>Feature sequence01 <1 1131 gene locus_tag LOCUS_00010 <1 1131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083774551.1:formate dehydrogenase subunit alpha 1135 2400 gene locus_tag LOCUS_00020 1135 2400 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869498.1 protein_id gnl|my_center|LOCUS_00020 3076 3948 gene locus_tag LOCUS_00030 3076 3948 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393681.1 protein_id gnl|my_center|LOCUS_00030 3955 4470 gene locus_tag LOCUS_00040 3955 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6148 4553 gene locus_tag LOCUS_00050 6148 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 7166 6129 gene locus_tag LOCUS_00060 7166 6129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 10339 7166 gene locus_tag LOCUS_00070 10339 7166 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839328.1 protein_id gnl|my_center|LOCUS_00070 11480 10326 gene locus_tag LOCUS_00080 11480 10326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11611 11793 gene locus_tag LOCUS_00090 11611 11793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11790 12968 gene locus_tag LOCUS_00100 gene pscS 11790 12968 CDS product O-phospho-L-seryl-tRNA:Cys-tRNA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966499.1 protein_id gnl|my_center|LOCUS_00100 14344 13166 gene locus_tag LOCUS_00110 gene thiI 14344 13166 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021480.1 protein_id gnl|my_center|LOCUS_00110 14597 15223 gene locus_tag LOCUS_00120 14597 15223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 15220 15672 gene locus_tag LOCUS_00130 15220 15672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 16146 15712 gene locus_tag LOCUS_00140 16146 15712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17706 16222 gene locus_tag LOCUS_00150 17706 16222 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868291.1 protein_id gnl|my_center|LOCUS_00150 17845 18756 gene locus_tag LOCUS_00160 17845 18756 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140212.1 protein_id gnl|my_center|LOCUS_00160 18769 20220 gene locus_tag LOCUS_00170 18769 20220 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062390429.1 protein_id gnl|my_center|LOCUS_00170 20511 20698 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20726 21409 gene locus_tag LOCUS_00180 20726 21409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21450 22412 gene locus_tag LOCUS_00190 21450 22412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 22443 23780 gene locus_tag LOCUS_00200 22443 23780 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057959.1 protein_id gnl|my_center|LOCUS_00200 24801 23686 gene locus_tag LOCUS_00210 24801 23686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 25074 26198 gene locus_tag LOCUS_00220 25074 26198 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 protein_id gnl|my_center|LOCUS_00220 26286 26960 gene locus_tag LOCUS_00230 26286 26960 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162995.1 protein_id gnl|my_center|LOCUS_00230 26933 27601 gene locus_tag LOCUS_00240 26933 27601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 27708 27929 gene locus_tag LOCUS_00250 27708 27929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 28474 28055 gene locus_tag LOCUS_00260 28474 28055 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020231.1 protein_id gnl|my_center|LOCUS_00260 28870 28682 gene locus_tag LOCUS_00270 28870 28682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00270 29183 28941 gene locus_tag LOCUS_00280 29183 28941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 29484 29167 gene locus_tag LOCUS_00290 29484 29167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 29768 29514 gene locus_tag LOCUS_00300 29768 29514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 31787 30171 gene locus_tag LOCUS_00310 gene hcp 31787 30171 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272545.1 protein_id gnl|my_center|LOCUS_00310 31874 32233 gene locus_tag LOCUS_00320 31874 32233 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303789.1 protein_id gnl|my_center|LOCUS_00320 32223 32438 gene locus_tag LOCUS_00330 32223 32438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 32461 33075 gene locus_tag LOCUS_00340 32461 33075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 33006 33359 gene locus_tag LOCUS_00350 33006 33359 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094555.1 protein_id gnl|my_center|LOCUS_00350 34258 33983 gene locus_tag LOCUS_00360 34258 33983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 34572 34279 gene locus_tag LOCUS_00370 34572 34279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 35769 34681 gene locus_tag LOCUS_00380 35769 34681 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878440.1 protein_id gnl|my_center|LOCUS_00380 37564 35762 gene locus_tag LOCUS_00390 37564 35762 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021597.1 protein_id gnl|my_center|LOCUS_00390 38783 37551 gene locus_tag LOCUS_00400 gene hisS 38783 37551 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020981.1 protein_id gnl|my_center|LOCUS_00400 39132 38800 gene locus_tag LOCUS_00410 39132 38800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 39180 39953 gene locus_tag LOCUS_00420 gene larB 39180 39953 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020480.1 protein_id gnl|my_center|LOCUS_00420 39950 40474 gene locus_tag LOCUS_00430 39950 40474 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870045.1 protein_id gnl|my_center|LOCUS_00430 40511 41812 gene locus_tag LOCUS_00440 40511 41812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 41946 42770 gene locus_tag LOCUS_00450 41946 42770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 43227 42907 gene locus_tag LOCUS_00460 43227 42907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 44440 43271 gene locus_tag LOCUS_00470 44440 43271 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024280.1 protein_id gnl|my_center|LOCUS_00470 44662 45252 gene locus_tag LOCUS_00480 44662 45252 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877617.1 protein_id gnl|my_center|LOCUS_00480 45255 46082 gene locus_tag LOCUS_00490 45255 46082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 47970 46774 gene locus_tag LOCUS_00500 47970 46774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 48165 50759 gene locus_tag LOCUS_00510 48165 50759 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022991.1 protein_id gnl|my_center|LOCUS_00510 51333 50716 gene locus_tag LOCUS_00520 gene tmk 51333 50716 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024311.1 protein_id gnl|my_center|LOCUS_00520 52007 51327 gene locus_tag LOCUS_00530 52007 51327 CDS product HisA/HisF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878216.1 protein_id gnl|my_center|LOCUS_00530 52052 52741 gene locus_tag LOCUS_00540 52052 52741 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024314.1 protein_id gnl|my_center|LOCUS_00540 52745 54211 gene locus_tag LOCUS_00550 gene guaB 52745 54211 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289261.1 protein_id gnl|my_center|LOCUS_00550 54249 54872 gene locus_tag LOCUS_00560 54249 54872 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903348.1 protein_id gnl|my_center|LOCUS_00560 54862 55284 gene locus_tag LOCUS_00570 54862 55284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 55678 55337 gene locus_tag LOCUS_00580 55678 55337 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589516.1 protein_id gnl|my_center|LOCUS_00580 55920 55684 gene locus_tag LOCUS_00590 55920 55684 CDS product Sm protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021429.1 protein_id gnl|my_center|LOCUS_00590 57133 56036 gene locus_tag LOCUS_00600 gene fbp 57133 56036 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393749.1 protein_id gnl|my_center|LOCUS_00600 57849 57388 gene locus_tag LOCUS_00610 57849 57388 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762292.1 protein_id gnl|my_center|LOCUS_00610 60329 57906 gene locus_tag LOCUS_00620 60329 57906 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_00620 60969 60382 gene locus_tag LOCUS_00630 60969 60382 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_00630 61444 61028 gene locus_tag LOCUS_00640 61444 61028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 61692 62345 gene locus_tag LOCUS_00650 61692 62345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 63677 62397 gene locus_tag LOCUS_00660 gene thiC 63677 62397 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024209.1 protein_id gnl|my_center|LOCUS_00660 63848 64546 gene locus_tag LOCUS_00670 63848 64546 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020130.1 protein_id gnl|my_center|LOCUS_00670 64697 65245 gene locus_tag LOCUS_00680 64697 65245 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024528.1 protein_id gnl|my_center|LOCUS_00680 65242 66015 gene locus_tag LOCUS_00690 65242 66015 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024526.1 protein_id gnl|my_center|LOCUS_00690 66003 66956 gene locus_tag LOCUS_00700 gene rnz 66003 66956 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 protein_id gnl|my_center|LOCUS_00700 66978 68174 gene locus_tag LOCUS_00710 66978 68174 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081432771.1 protein_id gnl|my_center|LOCUS_00710 68189 69409 gene locus_tag LOCUS_00720 68189 69409 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021450.1 protein_id gnl|my_center|LOCUS_00720 69424 71259 gene locus_tag LOCUS_00730 69424 71259 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064996.1 protein_id gnl|my_center|LOCUS_00730 71511 72041 gene locus_tag LOCUS_00740 71511 72041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 72320 72571 gene locus_tag LOCUS_00750 72320 72571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902537.1 protein_id gnl|my_center|LOCUS_00750 72544 72786 gene locus_tag LOCUS_00760 72544 72786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 73468 72869 gene locus_tag LOCUS_00770 73468 72869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 73654 73911 gene locus_tag LOCUS_00780 73654 73911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 74830 74036 gene locus_tag LOCUS_00790 74830 74036 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878537.1 protein_id gnl|my_center|LOCUS_00790 75337 74858 gene locus_tag LOCUS_00800 75337 74858 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868676.1 protein_id gnl|my_center|LOCUS_00800 78196 75350 gene locus_tag LOCUS_00810 78196 75350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 79078 78200 gene locus_tag LOCUS_00820 79078 78200 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102075.1 protein_id gnl|my_center|LOCUS_00820 79513 79872 gene locus_tag LOCUS_00830 79513 79872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 79881 81527 gene locus_tag LOCUS_00840 gene ade 79881 81527 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338640.1 protein_id gnl|my_center|LOCUS_00840 82791 81712 gene locus_tag LOCUS_00850 82791 81712 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256178.1 protein_id gnl|my_center|LOCUS_00850 83924 83169 gene locus_tag LOCUS_00860 83924 83169 CDS product heparan-alpha-glucosaminide N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065998.1 protein_id gnl|my_center|LOCUS_00860 84094 83936 gene locus_tag LOCUS_00870 84094 83936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 84937 84296 gene locus_tag LOCUS_00880 84937 84296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 85962 84955 gene locus_tag LOCUS_00890 85962 84955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250153.1 protein_id gnl|my_center|LOCUS_00890 86474 85962 gene locus_tag LOCUS_00900 86474 85962 CDS product DUF1887 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250154.1 protein_id gnl|my_center|LOCUS_00900 86782 87387 gene locus_tag LOCUS_00910 86782 87387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 88528 91983 gene locus_tag LOCUS_00920 88528 91983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 92137 92577 gene locus_tag LOCUS_00930 92137 92577 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021413.1 protein_id gnl|my_center|LOCUS_00930 93055 92570 gene locus_tag LOCUS_00940 93055 92570 CDS product TIGR00295 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023768.1 protein_id gnl|my_center|LOCUS_00940 93569 93048 gene locus_tag LOCUS_00950 93569 93048 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066543.1 protein_id gnl|my_center|LOCUS_00950 94773 93697 gene locus_tag LOCUS_00960 94773 93697 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023766.1 protein_id gnl|my_center|LOCUS_00960 95294 94770 gene locus_tag LOCUS_00970 95294 94770 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023175.1 protein_id gnl|my_center|LOCUS_00970 95574 95296 gene locus_tag LOCUS_00980 95574 95296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 95709 96101 gene locus_tag LOCUS_00990 95709 96101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 96814 96098 gene locus_tag LOCUS_01000 96814 96098 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021719.1 protein_id gnl|my_center|LOCUS_01000 97209 96811 gene locus_tag LOCUS_01010 97209 96811 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065229.1 protein_id gnl|my_center|LOCUS_01010 98714 97206 gene locus_tag LOCUS_01020 98714 97206 CDS product L-aspartate semialdehyde sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021823.1 protein_id gnl|my_center|LOCUS_01020 100136 98838 gene locus_tag LOCUS_01030 100136 98838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 100329 101039 gene locus_tag LOCUS_01040 100329 101039 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022780.1 protein_id gnl|my_center|LOCUS_01040 101036 101353 gene locus_tag LOCUS_01050 101036 101353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 101415 104159 gene locus_tag LOCUS_01060 gene alaS 101415 104159 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020252.1 protein_id gnl|my_center|LOCUS_01060 104152 104772 gene locus_tag LOCUS_01070 104152 104772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 105271 105876 gene locus_tag LOCUS_01080 105271 105876 CDS product DUF5698 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357138.1 protein_id gnl|my_center|LOCUS_01080 107011 105857 gene locus_tag LOCUS_01090 107011 105857 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_01090 107200 107487 gene locus_tag LOCUS_01100 107200 107487 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583804.1 protein_id gnl|my_center|LOCUS_01100 108683 107967 gene locus_tag LOCUS_01110 108683 107967 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892488.1 protein_id gnl|my_center|LOCUS_01110 111307 108680 gene locus_tag LOCUS_01120 111307 108680 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146858.1 protein_id gnl|my_center|LOCUS_01120 111837 112436 gene locus_tag LOCUS_01130 gene hxlB 111837 112436 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065105.1 protein_id gnl|my_center|LOCUS_01130 112445 113551 gene locus_tag LOCUS_01140 112445 113551 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021402.1 protein_id gnl|my_center|LOCUS_01140 113559 114596 gene locus_tag LOCUS_01150 113559 114596 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065828.1 protein_id gnl|my_center|LOCUS_01150 115135 114908 gene locus_tag LOCUS_01160 115135 114908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 115267 115596 gene locus_tag LOCUS_01170 gene sugE 115267 115596 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123025.1 protein_id gnl|my_center|LOCUS_01170 115581 115742 gene locus_tag LOCUS_01180 115581 115742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 115937 116173 gene locus_tag LOCUS_01190 115937 116173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 116198 116713 gene locus_tag LOCUS_01200 gene cobO 116198 116713 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948638.1 protein_id gnl|my_center|LOCUS_01200 117019 117221 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 118289 117249 gene locus_tag LOCUS_01210 118289 117249 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065518.1 protein_id gnl|my_center|LOCUS_01210 118561 118361 gene locus_tag LOCUS_01220 118561 118361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 119810 119121 gene locus_tag LOCUS_01230 119810 119121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 119944 120387 gene locus_tag LOCUS_01240 119944 120387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 120394 121143 gene locus_tag LOCUS_01250 120394 121143 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458882.1 protein_id gnl|my_center|LOCUS_01250 121136 121966 gene locus_tag LOCUS_01260 121136 121966 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937415.1 protein_id gnl|my_center|LOCUS_01260 122064 122975 gene locus_tag LOCUS_01270 122064 122975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 123107 123448 gene locus_tag LOCUS_01280 123107 123448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01280 124346 124071 gene locus_tag LOCUS_01290 124346 124071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01290 124724 125052 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 125086 125658 gene locus_tag LOCUS_01300 125086 125658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 126112 125687 gene locus_tag LOCUS_01310 126112 125687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 126706 126927 gene locus_tag LOCUS_01320 126706 126927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01320 126958 127170 gene locus_tag LOCUS_01330 126958 127170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 128318 127446 gene locus_tag LOCUS_01340 128318 127446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 128336 128541 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 129122 129943 gene locus_tag LOCUS_01350 129122 129943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 130008 130178 gene locus_tag LOCUS_01360 130008 130178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 131108 130434 gene locus_tag LOCUS_01370 131108 130434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 131907 131158 gene locus_tag LOCUS_01380 131907 131158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 132134 131808 gene locus_tag LOCUS_01390 132134 131808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 132390 132575 gene locus_tag LOCUS_01400 132390 132575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 132575 133084 gene locus_tag LOCUS_01410 132575 133084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 133954 133526 gene locus_tag LOCUS_01420 133954 133526 CDS product DUF365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879837.1 protein_id gnl|my_center|LOCUS_01420 134066 134409 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 135023 135220 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 135803 135537 gene locus_tag LOCUS_01430 135803 135537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 135848 136102 gene locus_tag LOCUS_01440 135848 136102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 136678 136271 gene locus_tag LOCUS_01450 136678 136271 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731152.1 protein_id gnl|my_center|LOCUS_01450 137043 136970 gene locus_tag LOCUS_t00010 137043 136970 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 138129 137098 gene locus_tag LOCUS_01460 gene hypD 138129 137098 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876696.1 protein_id gnl|my_center|LOCUS_01460 139113 138175 gene locus_tag LOCUS_01470 139113 138175 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933107.1 protein_id gnl|my_center|LOCUS_01470 140351 139173 gene locus_tag LOCUS_01480 140351 139173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 140504 141235 gene locus_tag LOCUS_01490 140504 141235 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871139.1 protein_id gnl|my_center|LOCUS_01490 141317 141389 gene locus_tag LOCUS_t00020 141317 141389 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 141474 141764 gene locus_tag LOCUS_01500 141474 141764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 142866 143036 gene locus_tag LOCUS_01510 142866 143036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 143033 144121 gene locus_tag LOCUS_01520 143033 144121 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876013.1 protein_id gnl|my_center|LOCUS_01520 144135 145235 gene locus_tag LOCUS_01530 gene wecB 144135 145235 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_01530 145243 146184 gene locus_tag LOCUS_01540 145243 146184 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060800.1 protein_id gnl|my_center|LOCUS_01540 146190 147188 gene locus_tag LOCUS_01550 146190 147188 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060801.1 protein_id gnl|my_center|LOCUS_01550 147215 148510 gene locus_tag LOCUS_01560 147215 148510 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081170.1 protein_id gnl|my_center|LOCUS_01560 148500 149798 gene locus_tag LOCUS_01570 148500 149798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 149799 151085 gene locus_tag LOCUS_01580 149799 151085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 151285 152406 gene locus_tag LOCUS_01590 151285 152406 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392195.1 protein_id gnl|my_center|LOCUS_01590 153244 153678 gene locus_tag LOCUS_01600 153244 153678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 154386 154622 gene locus_tag LOCUS_01610 154386 154622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 155742 156485 gene locus_tag LOCUS_01620 155742 156485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 156948 156739 gene locus_tag LOCUS_01630 156948 156739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 158026 157607 gene locus_tag LOCUS_01640 158026 157607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 160690 160565 gene locus_tag LOCUS_01650 160690 160565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 >Feature sequence02 533 739 gene locus_tag LOCUS_01660 533 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 1311 1141 gene locus_tag LOCUS_01670 1311 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 1918 1571 gene locus_tag LOCUS_01680 1918 1571 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_01680 2204 1902 gene locus_tag LOCUS_01690 2204 1902 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064812.1 protein_id gnl|my_center|LOCUS_01690 2493 2795 gene locus_tag LOCUS_01700 2493 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 3478 3113 gene locus_tag LOCUS_01710 3478 3113 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_01710 3789 3475 gene locus_tag LOCUS_01720 3789 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 4354 4572 gene locus_tag LOCUS_01730 4354 4572 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022122.1 protein_id gnl|my_center|LOCUS_01730 4814 4629 gene locus_tag LOCUS_01740 4814 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 5038 5217 gene locus_tag LOCUS_01750 5038 5217 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755892.1 protein_id gnl|my_center|LOCUS_01750 5575 5709 gene locus_tag LOCUS_01760 5575 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 5702 5992 gene locus_tag LOCUS_01770 5702 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 6181 6020 gene locus_tag LOCUS_01780 6181 6020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 6589 6362 gene locus_tag LOCUS_01790 6589 6362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 6881 6534 gene locus_tag LOCUS_01800 6881 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 8401 7136 gene locus_tag LOCUS_01810 8401 7136 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024335.1 protein_id gnl|my_center|LOCUS_01810 9147 8581 gene locus_tag LOCUS_01820 9147 8581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 