 22812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 22869 23159 gene locus_tag LOCUS_14120 22869 23159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 23341 23685 gene locus_tag LOCUS_14130 gene arsD 23341 23685 CDS product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890457.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence27 351 13 gene locus_tag LOCUS_14140 351 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 1348 1671 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2087 3388 gene locus_tag LOCUS_14150 2087 3388 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879167.1 protein_id gnl|my_center|LOCUS_14150 3388 3819 gene locus_tag LOCUS_14160 3388 3819 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_14160 4057 5676 gene locus_tag LOCUS_14170 4057 5676 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021335.1 protein_id gnl|my_center|LOCUS_14170 6022 6375 gene locus_tag LOCUS_14180 6022 6375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 6411 6737 gene locus_tag LOCUS_14190 6411 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 7009 8076 gene locus_tag LOCUS_14200 7009 8076 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888750.1 protein_id gnl|my_center|LOCUS_14200 8624 8833 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8882 9832 gene locus_tag LOCUS_14210 8882 9832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 10045 11391 gene locus_tag LOCUS_14220 10045 11391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 11396 12349 gene locus_tag LOCUS_14230 11396 12349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 12351 12815 gene locus_tag LOCUS_14240 12351 12815 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061215.1 protein_id gnl|my_center|LOCUS_14240 12812 14305 gene locus_tag LOCUS_14250 12812 14305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 14640 14350 gene locus_tag LOCUS_14260 14640 14350 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942208.1 protein_id gnl|my_center|LOCUS_14260 14846 15253 gene locus_tag LOCUS_14270 14846 15253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 15319 15630 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15640 16389 gene locus_tag LOCUS_14280 15640 16389 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876384.1 protein_id gnl|my_center|LOCUS_14280 16455 18350 gene locus_tag LOCUS_14290 16455 18350 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249735.1 protein_id gnl|my_center|LOCUS_14290 18453 19049 gene locus_tag LOCUS_14300 gene satP 18453 19049 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528527.1 protein_id gnl|my_center|LOCUS_14300 19810 19052 gene locus_tag LOCUS_14310 19810 19052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 19876 20658 gene locus_tag LOCUS_14320 19876 20658 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398526.1 protein_id gnl|my_center|LOCUS_14320 20988 20650 gene locus_tag LOCUS_14330 20988 20650 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023100.1 protein_id gnl|my_center|LOCUS_14330 21048 21680 gene locus_tag LOCUS_14340 21048 21680 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289436.1 protein_id gnl|my_center|LOCUS_14340 21682 22209 gene locus_tag LOCUS_14350 gene pyrE 21682 22209 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023240.1 protein_id gnl|my_center|LOCUS_14350 22206 22766 gene locus_tag LOCUS_14360 22206 22766 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903532.1 protein_id gnl|my_center|LOCUS_14360 23403 22708 gene locus_tag LOCUS_14370 23403 22708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 24258 23464 gene locus_tag LOCUS_14380 24258 23464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 24224 24424 gene locus_tag LOCUS_14390 24224 24424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 24430 24885 gene locus_tag LOCUS_14400 24430 24885 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061729.1 protein_id gnl|my_center|LOCUS_14400 >Feature sequence28 273 1118 gene locus_tag LOCUS_14410 273 1118 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020826.1 protein_id gnl|my_center|LOCUS_14410 1523 1167 gene locus_tag LOCUS_14420 1523 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1605 1856 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3251 4093 gene locus_tag LOCUS_14430 3251 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 5200 4136 gene locus_tag LOCUS_14440 5200 4136 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868366.1 protein_id gnl|my_center|LOCUS_14440 5801 5181 gene locus_tag LOCUS_14450 5801 5181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 6994 5825 gene locus_tag LOCUS_14460 6994 5825 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583323.1 protein_id gnl|my_center|LOCUS_14460 8289 6991 gene locus_tag LOCUS_14470 8289 6991 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868207.1 protein_id gnl|my_center|LOCUS_14470 8387 8755 gene locus_tag LOCUS_14480 8387 8755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 10255 8804 gene locus_tag LOCUS_14490 gene argH 10255 8804 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_14490 11628 10324 gene locus_tag LOCUS_14500 11628 10324 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869501.1 protein_id gnl|my_center|LOCUS_14500 11847 12863 gene locus_tag LOCUS_14510 gene argC 11847 12863 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876479.1 protein_id gnl|my_center|LOCUS_14510 13759 14013 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14143 14280 gene locus_tag LOCUS_14520 14143 14280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 14289 15116 gene locus_tag LOCUS_14530 gene argB 14289 15116 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869561.1 protein_id gnl|my_center|LOCUS_14530 15118 16296 gene locus_tag LOCUS_14540 15118 16296 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876950.1 protein_id gnl|my_center|LOCUS_14540 16723 16298 gene locus_tag LOCUS_14550 16723 16298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 16808 17034 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17662 17075 gene locus_tag LOCUS_14560 17662 17075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 17846 18529 gene locus_tag LOCUS_14570 17846 18529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 18534 18831 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19189 19509 gene locus_tag LOCUS_14580 19189 19509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 20175 20413 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21445 21792 gene locus_tag LOCUS_14590 21445 21792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 22610 21762 gene locus_tag LOCUS_14600 22610 21762 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_14600 22690 22614 gene locus_tag LOCUS_t00280 22690 22614 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 22786 23919 gene locus_tag LOCUS_14610 22786 23919 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229495.1 protein_id gnl|my_center|LOCUS_14610 23947 24765 gene locus_tag LOCUS_14620 23947 24765 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876749.1 protein_id gnl|my_center|LOCUS_14620 24814 24889 gene locus_tag LOCUS_t00290 24814 24889 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence29 2267 1068 gene locus_tag LOCUS_14630 2267 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 3622 2423 gene locus_tag LOCUS_14640 3622 2423 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496817.1 protein_id gnl|my_center|LOCUS_14640 5504 3798 gene locus_tag LOCUS_14650 gene glyS 5504 3798 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869726.1 protein_id gnl|my_center|LOCUS_14650 6371 5526 gene locus_tag LOCUS_14660 6371 5526 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023985.1 protein_id gnl|my_center|LOCUS_14660 6816 6373 gene locus_tag LOCUS_14670 6816 6373 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023986.1 protein_id gnl|my_center|LOCUS_14670 7877 6813 gene locus_tag LOCUS_14680 7877 6813 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023987.1 protein_id gnl|my_center|LOCUS_14680 8240 8407 gene locus_tag LOCUS_14690 8240 8407 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392923.1 protein_id gnl|my_center|LOCUS_14690 8512 9255 gene locus_tag LOCUS_14700 8512 9255 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146473.1 protein_id gnl|my_center|LOCUS_14700 9705 9268 gene locus_tag LOCUS_14710 9705 9268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 9866 9681 gene locus_tag LOCUS_14720 9866 9681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 10844 9909 gene locus_tag LOCUS_14730 10844 9909 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227955.1 protein_id gnl|my_center|LOCUS_14730 10970 11566 gene locus_tag LOCUS_14740 gene thpR 10970 11566 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876222.1 protein_id gnl|my_center|LOCUS_14740 11627 12103 gene locus_tag LOCUS_14750 11627 12103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 12100 12561 gene locus_tag LOCUS_14760 12100 12561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 12558 13025 gene locus_tag LOCUS_14770 12558 13025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 14161 12953 gene locus_tag LOCUS_14780 14161 12953 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101419.1 protein_id gnl|my_center|LOCUS_14780 14326 15516 gene locus_tag LOCUS_14790 gene nifS 14326 15516 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_14790 15497 15976 gene locus_tag LOCUS_14800 15497 15976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 16363 16133 gene locus_tag LOCUS_14810 16363 16133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 16569 16261 gene locus_tag LOCUS_14820 16569 16261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 16730 16527 gene locus_tag LOCUS_14830 16730 16527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 17390 18604 gene locus_tag LOCUS_14840 17390 18604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 18818 19279 gene locus_tag LOCUS_14850 18818 19279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 19560 20564 gene locus_tag LOCUS_14860 19560 20564 CDS product IS5-like element ISVpa3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021706804.1 protein_id gnl|my_center|LOCUS_14860 23227 20447 gene locus_tag LOCUS_14870 23227 20447 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061075.1 protein_id gnl|my_center|LOCUS_14870 23355 24263 gene locus_tag LOCUS_14880 23355 24263 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146595.