10442 9144 gene locus_tag LOCUS_01830 10442 9144 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881249.1 protein_id gnl|my_center|LOCUS_01830 11558 11340 gene locus_tag LOCUS_01840 11558 11340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 12407 11637 gene locus_tag LOCUS_01850 12407 11637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 12636 13772 gene locus_tag LOCUS_01860 12636 13772 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021211.1 protein_id gnl|my_center|LOCUS_01860 15517 14054 gene locus_tag LOCUS_01870 15517 14054 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061157.1 protein_id gnl|my_center|LOCUS_01870 17145 15514 gene locus_tag LOCUS_01880 17145 15514 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061070.1 protein_id gnl|my_center|LOCUS_01880 17217 19646 gene locus_tag LOCUS_01890 17217 19646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 20078 19677 gene locus_tag LOCUS_01900 20078 19677 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868296.1 protein_id gnl|my_center|LOCUS_01900 20340 20083 gene locus_tag LOCUS_01910 20340 20083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 20725 20489 gene locus_tag LOCUS_01920 20725 20489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 21330 20803 gene locus_tag LOCUS_01930 21330 20803 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878286.1 protein_id gnl|my_center|LOCUS_01930 21713 21330 gene locus_tag LOCUS_01940 gene sepF 21713 21330 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878285.1 protein_id gnl|my_center|LOCUS_01940 22254 21757 gene locus_tag LOCUS_01950 22254 21757 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876288.1 protein_id gnl|my_center|LOCUS_01950 22367 22594 gene locus_tag LOCUS_01960 22367 22594 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023130.1 protein_id gnl|my_center|LOCUS_01960 22611 22793 gene locus_tag LOCUS_01970 22611 22793 CDS product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876286.1 protein_id gnl|my_center|LOCUS_01970 22803 24239 gene locus_tag LOCUS_01980 gene purF 22803 24239 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065634.1 protein_id gnl|my_center|LOCUS_01980 24505 24431 gene locus_tag LOCUS_t00030 24505 24431 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 24637 25035 gene locus_tag LOCUS_01990 gene trxA 24637 25035 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878779.1 protein_id gnl|my_center|LOCUS_01990 25379 25032 gene locus_tag LOCUS_02000 25379 25032 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042653643.1 protein_id gnl|my_center|LOCUS_02000 26000 25431 gene locus_tag LOCUS_02010 26000 25431 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197538709.1 protein_id gnl|my_center|LOCUS_02010 27105 26002 gene locus_tag LOCUS_02020 27105 26002 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023369.1 protein_id gnl|my_center|LOCUS_02020 28042 27197 gene locus_tag LOCUS_02030 28042 27197 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022647.1 protein_id gnl|my_center|LOCUS_02030 28989 28039 gene locus_tag LOCUS_02040 28989 28039 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984847.1 protein_id gnl|my_center|LOCUS_02040 29354 29845 gene locus_tag LOCUS_02050 29354 29845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 30078 29878 gene locus_tag LOCUS_02060 30078 29878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 30241 30405 gene locus_tag LOCUS_02070 30241 30405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 30411 31697 gene locus_tag LOCUS_02080 30411 31697 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010923212.1 protein_id gnl|my_center|LOCUS_02080 31702 32646 gene locus_tag LOCUS_02090 gene arcC 31702 32646 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_02090 32708 33046 gene locus_tag LOCUS_02100 32708 33046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 33218 34597 gene locus_tag LOCUS_02110 33218 34597 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_02110 34681 36243 gene locus_tag LOCUS_02120 34681 36243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 36332 36490 gene locus_tag LOCUS_02130 36332 36490 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670545.1 protein_id gnl|my_center|LOCUS_02130 37061 37477 gene locus_tag LOCUS_02140 37061 37477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 38795 37746 gene locus_tag LOCUS_02150 38795 37746 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099211502.1 protein_id gnl|my_center|LOCUS_02150 39610 38795 gene locus_tag LOCUS_02160 39610 38795 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249669.1 protein_id gnl|my_center|LOCUS_02160 40104 39613 gene locus_tag LOCUS_02170 gene tsaA 40104 39613 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249662.1 protein_id gnl|my_center|LOCUS_02170 40919 40101 gene locus_tag LOCUS_02180 gene modA 40919 40101 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948645.1 protein_id gnl|my_center|LOCUS_02180 41492 41010 gene locus_tag LOCUS_02190 gene tsaA 41492 41010 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249662.1 protein_id gnl|my_center|LOCUS_02190 42351 41716 gene locus_tag LOCUS_02200 gene thiE 42351 41716 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106006557.1 protein_id gnl|my_center|LOCUS_02200 43265 42351 gene locus_tag LOCUS_02210 gene thiM 43265 42351 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256281.1 protein_id gnl|my_center|LOCUS_02210 43505 43945 gene locus_tag LOCUS_02220 43505 43945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 44246 44674 gene locus_tag LOCUS_02230 44246 44674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 45074 44985 gene locus_tag LOCUS_t00040 45074 44985 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 46828 45227 gene locus_tag LOCUS_02240 gene thsB 46828 45227 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020145.1 protein_id gnl|my_center|LOCUS_02240 47593 46979 gene locus_tag LOCUS_02250 47593 46979 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876509.1 protein_id gnl|my_center|LOCUS_02250 48071 47616 gene locus_tag LOCUS_02260 48071 47616 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147315.1 protein_id gnl|my_center|LOCUS_02260 48988 48068 gene locus_tag LOCUS_02270 gene rtcA 48988 48068 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878932.1 protein_id gnl|my_center|LOCUS_02270 49895 49038 gene locus_tag LOCUS_02280 49895 49038 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021191.1 protein_id gnl|my_center|LOCUS_02280 49977 51920 gene locus_tag LOCUS_02290 gene lonB 49977 51920 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023222.1 protein_id gnl|my_center|LOCUS_02290 51920 53254 gene locus_tag LOCUS_02300 51920 53254 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990640.1 protein_id gnl|my_center|LOCUS_02300 53251 54543 gene locus_tag LOCUS_02310 53251 54543 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065661.1 protein_id gnl|my_center|LOCUS_02310 54544 54807 gene locus_tag LOCUS_02320 54544 54807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 55944 55252 gene locus_tag LOCUS_02330 55944 55252 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877858.1 protein_id gnl|my_center|LOCUS_02330 56777 55944 gene locus_tag LOCUS_02340 56777 55944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064218.1 protein_id gnl|my_center|LOCUS_02340 57366 58901 gene locus_tag LOCUS_02350 57366 58901 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289232.1 protein_id gnl|my_center|LOCUS_02350 58901 60838 gene locus_tag LOCUS_02360 58901 60838 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878495.1 protein_id gnl|my_center|LOCUS_02360 61170 60835 gene locus_tag LOCUS_02370 61170 60835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 61133 61615 gene locus_tag LOCUS_02380 61133 61615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023265.1 protein_id gnl|my_center|LOCUS_02380 61667 61996 gene locus_tag LOCUS_02390 61667 61996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 61983 63947 gene locus_tag LOCUS_02400 61983 63947 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589509.1 protein_id gnl|my_center|LOCUS_02400 63952 64200 gene locus_tag LOCUS_02410 63952 64200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 64212 64790 gene locus_tag LOCUS_02420 64212 64790 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903582.1 protein_id gnl|my_center|LOCUS_02420 64804 65859 gene locus_tag LOCUS_02430 64804 65859 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024044.1 protein_id gnl|my_center|LOCUS_02430 65862 66164 gene locus_tag LOCUS_02440 65862 66164 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024045.1 protein_id gnl|my_center|LOCUS_02440 66164 67918 gene locus_tag LOCUS_02450 66164 67918 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024046.1 protein_id gnl|my_center|LOCUS_02450 67915 69306 gene locus_tag LOCUS_02460 67915 69306 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024047.1 protein_id gnl|my_center|LOCUS_02460 69313 69939 gene locus_tag LOCUS_02470 69313 69939 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024048.1 protein_id gnl|my_center|LOCUS_02470 71159 71409 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 72684 71827 gene locus_tag LOCUS_02480 72684 71827 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878600.1 protein_id gnl|my_center|LOCUS_02480 72798 72725 gene locus_tag LOCUS_t00050 72798 72725 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 73062 72862 gene locus_tag LOCUS_02490 73062 72862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 73844 73059 gene locus_tag LOCUS_02500 73844 73059 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320034.1 protein_id gnl|my_center|LOCUS_02500 74532 74335 gene locus_tag LOCUS_02510 74532 74335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 74604 75239 gene locus_tag LOCUS_02520 74604 75239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 75750 75319 gene locus_tag LOCUS_02530 75750 75319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 75944 76017 gene locus_tag LOCUS_t00060 75944 76017 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 76094 76345 gene locus_tag LOCUS_02540 76094 76345 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870552.1 protein_id gnl|my_center|LOCUS_02540 76389 77930 gene locus_tag LOCUS_02550 76389 77930 CDS product DNA-directed RNA polymerase subunit B'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755883.1 protein_id gnl|my_center|LOCUS_02550 77927 79741 gene locus_tag LOCUS_02560 gene rpoB 77927 79741 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021285.1 protein_id gnl|my_center|LOCUS_02560 79765 82413 gene locus_tag LOCUS_02570 79765 82413 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021284.1 protein_id gnl|my_center|LOCUS_02570 82880 83072 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 83715 84002 gene locus_tag LOCUS_02580 83715 84002 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250031.1 protein_id gnl|my_center|LOCUS_02580 84007 84456 gene locus_tag LOCUS_02590 84007 84456 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876680.1 protein_id gnl|my_center|LOCUS_02590 84624 85838 gene locus_tag LOCUS_02600 84624 85838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 86885 85854 gene locus_tag LOCUS_02610 86885 85854 CDS product DUF1786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392396.1 protein_id gnl|my_center|LOCUS_02610 91929 86929 gene locus_tag LOCUS_02620 91929 86929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 92189 91932 gene locus_tag LOCUS_02630 92189 91932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 92399 92938 gene locus_tag LOCUS_02640 gene thpR 92399 92938 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879646.1 protein_id gnl|my_center|LOCUS_02640 92935 94308 gene locus_tag LOCUS_02650 gene cca 92935 94308 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023473.1 protein_id gnl|my_center|LOCUS_02650 94660 95085 gene locus_tag LOCUS_02660 94660 95085 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940065.1 protein_id gnl|my_center|LOCUS_02660 95101 97080 gene locus_tag LOCUS_02670 95101 97080 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940066.1 protein_id gnl|my_center|LOCUS_02670 97224 97464 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 98005 98247 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 99268 98819 gene locus_tag LOCUS_02680 99268 98819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 99334 99518 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 100218 99559 gene locus_tag LOCUS_02690 100218 99559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 100309 100517 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 102076 101378 gene locus_tag LOCUS_02700 102076 101378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 102798 102070 gene locus_tag LOCUS_02710 102798 102070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 103475 102834 gene locus_tag LOCUS_02720 103475 102834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 104140 103472 gene locus_tag LOCUS_02730 104140 103472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 104808 104137 gene locus_tag LOCUS_02740 104808 104137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 105524 104802 gene locus_tag LOCUS_02750 105524 104802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 105754 108291 gene locus_tag LOCUS_02760 105754 108291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 108294 109982 gene locus_tag LOCUS_02770 108294 109982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 109979 111529 gene locus_tag LOCUS_02780 109979 111529 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020292.1 protein_id gnl|my_center|LOCUS_02780 111526 113322 gene locus_tag LOCUS_02790 111526 113322 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878495.1 protein_id gnl|my_center|LOCUS_02790 113333 113800 gene locus_tag LOCUS_02800 113333 113800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 113797 114729 gene locus_tag LOCUS_02810 113797 114729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 114723 115250 gene locus_tag LOCUS_02820 114723 115250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 115256 115792 gene locus_tag LOCUS_02830 115256 115792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 116283 119897 gene locus_tag LOCUS_02840 116283 119897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 120361 120759 gene locus_tag LOCUS_02850 120361 120759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809191.1 protein_id gnl|my_center|LOCUS_02850 121494 120847 gene locus_tag LOCUS_02860 121494 120847 CDS product DUF3267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020785.1 protein_id gnl|my_center|LOCUS_02860 122720 121701 gene locus_tag LOCUS_02870 122720 121701 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024104.1 protein_id gnl|my_center|LOCUS_02870 123462 122725 gene locus_tag LOCUS_02880 123462 122725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024103.1 protein_id gnl|my_center|LOCUS_02880 124990 123470 gene locus_tag LOCUS_02890 124990 123470 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024102.1 protein_id gnl|my_center|LOCUS_02890 125994 124987 gene locus_tag LOCUS_02900 125994 124987 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065933.1 protein_id gnl|my_center|LOCUS_02900 126163 127470 gene locus_tag LOCUS_02910 gene glnA 126163 127470 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392808.1 protein_id gnl|my_center|LOCUS_02910 128727 127711 gene locus_tag LOCUS_02920 128727 127711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 129182 128778 gene locus_tag LOCUS_02930 129182 128778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 129628 129308 gene locus_tag LOCUS_02940 129628 129308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 130528 129632 gene locus_tag LOCUS_02950 130528 129632 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869781.1 protein_id gnl|my_center|LOCUS_02950 131126 130668 gene locus_tag LOCUS_02960 gene tsaA 131126 130668 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877752.1 protein_id gnl|my_center|LOCUS_02960 131574 131131 gene locus_tag LOCUS_02970 131574 131131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02970 131661 132365 gene locus_tag LOCUS_02980 131661 132365 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526170.1 protein_id gnl|my_center|LOCUS_02980 133004 133471 gene locus_tag LOCUS_02990 133004 133471 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147291.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02990 133709 134167 gene locus_tag LOCUS_03000 133709 134167 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147291.1 protein_id gnl|my_center|LOCUS_03000 134217 134498 gene locus_tag LOCUS_03010 134217 134498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 134556 135014 gene locus_tag LOCUS_03020 134556 135014 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147291.1 protein_id gnl|my_center|LOCUS_03020 135511 135059 gene locus_tag LOCUS_03030 135511 135059 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980432.1 protein_id gnl|my_center|LOCUS_03030 135625 136554 gene locus_tag LOCUS_03040 135625 136554 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970730.1 protein_id gnl|my_center|LOCUS_03040 136634 137209 gene locus_tag LOCUS_03050 136634 137209 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940933.1 protein_id gnl|my_center|LOCUS_03050 137380 137216 gene locus_tag LOCUS_03060 137380 137216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 138560 137442 gene locus_tag LOCUS_03070 138560 137442 CDS product TIGR04084 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878081.1 protein_id gnl|my_center|LOCUS_03070 139107 138850 gene locus_tag LOCUS_03080 139107 138850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 140044 139109 gene locus_tag LOCUS_03090 140044 139109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 >Feature sequence03 800 378 gene locus_tag LOCUS_03100 800 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 857 1093 gene locus_tag LOCUS_03110 857 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 1524 2516 gene locus_tag LOCUS_03120 gene fgd 1524 2516 CDS product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225239.1 protein_id gnl|my_center|LOCUS_03120 2559 2948 gene locus_tag LOCUS_03130 2559 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 3311 3063 gene locus_tag LOCUS_03140 3311 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 3544 5556 gene locus_tag LOCUS_03150 3544 5556 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868460.1 protein_id gnl|my_center|LOCUS_03150 5544 5996 gene locus_tag LOCUS_03160 5544 5996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 6023 6934 gene locus_tag LOCUS_03170 6023 6934 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545174.1 protein_id gnl|my_center|LOCUS_03170 6954 7571 gene locus_tag LOCUS_03180 6954 7571 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021972.1 protein_id gnl|my_center|LOCUS_03180 7912 9099 gene locus_tag LOCUS_03190 7912 9099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 9882 9118 gene locus_tag LOCUS_03200 9882 9118 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020633.1 protein_id gnl|my_center|LOCUS_03200 10333 9875 gene locus_tag LOCUS_03210 10333 9875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 10376 10581 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10710 10886 gene locus_tag LOCUS_03220 10710 10886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 11092 11958 gene locus_tag LOCUS_03230 gene mdh 11092 11958 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903765.1 protein_id gnl|my_center|LOCUS_03230 11951 14389 gene locus_tag LOCUS_03240 11951 14389 CDS product DNA polymerase elongation subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902345.1 protein_id gnl|my_center|LOCUS_03240 14595 14954 gene locus_tag LOCUS_03250 14595 14954 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888340.1 protein_id gnl|my_center|LOCUS_03250 14965 16506 gene locus_tag LOCUS_03260 14965 16506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 17342 16659 gene locus_tag LOCUS_03270 17342 16659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 17477 17346 gene locus_tag LOCUS_03280 17477 17346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 18157 18341 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19636 19445 gene locus_tag LOCUS_03290 19636 19445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 19657 19957 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21094 20663 gene locus_tag LOCUS_03300 21094 20663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 21318 21950 gene locus_tag LOCUS_03310 21318 21950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 22122 23087 gene locus_tag LOCUS_03320 22122 23087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 24638 23097 gene locus_tag LOCUS_03330 24638 23097 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902894.1 protein_id gnl|my_center|LOCUS_03330 25330 24734 gene locus_tag LOCUS_03340 25330 24734 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021058.1 protein_id gnl|my_center|LOCUS_03340 27096 25327 gene locus_tag LOCUS_03350 gene iorA 27096 25327 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065029.1 protein_id gnl|my_center|LOCUS_03350 27203 27277 gene locus_tag LOCUS_t00070 27203 27277 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 27506 27579 gene locus_tag LOCUS_t00080 27506 27579 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 27931 28245 gene locus_tag LOCUS_03360 27931 28245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 28912 28583 gene locus_tag LOCUS_03370 28912 28583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 28936 29187 gene locus_tag LOCUS_03380 28936 29187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 30747 29470 gene locus_tag LOCUS_03390 30747 29470 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891593.1 protein_id gnl|my_center|LOCUS_03390 31198 32223 gene locus_tag LOCUS_03400 31198 32223 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256181.1 protein_id gnl|my_center|LOCUS_03400 32233 33408 gene locus_tag LOCUS_03410 gene tnpB 32233 33408 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054297574.1 protein_id gnl|my_center|LOCUS_03410 33446 34147 gene locus_tag LOCUS_03420 33446 34147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 35502 34225 gene locus_tag LOCUS_03430 gene serS 35502 34225 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868451.1 protein_id gnl|my_center|LOCUS_03430 35643 36095 gene locus_tag LOCUS_03440 35643 36095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 36675 36145 gene locus_tag LOCUS_03450 36675 36145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 37591 36746 gene locus_tag LOCUS_03460 37591 36746 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485751.1 protein_id gnl|my_center|LOCUS_03460 38360 37593 gene locus_tag LOCUS_03470 38360 37593 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_03470 39322 38357 gene locus_tag LOCUS_03480 39322 38357 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876243.1 protein_id gnl|my_center|LOCUS_03480 39832 39389 gene locus_tag LOCUS_03490 39832 39389 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066044.1 protein_id gnl|my_center|LOCUS_03490 41115 39877 gene locus_tag LOCUS_03500 41115 39877 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903362.1 protein_id gnl|my_center|LOCUS_03500 41253 42011 gene locus_tag LOCUS_03510 41253 42011 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060936.1 protein_id gnl|my_center|LOCUS_03510 42014 42907 gene locus_tag LOCUS_03520 gene nadA 42014 42907 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249251.1 protein_id gnl|my_center|LOCUS_03520 42912 43766 gene locus_tag LOCUS_03530 gene nadC 42912 43766 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867134.1 protein_id gnl|my_center|LOCUS_03530 44649 43705 gene locus_tag LOCUS_03540 44649 43705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 45336 44842 gene locus_tag LOCUS_03550 45336 44842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 45378 45920 gene locus_tag LOCUS_03560 45378 45920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 46762 46223 gene locus_tag LOCUS_03570 46762 46223 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846297.1 protein_id gnl|my_center|LOCUS_03570 46780 47187 gene locus_tag LOCUS_03580 46780 47187 CDS product UPF0146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878243.1 protein_id gnl|my_center|LOCUS_03580 48551 47184 gene locus_tag LOCUS_03590 48551 47184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 48798 49808 gene locus_tag LOCUS_03600 48798 49808 CDS product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024078.1 protein_id gnl|my_center|LOCUS_03600 49799 50560 gene locus_tag LOCUS_03610 gene mtxX 49799 50560 CDS product methanogenesis marker protein Mmp4/MtxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065223.1 protein_id gnl|my_center|LOCUS_03610 50748 50954 gene locus_tag LOCUS_03620 gene hpkA 50748 50954 CDS product archaeal histone HpkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250364.1 protein_id gnl|my_center|LOCUS_03620 51997 51272 gene locus_tag LOCUS_03630 51997 51272 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022767.1 protein_id gnl|my_center|LOCUS_03630 52330 53724 gene locus_tag LOCUS_03640 52330 53724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 53721 54263 gene locus_tag LOCUS_03650 gene cyaB 53721 54263 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879480.1 protein_id gnl|my_center|LOCUS_03650 54891 54250 gene locus_tag LOCUS_03660 54891 54250 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021463.1 protein_id gnl|my_center|LOCUS_03660 56004 54895 gene locus_tag LOCUS_03670 56004 54895 CDS product TIGR04013 family B12-binding domain/radical SAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020300.1 protein_id gnl|my_center|LOCUS_03670 56182 56931 gene locus_tag LOCUS_03680 56182 56931 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877445.1 protein_id gnl|my_center|LOCUS_03680 57695 56901 gene locus_tag LOCUS_03690 57695 56901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 57986 59056 gene locus_tag LOCUS_03700 57986 59056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 59295 59663 gene locus_tag LOCUS_03710 59295 59663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 59848 61059 gene locus_tag LOCUS_03720 59848 61059 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_03720 61056 62027 gene locus_tag LOCUS_03730 gene pfkA 61056 62027 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173968.1 protein_id gnl|my_center|LOCUS_03730 62594 62175 gene locus_tag LOCUS_03740 62594 62175 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023052.1 protein_id gnl|my_center|LOCUS_03740 63855 62680 gene locus_tag LOCUS_03750 63855 62680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 64856 63987 gene locus_tag LOCUS_03760 64856 63987 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065769.1 protein_id gnl|my_center|LOCUS_03760 65637 64909 gene locus_tag LOCUS_03770 65637 64909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 66338 65634 gene locus_tag LOCUS_03780 66338 65634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 67039 66338 gene locus_tag LOCUS_03790 67039 66338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 67551 67072 gene locus_tag LOCUS_03800 67551 67072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 68243 67548 gene locus_tag LOCUS_03810 68243 67548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 68884 68270 gene locus_tag LOCUS_03820 68884 68270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 69258 68881 gene locus_tag LOCUS_03830 69258 68881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 69900 69484 gene locus_tag LOCUS_03840 69900 69484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024361.1 protein_id gnl|my_center|LOCUS_03840 70144 70812 gene locus_tag LOCUS_03850 70144 70812 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202917.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03850 71387 73879 gene locus_tag LOCUS_03860 71387 73879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 74085 75131 gene locus_tag LOCUS_03870 74085 75131 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_03870 76018 75617 gene locus_tag LOCUS_03880 76018 75617 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023551.1 protein_id gnl|my_center|LOCUS_03880 76232 76789 gene locus_tag LOCUS_03890 76232 76789 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020434.1 protein_id gnl|my_center|LOCUS_03890 77642 76722 gene locus_tag LOCUS_03900 77642 76722 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933364.1 protein_id gnl|my_center|LOCUS_03900 77858 79087 gene locus_tag LOCUS_03910 77858 79087 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860110.1 protein_id gnl|my_center|LOCUS_03910 79202 79690 gene locus_tag LOCUS_03920 79202 79690 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438486.1 protein_id gnl|my_center|LOCUS_03920 79970 80149 gene locus_tag LOCUS_03930 79970 80149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03930 80115 80498 gene locus_tag LOCUS_03940 80115 80498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 80658 82202 gene locus_tag LOCUS_03950 80658 82202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 82189 82677 gene locus_tag LOCUS_03960 gene ahbB 82189 82677 CDS product siroheme decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064915.1 protein_id gnl|my_center|LOCUS_03960 82674 83861 gene locus_tag LOCUS_03970 gene ahbC 82674 83861 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938157.1 protein_id gnl|my_center|LOCUS_03970 85340 83883 gene locus_tag LOCUS_03980 85340 83883 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787371.1 protein_id gnl|my_center|LOCUS_03980 85908 86990 gene locus_tag LOCUS_03990 85908 86990 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461160.1 protein_id gnl|my_center|LOCUS_03990 87776 89146 gene locus_tag LOCUS_04000 87776 89146 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249095.1 protein_id gnl|my_center|LOCUS_04000 89672 89217 gene locus_tag LOCUS_04010 89672 89217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 90468 89665 gene locus_tag LOCUS_04020 90468 89665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 92642 90465 gene locus_tag LOCUS_04030 92642 90465 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 protein_id gnl|my_center|LOCUS_04030 93647 92652 gene locus_tag LOCUS_04040 93647 92652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 93825 93628 gene locus_tag LOCUS_04050 93825 93628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 94813 94091 gene locus_tag LOCUS_04060 94813 94091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 95149 94850 gene locus_tag LOCUS_04070 95149 94850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 95810 95184 gene locus_tag LOCUS_04080 95810 95184 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393334.1 protein_id gnl|my_center|LOCUS_04080 96663 95845 gene locus_tag LOCUS_04090 96663 95845 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065510.1 protein_id gnl|my_center|LOCUS_04090 97250 96675 gene locus_tag LOCUS_04100 97250 96675 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020386.1 protein_id gnl|my_center|LOCUS_04100 97421 97798 gene locus_tag LOCUS_04110 97421 97798 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020391.1 protein_id gnl|my_center|LOCUS_04110 97765 97944 gene locus_tag LOCUS_04120 97765 97944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 98425 99138 gene locus_tag LOCUS_04130 98425 99138 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023580.1 protein_id gnl|my_center|LOCUS_04130 99364 100428 gene locus_tag LOCUS_04140 99364 100428 CDS product TIGR04083 family peptide-modifying radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023249.1 protein_id gnl|my_center|LOCUS_04140 100497 100675 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 102548 100869 gene locus_tag LOCUS_04150 102548 100869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 103324 102545 gene locus_tag LOCUS_04160 103324 102545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 104603 103623 gene locus_tag LOCUS_04170 104603 103623 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090402.1 protein_id gnl|my_center|LOCUS_04170 104714 105808 gene locus_tag LOCUS_04180 gene rsgA 104714 105808 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023368.1 protein_id gnl|my_center|LOCUS_04180 106694 105912 gene locus_tag LOCUS_04190 106694 105912 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294685.1 protein_id gnl|my_center|LOCUS_04190 106859 107992 gene locus_tag LOCUS_04200 106859 107992 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065939.1 protein_id gnl|my_center|LOCUS_04200 108932 108060 gene locus_tag LOCUS_04210 108932 108060 CDS product bromoperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074319.1 protein_id gnl|my_center|LOCUS_04210 109070 109915 gene locus_tag LOCUS_04220 109070 109915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 110153 112315 gene locus_tag LOCUS_04230 110153 112315 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243331.1 protein_id gnl|my_center|LOCUS_04230 112854 112405 gene locus_tag LOCUS_04240 112854 112405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 113312 112929 gene locus_tag LOCUS_04250 113312 112929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 114085 113696 gene locus_tag LOCUS_04260 114085 113696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 115017 115235 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence04 780 1145 gene locus_tag LOCUS_04270 780 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 1164 1433 gene locus_tag LOCUS_04280 1164 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 1434 2351 gene locus_tag LOCUS_04290 gene hdrB 1434 2351 CDS product CoB--CoM heterodisulfide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870248.1 protein_id gnl|my_center|LOCUS_04290 2348 2629 gene locus_tag LOCUS_04300 2348 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 2622 4202 gene locus_tag LOCUS_04310 2622 4202 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545774.1 protein_id gnl|my_center|LOCUS_04310 4199 5128 gene locus_tag LOCUS_04320 4199 5128 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939562.1 protein_id gnl|my_center|LOCUS_04320 5125 5808 gene locus_tag LOCUS_04330 5125 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 5805 6224 gene locus_tag LOCUS_04340 5805 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 6367 7839 gene locus_tag LOCUS_04350 6367 7839 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388073.1 protein_id gnl|my_center|LOCUS_04350 7943 8347 gene locus_tag LOCUS_04360 gene hycI 7943 8347 CDS product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393669.1 protein_id gnl|my_center|LOCUS_04360 8987 8568 gene locus_tag LOCUS_04370 8987 8568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04370 9142 8972 gene locus_tag LOCUS_04380 9142 8972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 10048 9854 gene locus_tag LOCUS_04390 10048 9854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 10483 10064 gene locus_tag LOCUS_04400 10483 10064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 11312 10413 gene locus_tag LOCUS_04410 gene pstB 11312 10413 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878856.1 protein_id gnl|my_center|LOCUS_04410 12168 11317 gene locus_tag LOCUS_04420 12168 11317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 13084 12161 gene locus_tag LOCUS_04430 gene pstC 13084 12161 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877335.1 protein_id gnl|my_center|LOCUS_04430 14097 13090 gene locus_tag LOCUS_04440 gene pstS 14097 13090 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530168.1 protein_id gnl|my_center|LOCUS_04440 15880 14528 gene locus_tag LOCUS_04450 15880 14528 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250060.1 protein_id gnl|my_center|LOCUS_04450 16620 16168 gene locus_tag LOCUS_04460 16620 16168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 17687 16752 gene locus_tag LOCUS_04470 17687 16752 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_04470 19224 18355 gene locus_tag LOCUS_04480 19224 18355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 19535 19687 gene locus_tag LOCUS_04490 19535 19687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 20280 20642 gene locus_tag LOCUS_04500 20280 20642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 20621 21181 gene locus_tag LOCUS_04510 20621 21181 CDS product DUF5806 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903887.1 protein_id gnl|my_center|LOCUS_04510 21178 21879 gene locus_tag LOCUS_04520 21178 21879 CDS product molybdopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065273.1 protein_id gnl|my_center|LOCUS_04520 21894 23258 gene locus_tag LOCUS_04530 gene glmM 21894 23258 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868348.1 protein_id gnl|my_center|LOCUS_04530 23469 27035 gene locus_tag LOCUS_04540 23469 27035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 27032 27334 gene locus_tag LOCUS_04550 27032 27334 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081975.1 protein_id gnl|my_center|LOCUS_04550 28292 27300 gene locus_tag LOCUS_04560 28292 27300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 28257 28448 gene locus_tag LOCUS_04570 28257 28448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 28636 29907 gene locus_tag LOCUS_04580 28636 29907 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879505.1 protein_id gnl|my_center|LOCUS_04580 29907 31208 gene locus_tag LOCUS_04590 29907 31208 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023751.1 protein_id gnl|my_center|LOCUS_04590 31208 31636 gene locus_tag LOCUS_04600 31208 31636 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023752.1 protein_id gnl|my_center|LOCUS_04600 31744 32067 gene locus_tag LOCUS_04610 31744 32067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 33544 32255 gene locus_tag LOCUS_04620 33544 32255 CDS product bifunctional hexulose-6-phosphate synthase/ribonuclease regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878362.1 protein_id gnl|my_center|LOCUS_04620 33661 34623 gene locus_tag LOCUS_04630 33661 34623 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030964.1 protein_id gnl|my_center|LOCUS_04630 35008 34670 gene locus_tag LOCUS_04640 gene glnK1 35008 34670 CDS product P-II family nitrogen regulator GlnK1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869551.1 protein_id gnl|my_center|LOCUS_04640 36215 35022 gene locus_tag LOCUS_04650 36215 35022 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879245.1 protein_id gnl|my_center|LOCUS_04650 37072 36602 gene locus_tag LOCUS_04660 37072 36602 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582742.1 protein_id gnl|my_center|LOCUS_04660 38387 37191 gene locus_tag LOCUS_04670 38387 37191 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020067.1 protein_id gnl|my_center|LOCUS_04670 38922 38380 gene locus_tag LOCUS_04680 38922 38380 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902169.1 protein_id gnl|my_center|LOCUS_04680 39464 38910 gene locus_tag LOCUS_04690 39464 38910 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878817.1 protein_id gnl|my_center|LOCUS_04690 40519 39503 gene locus_tag LOCUS_04700 40519 39503 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867162.1 protein_id gnl|my_center|LOCUS_04700 40667 40940 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 41186 41503 gene locus_tag LOCUS_04710 41186 41503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 41715 41476 gene locus_tag LOCUS_04720 41715 41476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 41772 41990 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42038 42328 gene locus_tag LOCUS_04730 42038 42328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 42366 43247 gene locus_tag LOCUS_04740 42366 43247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 43459 43277 gene locus_tag LOCUS_04750 43459 43277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 43502 43749 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43880 45157 gene locus_tag LOCUS_04760 gene tuf 43880 45157 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021277.1 protein_id gnl|my_center|LOCUS_04760 45188 45496 gene locus_tag LOCUS_04770 gene rpsJ 45188 45496 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021276.1 protein_id gnl|my_center|LOCUS_04770 45509 47188 gene locus_tag LOCUS_04780 45509 47188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 49184 48102 gene locus_tag LOCUS_04790 49184 48102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 50361 49195 gene locus_tag LOCUS_04800 50361 49195 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064350.1 protein_id gnl|my_center|LOCUS_04800 50477 51709 gene locus_tag LOCUS_04810 50477 51709 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023973.1 protein_id gnl|my_center|LOCUS_04810 51702 52421 gene locus_tag LOCUS_04820 51702 52421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04820 52405 53385 gene locus_tag LOCUS_04830 52405 53385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04830 53375 55375 gene locus_tag LOCUS_04840 53375 55375 CDS product DUF2298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065896.1 protein_id gnl|my_center|LOCUS_04840 55560 55928 gene locus_tag LOCUS_04850 gene rpl7ae 55560 55928 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053601.1 protein_id gnl|my_center|LOCUS_04850 55941 56150 gene locus_tag LOCUS_04860 55941 56150 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065141.1 protein_id gnl|my_center|LOCUS_04860 56153 56344 gene locus_tag LOCUS_04870 56153 56344 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021537.1 protein_id gnl|my_center|LOCUS_04870 56350 56799 gene locus_tag LOCUS_04880 gene ndk 56350 56799 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_04880 57021 57674 gene locus_tag LOCUS_04890 57021 57674 CDS product NAAT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871201.1 protein_id gnl|my_center|LOCUS_04890 57671 57880 gene locus_tag LOCUS_04900 57671 57880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 57877 58674 gene locus_tag LOCUS_04910 57877 58674 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975129.1 protein_id gnl|my_center|LOCUS_04910 58684 59427 gene locus_tag LOCUS_04920 58684 59427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 59499 60704 gene locus_tag LOCUS_04930 gene thrC 59499 60704 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021620.1 protein_id gnl|my_center|LOCUS_04930 60749 61258 gene locus_tag LOCUS_04940 60749 61258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 61255 61830 gene locus_tag LOCUS_04950 61255 61830 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583025.1 protein_id gnl|my_center|LOCUS_04950 63773 62865 gene locus_tag LOCUS_04960 gene porB 63773 62865 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020090.1 protein_id gnl|my_center|LOCUS_04960 64928 63774 gene locus_tag LOCUS_04970 gene porA 64928 63774 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877345.1 protein_id gnl|my_center|LOCUS_04970 65188 64928 gene locus_tag LOCUS_04980 gene porD 65188 64928 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020092.1 protein_id gnl|my_center|LOCUS_04980 65691 65188 gene locus_tag LOCUS_04990 65691 65188 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_04990 66524 65907 gene locus_tag LOCUS_05000 66524 65907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 67486 66614 gene locus_tag LOCUS_05010 67486 66614 CDS product methanogenesis marker 12 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023754.1 protein_id gnl|my_center|LOCUS_05010 67695 68624 gene locus_tag LOCUS_05020 67695 68624 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877868.1 protein_id gnl|my_center|LOCUS_05020 68760 69914 gene locus_tag LOCUS_05030 68760 69914 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060815.1 protein_id gnl|my_center|LOCUS_05030 69987 71534 gene locus_tag LOCUS_05040 69987 71534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 72070 73155 gene locus_tag LOCUS_05050 72070 73155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 73152 74354 gene locus_tag LOCUS_05060 73152 74354 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296321.1 protein_id gnl|my_center|LOCUS_05060 75886 74438 gene locus_tag LOCUS_05070 75886 74438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 76380 77546 gene locus_tag LOCUS_05080 76380 77546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 77747 79966 gene locus_tag LOCUS_05090 77747 79966 CDS product DUF2206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021084.1 protein_id gnl|my_center|LOCUS_05090 81219 79978 gene locus_tag LOCUS_05100 81219 79978 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147032.1 protein_id gnl|my_center|LOCUS_05100 82114 81419 gene locus_tag LOCUS_05110 82114 81419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 82230 82463 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 86284 84629 gene locus_tag LOCUS_05120 86284 84629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 88079 86532 gene locus_tag LOCUS_05130 88079 86532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 88434 89030 gene locus_tag LOCUS_05140 88434 89030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 89094 90236 gene locus_tag LOCUS_05150 89094 90236 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020144.1 protein_id gnl|my_center|LOCUS_05150 90837 90286 gene locus_tag LOCUS_05160 90837 90286 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967173.1 protein_id gnl|my_center|LOCUS_05160 91080 92027 gene locus_tag LOCUS_05170 gene mch 91080 92027 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879428.1 protein_id gnl|my_center|LOCUS_05170 92092 92352 gene locus_tag LOCUS_05180 92092 92352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 92338 92411 gene locus_tag LOCUS_t00090 92338 92411 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence05 1822 407 gene locus_tag LOCUS_05190 1822 407 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485723.1 protein_id gnl|my_center|LOCUS_05190 2303 1809 gene locus_tag LOCUS_05200 2303 1809 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875952.1 protein_id gnl|my_center|LOCUS_05200 2955 3857 gene locus_tag LOCUS_05210 2955 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 4169 4310 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4320 4742 gene locus_tag LOCUS_05220 4320 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 5031 5270 gene locus_tag LOCUS_05230 5031 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 5898 5826 gene locus_tag LOCUS_t00100 5898 5826 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 6267 8048 gene locus_tag LOCUS_05240 gene infB 6267 8048 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065143.1 protein_id gnl|my_center|LOCUS_05240 8163 8561 gene locus_tag LOCUS_05250 8163 8561 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878018.1 protein_id gnl|my_center|LOCUS_05250 9257 8790 gene locus_tag LOCUS_05260 9257 8790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 9676 9254 gene locus_tag LOCUS_05270 9676 9254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 9785 11224 gene locus_tag LOCUS_05280 9785 11224 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877102.1 protein_id gnl|my_center|LOCUS_05280 11671 11294 gene locus_tag LOCUS_05290 11671 