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence30 25 1113 gene locus_tag LOCUS_14890 25 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1455 1153 gene locus_tag LOCUS_14900 1455 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1488 1724 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2163 1729 gene locus_tag LOCUS_14910 2163 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 3439 2324 gene locus_tag LOCUS_14920 3439 2324 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868467.1 protein_id gnl|my_center|LOCUS_14920 3921 3421 gene locus_tag LOCUS_14930 gene hacB 3921 3421 CDS product homoaconitase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876462.1 protein_id gnl|my_center|LOCUS_14930 5174 3921 gene locus_tag LOCUS_14940 gene leuC 5174 3921 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393737.1 protein_id gnl|my_center|LOCUS_14940 6766 5171 gene locus_tag LOCUS_14950 6766 5171 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877091.1 protein_id gnl|my_center|LOCUS_14950 7002 8432 gene locus_tag LOCUS_14960 7002 8432 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024491.1 protein_id gnl|my_center|LOCUS_14960 9088 8459 gene locus_tag LOCUS_14970 9088 8459 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545638.1 protein_id gnl|my_center|LOCUS_14970 9768 9085 gene locus_tag LOCUS_14980 gene queC 9768 9085 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272362.1 protein_id gnl|my_center|LOCUS_14980 10241 9765 gene locus_tag LOCUS_14990 10241 9765 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060999.1 protein_id gnl|my_center|LOCUS_14990 11088 10300 gene locus_tag LOCUS_15000 gene mtxX 11088 10300 CDS product methanogenesis marker protein Mmp4/MtxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065223.1 protein_id gnl|my_center|LOCUS_15000 11217 12410 gene locus_tag LOCUS_15010 11217 12410 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460662.1 protein_id gnl|my_center|LOCUS_15010 13386 12382 gene locus_tag LOCUS_15020 gene dph2 13386 12382 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020763.1 protein_id gnl|my_center|LOCUS_15020 13931 13434 gene locus_tag LOCUS_15030 13931 13434 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020241.1 protein_id gnl|my_center|LOCUS_15030 14401 14063 gene locus_tag LOCUS_15040 14401 14063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 14541 14879 gene locus_tag LOCUS_15050 14541 14879 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875703.1 protein_id gnl|my_center|LOCUS_15050 14918 15271 gene locus_tag LOCUS_15060 14918 15271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 15329 15703 gene locus_tag LOCUS_15070 15329 15703 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020348.1 protein_id gnl|my_center|LOCUS_15070 15654 15923 gene locus_tag LOCUS_15080 15654 15923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 16048 17310 gene locus_tag LOCUS_15090 gene serS 16048 17310 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023941.1 protein_id gnl|my_center|LOCUS_15090 18768 17365 gene locus_tag LOCUS_15100 gene mtaB 18768 17365 CDS product methanol--corrinoid protein co-methyltransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024271.1 protein_id gnl|my_center|LOCUS_15100 19572 18772 gene locus_tag LOCUS_15110 gene mtaC 19572 18772 CDS product methanol--corrinoid protein MtaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020507.1 protein_id gnl|my_center|LOCUS_15110 23957 19911 gene locus_tag LOCUS_15120 23957 19911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence31 1917 2213 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2734 2219 gene locus_tag LOCUS_15130 2734 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 2844 3761 gene locus_tag LOCUS_15140 2844 3761 CDS product presenilin family intramembrane aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065870.1 protein_id gnl|my_center|LOCUS_15140 3794 4435 gene locus_tag LOCUS_15150 3794 4435 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877484.1 protein_id gnl|my_center|LOCUS_15150 4540 4923 gene locus_tag LOCUS_15160 4540 4923 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875846.1 protein_id gnl|my_center|LOCUS_15160 5062 5361 gene locus_tag LOCUS_15170 5062 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 5766 5476 gene locus_tag LOCUS_15180 5766 5476 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869817.1 protein_id gnl|my_center|LOCUS_15180 5936 7345 gene locus_tag LOCUS_15190 5936 7345 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240506.1 protein_id gnl|my_center|LOCUS_15190 7364 8059 gene locus_tag LOCUS_15200 7364 8059 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249618.1 protein_id gnl|my_center|LOCUS_15200 8099 8893 gene locus_tag LOCUS_15210 8099 8893 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020802.1 protein_id gnl|my_center|LOCUS_15210 9498 8887 gene locus_tag LOCUS_15220 9498 8887 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990775.1 protein_id gnl|my_center|LOCUS_15220 11107 9596 gene locus_tag LOCUS_15230 11107 9596 CDS product F420-non-reducing hydrogenase subunit A, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545782.1 protein_id gnl|my_center|LOCUS_15230 12117 11104 gene locus_tag LOCUS_15240 12117 11104 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_15240 12625 12128 gene locus_tag LOCUS_15250 12625 12128 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876762.1 protein_id gnl|my_center|LOCUS_15250 15643 12629 gene locus_tag LOCUS_15260 15643 12629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 16082 16816 gene locus_tag LOCUS_15270 16082 16816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 16905 17939 gene locus_tag LOCUS_15280 gene ftsZ 16905 17939 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024152.1 protein_id gnl|my_center|LOCUS_15280 17942 18232 gene locus_tag LOCUS_15290 17942 18232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 18719 18938 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19230 19934 gene locus_tag LOCUS_15300 19230 19934 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876324.1 protein_id gnl|my_center|LOCUS_15300 20269 20508 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20524 20895 gene locus_tag LOCUS_15310 20524 20895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 20906 21673 gene locus_tag LOCUS_15320 gene rrp41 20906 21673 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250585.1 protein_id gnl|my_center|LOCUS_15320 21676 22449 gene locus_tag LOCUS_15330 gene rrp42 21676 22449 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250584.1 protein_id gnl|my_center|LOCUS_15330 22455 22739 gene locus_tag LOCUS_15340 22455 22739 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867396.1 protein_id gnl|my_center|LOCUS_15340 22736 22876 gene locus_tag LOCUS_15350 22736 22876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 22880 23122 gene locus_tag LOCUS_15360 22880 23122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence32 <1 1236 gene locus_tag LOCUS_15370 <1 1236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020772.1:DNA polymerase/3'-5' exonuclease PolX 1270 2220 gene locus_tag LOCUS_15380 1270 2220 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879529.1 protein_id gnl|my_center|LOCUS_15380 2223 3461 gene locus_tag LOCUS_15390 gene rbcL 2223 3461 CDS product type III ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870747.1 protein_id gnl|my_center|LOCUS_15390 4645 4895 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7290 6040 gene locus_tag LOCUS_15400 7290 6040 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029501.1 protein_id gnl|my_center|LOCUS_15400 8467 7337 gene locus_tag LOCUS_15410 gene dnaJ 8467 7337 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_15410 10334 8478 gene locus_tag LOCUS_15420 gene dnaK 10334 8478 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_15420 10864 10340 gene locus_tag LOCUS_15430 10864 10340 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876906.1 protein_id gnl|my_center|LOCUS_15430 12576 10945 gene locus_tag LOCUS_15440 gene thsB 12576 10945 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020145.1 protein_id gnl|my_center|LOCUS_15440 