11294 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020961.1 protein_id gnl|my_center|LOCUS_05290 12425 11778 gene locus_tag LOCUS_05300 gene hypB 12425 11778 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869941.1 protein_id gnl|my_center|LOCUS_05300 12480 12752 gene locus_tag LOCUS_05310 12480 12752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 12758 13402 gene locus_tag LOCUS_05320 12758 13402 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065077.1 protein_id gnl|my_center|LOCUS_05320 13741 14754 gene locus_tag LOCUS_05330 13741 14754 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020659.1 protein_id gnl|my_center|LOCUS_05330 14776 14849 gene locus_tag LOCUS_t00110 14776 14849 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 16169 15156 gene locus_tag LOCUS_05340 16169 15156 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974005.1 protein_id gnl|my_center|LOCUS_05340 16343 17128 gene locus_tag LOCUS_05350 16343 17128 CDS product YhfC family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013710.1 protein_id gnl|my_center|LOCUS_05350 17991 17125 gene locus_tag LOCUS_05360 gene thiL 17991 17125 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066048.1 protein_id gnl|my_center|LOCUS_05360 19939 17984 gene locus_tag LOCUS_05370 19939 17984 CDS product DUF460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990592.1 protein_id gnl|my_center|LOCUS_05370 20793 19936 gene locus_tag LOCUS_05380 20793 19936 CDS product serine/threonine-protein kinase RIO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022486.1 protein_id gnl|my_center|LOCUS_05380 20843 21646 gene locus_tag LOCUS_05390 20843 21646 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021969.1 protein_id gnl|my_center|LOCUS_05390 22493 21771 gene locus_tag LOCUS_05400 22493 21771 CDS product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020865.1 protein_id gnl|my_center|LOCUS_05400 23773 22493 gene locus_tag LOCUS_05410 23773 22493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 23888 24628 gene locus_tag LOCUS_05420 23888 24628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 25368 24622 gene locus_tag LOCUS_05430 25368 24622 CDS product NrpR regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020866.1 protein_id gnl|my_center|LOCUS_05430 26272 25664 gene locus_tag LOCUS_05440 26272 25664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 26728 27696 gene locus_tag LOCUS_05450 26728 27696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 27703 29025 gene locus_tag LOCUS_05460 27703 29025 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892604.1 protein_id gnl|my_center|LOCUS_05460 30665 29043 gene locus_tag LOCUS_05470 30665 29043 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_238581565.1 protein_id gnl|my_center|LOCUS_05470 31134 32885 gene locus_tag LOCUS_05480 31134 32885 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462083.1 protein_id gnl|my_center|LOCUS_05480 32888 34642 gene locus_tag LOCUS_05490 32888 34642 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462084.1 protein_id gnl|my_center|LOCUS_05490 34657 35460 gene locus_tag LOCUS_05500 34657 35460 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494981.1 protein_id gnl|my_center|LOCUS_05500 35596 36258 gene locus_tag LOCUS_05510 35596 36258 CDS product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072772897.1 protein_id gnl|my_center|LOCUS_05510 36381 36938 gene locus_tag LOCUS_05520 36381 36938 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022735.1 protein_id gnl|my_center|LOCUS_05520 37641 37845 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38545 39120 gene locus_tag LOCUS_05530 38545 39120 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767703.1 protein_id gnl|my_center|LOCUS_05530 39117 39296 gene locus_tag LOCUS_05540 39117 39296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 39268 39960 gene locus_tag LOCUS_05550 39268 39960 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279101.1 protein_id gnl|my_center|LOCUS_05550 40158 40823 gene locus_tag LOCUS_05560 40158 40823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_05560 40823 42022 gene locus_tag LOCUS_05570 40823 42022 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064319.1 protein_id gnl|my_center|LOCUS_05570 42039 43232 gene locus_tag LOCUS_05580 42039 43232 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064319.1 protein_id gnl|my_center|LOCUS_05580 43321 43584 gene locus_tag LOCUS_05590 43321 43584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 43912 45117 gene locus_tag LOCUS_05600 43912 45117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 45140 45796 gene locus_tag LOCUS_05610 45140 45796 CDS product NAAT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871201.1 protein_id gnl|my_center|LOCUS_05610 45793 46767 gene locus_tag LOCUS_05620 45793 46767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 46976 47434 gene locus_tag LOCUS_05630 46976 47434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 47436 48524 gene locus_tag LOCUS_05640 47436 48524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 50125 48791 gene locus_tag LOCUS_05650 50125 48791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 50792 50163 gene locus_tag LOCUS_05660 gene rnhB 50792 50163 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878125.1 protein_id gnl|my_center|LOCUS_05660 50848 51513 gene locus_tag LOCUS_05670 50848 51513 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904055.1 protein_id gnl|my_center|LOCUS_05670 52701 51505 gene locus_tag LOCUS_05680 52701 51505 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021498.1 protein_id gnl|my_center|LOCUS_05680 52700 52993 gene locus_tag LOCUS_05690 52700 52993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 53059 53589 gene locus_tag LOCUS_05700 gene cbiT 53059 53589 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024144.1 protein_id gnl|my_center|LOCUS_05700 53580 54197 gene locus_tag LOCUS_05710 53580 54197 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024143.1 protein_id gnl|my_center|LOCUS_05710 54190 54906 gene locus_tag LOCUS_05720 54190 54906 CDS product cobalt-precorrin-4/precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024142.1 protein_id gnl|my_center|LOCUS_05720 54903 55775 gene locus_tag LOCUS_05730 gene cbiG 54903 55775 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903134.1 protein_id gnl|my_center|LOCUS_05730 55759 56538 gene locus_tag LOCUS_05740 gene cobJ 55759 56538 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024141.1 protein_id gnl|my_center|LOCUS_05740 56486 57166 gene locus_tag LOCUS_05750 56486 57166 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024140.1 protein_id gnl|my_center|LOCUS_05750 57147 58160 gene locus_tag LOCUS_05760 57147 58160 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020570.1 protein_id gnl|my_center|LOCUS_05760 58157 58729 gene locus_tag LOCUS_05770 58157 58729 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020569.1 protein_id gnl|my_center|LOCUS_05770 59102 58752 gene locus_tag LOCUS_05780 59102 58752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 60129 59191 gene locus_tag LOCUS_05790 60129 59191 CDS product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142703.1 protein_id gnl|my_center|LOCUS_05790 60995 60276 gene locus_tag LOCUS_05800 60995 60276 CDS product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020356.1 protein_id gnl|my_center|LOCUS_05800 61912 60974 gene locus_tag LOCUS_05810 61912 60974 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020357.1 protein_id gnl|my_center|LOCUS_05810 62805 61909 gene locus_tag LOCUS_05820 62805 61909 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020358.1 protein_id gnl|my_center|LOCUS_05820 63739 62798 gene locus_tag LOCUS_05830 63739 62798 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020359.1 protein_id gnl|my_center|LOCUS_05830 64505 63744 gene locus_tag LOCUS_05840 64505 63744 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020355.1 protein_id gnl|my_center|LOCUS_05840 66066 64516 gene locus_tag LOCUS_05850 66066 64516 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020360.1 protein_id gnl|my_center|LOCUS_05850 66831 66067 gene locus_tag LOCUS_05860 66831 66067 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020355.1 protein_id gnl|my_center|LOCUS_05860 68361 67030 gene locus_tag LOCUS_05870 68361 67030 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020360.1 protein_id gnl|my_center|LOCUS_05870 68383 68565 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 69934 69215 gene locus_tag LOCUS_05880 69934 69215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 70397 70663 gene locus_tag LOCUS_05890 70397 70663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 70739 71287 gene locus_tag LOCUS_05900 70739 71287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 72418 71387 gene locus_tag LOCUS_05910 72418 71387 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393185.1 protein_id gnl|my_center|LOCUS_05910 73963 72464 gene locus_tag LOCUS_05920 gene pyk 73963 72464 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066546.1 protein_id gnl|my_center|LOCUS_05920 74027 74149 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 75403 74198 gene locus_tag LOCUS_05930 75403 74198 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023466.1 protein_id gnl|my_center|LOCUS_05930 76176 75400 gene locus_tag LOCUS_05940 gene cbiQ 76176 75400 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065744.1 protein_id gnl|my_center|LOCUS_05940 76501 76211 gene locus_tag LOCUS_05950 76501 76211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 77190 76498 gene locus_tag LOCUS_05960 77190 76498 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023469.1 protein_id gnl|my_center|LOCUS_05960 77321 78652 gene locus_tag LOCUS_05970 77321 78652 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064814.1 protein_id gnl|my_center|LOCUS_05970 79309 78692 gene locus_tag LOCUS_05980 79309 78692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 79614 80462 gene locus_tag LOCUS_05990 79614 80462 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929171.1 protein_id gnl|my_center|LOCUS_05990 80526 81722 gene locus_tag LOCUS_06000 80526 81722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 81772 82917 gene locus_tag LOCUS_06010 81772 82917 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257886.1 protein_id gnl|my_center|LOCUS_06010 83616 82960 gene locus_tag LOCUS_06020 83616 82960 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990768.1 protein_id gnl|my_center|LOCUS_06020 84412 84810 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccctatcgggttttctcatcagctgagac >Feature sequence06 2226 2430 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4355 2703 gene locus_tag LOCUS_06030 4355 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 5526 4339 gene locus_tag LOCUS_06040 5526 4339 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020137.1 protein_id gnl|my_center|LOCUS_06040 6788 5793 gene locus_tag LOCUS_06050 6788 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 7624 7037 gene locus_tag LOCUS_06060 7624 7037 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990826.1 protein_id gnl|my_center|LOCUS_06060 8211 7795 gene locus_tag LOCUS_06070 gene glxB 8211 7795 CDS product methylglyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243237.1 protein_id gnl|my_center|LOCUS_06070 8368 8559 gene locus_tag LOCUS_06080 8368 8559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 8666 8944 gene locus_tag LOCUS_06090 8666 8944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 9566 10090 gene locus_tag LOCUS_06100 9566 10090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 10721 10095 gene locus_tag LOCUS_06110 10721 10095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 10974 10711 gene locus_tag LOCUS_06120 10974 10711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 11664 11593 gene locus_tag LOCUS_t00120 11664 11593 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 12855 11722 gene locus_tag LOCUS_06130 12855 11722 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868844.1 protein_id gnl|my_center|LOCUS_06130 13016 13687 gene locus_tag LOCUS_06140 gene mtnP 13016 13687 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879284.1 protein_id gnl|my_center|LOCUS_06140 13684 15000 gene locus_tag LOCUS_06150 13684 15000 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_06150 16751 15024 gene locus_tag LOCUS_06160 16751 15024 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941764.1 protein_id gnl|my_center|LOCUS_06160 17168 18355 gene locus_tag LOCUS_06170 17168 18355 CDS product bifunctional 5,6,7,8-tetrahydromethanopterin hydro-lyase/3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024481.1 protein_id gnl|my_center|LOCUS_06170 18464 19030 gene locus_tag LOCUS_06180 18464 19030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 19032 20519 gene locus_tag LOCUS_06190 19032 20519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 21680 20580 gene locus_tag LOCUS_06200 21680 20580 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064863.1 protein_id gnl|my_center|LOCUS_06200 22196 21693 gene locus_tag LOCUS_06210 22196 21693 CDS product DUF2148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022484.1 protein_id gnl|my_center|LOCUS_06210 22271 22816 gene locus_tag LOCUS_06220 gene msrA 22271 22816 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943782.1 protein_id gnl|my_center|LOCUS_06220 23716 23291 gene locus_tag LOCUS_06230 23716 23291 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937904.1 protein_id gnl|my_center|LOCUS_06230 24419 23721 gene locus_tag LOCUS_06240 24419 23721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 25393 24416 gene locus_tag LOCUS_06250 25393 24416 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584074.1 protein_id gnl|my_center|LOCUS_06250 26730 25390 gene locus_tag LOCUS_06260 26730 25390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 27993 26869 gene locus_tag LOCUS_06270 27993 26869 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964038.1 protein_id gnl|my_center|LOCUS_06270 29541 28144 gene locus_tag LOCUS_06280 29541 28144 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965302.1 protein_id gnl|my_center|LOCUS_06280 30069 30266 gene locus_tag LOCUS_06290 30069 30266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 31897 30509 gene locus_tag LOCUS_06300 31897 30509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 32604 32296 gene locus_tag LOCUS_06310 32604 32296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 33038 32730 gene locus_tag LOCUS_06320 33038 32730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 33478 33831 gene locus_tag LOCUS_06330 33478 33831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 35447 34263 gene locus_tag LOCUS_06340 35447 34263 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964643.1 protein_id gnl|my_center|LOCUS_06340 35775 35455 gene locus_tag LOCUS_06350 35775 35455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 37461 35875 gene locus_tag LOCUS_06360 37461 35875 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274408.1 protein_id gnl|my_center|LOCUS_06360 38155 37667 gene locus_tag LOCUS_06370 gene ilvN 38155 37667 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_06370 39843 38167 gene locus_tag LOCUS_06380 39843 38167 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_06380 41327 39840 gene locus_tag LOCUS_06390 41327 39840 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589535.1 protein_id gnl|my_center|LOCUS_06390 42086 41412 gene locus_tag LOCUS_06400 42086 41412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 42783 42235 gene locus_tag LOCUS_06410 42783 42235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 45109 43625 gene locus_tag LOCUS_06420 gene purH 45109 43625 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187534.1 protein_id gnl|my_center|LOCUS_06420 45393 45902 gene locus_tag LOCUS_06430 45393 45902 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107672.1 protein_id gnl|my_center|LOCUS_06430 45907 47748 gene locus_tag LOCUS_06440 gene dnaK 45907 47748 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_06440 47754 48911 gene locus_tag LOCUS_06450 gene dnaJ 47754 48911 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357822.1 protein_id gnl|my_center|LOCUS_06450 49454 49026 gene locus_tag LOCUS_06460 49454 49026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 50216 49578 gene locus_tag LOCUS_06470 50216 49578 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450361.1 protein_id gnl|my_center|LOCUS_06470 50678 51640 gene locus_tag LOCUS_06480 50678 51640 CDS product TRM11 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020267.1 protein_id gnl|my_center|LOCUS_06480 51698 52066 gene locus_tag LOCUS_06490 51698 52066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 52217 52396 gene locus_tag LOCUS_06500 52217 52396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 52676 52864 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 53745 54512 gene locus_tag LOCUS_06510 53745 54512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 54523 55329 gene locus_tag LOCUS_06520 54523 55329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 55885 56098 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 56213 56968 gene locus_tag LOCUS_06530 56213 56968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 57460 57263 gene locus_tag LOCUS_06540 57460 57263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 58639 58091 gene locus_tag LOCUS_06550 58639 58091 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_06550 59259 58654 gene locus_tag LOCUS_06560 59259 58654 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101939.1 protein_id gnl|my_center|LOCUS_06560 60726 59776 gene locus_tag LOCUS_06570 60726 59776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 63515 60729 gene locus_tag LOCUS_06580 63515 60729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 63974 64216 gene locus_tag LOCUS_06590 63974 64216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 65229 64177 gene locus_tag LOCUS_06600 65229 64177 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186160.1 protein_id gnl|my_center|LOCUS_06600 66251 65244 gene locus_tag LOCUS_06610 gene gap 66251 65244 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219957.1 protein_id gnl|my_center|LOCUS_06610 67083 66337 gene locus_tag LOCUS_06620 gene gpmA 67083 66337 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942257.1 protein_id gnl|my_center|LOCUS_06620 67540 67668 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 68041 68181 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 69435 70295 gene locus_tag LOCUS_06630 69435 70295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 70753 70334 gene locus_tag LOCUS_06640 70753 70334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 72637 70790 gene locus_tag LOCUS_06650 72637 70790 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940249.1 protein_id gnl|my_center|LOCUS_06650 73903 73262 gene locus_tag LOCUS_06660 73903 73262 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990722.1 protein_id gnl|my_center|LOCUS_06660 74226 76292 gene locus_tag LOCUS_06670 gene fdhF 74226 76292 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774551.1 protein_id gnl|my_center|LOCUS_06670 >Feature sequence07 356 48 gene locus_tag LOCUS_06680 356 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 943 362 gene locus_tag LOCUS_06690 943 362 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042684532.1 protein_id gnl|my_center|LOCUS_06690 1305 1982 gene locus_tag LOCUS_06700 1305 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 3073 2189 gene locus_tag LOCUS_06710 gene speB 3073 2189 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023880.1 protein_id gnl|my_center|LOCUS_06710 3443 3066 gene locus_tag LOCUS_06720 gene eif5A 3443 3066 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878148.1 protein_id gnl|my_center|LOCUS_06720 3535 4311 gene locus_tag LOCUS_06730 3535 4311 CDS product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023274.1 protein_id gnl|my_center|LOCUS_06730 4320 5132 gene locus_tag LOCUS_06740 4320 5132 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023273.1 protein_id gnl|my_center|LOCUS_06740 5205 5921 gene locus_tag LOCUS_06750 5205 5921 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876165.1 protein_id gnl|my_center|LOCUS_06750 6035 6526 gene locus_tag LOCUS_06760 6035 6526 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878434.1 protein_id gnl|my_center|LOCUS_06760 6526 7512 gene locus_tag LOCUS_06770 6526 7512 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871127.1 protein_id gnl|my_center|LOCUS_06770 7538 8620 gene locus_tag LOCUS_06780 7538 8620 CDS product DUF1743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877003.1 protein_id gnl|my_center|LOCUS_06780 8656 8814 gene locus_tag LOCUS_06790 8656 8814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 9273 9010 gene locus_tag LOCUS_06800 9273 9010 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878730.1 protein_id gnl|my_center|LOCUS_06800 9446 10264 gene locus_tag LOCUS_06810 gene artA 9446 10264 CDS product archaeosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879538.1 protein_id gnl|my_center|LOCUS_06810 11741 11109 gene locus_tag LOCUS_06820 11741 11109 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880790.1 protein_id gnl|my_center|LOCUS_06820 11953 12633 gene locus_tag LOCUS_06830 11953 12633 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880245.1 protein_id gnl|my_center|LOCUS_06830 13919 12648 gene locus_tag LOCUS_06840 gene truD 13919 12648 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065655.1 protein_id gnl|my_center|LOCUS_06840 14278 13916 gene locus_tag LOCUS_06850 gene pth2 14278 13916 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023203.1 protein_id gnl|my_center|LOCUS_06850 14460 15590 gene locus_tag LOCUS_06860 14460 15590 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022842.1 protein_id gnl|my_center|LOCUS_06860 15647 16291 gene locus_tag LOCUS_06870 gene cbiM 15647 16291 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065876.1 protein_id gnl|my_center|LOCUS_06870 16291 16641 gene locus_tag LOCUS_06880 16291 16641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 16672 17505 gene locus_tag LOCUS_06890 16672 17505 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023914.1 protein_id gnl|my_center|LOCUS_06890 17502 18317 gene locus_tag LOCUS_06900 gene cbiQ 17502 18317 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023913.1 protein_id gnl|my_center|LOCUS_06900 18381 18695 gene locus_tag LOCUS_06910 18381 18695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 18937 20907 gene locus_tag LOCUS_06920 gene gyrB 18937 20907 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021594.1 protein_id gnl|my_center|LOCUS_06920 20897 23323 gene locus_tag LOCUS_06930 gene gyrA 20897 23323 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021593.1 protein_id gnl|my_center|LOCUS_06930 23527 24279 gene locus_tag LOCUS_06940 23527 24279 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878632.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06940 24276 24497 gene locus_tag LOCUS_06950 24276 24497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 24494 24730 gene locus_tag LOCUS_06960 24494 24730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06960 24694 25326 gene locus_tag LOCUS_06970 24694 25326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 25412 25828 gene locus_tag LOCUS_06980 25412 25828 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_06980 26213 25950 gene locus_tag LOCUS_06990 26213 25950 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064806.1 protein_id gnl|my_center|LOCUS_06990 26280 26648 gene locus_tag LOCUS_07000 26280 26648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 28882 26639 gene locus_tag LOCUS_07010 28882 26639 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878955.1 protein_id gnl|my_center|LOCUS_07010 30609 28879 gene locus_tag LOCUS_07020 gene glyS 30609 28879 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096515.1 protein_id gnl|my_center|LOCUS_07020 30921 31529 gene locus_tag LOCUS_07030 30921 31529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 31598 32272 gene locus_tag LOCUS_07040 31598 32272 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021328.1 protein_id gnl|my_center|LOCUS_07040 32660 33622 gene locus_tag LOCUS_07050 32660 33622 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876261.1 protein_id gnl|my_center|LOCUS_07050 34614 33964 gene locus_tag LOCUS_07060 gene phoU 34614 33964 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_07060 35384 34620 gene locus_tag LOCUS_07070 gene pstB 35384 34620 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020934.1 protein_id gnl|my_center|LOCUS_07070 37463 35391 gene locus_tag LOCUS_07080 37463 35391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 37601 38608 gene locus_tag LOCUS_07090 37601 38608 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902294.1 protein_id gnl|my_center|LOCUS_07090 38686 39939 gene locus_tag LOCUS_07100 38686 39939 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020830.1 protein_id gnl|my_center|LOCUS_07100 40837 39947 gene locus_tag LOCUS_07110 40837 39947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 41516 41040 gene locus_tag LOCUS_07120 41516 41040 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876721.1 protein_id gnl|my_center|LOCUS_07120 41866 43152 gene locus_tag LOCUS_07130 41866 43152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 43678 43181 gene locus_tag LOCUS_07140 43678 43181 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867756.1 protein_id gnl|my_center|LOCUS_07140 44232 44002 gene locus_tag LOCUS_07150 44232 44002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 44385 46022 gene locus_tag LOCUS_07160 44385 46022 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938901.1 protein_id gnl|my_center|LOCUS_07160 46019 46699 gene locus_tag LOCUS_07170 46019 46699 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870952.1 protein_id gnl|my_center|LOCUS_07170 46894 46709 gene locus_tag LOCUS_07180 46894 46709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 47047 48861 gene locus_tag LOCUS_07190 gene recQ 47047 48861 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707789.1 protein_id gnl|my_center|LOCUS_07190 48931 49899 gene locus_tag LOCUS_07200 48931 49899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 50046 50450 gene locus_tag LOCUS_07210 50046 50450 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022524.1 protein_id gnl|my_center|LOCUS_07210 50694 50609 gene locus_tag LOCUS_t00130 50694 50609 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 51819 50734 gene locus_tag LOCUS_07220 51819 50734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 51848 52834 gene locus_tag LOCUS_07230 51848 52834 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878512.1 protein_id gnl|my_center|LOCUS_07230 54063 52831 gene locus_tag LOCUS_07240 54063 52831 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878773.1 protein_id gnl|my_center|LOCUS_07240 54745 54131 gene locus_tag LOCUS_07250 54745 54131 CDS product TIGR00454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052457366.1 protein_id gnl|my_center|LOCUS_07250 55731 54733 gene locus_tag LOCUS_07260 55731 54733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 56119 57243 gene locus_tag LOCUS_07270 gene ftsZ 56119 57243 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023772.1 protein_id gnl|my_center|LOCUS_07270 57599 58459 gene locus_tag LOCUS_07280 57599 58459 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902245.1 protein_id gnl|my_center|LOCUS_07280 58518 59645 gene locus_tag LOCUS_07290 58518 59645 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066217.1 protein_id gnl|my_center|LOCUS_07290 60635 60192 gene locus_tag LOCUS_07300 60635 60192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 61160 60885 gene locus_tag LOCUS_07310 gene albA 61160 60885 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878567.1 protein_id gnl|my_center|LOCUS_07310 62055 61174 gene locus_tag LOCUS_07320 gene asd 62055 61174 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020482.1 protein_id gnl|my_center|LOCUS_07320 63231 62473 gene locus_tag LOCUS_07330 gene dapB 63231 62473 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024350.1 protein_id gnl|my_center|LOCUS_07330 64099 63224 gene locus_tag LOCUS_07340 gene dapA 64099 63224 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024349.1 protein_id gnl|my_center|LOCUS_07340 64298 64110 gene locus_tag LOCUS_07350 64298 64110 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878411.1 protein_id gnl|my_center|LOCUS_07350 64961 64311 gene locus_tag LOCUS_07360 64961 64311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 64979 65161 gene locus_tag LOCUS_07370 64979 65161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 66244 65240 gene locus_tag LOCUS_07380 gene priL 66244 65240 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020168.1 protein_id gnl|my_center|LOCUS_07380 66987 66244 gene locus_tag LOCUS_07390 66987 66244 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903677.1 protein_id gnl|my_center|LOCUS_07390 67193 67804 gene locus_tag LOCUS_07400 67193 67804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 67782 68660 gene locus_tag LOCUS_07410 gene moaA 67782 68660 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020164.1 protein_id gnl|my_center|LOCUS_07410 68791 69099 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 69177 69686 gene locus_tag LOCUS_07420 69177 69686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 69699 70868 gene locus_tag LOCUS_07430 69699 70868 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979578.1 protein_id gnl|my_center|LOCUS_07430 71147 72268 gene locus_tag LOCUS_07440 71147 72268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 72322 72637 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence08 243 650 gene locus_tag LOCUS_07450 243 650 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_07450 737 988 gene locus_tag LOCUS_07460 737 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 1379 1294 gene locus_tag LOCUS_t00140 1379 1294 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1560 1841 gene locus_tag LOCUS_07470 1560 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 1846 2502 gene locus_tag LOCUS_07480 1846 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 4404 2602 gene locus_tag LOCUS_07490 4404 2602 CDS product DUF2070 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902126.1 protein_id gnl|my_center|LOCUS_07490 5315 4425 gene locus_tag LOCUS_07500 5315 4425 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021391.1 protein_id gnl|my_center|LOCUS_07500 5593 5312 gene locus_tag LOCUS_07510 5593 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 6199 5672 gene locus_tag LOCUS_07520 6199 5672 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877737.1 protein_id gnl|my_center|LOCUS_07520 6542 6186 gene locus_tag LOCUS_07530 6542 6186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 6903 6598 gene locus_tag LOCUS_07540 6903 6598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 8865 7006 gene locus_tag LOCUS_07550 gene gatE 8865 7006 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022814.1 protein_id gnl|my_center|LOCUS_07550 10066 8855 gene locus_tag LOCUS_07560 gene gatD 10066 8855 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021336.1 protein_id gnl|my_center|LOCUS_07560 11571 10093 gene locus_tag LOCUS_07570 gene argH 11571 10093 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021337.1 protein_id gnl|my_center|LOCUS_07570 12107 13099 gene locus_tag LOCUS_07580 12107 13099 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020124.1 protein_id gnl|my_center|LOCUS_07580 13234 14010 gene locus_tag LOCUS_07590 13234 14010 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020123.1 protein_id gnl|my_center|LOCUS_07590 14012 14773 gene locus_tag LOCUS_07600 14012 14773 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_07600 14835 15347 gene locus_tag LOCUS_07610 14835 15347 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020241.1 protein_id gnl|my_center|LOCUS_07610 15446 16282 gene locus_tag LOCUS_07620 15446 16282 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065423.1 protein_id gnl|my_center|LOCUS_07620 16279 16824 gene locus_tag LOCUS_07630 16279 16824 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867611.1 protein_id gnl|my_center|LOCUS_07630 16836 17108 gene locus_tag LOCUS_07640 16836 17108 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869641.1 protein_id gnl|my_center|LOCUS_07640 17373 17185 gene locus_tag LOCUS_07650 17373 17185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 18083 18324 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18339 19127 gene locus_tag LOCUS_07660 18339 19127 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870041.1 protein_id gnl|my_center|LOCUS_07660 19124 19672 gene locus_tag LOCUS_07670 19124 19672 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250074.1 protein_id gnl|my_center|LOCUS_07670 19659 20744 gene locus_tag LOCUS_07680 gene sucC 19659 20744 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869705.1 protein_id gnl|my_center|LOCUS_07680 20741 21607 gene locus_tag LOCUS_07690 gene sucD 20741 21607 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879674.1 protein_id gnl|my_center|LOCUS_07690 21604 22416 gene locus_tag LOCUS_07700 21604 22416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 22477 23679 gene locus_tag LOCUS_07710 22477 23679 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020274.1 protein_id gnl|my_center|LOCUS_07710 23709 24608 gene locus_tag LOCUS_07720 gene hisG 23709 24608 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020275.1 protein_id gnl|my_center|LOCUS_07720 24613 25332 gene locus_tag LOCUS_07730 gene hisA 24613 25332 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903708.1 protein_id gnl|my_center|LOCUS_07730 25319 25903 gene locus_tag LOCUS_07740 gene hisB 25319 25903 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020277.1 protein_id gnl|my_center|LOCUS_07740 26582 25914 gene locus_tag LOCUS_07750 gene nth 26582 25914 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546206.1 protein_id gnl|my_center|LOCUS_07750 26662 26588 gene locus_tag LOCUS_t00150 26662 26588 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 27421 26717 gene locus_tag LOCUS_07760 gene pyrH 27421 26717 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020429.1 protein_id gnl|my_center|LOCUS_07760 27594 28607 gene locus_tag LOCUS_07770 gene amrS 27594 28607 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023404.1 protein_id gnl|my_center|LOCUS_07770 28630 29079 gene locus_tag LOCUS_07780 28630 29079 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878928.1 protein_id gnl|my_center|LOCUS_07780 30207 29155 gene locus_tag LOCUS_07790 30207 29155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877363.1 protein_id gnl|my_center|LOCUS_07790 30426 33821 gene locus_tag LOCUS_07800 30426 33821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 34499 33831 gene locus_tag LOCUS_07810 34499 33831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 35021 34554 gene locus_tag LOCUS_07820 35021 34554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 35162 35647 gene locus_tag LOCUS_07830 gene msrB 35162 35647 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057056.1 protein_id gnl|my_center|LOCUS_07830 36721 35666 gene locus_tag LOCUS_07840 36721 35666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 38001 36811 gene locus_tag LOCUS_07850 38001 36811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 38129 38752 gene locus_tag LOCUS_07860 38129 38752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 39470 39697 gene locus_tag LOCUS_07870 39470 39697 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868354.1 protein_id gnl|my_center|LOCUS_07870 39697 40038 gene locus_tag LOCUS_07880 gene hypA 39697 40038 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060898.1 protein_id gnl|my_center|LOCUS_07880 40035 41030 gene locus_tag LOCUS_07890 gene hypE 40035 41030 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060768.1 protein_id gnl|my_center|LOCUS_07890 41131 41562 gene locus_tag LOCUS_07900 41131 41562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 41566 42480 gene locus_tag LOCUS_07910 41566 42480 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065217.1 protein_id gnl|my_center|LOCUS_07910 42477 43736 gene locus_tag LOCUS_07920 42477 43736 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020936.1 protein_id gnl|my_center|LOCUS_07920 43891 44119 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 44435 44624 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 44747 45949 gene locus_tag LOCUS_07930 gene dnaG 44747 45949 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879392.1 protein_id gnl|my_center|LOCUS_07930 46013 46297 gene locus_tag LOCUS_07940 46013 46297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 47118 46324 gene locus_tag LOCUS_07950 47118 46324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 47197 47700 gene locus_tag LOCUS_07960 47197 47700 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021168.1 protein_id gnl|my_center|LOCUS_07960 47845 48423 gene locus_tag LOCUS_07970 47845 48423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 48444 48953 gene locus_tag LOCUS_07980 48444 48953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 48984 49772 gene locus_tag LOCUS_07990 48984 49772 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320034.1 protein_id gnl|my_center|LOCUS_07990 50089 50331 gene locus_tag LOCUS_08000 50089 50331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 50331 50894 gene locus_tag LOCUS_08010 50331 50894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943054.1 protein_id gnl|my_center|LOCUS_08010 50904 51821 gene locus_tag LOCUS_08020 50904 51821 CDS product methyl viologen-reducing hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943055.1 protein_id gnl|my_center|LOCUS_08020 51818 53185 gene locus_tag LOCUS_08030 51818 53185 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_08030 53198 53545 gene locus_tag LOCUS_08040 53198 53545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 53550 54221 gene locus_tag LOCUS_08050 53550 54221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 55952 54483 gene locus_tag LOCUS_08060 55952 54483 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060907.1 protein_id gnl|my_center|LOCUS_08060 56032 56595 gene locus_tag LOCUS_08070 56032 56595 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023239.1 protein_id gnl|my_center|LOCUS_08070 56589 57101 gene locus_tag LOCUS_08080 gene pyrE 56589 57101 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870621.1 protein_id gnl|my_center|LOCUS_08080 57127 58419 gene locus_tag LOCUS_08090 gene purD 57127 58419 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065667.1 protein_id gnl|my_center|LOCUS_08090 58416 59345 gene locus_tag LOCUS_08100 gene argF 58416 59345 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878750.1 protein_id gnl|my_center|LOCUS_08100 60375 59650 gene locus_tag LOCUS_08110 60375 59650 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184045.1 protein_id gnl|my_center|LOCUS_08110 61121 60885 gene locus_tag LOCUS_08120 61121 60885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 62488 61136 gene locus_tag LOCUS_08130 62488 61136 CDS product methanogenesis marker 14 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024395.1 protein_id gnl|my_center|LOCUS_08130 63123 63527 gene locus_tag LOCUS_08140 63123 63527 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022524.1 protein_id gnl|my_center|LOCUS_08140 64723 63536 gene locus_tag LOCUS_08150 64723 63536 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022128.1 protein_id gnl|my_center|LOCUS_08150 65160 66419 gene locus_tag LOCUS_08160 65160 66419 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172728.1 protein_id gnl|my_center|LOCUS_08160 66406 67248 gene locus_tag LOCUS_08170 66406 67248 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022132.1 protein_id gnl|my_center|LOCUS_08170 67677 67489 gene locus_tag LOCUS_08180 67677 67489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 67591 68466 gene locus_tag LOCUS_08190 67591 68466 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022133.1 protein_id gnl|my_center|LOCUS_08190 68415 68633 gene locus_tag LOCUS_08200 68415 68633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 72398 69228 gene locus_tag LOCUS_08210 gene carB 72398 69228 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022129.1 protein_id gnl|my_center|LOCUS_08210 73453 72398 gene locus_tag LOCUS_08220 gene carA 73453 72398 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022130.1 protein_id gnl|my_center|LOCUS_08220 >Feature sequence09 2118 616 gene locus_tag LOCUS_08230 2118 616 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 protein_id gnl|my_center|LOCUS_08230 2339 3436 gene locus_tag LOCUS_08240 2339 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 4169 4002 gene locus_tag LOCUS_08250 4169 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 4241 4452 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5967 6626 gene locus_tag LOCUS_08260 gene radC 5967 6626 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546157.1 protein_id gnl|my_center|LOCUS_08260 7054 6833 gene locus_tag LOCUS_08270 7054 6833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 7260 8168 gene locus_tag LOCUS_08280 7260 8168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 8170 9312 gene locus_tag LOCUS_08290 8170 9312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 9318 9989 gene locus_tag LOCUS_08300 9318 9989 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_08300 9986 11131 gene locus_tag LOCUS_08310 9986 11131 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064319.1 protein_id gnl|my_center|LOCUS_08310 11390 11136 gene locus_tag LOCUS_08320 11390 11136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 12060 11383 gene locus_tag LOCUS_08330 12060 11383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 12545 12081 gene locus_tag LOCUS_08340 12545 12081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 13205 12621 gene locus_tag LOCUS_08350 13205 12621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 13346 14707 gene locus_tag LOCUS_08360 13346 14707 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943015.1 protein_id gnl|my_center|LOCUS_08360 14718 16232 gene locus_tag LOCUS_08370 gene trpE 14718 16232 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880347.1 protein_id gnl|my_center|LOCUS_08370 16232 16810 gene locus_tag LOCUS_08380 gene pabA 16232 16810 CDS product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099059.1 protein_id gnl|my_center|LOCUS_08380 16807 17823 gene locus_tag LOCUS_08390 gene trpD 16807 17823 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_08390 17820 18578 gene locus_tag LOCUS_08400 gene trpC 17820 18578 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228482.1 protein_id gnl|my_center|LOCUS_08400 18575 19147 gene locus_tag LOCUS_08410 18575 19147 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903201.1 protein_id gnl|my_center|LOCUS_08410 19144 20316 gene locus_tag LOCUS_08420 gene trpB 19144 20316 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064422.1 protein_id gnl|my_center|LOCUS_08420 20313 21122 gene locus_tag LOCUS_08430 gene trpA 20313 21122 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750470.1 protein_id gnl|my_center|LOCUS_08430 21119 22222 gene locus_tag LOCUS_08440 21119 22222 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072974.1 protein_id gnl|my_center|LOCUS_08440 22266 22934 gene locus_tag LOCUS_08450 22266 22934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 23544 22975 gene locus_tag LOCUS_08460 23544 22975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 24680 23991 gene locus_tag LOCUS_08470 24680 23991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 24939 24730 gene locus_tag LOCUS_08480 24939 24730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 25241 26272 gene locus_tag LOCUS_08490 25241 26272 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878633.1 protein_id gnl|my_center|LOCUS_08490 26578 27039 gene locus_tag LOCUS_08500 26578 27039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 27052 28599 gene locus_tag LOCUS_08510 27052 28599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 28631 29635 gene locus_tag LOCUS_08520 28631 29635 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878633.1 protein_id gnl|my_center|LOCUS_08520 29807 30817 gene locus_tag LOCUS_08530 29807 30817 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878633.1 protein_id gnl|my_center|LOCUS_08530 31314 32333 gene locus_tag LOCUS_08540 31314 32333 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878633.1 protein_id gnl|my_center|LOCUS_08540 32441 32953 gene locus_tag LOCUS_08550 32441 32953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 32967 33458 gene locus_tag LOCUS_08560 32967 33458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 34182 33475 gene locus_tag LOCUS_08570 34182 33475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 34643 34224 gene locus_tag LOCUS_08580 34643 34224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 35688 36015 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36303 36502 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36658 36935 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37069 37875 gene locus_tag LOCUS_08590 37069 37875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 38299 38709 gene locus_tag LOCUS_08600 38299 38709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 39606 38941 gene locus_tag LOCUS_08610 39606 38941 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770132.1 protein_id gnl|my_center|LOCUS_08610 41951 39903 gene locus_tag LOCUS_08620 41951 39903 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104337.1 protein_id gnl|my_center|LOCUS_08620 42674 42189 gene locus_tag LOCUS_08630 42674 42189 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020126.1 protein_id gnl|my_center|LOCUS_08630 42777 43556 gene locus_tag LOCUS_08640 42777 43556 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869614.1 protein_id gnl|my_center|LOCUS_08640 43553 44260 gene locus_tag LOCUS_08650 43553 44260 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388822.1 protein_id gnl|my_center|LOCUS_08650 44264 44887 gene locus_tag LOCUS_08660 44264 44887 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496401.1 protein_id gnl|my_center|LOCUS_08660 44884 46125 gene locus_tag LOCUS_08670 44884 46125 CDS product methanogenesis marker 16 metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877291.1 protein_id gnl|my_center|LOCUS_08670 46122 47414 gene locus_tag LOCUS_08680 46122 47414 CDS product cysteate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066469.1 protein_id gnl|my_center|LOCUS_08680 47407 48528 gene locus_tag LOCUS_08690 gene comE 47407 48528 CDS product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023231.1 protein_id gnl|my_center|LOCUS_08690 48879 49772 gene locus_tag LOCUS_08700 48879 49772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 50660 50325 gene locus_tag LOCUS_08710 50660 50325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 51196 50885 gene locus_tag LOCUS_08720 51196 50885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 51389 51637 gene locus_tag LOCUS_08730 51389 51637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 51980 52201 gene locus_tag LOCUS_08740 51980 52201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 52781 53221 gene locus_tag LOCUS_08750 52781 53221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 53409 53909 gene locus_tag LOCUS_08760 53409 53909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 54474 54803 gene locus_tag LOCUS_08770 54474 54803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 55160 54981 gene locus_tag LOCUS_08780 55160 54981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 55538 55966 gene locus_tag LOCUS_08790 55538 55966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066236.1 protein_id gnl|my_center|LOCUS_08790 56423 56788 gene locus_tag LOCUS_08800 56423 56788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 57575 56883 gene locus_tag LOCUS_08810 57575 56883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 57852 58010 gene locus_tag LOCUS_08820 57852 58010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 58212 58610 gene locus_tag LOCUS_08830 58212 58610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 58579 58875 gene locus_tag LOCUS_08840 58579 58875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 59376 59014 gene locus_tag LOCUS_08850 59376 59014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 60497 59565 gene locus_tag LOCUS_08860 60497 59565 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893461.1 protein_id gnl|my_center|LOCUS_08860 60875 61420 gene locus_tag LOCUS_08870 60875 61420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 61417 61842 gene locus_tag LOCUS_08880 61417 61842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 62572 62099 gene locus_tag LOCUS_08890 62572 62099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 63514 62699 gene locus_tag LOCUS_08900 63514 62699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 64317 63541 gene locus_tag LOCUS_08910 64317 63541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 65028 64333 gene locus_tag LOCUS_08920 65028 64333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 65440 66603 gene locus_tag LOCUS_08930 65440 66603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 66645 67193 gene locus_tag LOCUS_08940 66645 67193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 67213 68340 gene locus_tag LOCUS_08950 67213 68340 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583646.1 protein_id gnl|my_center|LOCUS_08950 68857 68988 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 69139 69906 gene locus_tag LOCUS_08960 69139 69906 CDS product DUF6345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064899.1 protein_id gnl|my_center|LOCUS_08960 69922 70869 gene locus_tag LOCUS_08970 69922 70869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020555.