12811 13278 gene locus_tag LOCUS_15450 12811 13278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 13785 13279 gene locus_tag LOCUS_15460 13785 13279 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496550.1 protein_id gnl|my_center|LOCUS_15460 14043 15251 gene locus_tag LOCUS_15470 gene pan 14043 15251 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879468.1 protein_id gnl|my_center|LOCUS_15470 15423 15686 gene locus_tag LOCUS_15480 15423 15686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 16450 15683 gene locus_tag LOCUS_15490 16450 15683 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879698.1 protein_id gnl|my_center|LOCUS_15490 16534 16866 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17545 17943 gene locus_tag LOCUS_15500 17545 17943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15500 18032 17958 gene locus_tag LOCUS_t00300 18032 17958 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 18148 18675 gene locus_tag LOCUS_15510 18148 18675 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496828.1 protein_id gnl|my_center|LOCUS_15510 18698 19480 gene locus_tag LOCUS_15520 18698 19480 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_15520 20244 19477 gene locus_tag LOCUS_15530 20244 19477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 20365 20673 gene locus_tag LOCUS_15540 20365 20673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 20657 21064 gene locus_tag LOCUS_15550 20657 21064 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876523.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence33 1377 1671 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1786 2520 gene locus_tag LOCUS_15560 1786 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 2576 2929 gene locus_tag LOCUS_15570 gene pth2 2576 2929 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251250.1 protein_id gnl|my_center|LOCUS_15570 2932 3501 gene locus_tag LOCUS_15580 2932 3501 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061023.1 protein_id gnl|my_center|LOCUS_15580 4127 3498 gene locus_tag LOCUS_15590 4127 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 4498 4926 gene locus_tag LOCUS_15600 4498 4926 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876681.1 protein_id gnl|my_center|LOCUS_15600 4932 5522 gene locus_tag LOCUS_15610 4932 5522 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021279.1 protein_id gnl|my_center|LOCUS_15610 5553 7751 gene locus_tag LOCUS_15620 5553 7751 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060960.1 protein_id gnl|my_center|LOCUS_15620 8036 8342 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8367 9230 gene locus_tag LOCUS_15630 8367 9230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 9267 9578 gene locus_tag LOCUS_15640 gene rpsJ 9267 9578 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878438.1 protein_id gnl|my_center|LOCUS_15640 9683 10561 gene locus_tag LOCUS_15650 9683 10561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 10684 11541 gene locus_tag LOCUS_15660 10684 11541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 11614 13260 gene locus_tag LOCUS_15670 gene ilvD 11614 13260 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061057.1 protein_id gnl|my_center|LOCUS_15670 13338 13412 gene locus_tag LOCUS_t00310 13338 13412 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 14016 13600 gene locus_tag LOCUS_15680 14016 13600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 15147 14656 gene locus_tag LOCUS_15690 15147 14656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 16268 15237 gene locus_tag LOCUS_15700 16268 15237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 16897 17103 gene locus_tag LOCUS_15710 16897 17103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15710 17954 19120 gene locus_tag LOCUS_15720 17954 19120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 20255 19137 gene locus_tag LOCUS_15730 20255 19137 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107209.1 protein_id gnl|my_center|LOCUS_15730 21110 20328 gene locus_tag LOCUS_15740 21110 20328 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065769.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence34 5392 3821 gene locus_tag LOCUS_15750 5392 3821 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029859.1 protein_id gnl|my_center|LOCUS_15750 5514 6329 gene locus_tag LOCUS_15760 5514 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 6441 7133 gene locus_tag LOCUS_15770 6441 7133 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943860.1 protein_id gnl|my_center|LOCUS_15770 7270 8289 gene locus_tag LOCUS_15780 7270 8289 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_15780 8301 9419 gene locus_tag LOCUS_15790 gene trpD 8301 9419 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022929.1 protein_id gnl|my_center|LOCUS_15790 9888 9499 gene locus_tag LOCUS_15800 9888 9499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 9982 10179 gene locus_tag LOCUS_15810 9982 10179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 11330 10167 gene locus_tag LOCUS_15820 11330 10167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 12430 11327 gene locus_tag LOCUS_15830 12430 11327 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066036.1 protein_id gnl|my_center|LOCUS_15830 13673 12432 gene locus_tag LOCUS_15840 gene larA 13673 12432 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860456.1 protein_id gnl|my_center|LOCUS_15840 13802 14021 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14604 14044 gene locus_tag LOCUS_15850 14604 14044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 14689 15978 gene locus_tag LOCUS_15860 14689 15978 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023306.1 protein_id gnl|my_center|LOCUS_15860 16068 16616 gene locus_tag LOCUS_15870 16068 16616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 17662 16628 gene locus_tag LOCUS_15880 17662 16628 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147112.1 protein_id gnl|my_center|LOCUS_15880 18393 17734 gene locus_tag LOCUS_15890 18393 17734 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064970.1 protein_id gnl|my_center|LOCUS_15890 19089 18424 gene locus_tag LOCUS_15900 19089 18424 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024122.1 protein_id gnl|my_center|LOCUS_15900 >Feature sequence35 1154 1330 gene locus_tag LOCUS_15910 1154 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 2320 1919 gene locus_tag LOCUS_15920 2320 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 2252 2575 gene locus_tag LOCUS_15930 2252 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 2575 3213 gene locus_tag LOCUS_15940 2575 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 3206 4093 gene locus_tag LOCUS_15950 gene map 3206 4093 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879334.1 protein_id gnl|my_center|LOCUS_15950 5142 4393 gene locus_tag LOCUS_15960 5142 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 5266 5567 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7779 6394 gene locus_tag LOCUS_15970 7779 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 8499 8002 gene locus_tag LOCUS_15980 8499 8002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 8975 8496 gene locus_tag LOCUS_15990 8975 8496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 9765 9070 gene locus_tag LOCUS_16000 9765 9070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 9964 11037 gene locus_tag LOCUS_16010 9964 11037 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868404.1 protein_id gnl|my_center|LOCUS_16010 11157 11723 gene locus_tag LOCUS_16020 11157 11723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 11808 12941 gene locus_tag LOCUS_16030 11808 12941 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728183.1 protein_id gnl|my_center|LOCUS_16030 13387 13001 gene locus_tag LOCUS_16040 13387 13001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 13533 14468 gene locus_tag LOCUS_16050 13533 14468 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064922.1 protein_id gnl|my_center|LOCUS_16050 16060 14867 gene locus_tag LOCUS_16060 16060 14867 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021498.1 protein_id gnl|my_center|LOCUS_16060 16229 16062 gene locus_tag LOCUS_16070 16229 16062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 17793 16240 gene locus_tag LOCUS_16080 17793 16240 CDS product 7,8-dihydro-6-hydroxymethylpterin dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870124.1 protein_id gnl|my_center|LOCUS_16080 17872 18597 gene locus_tag LOCUS_16090 17872 18597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence36 2205 1207 gene locus_tag LOCUS_16100 2205 1207 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250141.1 protein_id gnl|my_center|LOCUS_16100 2259 2963 gene locus_tag LOCUS_16110 2259 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 3015 3458 gene locus_tag LOCUS_16120 gene lrpB 3015 3458 CDS product transcriptional regulator LrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246612.1 protein_id gnl|my_center|LOCUS_16120 3998 3459 gene locus_tag LOCUS_16130 3998 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 4817 4134 gene locus_tag LOCUS_16140 4817 4134 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060758.1 protein_id gnl|my_center|LOCUS_16140 4914 7523 gene locus_tag LOCUS_16150 gene mgtA 