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence10 1258 344 gene locus_tag LOCUS_08980 1258 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 1762 1388 gene locus_tag LOCUS_08990 1762 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 1649 2440 gene locus_tag LOCUS_09000 1649 2440 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023617.1 protein_id gnl|my_center|LOCUS_09000 2437 3219 gene locus_tag LOCUS_09010 gene uppS 2437 3219 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903300.1 protein_id gnl|my_center|LOCUS_09010 3853 3263 gene locus_tag LOCUS_09020 3853 3263 CDS product undecaprenyl diphosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289377.1 protein_id gnl|my_center|LOCUS_09020 5535 3850 gene locus_tag LOCUS_09030 gene polX 5535 3850 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020772.1 protein_id gnl|my_center|LOCUS_09030 5698 6336 gene locus_tag LOCUS_09040 5698 6336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 6333 8192 gene locus_tag LOCUS_09050 gene feoB 6333 8192 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024217.1 protein_id gnl|my_center|LOCUS_09050 8192 8911 gene locus_tag LOCUS_09060 8192 8911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 8943 9695 gene locus_tag LOCUS_09070 gene dph5 8943 9695 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021388.1 protein_id gnl|my_center|LOCUS_09070 9692 10261 gene locus_tag LOCUS_09080 9692 10261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 10491 11525 gene locus_tag LOCUS_09090 10491 11525 CDS product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023080.1 protein_id gnl|my_center|LOCUS_09090 11614 12024 gene locus_tag LOCUS_09100 11614 12024 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878603.1 protein_id gnl|my_center|LOCUS_09100 12364 12071 gene locus_tag LOCUS_09110 gene hisE 12364 12071 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021409.1 protein_id gnl|my_center|LOCUS_09110 12797 12357 gene locus_tag LOCUS_09120 12797 12357 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978223.1 protein_id gnl|my_center|LOCUS_09120 14357 12888 gene locus_tag LOCUS_09130 14357 12888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 14890 15528 gene locus_tag LOCUS_09140 14890 15528 CDS product DUF432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879042.1 protein_id gnl|my_center|LOCUS_09140 15525 16385 gene locus_tag LOCUS_09150 15525 16385 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064408.1 protein_id gnl|my_center|LOCUS_09150 16440 16592 gene locus_tag LOCUS_09160 16440 16592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 17320 16577 gene locus_tag LOCUS_09170 17320 16577 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903934.1 protein_id gnl|my_center|LOCUS_09170 17522 17806 gene locus_tag LOCUS_09180 17522 17806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 17887 18165 gene locus_tag LOCUS_09190 17887 18165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 18630 18181 gene locus_tag LOCUS_09200 18630 18181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 20292 18670 gene locus_tag LOCUS_09210 20292 18670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 21602 20292 gene locus_tag LOCUS_09220 21602 20292 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022811.1 protein_id gnl|my_center|LOCUS_09220 21697 23436 gene locus_tag LOCUS_09230 21697 23436 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020773.1 protein_id gnl|my_center|LOCUS_09230 23439 25172 gene locus_tag LOCUS_09240 gene polX 23439 25172 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_09240 25641 25204 gene locus_tag LOCUS_09250 25641 25204 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404934.1 protein_id gnl|my_center|LOCUS_09250 26358 25675 gene locus_tag LOCUS_09260 26358 25675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 28944 27331 gene locus_tag LOCUS_09270 28944 27331 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_09270 29113 29856 gene locus_tag LOCUS_09280 29113 29856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 30500 29862 gene locus_tag LOCUS_09290 30500 29862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 31593 33980 gene locus_tag LOCUS_09300 31593 33980 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045029.1 protein_id gnl|my_center|LOCUS_09300 34429 34061 gene locus_tag LOCUS_09310 34429 34061 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940054.1 protein_id gnl|my_center|LOCUS_09310 34690 35835 gene locus_tag LOCUS_09320 34690 35835 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_09320 36013 36813 gene locus_tag LOCUS_09330 36013 36813 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249930.1 protein_id gnl|my_center|LOCUS_09330 36955 37326 gene locus_tag LOCUS_09340 36955 37326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 37774 38340 gene locus_tag LOCUS_09350 37774 38340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 38321 38743 gene locus_tag LOCUS_09360 38321 38743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 39479 38775 gene locus_tag LOCUS_09370 39479 38775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 40321 39506 gene locus_tag LOCUS_09380 40321 39506 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393323.1 protein_id gnl|my_center|LOCUS_09380 41120 40299 gene locus_tag LOCUS_09390 gene modA 41120 40299 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393324.1 protein_id gnl|my_center|LOCUS_09390 41852 41199 gene locus_tag LOCUS_09400 gene anfO 41852 41199 CDS product Fe-only nitrogenase accessory protein AnfO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389145.1 protein_id gnl|my_center|LOCUS_09400 42161 41853 gene locus_tag LOCUS_09410 42161 41853 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933206.1 protein_id gnl|my_center|LOCUS_09410 43545 42148 gene locus_tag LOCUS_09420 43545 42148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 44006 43542 gene locus_tag LOCUS_09430 44006 43542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 44112 44355 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 44678 44938 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45385 45761 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 46054 46289 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 47207 46830 gene locus_tag LOCUS_09440 47207 46830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 47235 47440 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 49008 48589 gene locus_tag LOCUS_09450 49008 48589 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176591.1 protein_id gnl|my_center|LOCUS_09450 49361 49026 gene locus_tag LOCUS_09460 49361 49026 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963577.1 protein_id gnl|my_center|LOCUS_09460 49642 49376 gene locus_tag LOCUS_09470 49642 49376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 49735 49958 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51869 52159 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 52264 52704 gene locus_tag LOCUS_09480 52264 52704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 52980 53432 gene locus_tag LOCUS_09490 52980 53432 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942952.1 protein_id gnl|my_center|LOCUS_09490 54868 53987 gene locus_tag LOCUS_09500 54868 53987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 55106 55439 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 56305 55988 gene locus_tag LOCUS_09510 56305 55988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 56685 57230 gene locus_tag LOCUS_09520 56685 57230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 57327 57115 gene locus_tag LOCUS_09530 57327 57115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 58160 57468 gene locus_tag LOCUS_09540 58160 57468 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021186.1 protein_id gnl|my_center|LOCUS_09540 58778 58703 gene locus_tag LOCUS_t00160 58778 58703 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 60089 58896 gene locus_tag LOCUS_09550 60089 58896 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877092.1 protein_id gnl|my_center|LOCUS_09550 61113 60244 gene locus_tag LOCUS_09560 gene ilvE 61113 60244 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878433.1 protein_id gnl|my_center|LOCUS_09560 62544 61174 gene locus_tag LOCUS_09570 gene cfbB 62544 61174 CDS product Ni-sirohydrochlorin a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023534.1 protein_id gnl|my_center|LOCUS_09570 63605 62541 gene locus_tag LOCUS_09580 gene cfbD 63605 62541 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023536.1 protein_id gnl|my_center|LOCUS_09580 64782 63607 gene locus_tag LOCUS_09590 gene cfbE 64782 63607 CDS product coenzyme F430 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023538.1 protein_id gnl|my_center|LOCUS_09590 65179 64787 gene locus_tag LOCUS_09600 gene cfbA 65179 64787 CDS product sirohydrochlorin nickelochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023539.1 protein_id gnl|my_center|LOCUS_09600 65272 65781 gene locus_tag LOCUS_09610 65272 65781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020868.1 protein_id gnl|my_center|LOCUS_09610 65768 66904 gene locus_tag LOCUS_09620 65768 66904 CDS product methanogenesis marker 9 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020738.1 protein_id gnl|my_center|LOCUS_09620 67013 67290 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence11 93 251 gene locus_tag LOCUS_09630 93 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 482 733 gene locus_tag LOCUS_09640 482 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 987 1255 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1430 1357 gene locus_tag LOCUS_t00170 1430 1357 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1565 2539 gene locus_tag LOCUS_09650 1565 2539 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978561.1 protein_id gnl|my_center|LOCUS_09650 2658 2866 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3479 5473 gene locus_tag LOCUS_09660 gene metG 3479 5473 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878950.1 protein_id gnl|my_center|LOCUS_09660 5650 5575 gene locus_tag LOCUS_t00180 5650 5575 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6083 5730 gene locus_tag LOCUS_09670 6083 5730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 6838 6125 gene locus_tag LOCUS_09680 6838 6125 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066594.1 protein_id gnl|my_center|LOCUS_09680 6898 7224 gene locus_tag LOCUS_09690 6898 7224 CDS product DUF5611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065922.1 protein_id gnl|my_center|LOCUS_09690 7678 7352 gene locus_tag LOCUS_09700 7678 7352 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965771.1 protein_id gnl|my_center|LOCUS_09700 9938 7854 gene locus_tag LOCUS_09710 9938 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 10001 10228 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12673 10787 gene locus_tag LOCUS_09720 12673 10787 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020947.1 protein_id gnl|my_center|LOCUS_09720 13062 12697 gene locus_tag LOCUS_09730 gene hisI 13062 12697 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879442.1 protein_id gnl|my_center|LOCUS_09730 13878 13069 gene locus_tag LOCUS_09740 13878 13069 CDS product A24 family peptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024381.1 protein_id gnl|my_center|LOCUS_09740 14173 14021 gene locus_tag LOCUS_09750 14173 14021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 14576 15217 gene locus_tag LOCUS_09760 14576 15217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 15234 17576 gene locus_tag LOCUS_09770 15234 17576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 17573 18496 gene locus_tag LOCUS_09780 17573 18496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09780 18499 19554 gene locus_tag LOCUS_09790 18499 19554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09790 19838 20611 gene locus_tag LOCUS_09800 19838 20611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09800 20781 20572 gene locus_tag LOCUS_09810 20781 20572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 20764 20883 gene locus_tag LOCUS_09820 20764 20883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09820 20887 21117 gene locus_tag LOCUS_09830 20887 21117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09830 21412 21125 gene locus_tag LOCUS_09840 21412 21125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 21828 21571 gene locus_tag LOCUS_09850 21828 21571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 23252 21924 gene locus_tag LOCUS_09860 gene glnA 23252 21924 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392808.1 protein_id gnl|my_center|LOCUS_09860 23414 24427 gene locus_tag LOCUS_09870 23414 24427 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065933.1 protein_id gnl|my_center|LOCUS_09870 24424 25932 gene locus_tag LOCUS_09880 24424 25932 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024102.1 protein_id gnl|my_center|LOCUS_09880 27109 25949 gene locus_tag LOCUS_09890 27109 25949 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020303.1 protein_id gnl|my_center|LOCUS_09890 28354 27113 gene locus_tag LOCUS_09900 28354 27113 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020304.1 protein_id gnl|my_center|LOCUS_09900 28903 28358 gene locus_tag LOCUS_09910 28903 28358 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020756.1 protein_id gnl|my_center|LOCUS_09910 30126 28918 gene locus_tag LOCUS_09920 30126 28918 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020758.1 protein_id gnl|my_center|LOCUS_09920 30309 30626 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30726 31178 gene locus_tag LOCUS_09930 30726 31178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 31252 32157 gene locus_tag LOCUS_09940 gene cofD 31252 32157 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066127.1 protein_id gnl|my_center|LOCUS_09940 32555 32169 gene locus_tag LOCUS_09950 gene nifU 32555 32169 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_09950 33721 32567 gene locus_tag LOCUS_09960 33721 32567 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064599.1 protein_id gnl|my_center|LOCUS_09960 34093 33734 gene locus_tag LOCUS_09970 34093 33734 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318897.1 protein_id gnl|my_center|LOCUS_09970 34455 34204 gene locus_tag LOCUS_09980 34455 34204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 34707 34465 gene locus_tag LOCUS_09990 34707 34465 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877700.1 protein_id gnl|my_center|LOCUS_09990 35124 35666 gene locus_tag LOCUS_10000 35124 35666 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023416.1 protein_id gnl|my_center|LOCUS_10000 35764 37053 gene locus_tag LOCUS_10010 gene aspS 35764 37053 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878420.1 protein_id gnl|my_center|LOCUS_10010 37721 37910 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39536 38952 gene locus_tag LOCUS_10020 39536 38952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 41161 39611 gene locus_tag LOCUS_10030 41161 39611 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879268.1 protein_id gnl|my_center|LOCUS_10030 41401 41574 gene locus_tag LOCUS_10040 41401 41574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 41969 42994 gene locus_tag LOCUS_10050 41969 42994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 43493 43690 gene locus_tag LOCUS_10060 43493 43690 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023401.1 protein_id gnl|my_center|LOCUS_10060 43690 43932 gene locus_tag LOCUS_10070 43690 43932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 43929 45923 gene locus_tag LOCUS_10080 gene feoB 43929 45923 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065727.1 protein_id gnl|my_center|LOCUS_10080 45927 46382 gene locus_tag LOCUS_10090 45927 46382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023398.1 protein_id gnl|my_center|LOCUS_10090 46379 46669 gene locus_tag LOCUS_10100 46379 46669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 46895 48676 gene locus_tag LOCUS_10110 46895 48676 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948724.1 protein_id gnl|my_center|LOCUS_10110 48676 50412 gene locus_tag LOCUS_10120 48676 50412 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948725.1 protein_id gnl|my_center|LOCUS_10120 51155 50553 gene locus_tag LOCUS_10130 51155 50553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 51348 52601 gene locus_tag LOCUS_10140 51348 52601 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065539.1 protein_id gnl|my_center|LOCUS_10140 52594 53805 gene locus_tag LOCUS_10150 52594 53805 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023495.1 protein_id gnl|my_center|LOCUS_10150 54292 54540 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 54648 54932 gene locus_tag LOCUS_10160 54648 54932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 55838 54993 gene locus_tag LOCUS_10170 gene cas7c 55838 54993 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263666.1 protein_id gnl|my_center|LOCUS_10170 57811 55841 gene locus_tag LOCUS_10180 gene cas8c 57811 55841 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922511.1 protein_id gnl|my_center|LOCUS_10180 58512 57808 gene locus_tag LOCUS_10190 gene cas5c 58512 57808 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205009051.1 protein_id gnl|my_center|LOCUS_10190 60938 58539 gene locus_tag LOCUS_10200 60938 58539 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263668.1 protein_id gnl|my_center|LOCUS_10200 61010 61672 gene locus_tag LOCUS_10210 gene cas4 61010 61672 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 protein_id gnl|my_center|LOCUS_10210 61669 62703 gene locus_tag LOCUS_10220 gene cas1c 61669 62703 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_10220 62700 62999 gene locus_tag LOCUS_10230 gene cas2 62700 62999 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626042.1 protein_id gnl|my_center|LOCUS_10230 63277 >65891 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgtgcctcacgtaggcacgtggattgaaat >Feature sequence12 1632 376 gene locus_tag LOCUS_10240 gene glmM 1632 376 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065583.1 protein_id gnl|my_center|LOCUS_10240 2273 1668 gene locus_tag LOCUS_10250 2273 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 2890 2270 gene locus_tag LOCUS_10260 gene kynB 2890 2270 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858074.1 protein_id gnl|my_center|LOCUS_10260 3552 2887 gene locus_tag LOCUS_10270 3552 2887 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545748.1 protein_id gnl|my_center|LOCUS_10270 4653 3565 gene locus_tag LOCUS_10280 4653 3565 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938320.1 protein_id gnl|my_center|LOCUS_10280 5390 4659 gene locus_tag LOCUS_10290 5390 4659 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938321.1 protein_id gnl|my_center|LOCUS_10290 5678 5902 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7029 5926 gene locus_tag LOCUS_10300 7029 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 7801 7034 gene locus_tag LOCUS_10310 7801 7034 CDS product TIGR01458 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971814.1 protein_id gnl|my_center|LOCUS_10310 7972 8940 gene locus_tag LOCUS_10320 7972 8940 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876130.1 protein_id gnl|my_center|LOCUS_10320 9462 9256 gene locus_tag LOCUS_10330 9462 9256 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879289.1 protein_id gnl|my_center|LOCUS_10330 9904 9515 gene locus_tag LOCUS_10340 9904 9515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 10312 12570 gene locus_tag LOCUS_10350 10312 12570 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_10350 14140 12548 gene locus_tag LOCUS_10360 gene sepS 14140 12548 CDS product O-phosphoserine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020149.1 protein_id gnl|my_center|LOCUS_10360 15039 14137 gene locus_tag LOCUS_10370 gene twy1 15039 14137 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020099.1 protein_id gnl|my_center|LOCUS_10370 16675 15011 gene locus_tag LOCUS_10380 gene argS 16675 15011 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064797.1 protein_id gnl|my_center|LOCUS_10380 17946 16675 gene locus_tag LOCUS_10390 gene prf1 17946 16675 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020101.1 protein_id gnl|my_center|LOCUS_10390 18546 18052 gene locus_tag LOCUS_10400 18546 18052 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_10400 19217 18549 gene locus_tag LOCUS_10410 gene queC 19217 18549 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904151.1 protein_id gnl|my_center|LOCUS_10410 19822 19214 gene locus_tag LOCUS_10420 gene queE 19822 19214 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120697.1 protein_id gnl|my_center|LOCUS_10420 20222 19809 gene locus_tag LOCUS_10430 20222 19809 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868831.1 protein_id