4914 7523 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948085.1 protein_id gnl|my_center|LOCUS_16150 8201 7533 gene locus_tag LOCUS_16160 8201 7533 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933408.1 protein_id gnl|my_center|LOCUS_16160 8320 9822 gene locus_tag LOCUS_16170 8320 9822 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392725.1 protein_id gnl|my_center|LOCUS_16170 9937 10893 gene locus_tag LOCUS_16180 9937 10893 CDS product EF-Tu/IF-2/RF-3 family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869822.1 protein_id gnl|my_center|LOCUS_16180 10934 11284 gene locus_tag LOCUS_16190 10934 11284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 11363 11782 gene locus_tag LOCUS_16200 11363 11782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 12026 12262 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12364 12660 gene locus_tag LOCUS_16210 12364 12660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 15491 12873 gene locus_tag LOCUS_16220 15491 12873 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272585.1 protein_id gnl|my_center|LOCUS_16220 15757 17769 gene locus_tag LOCUS_16230 15757 17769 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868460.1 protein_id gnl|my_center|LOCUS_16230 >Feature sequence37 178 519 gene locus_tag LOCUS_16240 178 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 883 572 gene locus_tag LOCUS_16250 883 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 1295 1026 gene locus_tag LOCUS_16260 1295 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16260 1416 2537 gene locus_tag LOCUS_16270 gene arsB 1416 2537 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393695.1 protein_id gnl|my_center|LOCUS_16270 2540 2746 gene locus_tag LOCUS_16280 2540 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 2760 3371 gene locus_tag LOCUS_16290 2760 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 3798 3592 gene locus_tag LOCUS_16300 3798 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 3767 4438 gene locus_tag LOCUS_16310 3767 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 5509 4460 gene locus_tag LOCUS_16320 5509 4460 CDS product DUF2117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990783.1 protein_id gnl|my_center|LOCUS_16320 6681 5545 gene locus_tag LOCUS_16330 6681 5545 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020066.1 protein_id gnl|my_center|LOCUS_16330 7525 6722 gene locus_tag LOCUS_16340 7525 6722 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772043.1 protein_id gnl|my_center|LOCUS_16340 7619 7984 gene locus_tag LOCUS_16350 7619 7984 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256234.1 protein_id gnl|my_center|LOCUS_16350 8530 7985 gene locus_tag LOCUS_16360 gene cobO 8530 7985 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392864.1 protein_id gnl|my_center|LOCUS_16360 9795 8563 gene locus_tag LOCUS_16370 9795 8563 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867288.1 protein_id gnl|my_center|LOCUS_16370 10831 9797 gene locus_tag LOCUS_16380 10831 9797 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546404.1 protein_id gnl|my_center|LOCUS_16380 11510 10842 gene locus_tag LOCUS_16390 11510 10842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 11887 11681 gene locus_tag LOCUS_16400 11887 11681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 12045 12731 gene locus_tag LOCUS_16410 12045 12731 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892625.1 protein_id gnl|my_center|LOCUS_16410 13300 12728 gene locus_tag LOCUS_16420 13300 12728 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393271.1 protein_id gnl|my_center|LOCUS_16420 13575 14504 gene locus_tag LOCUS_16430 13575 14504 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028801.1 protein_id gnl|my_center|LOCUS_16430 14516 15241 gene locus_tag LOCUS_16440 gene cbiQ 14516 15241 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496721.1 protein_id gnl|my_center|LOCUS_16440 15286 16056 gene locus_tag LOCUS_16450 15286 16056 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877312.1 protein_id gnl|my_center|LOCUS_16450 16612 17019 gene locus_tag LOCUS_16460 16612 17019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 >Feature sequence38 2281 1073 gene locus_tag LOCUS_16470 2281 1073 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014128488.1 protein_id gnl|my_center|LOCUS_16470 4294 2315 gene locus_tag LOCUS_16480 4294 2315 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403165.1 protein_id gnl|my_center|LOCUS_16480 5252 4251 gene locus_tag LOCUS_16490 5252 4251 CDS product TIGR03885 family FMN-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969667.1 protein_id gnl|my_center|LOCUS_16490 5640 6737 gene locus_tag LOCUS_16500 5640 6737 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083283.1 protein_id gnl|my_center|LOCUS_16500 7294 6734 gene locus_tag LOCUS_16510 7294 6734 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722200.1 protein_id gnl|my_center|LOCUS_16510 7368 8669 gene locus_tag LOCUS_16520 7368 8669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 8720 9061 gene locus_tag LOCUS_16530 8720 9061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 9058 9726 gene locus_tag LOCUS_16540 9058 9726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559189.1 protein_id gnl|my_center|LOCUS_16540 9903 11126 gene locus_tag LOCUS_16550 9903 11126 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459673.1 protein_id gnl|my_center|LOCUS_16550 11166 11540 gene locus_tag LOCUS_16560 11166 11540 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148208718.1 protein_id gnl|my_center|LOCUS_16560 12463 11537 gene locus_tag LOCUS_16570 12463 11537 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805026.1 protein_id gnl|my_center|LOCUS_16570 12590 14989 gene locus_tag LOCUS_16580 12590 14989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 15562 15095 gene locus_tag LOCUS_16590 15562 15095 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022180.1 protein_id gnl|my_center|LOCUS_16590 15778 15703 gene locus_tag LOCUS_t00320 15778 15703 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence39 1913 327 gene locus_tag LOCUS_16600 gene secY 1913 327 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021124.1 protein_id gnl|my_center|LOCUS_16600 2352 1927 gene locus_tag LOCUS_16610 2352 1927 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875667.1 protein_id gnl|my_center|LOCUS_16610 2826 2362 gene locus_tag LOCUS_16620 gene rpmD 2826 2362 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875666.1 protein_id gnl|my_center|LOCUS_16620 3524 2832 gene locus_tag LOCUS_16630 gene rpsE 3524 2832 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879398.1 protein_id gnl|my_center|LOCUS_16630 4027 3527 gene locus_tag LOCUS_16640 4027 3527 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875664.1 protein_id gnl|my_center|LOCUS_16640 4490 4029 gene locus_tag LOCUS_16650 4490 4029 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496504.1 protein_id gnl|my_center|LOCUS_16650 5188 4487 gene locus_tag LOCUS_16660 5188 4487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 5736 5185 gene locus_tag LOCUS_16670 5736 5185 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875661.1 protein_id gnl|my_center|LOCUS_16670 6135 5746 gene locus_tag LOCUS_16680 6135 5746 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869971.1 protein_id gnl|my_center|LOCUS_16680 6800 6288 gene locus_tag LOCUS_16690 6800 6288 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013673.1 protein_id gnl|my_center|LOCUS_16690 7507 6797 gene locus_tag LOCUS_16700 7507 6797 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875657.1 protein_id gnl|my_center|LOCUS_16700 7881 7504 gene locus_tag LOCUS_16710 gene rplX 7881 7504 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846306.1 protein_id gnl|my_center|LOCUS_16710 8290 7892 gene locus_tag LOCUS_16720 gene rpl14p 8290 7892 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021111.1 protein_id gnl|my_center|LOCUS_16720 8625 8296 gene locus_tag LOCUS_16730 8625 8296 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869965.1 protein_id gnl|my_center|LOCUS_16730 8867 8631 gene locus_tag LOCUS_16740 8867 8631 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869964.1 protein_id gnl|my_center|LOCUS_16740 9190 8891 gene locus_tag LOCUS_16750 gene yciH 9190 8891 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875652.1 protein_id gnl|my_center|LOCUS_16750 9393 9190 gene locus_tag LOCUS_16760 gene rpmC 9393 9190 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250486.1 protein_id gnl|my_center|LOCUS_16760 10151 9393 gene locus_tag LOCUS_16770 10151 9393 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869961.1 protein_id gnl|my_center|LOCUS_16770 10597 10151 gene locus_tag LOCUS_16780 gene rplV 10597 10151 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496502.1 protein_id gnl|my_center|LOCUS_16780 11070 10609 gene locus_tag LOCUS_16790 gene rpsS 11070 10609 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879414.1 protein_id gnl|my_center|LOCUS_16790 11767 11075 gene locus_tag LOCUS_16800 11767 11075 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875647.1 protein_id gnl|my_center|LOCUS_16800 12067 11777 gene locus_tag LOCUS_16810 12067 11777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 12831 12061 gene locus_tag LOCUS_16820 gene rpl4p 12831 12061 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879417.1 protein_id gnl|my_center|LOCUS_16820 13838 12837 gene locus_tag LOCUS_16830 gene rpl3p 13838 12837 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879418.1 protein_id gnl|my_center|LOCUS_16830 >Feature sequence40 61 720 gene locus_tag LOCUS_16840 61 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 725 1951 gene locus_tag LOCUS_16850 725 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 1948 4899 gene locus_tag LOCUS_16860 1948 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 2184 2472 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4896 5474 gene locus_tag LOCUS_16870 4896 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 5471 6751 gene locus_tag LOCUS_16880 5471 6751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 6866 8173 gene locus_tag LOCUS_16890 6866 8173 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057316.1 protein_id gnl|my_center|LOCUS_16890 8688 8104 gene locus_tag LOCUS_16900 8688 8104 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033534649.1 protein_id gnl|my_center|LOCUS_16900 9106 8711 gene locus_tag LOCUS_16910 9106 8711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 9945 9166 gene locus_tag LOCUS_16920 9945 9166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 11511 10162 gene locus_tag LOCUS_16930 11511 10162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 12649 11645 gene locus_tag LOCUS_16940 12649 11645 CDS product MtaA/CmuA family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020204.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence41 204 4 gene locus_tag LOCUS_16950 204 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 504 389 gene locus_tag LOCUS_r00020 504 389 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 770 1046 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2670 2272 gene locus_tag LOCUS_16960 2670 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 2908 3489 gene locus_tag LOCUS_16970 2908 3489 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268114.1 protein_id gnl|my_center|LOCUS_16970 4339 3542 gene locus_tag LOCUS_16980 4339 3542 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061059.1 protein_id gnl|my_center|LOCUS_16980 4888 5201 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5283 7484 gene locus_tag LOCUS_16990 5283 7484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 7689 8687 gene locus_tag LOCUS_17000 7689 8687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 8997 8767 gene locus_tag LOCUS_17010 8997 8767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 9007 9292 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10317 9715 gene locus_tag LOCUS_17020 10317 9715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 11928 10369 gene locus_tag LOCUS_17030 11928 10369 CDS product thermostable carboxypeptidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174078.1 protein_id gnl|my_center|LOCUS_17030 >Feature sequence42 1803 235 gene locus_tag LOCUS_17040 1803 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 2071 2349 gene locus_tag LOCUS_17050 2071 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 2520 2230 gene locus_tag LOCUS_17060 2520 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 2952 3434 gene locus_tag LOCUS_17070 2952 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 4608 3442 gene locus_tag LOCUS_17080 4608 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 4631 5794 gene locus_tag LOCUS_17090 4631 5794 CDS product MtaA/CmuA family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393827.1 protein_id gnl|my_center|LOCUS_17090 6264 6073 gene locus_tag LOCUS_17100 6264 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 6215 7906 gene locus_tag LOCUS_17110 6215 7906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 9880 7961 gene locus_tag LOCUS_17120 9880 7961 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_17120 10532 10275 gene locus_tag LOCUS_17130 10532 10275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 10764 10435 gene locus_tag LOCUS_17140 10764 10435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 10968 10768 gene locus_tag LOCUS_17150 10968 10768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 11985 11308 gene locus_tag LOCUS_17160 11985 11308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 >Feature sequence43 58 810 gene locus_tag LOCUS_17170 58 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 1810 797 gene locus_tag LOCUS_17180 gene rtcA 1810 797 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878932.1 protein_id gnl|my_center|LOCUS_17180 3536 1803 gene locus_tag LOCUS_17190 3536 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 3546 3879 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5190 4708 gene locus_tag LOCUS_17200 5190 4708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 5561 5722 gene locus_tag LOCUS_17210 5561 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 6358 7059 gene locus_tag LOCUS_17220 6358 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 7437 7252 gene locus_tag LOCUS_17230 7437 7252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 7969 7613 gene locus_tag LOCUS_17240 7969 7613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17240 7919 8059 gene locus_tag LOCUS_17250 7919 8059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 8280 8208 gene locus_tag LOCUS_t00330 8280 8208 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8588 8334 gene locus_tag LOCUS_17260 8588 8334 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061044.1 protein_id gnl|my_center|LOCUS_17260 8979 8623 gene locus_tag LOCUS_17270 8979 8623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 9226 9059 gene locus_tag LOCUS_17280 9226 9059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 9544 9350 gene locus_tag LOCUS_17290 9544 9350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 9780 9526 gene locus_tag LOCUS_17300 9780 9526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 9877 11169 gene locus_tag LOCUS_17310 gene asnS 9877 11169 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249710.1 protein_id gnl|my_center|LOCUS_17310 12182 11160 gene locus_tag LOCUS_17320 12182 11160 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339538.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence44 199 412 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1879 1364 gene locus_tag LOCUS_17330 1879 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 2355 4202 gene locus_tag LOCUS_17340 2355 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17340 5401 4385 gene locus_tag LOCUS_17350 5401 4385 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358407.1 protein_id gnl|my_center|LOCUS_17350 6819 5422 gene locus_tag LOCUS_17360 6819 5422 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948160.1 protein_id gnl|my_center|LOCUS_17360 8144 7116 gene locus_tag LOCUS_17370 8144 7116 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583099.1 protein_id gnl|my_center|LOCUS_17370 9279 9944 gene locus_tag LOCUS_17380 9279 9944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17380 10167 10760 gene locus_tag LOCUS_17390 10167 10760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17390 10847 11086 gene locus_tag LOCUS_17400 10847 11086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 11566 11087 gene locus_tag LOCUS_17410 11566 11087 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021795.1 protein_id gnl|my_center|LOCUS_17410 11801 11589 gene locus_tag LOCUS_17420 11801 11589 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879289.1 protein_id gnl|my_center|LOCUS_17420 >Feature sequence45 1914 127 gene locus_tag LOCUS_17430 1914 127 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048250.1 protein_id gnl|my_center|LOCUS_17430 2070 2288 gene locus_tag LOCUS_17440 2070 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 2936 2289 gene locus_tag LOCUS_17450 2936 2289 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933918.1 protein_id gnl|my_center|LOCUS_17450 3321 2983 gene locus_tag LOCUS_17460 3321 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 3418 3732 gene locus_tag LOCUS_17470 3418 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 3779 4186 gene locus_tag LOCUS_17480 3779 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 4211 4390 gene locus_tag LOCUS_17490 4211 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 5728 4400 gene locus_tag LOCUS_17500 5728 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 5979 7211 gene locus_tag LOCUS_17510 5979 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 7773 7282 gene locus_tag LOCUS_17520 7773 7282 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705794.1 protein_id gnl|my_center|LOCUS_17520 7883 8830 gene locus_tag LOCUS_17530 7883 8830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 10493 8835 gene locus_tag LOCUS_17540 10493 8835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 11049 10690 gene locus_tag LOCUS_17550 11049 10690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 11633 11100 gene locus_tag LOCUS_17560 11633 11100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 >Feature sequence46 <1 630 gene locus_tag LOCUS_17570 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026914.1:class I SAM-dependent methyltransferase 956 2371 gene locus_tag