gnl|my_center|LOCUS_10430 20396 20824 gene locus_tag LOCUS_10440 20396 20824 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021280.1 protein_id gnl|my_center|LOCUS_10440 20832 21437 gene locus_tag LOCUS_10450 20832 21437 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021279.1 protein_id gnl|my_center|LOCUS_10450 21499 23661 gene locus_tag LOCUS_10460 21499 23661 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021278.1 protein_id gnl|my_center|LOCUS_10460 23978 23649 gene locus_tag LOCUS_10470 23978 23649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 24723 24163 gene locus_tag LOCUS_10480 24723 24163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 25168 26709 gene locus_tag LOCUS_10490 gene ppcA 25168 26709 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060929.1 protein_id gnl|my_center|LOCUS_10490 27291 26758 gene locus_tag LOCUS_10500 27291 26758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 28080 27394 gene locus_tag LOCUS_10510 28080 27394 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755943.1 protein_id gnl|my_center|LOCUS_10510 29288 28086 gene locus_tag LOCUS_10520 29288 28086 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022791.1 protein_id gnl|my_center|LOCUS_10520 30574 29294 gene locus_tag LOCUS_10530 30574 29294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 31011 31211 gene locus_tag LOCUS_10540 31011 31211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 31434 31258 gene locus_tag LOCUS_10550 31434 31258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 31351 31947 gene locus_tag LOCUS_10560 31351 31947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 32041 32517 gene locus_tag LOCUS_10570 32041 32517 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065754.1 protein_id gnl|my_center|LOCUS_10570 32734 33345 gene locus_tag LOCUS_10580 32734 33345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 33468 34307 gene locus_tag LOCUS_10590 33468 34307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 34313 35101 gene locus_tag LOCUS_10600 34313 35101 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228266.1 protein_id gnl|my_center|LOCUS_10600 35368 36207 gene locus_tag LOCUS_10610 35368 36207 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021957.1 protein_id gnl|my_center|LOCUS_10610 39070 36209 gene locus_tag LOCUS_10620 39070 36209 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021615.1 protein_id gnl|my_center|LOCUS_10620 39253 39394 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40119 39766 gene locus_tag LOCUS_10630 40119 39766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 40412 40897 gene locus_tag LOCUS_10640 40412 40897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 40940 41764 gene locus_tag LOCUS_10650 40940 41764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 42747 41815 gene locus_tag LOCUS_10660 42747 41815 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022320.1 protein_id gnl|my_center|LOCUS_10660 43416 43763 gene locus_tag LOCUS_10670 43416 43763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 44288 44482 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 46250 48649 gene locus_tag LOCUS_10680 46250 48649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 48691 49254 gene locus_tag LOCUS_10690 48691 49254 CDS product DNA polymerase ligase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031607.1 protein_id gnl|my_center|LOCUS_10690 49806 50252 gene locus_tag LOCUS_10700 49806 50252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 51381 50908 gene locus_tag LOCUS_10710 51381 50908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 51735 51421 gene locus_tag LOCUS_10720 51735 51421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 52944 52057 gene locus_tag LOCUS_10730 gene frhB 52944 52057 CDS product coenzyme F420 hydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021015.1 protein_id gnl|my_center|LOCUS_10730 53851 52955 gene locus_tag LOCUS_10740 gene frhG 53851 52955 CDS product coenzyme F420 hydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065016.1 protein_id gnl|my_center|LOCUS_10740 54380 53820 gene locus_tag LOCUS_10750 gene frhD 54380 53820 CDS product coenzyme F420-reducing hydrogenase, FrhD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021013.1 protein_id gnl|my_center|LOCUS_10750 55758 54391 gene locus_tag LOCUS_10760 gene frhA 55758 54391 CDS product coenzyme F420 hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990767.1 protein_id gnl|my_center|LOCUS_10760 56922 55984 gene locus_tag LOCUS_10770 gene mptA 56922 55984 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066005.1 protein_id gnl|my_center|LOCUS_10770 57050 58039 gene locus_tag LOCUS_10780 gene ilvC 57050 58039 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816729.1 protein_id gnl|my_center|LOCUS_10780 58075 58581 gene locus_tag LOCUS_10790 58075 58581 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966687.1 protein_id gnl|my_center|LOCUS_10790 60622 58550 gene locus_tag LOCUS_10800 gene purL 60622 58550 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023948.1 protein_id gnl|my_center|LOCUS_10800 60720 61337 gene locus_tag LOCUS_10810 60720 61337 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020240.1 protein_id gnl|my_center|LOCUS_10810 >Feature sequence13 897 613 gene locus_tag LOCUS_10820 897 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 890 1141 gene locus_tag LOCUS_10830 890 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 1742 1119 gene locus_tag LOCUS_10840 1742 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 1858 2097 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2317 2633 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3497 3222 gene locus_tag LOCUS_10850 3497 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 3882 3661 gene locus_tag LOCUS_10860 3882 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 3881 4213 gene locus_tag LOCUS_10870 3881 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 4200 5093 gene locus_tag LOCUS_10880 4200 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 5688 5965 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6356 6060 gene locus_tag LOCUS_10890 6356 6060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 7702 6809 gene locus_tag LOCUS_10900 7702 6809 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020436.1 protein_id gnl|my_center|LOCUS_10900 7943 7770 gene locus_tag LOCUS_10910 7943 7770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 7869 8630 gene locus_tag LOCUS_10920 7869 8630 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023894.1 protein_id gnl|my_center|LOCUS_10920 8675 10285 gene locus_tag LOCUS_10930 gene atwA 8675 10285 CDS product methyl coenzyme M reductase system, component A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023893.1 protein_id gnl|my_center|LOCUS_10930 10296 11825 gene locus_tag LOCUS_10940 10296 11825 CDS product methanogenesis marker 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023892.1 protein_id gnl|my_center|LOCUS_10940 11825 12286 gene locus_tag LOCUS_10950 11825 12286 CDS product methanogenesis marker 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065869.1 protein_id gnl|my_center|LOCUS_10950 12292 12747 gene locus_tag LOCUS_10960 12292 12747 CDS product methanogenesis marker 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869903.1 protein_id gnl|my_center|LOCUS_10960 12744 13982 gene locus_tag LOCUS_10970 12744 13982 CDS product methanogenesis marker 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023889.1 protein_id gnl|my_center|LOCUS_10970 13983 14567 gene locus_tag LOCUS_10980 13983 14567 CDS product methanogenesis marker 17 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023888.1 protein_id gnl|my_center|LOCUS_10980 14564 15505 gene locus_tag LOCUS_10990 14564 15505 CDS product methanogenesis marker 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023887.1 protein_id gnl|my_center|LOCUS_10990 15508 15954 gene locus_tag LOCUS_11000 15508 15954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 15962 17770 gene locus_tag LOCUS_11010 15962 17770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 18529 17783 gene locus_tag LOCUS_11020 18529 17783 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970750.1 protein_id gnl|my_center|LOCUS_11020 18930 18718 gene locus_tag LOCUS_11030 18930 18718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 18929 19648 gene locus_tag LOCUS_11040 18929 19648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 19724 20158 gene locus_tag LOCUS_11050 19724 20158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 21858 20245 gene locus_tag LOCUS_11060 gene groL 21858 20245 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020679.1 protein_id gnl|my_center|LOCUS_11060 22136 21864 gene locus_tag LOCUS_11070 gene groES 22136 21864 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020678.1 protein_id gnl|my_center|LOCUS_11070 22298 22693 gene locus_tag LOCUS_11080 22298 22693 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020677.1 protein_id gnl|my_center|LOCUS_11080 23518 23051 gene locus_tag LOCUS_11090 23518 23051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 24318 23572 gene locus_tag LOCUS_11100 24318 23572 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878032.1 protein_id gnl|my_center|LOCUS_11100 25253 24474 gene locus_tag LOCUS_11110 25253 24474 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064935.1 protein_id gnl|my_center|LOCUS_11110 25449 25261 gene locus_tag LOCUS_11120 25449 25261 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878831.1 protein_id gnl|my_center|LOCUS_11120 25669 25457 gene locus_tag LOCUS_11130 25669 25457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 26438 25773 gene locus_tag LOCUS_11140 26438 25773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 27557 26442 gene locus_tag LOCUS_11150 gene priS 27557 26442 CDS product DNA primase small subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289337.1 protein_id gnl|my_center|LOCUS_11150 29128 27554 gene locus_tag LOCUS_11160 29128 27554 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020870.1 protein_id gnl|my_center|LOCUS_11160 29401 29132 gene locus_tag LOCUS_11170 29401 29132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 29471 30343 gene locus_tag LOCUS_11180 29471 30343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 30842 30390 gene locus_tag LOCUS_11190 30842 30390 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023592.1 protein_id gnl|my_center|LOCUS_11190 31932 30850 gene locus_tag LOCUS_11200 31932 30850 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023593.1 protein_id gnl|my_center|LOCUS_11200 31944 32789 gene locus_tag LOCUS_11210 31944 32789 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066525.1 protein_id gnl|my_center|LOCUS_11210 32782 33348 gene locus_tag LOCUS_11220 32782 33348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 33379 34812 gene locus_tag LOCUS_11230 gene proS 33379 34812 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023782.1 protein_id gnl|my_center|LOCUS_11230 35268 34813 gene locus_tag LOCUS_11240 35268 34813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 35605 36528 gene locus_tag LOCUS_11250 35605 36528 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879724.1 protein_id gnl|my_center|LOCUS_11250 37085 36525 gene locus_tag LOCUS_11260 37085 36525 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023653.1 protein_id gnl|my_center|LOCUS_11260 37811 39733 gene locus_tag LOCUS_11270 37811 39733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 40319 39693 gene locus_tag LOCUS_11280 40319 39693 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485785.1 protein_id gnl|my_center|LOCUS_11280 41897 40416 gene locus_tag LOCUS_11290 41897 40416 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148183489.1 protein_id gnl|my_center|LOCUS_11290 42912 42100 gene locus_tag LOCUS_11300 42912 42100 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089920.1 protein_id gnl|my_center|LOCUS_11300 43238 43451 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 44602 44156 gene locus_tag LOCUS_11310 44602 44156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 44641 44859 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45039 45311 gene locus_tag LOCUS_11320 45039 45311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 45354 45965 gene locus_tag LOCUS_11330 45354 45965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 47981 46461 gene locus_tag LOCUS_11340 47981 46461 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080443.1 protein_id gnl|my_center|LOCUS_11340 48239 48703 gene locus_tag LOCUS_11350 48239 48703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 49443 48763 gene locus_tag LOCUS_11360 49443 48763 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023984.1 protein_id gnl|my_center|LOCUS_11360 49733 51466 gene locus_tag LOCUS_11370 49733 51466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 51470 51895 gene locus_tag LOCUS_11380 51470 51895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 51998 53359 gene locus_tag LOCUS_11390 51998 53359 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978370.1 protein_id gnl|my_center|LOCUS_11390 53880 53446 gene locus_tag LOCUS_11400 53880 53446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 54302 55546 gene locus_tag LOCUS_11410 54302 55546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 56210 55599 gene locus_tag LOCUS_11420 56210 55599 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392851.1 protein_id gnl|my_center|LOCUS_11420 >Feature sequence14 353 222 gene locus_tag LOCUS_11430 353 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 380 573 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1423 791 gene locus_tag LOCUS_11440 1423 791 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060758.1 protein_id gnl|my_center|LOCUS_11440 1516 1875 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2072 3643 gene locus_tag LOCUS_11450 2072 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 5733 3685 gene locus_tag LOCUS_11460 5733 3685 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226412.1 protein_id gnl|my_center|LOCUS_11460 6585 7808 gene locus_tag LOCUS_11470 6585 7808 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176674.1 protein_id gnl|my_center|LOCUS_11470 8996 8157 gene locus_tag LOCUS_11480 gene nudC 8996 8157 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021453.1 protein_id gnl|my_center|LOCUS_11480 10673 9390 gene locus_tag LOCUS_11490 10673 9390 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_11490 10908 11145 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11564 11397 gene locus_tag LOCUS_11500 11564 11397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 12850 11774 gene locus_tag LOCUS_11510 12850 11774 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943960.1 protein_id gnl|my_center|LOCUS_11510 12866 13047 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13844 14120 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15474 14320 gene locus_tag LOCUS_11520 15474 14320 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110188582.1 protein_id gnl|my_center|LOCUS_11520 15642 15800 gene locus_tag LOCUS_11530 15642 15800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 16960 15977 gene locus_tag LOCUS_11540 16960 15977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 17250 16957 gene locus_tag LOCUS_11550 17250 16957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 18266 17370 gene locus_tag LOCUS_11560 gene cmr4 18266 17370 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229141.1 protein_id gnl|my_center|LOCUS_11560 18390 18582 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21385 19604 gene locus_tag LOCUS_11570 gene cas10 21385 19604 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229144.1 protein_id gnl|my_center|LOCUS_11570 23622 22840 gene locus_tag LOCUS_11580 23622 22840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 24401 24553 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24739 24939 gene locus_tag LOCUS_11590 24739 24939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 25134 25058 gene locus_tag LOCUS_t00190 25134 25058 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 25322 26437 gene locus_tag LOCUS_11600 25322 26437 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496792.1 protein_id gnl|my_center|LOCUS_11600 27431 26424 gene locus_tag LOCUS_11610 27431 26424 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021469.1 protein_id gnl|my_center|LOCUS_11610 27610 27687 gene locus_tag LOCUS_t00200 27610 27687 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 27761 28600 gene locus_tag LOCUS_11620 27761 28600 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250907.1 protein_id gnl|my_center|LOCUS_11620 28760 29170 gene locus_tag LOCUS_11630 28760 29170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020121.1 protein_id gnl|my_center|LOCUS_11630 29839 29135 gene locus_tag LOCUS_11640 29839 29135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 30888 29836 gene locus_tag LOCUS_11650 30888 29836 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877877.1 protein_id gnl|my_center|LOCUS_11650 32165 30891 gene locus_tag LOCUS_11660 32165 30891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 32649 32158 gene locus_tag LOCUS_11670 32649 32158 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977514.1 protein_id gnl|my_center|LOCUS_11670 32767 33216 gene locus_tag LOCUS_11680 32767 33216 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023461.1 protein_id gnl|my_center|LOCUS_11680 33679 33209 gene locus_tag LOCUS_11690 gene pyrI 33679 33209 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289641.1 protein_id gnl|my_center|LOCUS_11690 34572 33676 gene locus_tag LOCUS_11700 gene pyrB 34572 33676 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064165.1 protein_id gnl|my_center|LOCUS_11700 34779 34964 gene locus_tag LOCUS_11710 34779 34964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 35696 34971 gene locus_tag LOCUS_11720 35696 34971 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877727.1 protein_id gnl|my_center|LOCUS_11720 36034 35693 gene locus_tag LOCUS_11730 36034 35693 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064993.1 protein_id gnl|my_center|LOCUS_11730 36519 36016 gene locus_tag LOCUS_11740 36519 36016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878211.1 protein_id gnl|my_center|LOCUS_11740 37861 36458 gene locus_tag LOCUS_11750 37861 36458 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903741.1 protein_id gnl|my_center|LOCUS_11750 38281 39684 gene locus_tag LOCUS_11760 38281 39684 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021194.1 protein_id gnl|my_center|LOCUS_11760 39773 40267 gene locus_tag LOCUS_11770 gene moaC 39773 40267 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867492.1 protein_id gnl|my_center|LOCUS_11770 40398 40988 gene locus_tag LOCUS_11780 40398 40988 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021787.1 protein_id gnl|my_center|LOCUS_11780 41025 41669 gene locus_tag LOCUS_11790 41025 41669 CDS product RNase P subunit p30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289302.1 protein_id gnl|my_center|LOCUS_11790 41666 42148 gene locus_tag LOCUS_11800 41666 42148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 42148 42870 gene locus_tag LOCUS_11810 gene psmA 42148 42870 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_11810 42883 43584 gene locus_tag LOCUS_11820 42883 43584 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021781.1 protein_id gnl|my_center|LOCUS_11820 43640 43930 gene locus_tag LOCUS_11830 43640 43930 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289127.1 protein_id gnl|my_center|LOCUS_11830 44065 44469 gene locus_tag LOCUS_11840 44065 44469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 44469 44750 gene locus_tag LOCUS_11850 44469 44750 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021744.1 protein_id gnl|my_center|LOCUS_11850 44888 45259 gene locus_tag LOCUS_11860 44888 45259 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496690.1 protein_id gnl|my_center|LOCUS_11860 46854 45298 gene locus_tag LOCUS_11870 46854 45298 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024485.1 protein_id gnl|my_center|LOCUS_11870 47110 47185 gene locus_tag LOCUS_t00210 47110 47185 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 47232 47435 gene locus_tag LOCUS_11880 47232 47435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 47583 48068 gene locus_tag LOCUS_11890 47583 48068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 48812 48087 gene locus_tag LOCUS_11900 48812 48087 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388610.1 protein_id gnl|my_center|LOCUS_11900 49824 48886 gene locus_tag LOCUS_11910 49824 48886 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_11910 50093 50629 gene locus_tag LOCUS_11920 50093 50629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 50693 51139 gene locus_tag LOCUS_11930 50693 51139 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131384.1 protein_id gnl|my_center|LOCUS_11930 51706 51113 gene locus_tag LOCUS_11940 51706 51113 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762930.1 protein_id gnl|my_center|LOCUS_11940 51746 52672 gene locus_tag LOCUS_11950 gene aglJ 51746 52672 CDS product S-layer glycoprotein N-glycosyltransferase AglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024210.1 protein_id gnl|my_center|LOCUS_11950 53185 52643 gene locus_tag LOCUS_11960 53185 52643 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251082.1 protein_id gnl|my_center|LOCUS_11960 54394 53414 gene locus_tag LOCUS_11970 54394 53414 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066092.