LOCUS_17580 956 2371 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392725.1 protein_id gnl|my_center|LOCUS_17580 2473 2781 gene locus_tag LOCUS_17590 2473 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 4169 3294 gene locus_tag LOCUS_17600 4169 3294 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943396.1 protein_id gnl|my_center|LOCUS_17600 4418 4245 gene locus_tag LOCUS_17610 4418 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 4619 5368 gene locus_tag LOCUS_17620 4619 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 5417 6799 gene locus_tag LOCUS_17630 5417 6799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 7018 7200 gene locus_tag LOCUS_17640 7018 7200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 7419 7745 gene locus_tag LOCUS_17650 7419 7745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 7822 8119 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8368 8174 gene locus_tag LOCUS_17660 8368 8174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 8430 9134 gene locus_tag LOCUS_17670 8430 9134 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256184.1 protein_id gnl|my_center|LOCUS_17670 9127 9408 gene locus_tag LOCUS_17680 9127 9408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 10116 9451 gene locus_tag LOCUS_17690 10116 9451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 >Feature sequence47 1181 12 gene locus_tag LOCUS_17700 1181 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 3003 1255 gene locus_tag LOCUS_17710 3003 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 3302 3003 gene locus_tag LOCUS_17720 3302 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 3502 3299 gene locus_tag LOCUS_17730 3502 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 3674 3504 gene locus_tag LOCUS_17740 3674 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 4111 3926 gene locus_tag LOCUS_17750 4111 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 4203 4373 gene locus_tag LOCUS_17760 4203 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 5244 4885 gene locus_tag LOCUS_17770 5244 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 7263 5245 gene locus_tag LOCUS_17780 7263 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 7472 7260 gene locus_tag LOCUS_17790 7472 7260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 7793 8197 gene locus_tag LOCUS_17800 7793 8197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 8512 8267 gene locus_tag LOCUS_17810 8512 8267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 9335 9472 gene locus_tag LOCUS_17820 9335 9472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 10256 9624 gene locus_tag LOCUS_17830 10256 9624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence48 <1 632 gene locus_tag LOCUS_17840 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249596.1:bifunctional oligoribonuclease/PAP phosphatase NrnA 1679 633 gene locus_tag LOCUS_17850 1679 633 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846716.1 protein_id gnl|my_center|LOCUS_17850 1736 2035 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2187 3638 gene locus_tag LOCUS_17860 gene glnA 2187 3638 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_17860 3984 3703 gene locus_tag LOCUS_17870 3984 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 5357 3981 gene locus_tag LOCUS_17880 5357 3981 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496570.1 protein_id gnl|my_center|LOCUS_17880 5404 5617 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5665 6657 gene locus_tag LOCUS_17890 5665 6657 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066004.1 protein_id gnl|my_center|LOCUS_17890 6670 6990 gene locus_tag LOCUS_17900 6670 6990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 7879 7217 gene locus_tag LOCUS_17910 7879 7217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 8250 8966 gene locus_tag LOCUS_17920 8250 8966 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990768.1 protein_id gnl|my_center|LOCUS_17920 9924 8968 gene locus_tag LOCUS_17930 9924 8968 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869643.1 protein_id gnl|my_center|LOCUS_17930 10447 9905 gene locus_tag LOCUS_17940 10447 9905 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870161.1 protein_id gnl|my_center|LOCUS_17940 >Feature sequence49 120 473 gene locus_tag LOCUS_17950 120 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 549 1841 gene locus_tag LOCUS_17960 549 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 1889 2131 gene locus_tag LOCUS_17970 1889 2131 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251002.1 protein_id gnl|my_center|LOCUS_17970 2335 2964 gene locus_tag LOCUS_17980 2335 2964 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545227.1 protein_id gnl|my_center|LOCUS_17980 3912 3007 gene locus_tag LOCUS_17990 gene nadA 3912 3007 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020997.1 protein_id gnl|my_center|LOCUS_17990 4917 5303 gene locus_tag LOCUS_18000 4917 5303 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060955.1 protein_id gnl|my_center|LOCUS_18000 5380 5679 gene locus_tag LOCUS_18010 5380 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 5873 6358 gene locus_tag LOCUS_18020 5873 6358 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871083.1 protein_id gnl|my_center|LOCUS_18020 6355 7470 gene locus_tag LOCUS_18030 6355 7470 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146544.1 protein_id gnl|my_center|LOCUS_18030 7590 8816 gene locus_tag LOCUS_18040 7590 8816 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775353.1 protein_id gnl|my_center|LOCUS_18040 9355 8813 gene locus_tag LOCUS_18050 9355 8813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 10639 9449 gene locus_tag LOCUS_18060 10639 9449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 >Feature sequence50 1128 151 gene locus_tag LOCUS_18070 gene hemB 1128 151 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940811.1 protein_id gnl|my_center|LOCUS_18070 2386 1085 gene locus_tag LOCUS_18080 gene hemA 2386 1085 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020626.1 protein_id gnl|my_center|LOCUS_18080 2997 2383 gene locus_tag LOCUS_18090 2997 2383 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020625.1 protein_id gnl|my_center|LOCUS_18090 4302 3199 gene locus_tag LOCUS_18100 4302 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 4992 4408 gene locus_tag LOCUS_18110 4992 4408 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020569.1 protein_id gnl|my_center|LOCUS_18110 5239 5616 gene locus_tag LOCUS_18120 gene cfbA 5239 5616 CDS product sirohydrochlorin nickelochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023539.1 protein_id gnl|my_center|LOCUS_18120 5618 6904 gene locus_tag LOCUS_18130 gene cfbE 5618 6904 CDS product coenzyme F430 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023538.1 protein_id gnl|my_center|LOCUS_18130 6901 7986 gene locus_tag LOCUS_18140 gene cfbD 6901 7986 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877132.1 protein_id gnl|my_center|LOCUS_18140 7977 8762 gene locus_tag LOCUS_18150 gene cfbC 7977 8762 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase ATP-dependent reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023535.1 protein_id gnl|my_center|LOCUS_18150 8762 10096 gene locus_tag LOCUS_18160 gene cfbB 8762 10096 CDS product Ni-sirohydrochlorin a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877070.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence51 227 480 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 631 2049 gene locus_tag LOCUS_18170 gene glmS 631 2049 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022962.1 protein_id gnl|my_center|LOCUS_18170 3033 2050 gene locus_tag LOCUS_18180 3033 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 3883 3080 gene locus_tag LOCUS_18190 3883 3080 CDS product C15orf41 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065051.1 protein_id gnl|my_center|LOCUS_18190 4509 4793 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4809 5231 gene locus_tag LOCUS_18200 4809 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 5482 5228 gene locus_tag LOCUS_18210 5482 5228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 5636 5891 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7419 8078 gene locus_tag LOCUS_18220 7419 8078 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877750.1 protein_id gnl|my_center|LOCUS_18220 8115 8672 gene locus_tag LOCUS_18230 gene hpt 8115 8672 CDS product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871179.1 protein_id gnl|my_center|LOCUS_18230 8781 9039 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence52 124 459 gene locus_tag LOCUS_18240 124 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 490 1791 gene locus_tag LOCUS_18250 490 1791 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066507.1 protein_id gnl|my_center|LOCUS_18250 1897 3057 gene locus_tag LOCUS_18260 1897 3057 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_18260 3139 4404 gene locus_tag LOCUS_18270 3139 4404 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878404.1 protein_id gnl|my_center|LOCUS_18270 5045 4398 gene locus_tag LOCUS_18280 5045 4398 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202734.1 protein_id gnl|my_center|LOCUS_18280 6202 5090 gene locus_tag LOCUS_18290 gene ftsY 6202 5090 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877216.1 protein_id gnl|my_center|LOCUS_18290 6631 6212 gene locus_tag LOCUS_18300 6631 6212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 6861 6628 gene locus_tag LOCUS_18310 6861 6628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 6797 7771 gene locus_tag LOCUS_18320 6797 7771 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391984.1 protein_id gnl|my_center|LOCUS_18320 8541 7744 gene locus_tag LOCUS_18330 8541 7744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 9827 8607 gene locus_tag LOCUS_18340 gene priS 9827 8607 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020695.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence53 <1 2266 gene locus_tag LOCUS_18350 <1 2266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879218.1:DNA polymerase II large subunit 3199 2360 gene locus_tag LOCUS_18360 3199 2360 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875678.1 protein_id gnl|my_center|LOCUS_18360 3592 3209 gene locus_tag LOCUS_18370 3592 3209 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879772.1 protein_id gnl|my_center|LOCUS_18370 4260 3595 gene locus_tag LOCUS_18380 4260 3595 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869685.1 protein_id gnl|my_center|LOCUS_18380 4860 4297 gene locus_tag LOCUS_18390 4860 4297 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902812.1 protein_id gnl|my_center|LOCUS_18390 7725 5020 gene locus_tag LOCUS_18400 gene alaS 7725 5020 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250518.1 protein_id gnl|my_center|LOCUS_18400 8183 8321 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8612 8821 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8815 9148 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcatccccactcgcgtggggaacag 9141 9351 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9344 >9670 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcatccccactcgcgtggggaacag >Feature sequence54 1693 431 gene locus_tag LOCUS_18410 1693 431 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249880.1 protein_id gnl|my_center|LOCUS_18410 1813 3498 gene locus_tag LOCUS_18420 1813 3498 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250359.1 protein_id gnl|my_center|LOCUS_18420 3648 5753 gene locus_tag LOCUS_18430 3648 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 6200 5748 gene locus_tag LOCUS_18440 6200 5748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 6807 6244 gene locus_tag LOCUS_18450 6807 6244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 6820 7061 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9020 8364 gene locus_tag LOCUS_18460 9020 8364 CDS product DtxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330364.1 protein_id gnl|my_center|LOCUS_18460 >Feature sequence55 727 2268 gene locus_tag LOCUS_18470 727 2268 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879532.1 protein_id gnl|my_center|LOCUS_18470 3831 2254 gene locus_tag LOCUS_18480 3831 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 3834 4138 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4832 4593 gene locus_tag LOCUS_18490 4832 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 5589 4837 gene locus_tag LOCUS_18500 5589 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 5853 7298 gene locus_tag LOCUS_18510 5853 7298 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225752.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence56 667 254 gene locus_tag LOCUS_18520 gene tcrA 667 254 CDS product acid-responsive two-component system response regulator TcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970747.1 protein_id gnl|my_center|LOCUS_18520 1908 667 gene locus_tag LOCUS_18530 1908 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 2896 1847 gene locus_tag LOCUS_18540 2896 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 3643 3116 gene locus_tag LOCUS_18550 3643 3116 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023860.1 protein_id gnl|my_center|LOCUS_18550 3962 4180 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6293 4722 gene locus_tag LOCUS_18560 6293 4722 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021335.1 protein_id gnl|my_center|LOCUS_18560 7035 6562 gene locus_tag LOCUS_18570 7035 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 7161 7340 gene locus_tag LOCUS_18580 7161 7340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 7619 7878 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7951 8316 gene locus_tag LOCUS_18590 7951 8316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence57 138 465 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 496 1407 gene locus_tag LOCUS_18600 496 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 2298 1426 gene locus_tag LOCUS_18610 2298 1426 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061282.1 protein_id gnl|my_center|LOCUS_18610 3074 2406 gene locus_tag LOCUS_18620 3074 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 3269 3709 gene locus_tag LOCUS_18630 3269 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 5673 3715 gene locus_tag LOCUS_18640 5673 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 6095 5778 gene locus_tag LOCUS_18650 6095 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 6308 6694 gene locus_tag LOCUS_18660 6308 6694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 7598 6744 gene locus_tag LOCUS_18670 7598 6744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 7752 8017 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence58 <1 1672 gene locus_tag LOCUS_18680 <1 1672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868771.1:valine--tRNA ligase 1764 1837 gene locus_tag LOCUS_t00340 1764 1837 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2884 2003 gene locus_tag LOCUS_18690 2884 2003 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228395.1 protein_id gnl|my_center|LOCUS_18690 3392 3210 gene locus_tag LOCUS_18700 3392 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 3414 3813 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4485 4717 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6441 6729 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence59 1001 1252 gene locus_tag LOCUS_18710 1001 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 1357 2778 gene locus_tag LOCUS_18720 1357 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 3274 2759 gene locus_tag LOCUS_18730 3274 2759 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762040.1 protein_id gnl|my_center|LOCUS_18730 3279 3533 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5454 4210 gene locus_tag LOCUS_18740 5454 4210 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174245.1 protein_id gnl|my_center|LOCUS_18740 6479 5499 gene locus_tag LOCUS_18750 6479 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 >Feature sequence60 <1 758 gene locus_tag LOCUS_18760 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250698.1:inosine/xanthosine triphosphatase 973 755 gene locus_tag LOCUS_18770 973 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 2892 1018 gene locus_tag LOCUS_18780 2892 1018 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_18780 2994 3332 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4447 3536 gene locus_tag LOCUS_18790 4447 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 4633 5529 gene locus_tag LOCUS_18800 4633 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 5539 5913 gene locus_tag LOCUS_18810 5539 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 6009 5922 gene locus_tag LOCUS_t00350 6009 5922 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence61 777 1742 gene locus_tag LOCUS_18820 777 1742 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018271.1 protein_id gnl|my_center|LOCUS_18820 1735 2823 gene locus_tag LOCUS_18830 1735 2823 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877096.1 protein_id gnl|my_center|LOCUS_18830 3767 2838 gene locus_tag LOCUS_18840 3767 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798333.1 protein_id gnl|my_center|LOCUS_18840 4794 3772 gene locus_tag LOCUS_18850 4794 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 5096 4791 gene locus_tag LOCUS_18860 5096 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 5169 5487 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence62 954 1184 gene locus_tag LOCUS_18870 954 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 1723 1163 gene locus_tag LOCUS_18880 1723 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 2063 1785 gene locus_tag LOCUS_18890 2063 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 2157 2427 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <5670 2649 gene locus_tag LOCUS_18900 <5670 2649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041594898.1:HsdR family type I site-specific deoxyribonuclease >Feature sequence63 1 612 gene locus_tag LOCUS_18910 1 612 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902910.1 protein_id gnl|my_center|LOCUS_18910 605 1087 gene locus_tag LOCUS_18920 605 1087 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868429.1 protein_id gnl|my_center|LOCUS_18920 1544 1062 gene locus_tag LOCUS_18930 1544 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 1613 1885 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2282 2665 gene locus_tag LOCUS_18940 2282 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 2867 2649 gene locus_tag LOCUS_18950 2867 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 3427 2855 gene locus_tag LOCUS_18960 3427 2855 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871100.1 protein_id gnl|my_center|LOCUS_18960 3532 4254 gene locus_tag LOCUS_18970 3532 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 5241 4573 gene locus_tag LOCUS_18980 5241 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence64 920 51 gene locus_tag LOCUS_18990 920 51 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024306.1 protein_id gnl|my_center|LOCUS_18990 1431 1066 gene locus_tag LOCUS_19000 1431 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 1961 1608 gene locus_tag LOCUS_19010 1961 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 3648 2029 gene locus_tag LOCUS_19020 3648 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 3847 5157 gene locus_tag LOCUS_19030 gene purB 3847 5157 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868368.1 protein_id gnl|my_center|LOCUS_19030 5352 5376 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence65 97 366 gene locus_tag LOCUS_19040 97 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 566 363 gene locus_tag LOCUS_19050 566 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 670 828 gene locus_tag LOCUS_19060 670 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 1183 2046 gene locus_tag LOCUS_19070 1183 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 2322 2522 gene locus_tag LOCUS_19080 2322 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 2519 2680 gene locus_tag LOCUS_19090 2519 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 4969 2681 gene locus_tag LOCUS_19100 4969 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 >Feature sequence66 27 944 gene locus_tag LOCUS_19110 27 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 1046 3010 gene locus_tag LOCUS_19120 1046 3010 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968324.1 protein_id gnl|my_center|LOCUS_19120 3240 4112 gene locus_tag LOCUS_19130 3240 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 5257 4115 gene locus_tag LOCUS_19140 5257 4115 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930984.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence67 761 2431 gene locus_tag LOCUS_19150 761 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 2661 3977 gene locus_tag LOCUS_19160 2661 3977 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024460.1 protein_id gnl|my_center|LOCUS_19160 3974 4561 gene locus_tag LOCUS_19170 gene trmY 3974 4561 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066221.1 protein_id gnl|my_center|LOCUS_19170 4617 4811 gene locus_tag LOCUS_19180 4617 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence68 1450 1052 gene locus_tag LOCUS_19190 1450 1052 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496977.1 protein_id gnl|my_center|LOCUS_19190 2619 1450 gene locus_tag LOCUS_19200 2619 1450 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_19200 3683 2616 gene locus_tag LOCUS_19210 3683 2616 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871070.1 protein_id gnl|my_center|LOCUS_19210 4368 3685 gene locus_tag LOCUS_19220 4368 3685 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250639.1 protein_id gnl|my_center|LOCUS_19220 4581 4459 gene locus_tag LOCUS_19230 4581 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 >Feature sequence69 516 1643 gene locus_tag LOCUS_19240 516 1643 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392524.1 protein_id gnl|my_center|LOCUS_19240 1729 2478 gene locus_tag LOCUS_19250 1729 2478 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024285.1 protein_id gnl|my_center|LOCUS_19250 2454 3680 gene locus_tag LOCUS_19260 2454 3680 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024286.1 protein_id gnl|my_center|LOCUS_19260 3753 4130 gene locus_tag LOCUS_19270 3753 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 4279 4728 gene locus_tag LOCUS_19280 4279 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 >Feature sequence70 1457 540 gene locus_tag LOCUS_19290 1457 540 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065835.1 protein_id gnl|my_center|LOCUS_19290 1493 1785 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <4681 2564 gene locus_tag LOCUS_19300 <4681 2564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023333.1:phosphoenolpyruvate synthase >Feature sequence71 351 100 gene locus_tag LOCUS_19310 351 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 3145 452 gene locus_tag LOCUS_19320 3145 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 3257 3811 gene locus_tag LOCUS_19330 3257 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 4261 3851 gene locus_tag LOCUS_19340 4261 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 >Feature sequence72 1897 698 gene locus_tag LOCUS_19350 1897 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 1901 2217 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3440 2607 gene locus_tag LOCUS_19360 gene mtaC 3440 2607 CDS product methanol--corrinoid protein MtaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024270.1 protein_id gnl|my_center|LOCUS_19360 <4375 3440 gene locus_tag LOCUS_19370 <4375 3440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393827.1:MtaA/CmuA family methyltransferase >Feature sequence73 <1 1203 gene locus_tag LOCUS_19380 <1 1203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157860380.1:MFS transporter 1451 1644 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1651 2511 gene locus_tag LOCUS_19390 gene mtaA 1651 2511 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021625.1 protein_id gnl|my_center|LOCUS_19390 3212 2571 gene locus_tag LOCUS_19400 3212 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 3670 3209 gene locus_tag LOCUS_19410 3670 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 >Feature sequence74 <4250 1089 gene locus_tag LOCUS_19420 <4250 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_084493241.1:trehalose-phosphatase >Feature sequence75 339 488 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1259 1909 gene locus_tag LOCUS_19430 gene cysE 1259 1909 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591551.1 protein_id gnl|my_center|LOCUS_19430 1953 3356 gene locus_tag LOCUS_19440 gene cysS 1953 3356 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_19440 >Feature sequence76 888 1229 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1530 1758 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2574 2278 gene locus_tag LOCUS_19450 2574 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence77 1009 1333 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1436 2506 gene locus_tag LOCUS_19460 1436 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 2554 2828 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2953 3459 gene locus_tag LOCUS_19470 2953 3459 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903666.1 protein_id gnl|my_center|LOCUS_19470 >Feature sequence78 165 524 gene locus_tag LOCUS_19480 gene ndhC 165 524 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257856.1 protein_id gnl|my_center|LOCUS_19480 515 1078 gene locus_tag LOCUS_19490 515 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 1080 1553 gene locus_tag LOCUS_19500 1080 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 2426 2671 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence79 <1 940 gene locus_tag LOCUS_19510 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235045029.1:heavy metal translocating P-type ATPase 1691 927 gene locus_tag LOCUS_19520 1691 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 1927 3009 gene locus_tag LOCUS_19530 gene rfbB 1927 3009 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224748.1 protein_id gnl|my_center|LOCUS_19530 >Feature sequence80 1882 233 gene locus_tag LOCUS_19540 1882 233 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940324.1 protein_id gnl|my_center|LOCUS_19540 2455 1892 gene locus_tag LOCUS_19550 2455 1892 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940325.1 protein_id gnl|my_center|LOCUS_19550 <3064 2512 gene locus_tag LOCUS_19560 <3064 2512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066425.1:2-oxoacid:acceptor oxidoreductase family protein >Feature sequence81 665 1393 gene locus_tag LOCUS_19570 665 1393 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274412.1 protein_id gnl|my_center|LOCUS_19570 1618 2466 gene locus_tag LOCUS_19580 1618 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 2889 2452 gene locus_tag LOCUS_19590 2889 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 >Feature sequence82 1283 2530 gene locus_tag LOCUS_19600 1283 2530 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251014.1 protein_id gnl|my_center|LOCUS_19600 2563 2636 gene locus_tag LOCUS_t00360 2563 2636 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence83 1456 395 gene locus_tag LOCUS_19610 gene wecB 1456 395 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_19610 2045 1560 gene locus_tag LOCUS_19620 2045 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 >Feature sequence84 109 2052 gene locus_tag LOCUS_19630 109 2052 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021363.1 protein_id gnl|my_center|LOCUS_19630 2555 2328 gene locus_tag LOCUS_19640 2555 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19640