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence15 1894 1091 gene locus_tag LOCUS_11980 1894 1091 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816411.1 protein_id gnl|my_center|LOCUS_11980 2979 1891 gene locus_tag LOCUS_11990 2979 1891 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460845.1 protein_id gnl|my_center|LOCUS_11990 4165 3308 gene locus_tag LOCUS_12000 4165 3308 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392933.1 protein_id gnl|my_center|LOCUS_12000 4313 4789 gene locus_tag LOCUS_12010 4313 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 4773 4982 gene locus_tag LOCUS_12020 4773 4982 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496448.1 protein_id gnl|my_center|LOCUS_12020 5780 7021 gene locus_tag LOCUS_12030 5780 7021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 7041 7712 gene locus_tag LOCUS_12040 7041 7712 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_12040 7709 8926 gene locus_tag LOCUS_12050 7709 8926 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064397.1 protein_id gnl|my_center|LOCUS_12050 8970 9242 gene locus_tag LOCUS_12060 8970 9242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 9355 9684 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10076 9873 gene locus_tag LOCUS_12070 10076 9873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 10812 10171 gene locus_tag LOCUS_12080 10812 10171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 10900 11406 gene locus_tag LOCUS_12090 10900 11406 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065297.1 protein_id gnl|my_center|LOCUS_12090 11471 13024 gene locus_tag LOCUS_12100 11471 13024 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065911.1 protein_id gnl|my_center|LOCUS_12100 14116 13238 gene locus_tag LOCUS_12110 14116 13238 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_12110 15519 14200 gene locus_tag LOCUS_12120 15519 14200 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023306.1 protein_id gnl|my_center|LOCUS_12120 16086 16541 gene locus_tag LOCUS_12130 16086 16541 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226147.1 protein_id gnl|my_center|LOCUS_12130 16561 16863 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16938 17234 gene locus_tag LOCUS_12140 16938 17234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 17477 17362 gene locus_tag LOCUS_r00010 17477 17362 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 17639 17568 gene locus_tag LOCUS_t00220 17639 17568 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 20658 17755 gene locus_tag LOCUS_r00020 20658 17755 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 20874 20801 gene locus_tag LOCUS_t00230 20874 20801 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 22403 20943 gene locus_tag LOCUS_r00030 22403 20943 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 24133 23390 gene locus_tag LOCUS_12150 24133 23390 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902207.1 protein_id gnl|my_center|LOCUS_12150 27569 24126 gene locus_tag LOCUS_12160 gene smc 27569 24126 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024214.1 protein_id gnl|my_center|LOCUS_12160 28229 27588 gene locus_tag LOCUS_12170 28229 27588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 28557 29828 gene locus_tag LOCUS_12180 28557 29828 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_12180 29825 30676 gene locus_tag LOCUS_12190 gene folD 29825 30676 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686899.1 protein_id gnl|my_center|LOCUS_12190 30652 31467 gene locus_tag LOCUS_12200 30652 31467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 31464 32270 gene locus_tag LOCUS_12210 gene cofE 31464 32270 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023428.1 protein_id gnl|my_center|LOCUS_12210 32843 32196 gene locus_tag LOCUS_12220 gene cofC 32843 32196 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021502.1 protein_id gnl|my_center|LOCUS_12220 33005 34000 gene locus_tag LOCUS_12230 gene cofG 33005 34000 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755891.1 protein_id gnl|my_center|LOCUS_12230 34044 34769 gene locus_tag LOCUS_12240 34044 34769 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875809.1 protein_id gnl|my_center|LOCUS_12240 34766 35008 gene locus_tag LOCUS_12250 gene purS 34766 35008 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066286.1 protein_id gnl|my_center|LOCUS_12250 35024 35725 gene locus_tag LOCUS_12260 gene purQ 35024 35725 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021958.1 protein_id gnl|my_center|LOCUS_12260 35743 36027 gene locus_tag LOCUS_12270 35743 36027 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022822.1 protein_id gnl|my_center|LOCUS_12270 37720 36074 gene locus_tag LOCUS_12280 37720 36074 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_12280 38937 37747 gene locus_tag LOCUS_12290 38937 37747 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660204.1 protein_id gnl|my_center|LOCUS_12290 39554 38943 gene locus_tag LOCUS_12300 39554 38943 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020764.1 protein_id gnl|my_center|LOCUS_12300 40498 39551 gene locus_tag LOCUS_12310 gene dph2 40498 39551 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020763.1 protein_id gnl|my_center|LOCUS_12310 41033 40473 gene locus_tag LOCUS_12320 gene hpt 41033 40473 CDS product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902373.1 protein_id gnl|my_center|LOCUS_12320 42123 41026 gene locus_tag LOCUS_12330 gene mfnA 42123 41026 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879496.1 protein_id gnl|my_center|LOCUS_12330 44401 42116 gene locus_tag LOCUS_12340 gene ppsA 44401 42116 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878213.1 protein_id gnl|my_center|LOCUS_12340 45237 45528 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45567 46208 gene locus_tag LOCUS_12350 45567 46208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 46334 46407 gene locus_tag LOCUS_t00240 46334 46407 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 47011 47235 gene locus_tag LOCUS_12360 47011 47235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 47780 47307 gene locus_tag LOCUS_12370 47780 47307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 49246 47840 gene locus_tag LOCUS_12380 49246 47840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 50173 49400 gene locus_tag LOCUS_12390 50173 49400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 50163 50342 gene locus_tag LOCUS_12400 50163 50342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 52034 50367 gene locus_tag LOCUS_12410 52034 50367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 52180 52494 gene locus_tag LOCUS_12420 52180 52494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence16 1532 915 gene locus_tag LOCUS_12430 1532 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 2134 1529 gene locus_tag LOCUS_12440 2134 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 2591 3712 gene locus_tag LOCUS_12450 gene dinB 2591 3712 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172312.1 protein_id gnl|my_center|LOCUS_12450 3793 4623 gene locus_tag LOCUS_12460 3793 4623 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228704.1 protein_id gnl|my_center|LOCUS_12460 4652 5092 gene locus_tag LOCUS_12470 4652 5092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 5239 6069 gene locus_tag LOCUS_12480 5239 6069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 6201 7055 gene locus_tag LOCUS_12490 6201 7055 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021026.1 protein_id gnl|my_center|LOCUS_12490 8273 7062 gene locus_tag LOCUS_12500 8273 7062 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_12500 9345 8353 gene locus_tag LOCUS_12510 9345 8353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 11036 10359 gene locus_tag LOCUS_12520 11036 10359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 11289 11038 gene locus_tag LOCUS_12530 11289 11038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 12169 12349 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12848 12372 gene locus_tag LOCUS_12540 12848 12372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 12747 13505 gene locus_tag LOCUS_12550 12747 13505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 14321 13521 gene locus_tag LOCUS_12560 14321 13521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 14984 14547 gene locus_tag LOCUS_12570 14984 14547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 15007 15143 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17273 15960 gene locus_tag LOCUS_12580 17273 15960 CDS product methyl-coenzyme M reductase glutamine C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496936.1 protein_id gnl|my_center|LOCUS_12580 18007 17330 gene locus_tag LOCUS_12590 18007 17330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 19177 18095 gene locus_tag LOCUS_12600 19177 18095 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892491.1 protein_id gnl|my_center|LOCUS_12600 20979 19174 gene locus_tag LOCUS_12610 20979 19174 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902477.1 protein_id gnl|my_center|LOCUS_12610 21061 21948 gene locus_tag LOCUS_12620 21061 21948 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902476.1 protein_id gnl|my_center|LOCUS_12620 22348 23082 gene locus_tag LOCUS_12630 22348 23082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 26210 23115 gene locus_tag LOCUS_12640 26210 23115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 26530 28392 gene locus_tag LOCUS_12650 26530 28392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 28403 28894 gene locus_tag LOCUS_12660 28403 28894 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249580.1 protein_id gnl|my_center|LOCUS_12660 29318 29242 gene locus_tag LOCUS_t00250 29318 29242 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 29389 30891 gene locus_tag LOCUS_12670 29389 30891 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065053.1 protein_id gnl|my_center|LOCUS_12670 30888 31511 gene locus_tag LOCUS_12680 30888 31511 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022401.1 protein_id gnl|my_center|LOCUS_12680 31501 33144 gene locus_tag LOCUS_12690 31501 33144 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022802.1 protein_id gnl|my_center|LOCUS_12690 34326 34748 gene locus_tag LOCUS_12700 34326 34748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 35042 35422 gene locus_tag LOCUS_12710 35042 35422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 35410 35691 gene locus_tag LOCUS_12720 35410 35691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 36135 36491 gene locus_tag LOCUS_12730 36135 36491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 38155 37019 gene locus_tag LOCUS_12740 38155 37019 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020066.1 protein_id gnl|my_center|LOCUS_12740 38209 38472 gene locus_tag LOCUS_12750 38209 38472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 38518 39252 gene locus_tag LOCUS_12760 38518 39252 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_12760 42414 39235 gene locus_tag LOCUS_12770 gene ileS 42414 39235 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022402.1 protein_id gnl|my_center|LOCUS_12770 42602 43084 gene locus_tag LOCUS_12780 42602 43084 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_12780 44873 43011 gene locus_tag LOCUS_12790 44873 43011 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986480.1 protein_id gnl|my_center|LOCUS_12790 46069 44867 gene locus_tag LOCUS_12800 46069 44867 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250233.1 protein_id gnl|my_center|LOCUS_12800 46311 46066 gene locus_tag LOCUS_12810 46311 46066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 46342 47655 gene locus_tag LOCUS_12820 46342 47655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 47652 48749 gene locus_tag LOCUS_12830 gene ftsZ 47652 48749 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064630.1 protein_id gnl|my_center|LOCUS_12830 48756 48965 gene locus_tag LOCUS_12840 48756 48965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 48962 49444 gene locus_tag LOCUS_12850 48962 49444 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065945.1 protein_id gnl|my_center|LOCUS_12850 49650 50126 gene locus_tag LOCUS_12860 49650 50126 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024155.1 protein_id gnl|my_center|LOCUS_12860 50178 50819 gene locus_tag LOCUS_12870 50178 50819 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878987.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence17 868 1368 gene locus_tag LOCUS_12880 868 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 3016 1991 gene locus_tag LOCUS_12890 3016 1991 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021053.1 protein_id gnl|my_center|LOCUS_12890 3252 3836 gene locus_tag LOCUS_12900 3252 3836 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266683.1 protein_id gnl|my_center|LOCUS_12900 4136 3861 gene locus_tag LOCUS_12910 4136 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065696.1 protein_id gnl|my_center|LOCUS_12910 4288 4500 gene locus_tag LOCUS_12920 4288 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 4579 5517 gene locus_tag LOCUS_12930 4579 5517 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240546.1 protein_id gnl|my_center|LOCUS_12930 5514 6023 gene locus_tag LOCUS_12940 5514 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 7585 6116 gene locus_tag LOCUS_12950 7585 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 9186 7825 gene locus_tag LOCUS_12960 9186 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990833.1 protein_id gnl|my_center|LOCUS_12960 9937 9221 gene locus_tag LOCUS_12970 9937 9221 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022197.1 protein_id gnl|my_center|LOCUS_12970 10450 12666 gene locus_tag LOCUS_12980 gene glgP 10450 12666 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256629.1 protein_id gnl|my_center|LOCUS_12980 12773 13681 gene locus_tag LOCUS_12990 12773 13681 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313297.1 protein_id gnl|my_center|LOCUS_12990 13791 14732 gene locus_tag LOCUS_13000 13791 14732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 14729 15340 gene locus_tag LOCUS_13010 14729 15340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 16017 15337 gene locus_tag LOCUS_13020 16017 15337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 16174 16911 gene locus_tag LOCUS_13030 16174 16911 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095760.1 protein_id gnl|my_center|LOCUS_13030 18171 17680 gene locus_tag LOCUS_13040 18171 17680 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065425.1 protein_id gnl|my_center|LOCUS_13040 18207 19094 gene locus_tag LOCUS_13050 18207 19094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 19556 21292 gene locus_tag LOCUS_13060 19556 21292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 21346 21909 gene locus_tag LOCUS_13070 21346 21909 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871101.1 protein_id gnl|my_center|LOCUS_13070 21916 23790 gene locus_tag LOCUS_13080 21916 23790 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871102.1 protein_id gnl|my_center|LOCUS_13080 23883 25067 gene locus_tag LOCUS_13090 23883 25067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 25148 25423 gene locus_tag LOCUS_13100 25148 25423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 25518 25847 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26867 26316 gene locus_tag LOCUS_13110 26867 26316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 27036 27278 gene locus_tag LOCUS_13120 27036 27278 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877185.1 protein_id gnl|my_center|LOCUS_13120 27271 27783 gene locus_tag LOCUS_13130 27271 27783 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065175.1 protein_id gnl|my_center|LOCUS_13130 28001 27702 gene locus_tag LOCUS_13140 28001 27702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 27982 28197 gene locus_tag LOCUS_13150 27982 28197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 28564 28199 gene locus_tag LOCUS_13160 28564 28199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 28635 28868 gene locus_tag LOCUS_13170 28635 28868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 28865 29182 gene locus_tag LOCUS_13180 28865 29182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878070.1 protein_id gnl|my_center|LOCUS_13180 30856 29189 gene locus_tag LOCUS_13190 30856 29189 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361675.1 protein_id gnl|my_center|LOCUS_13190 30901 31503 gene locus_tag LOCUS_13200 30901 31503 CDS product amino acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021487.1 protein_id gnl|my_center|LOCUS_13200 31718 31972 gene locus_tag LOCUS_13210 31718 31972 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877307.1 protein_id gnl|my_center|LOCUS_13210 32956 32003 gene locus_tag LOCUS_13220 32956 32003 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875827.1 protein_id gnl|my_center|LOCUS_13220 33572 33291 gene locus_tag LOCUS_13230 33572 33291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 33865 34131 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34819 34457 gene locus_tag LOCUS_13240 34819 34457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 35526 34975 gene locus_tag LOCUS_13250 35526 34975 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223369.1 protein_id gnl|my_center|LOCUS_13250 35634 36173 gene locus_tag LOCUS_13260 35634 36173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 36252 37685 gene locus_tag LOCUS_13270 gene cls 36252 37685 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243311.1 protein_id gnl|my_center|LOCUS_13270 38660 37692 gene locus_tag LOCUS_13280 38660 37692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 39045 38674 gene locus_tag LOCUS_13290 39045 38674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 39702 39088 gene locus_tag LOCUS_13300 39702 39088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 39884 39750 gene locus_tag LOCUS_13310 39884 39750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 40055 40411 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 41649 40624 gene locus_tag LOCUS_13320 41649 40624 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_13320 41704 41779 gene locus_tag LOCUS_t00260 41704 41779 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 42217 42642 gene locus_tag LOCUS_13330 42217 42642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 43595 47536 gene locus_tag LOCUS_13340 43595 47536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 47260 47493 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence18 5736 4768 gene locus_tag LOCUS_13350 5736 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 5937 6113 gene locus_tag LOCUS_13360 5937 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 6386 6754 gene locus_tag LOCUS_13370 6386 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 6841 7062 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7714 7965 gene locus_tag LOCUS_13380 7714 7965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 7991 8176 gene locus_tag LOCUS_13390 7991 8176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 8624 8882 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9022 9295 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9344 10528 gene locus_tag LOCUS_13400 9344 10528 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023091.1 protein_id gnl|my_center|LOCUS_13400 15056 11037 gene locus_tag LOCUS_13410 15056 11037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 15153 15361 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17080 16415 gene locus_tag LOCUS_13420 17080 16415 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021756.1 protein_id gnl|my_center|LOCUS_13420 18059 17085 gene locus_tag LOCUS_13430 18059 17085 CDS product DUF3344 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065202.1 protein_id gnl|my_center|LOCUS_13430 18268 18467 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20823 20647 gene locus_tag LOCUS_13440 20823 20647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 20786 21148 gene locus_tag LOCUS_13450 20786 21148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 21145 22365 gene locus_tag LOCUS_13460 21145 22365 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860356.1 protein_id gnl|my_center|LOCUS_13460 22362 23423 gene locus_tag LOCUS_13470 22362 23423 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_13470 23423 24211 gene locus_tag LOCUS_13480 23423 24211 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 protein_id gnl|my_center|LOCUS_13480 24208 27882 gene locus_tag LOCUS_13490 gene cobN 24208 27882 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932109.1 protein_id gnl|my_center|LOCUS_13490 27995 28255 gene locus_tag LOCUS_13500 27995 28255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 29414 28233 gene locus_tag LOCUS_13510 29414 28233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 30693 30118 gene locus_tag LOCUS_13520 30693 30118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 31318 30680 gene locus_tag LOCUS_13530 31318 30680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 32382 32822 gene locus_tag LOCUS_13540 32382 32822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 33137 33466 gene locus_tag LOCUS_13550 33137 33466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 33535 35589 gene locus_tag LOCUS_13560 33535 35589 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256027.1 protein_id gnl|my_center|LOCUS_13560 36937 35597 gene locus_tag LOCUS_13570 gene purB 36937 35597 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066555.1 protein_id gnl|my_center|LOCUS_13570 37746 36991 gene locus_tag LOCUS_13580 37746 36991 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418348.1 protein_id gnl|my_center|LOCUS_13580 38994 37969 gene locus_tag LOCUS_13590 38994 37969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392352.1 protein_id gnl|my_center|LOCUS_13590 40913 38991 gene locus_tag LOCUS_13600 40913 38991 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811724.1 protein_id gnl|my_center|LOCUS_13600 42247 40913 gene locus_tag LOCUS_13610 gene acsC 42247 40913 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811725.1 protein_id gnl|my_center|LOCUS_13610 43164 42253 gene locus_tag LOCUS_13620 43164 42253 CDS product acetyl-CoA decarbonylase/synthase complex subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944232.1 protein_id gnl|my_center|LOCUS_13620 45214 43178 gene locus_tag LOCUS_13630 gene acsB 45214 43178 CDS product acetyl-CoA decarbonylase/synthase complex subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546472.1 protein_id gnl|my_center|LOCUS_13630 >Feature sequence19 1953 1336 gene locus_tag LOCUS_13640 1953 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 2180 1950 gene locus_tag LOCUS_13650 2180 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 2239 2440 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3022 3816 gene locus_tag LOCUS_13660 3022 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 3830 4666 gene locus_tag LOCUS_13670 3830 4666 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921011.1 protein_id gnl|my_center|LOCUS_13670 5496 4744 gene locus_tag LOCUS_13680 5496 4744 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020795.1 protein_id gnl|my_center|LOCUS_13680 5700 5939 gene locus_tag LOCUS_13690 5700 5939 CDS product MTH865 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022202.1 protein_id gnl|my_center|LOCUS_13690 6626 6036 gene locus_tag LOCUS_13700 6626 6036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 7175 7312 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10186 7835 gene locus_tag LOCUS_13710 gene lon 10186 7835 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021863.1 protein_id gnl|my_center|LOCUS_13710 10696 10277 gene locus_tag LOCUS_13720 10696 10277 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021864.1 protein_id gnl|my_center|LOCUS_13720 11566 10775 gene locus_tag LOCUS_13730 11566 10775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 12625 11627 gene locus_tag LOCUS_13740 12625 11627 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967612.1 protein_id gnl|my_center|LOCUS_13740 13002 13442 gene locus_tag LOCUS_13750 13002 13442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 14921 13848 gene locus_tag LOCUS_13760 14921 13848 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065256.1 protein_id gnl|my_center|LOCUS_13760 15234 15162 gene locus_tag LOCUS_t00270 15234 15162 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 16017 15394 gene locus_tag LOCUS_13770 16017 15394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 16353 17834 gene locus_tag LOCUS_13780 16353 17834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 17847 18962 gene locus_tag LOCUS_13790 17847 18962 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250860.1 protein_id gnl|my_center|LOCUS_13790 20871 19048 gene locus_tag LOCUS_13800 20871 19048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 23530 21218 gene locus_tag LOCUS_13810 23530 21218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 23459 23704 gene locus_tag LOCUS_13820 23459 23704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 24003 25973 gene locus_tag LOCUS_13830 24003 25973 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_13830 26100 26465 gene locus_tag LOCUS_13840 26100 26465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 28210 26462 gene locus_tag LOCUS_13850 28210 26462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 28425 28694 gene locus_tag LOCUS_13860 28425 28694 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_13860 28747 29334 gene locus_tag LOCUS_13870 28747 29334 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065212.1 protein_id gnl|my_center|LOCUS_13870 29414 30121 gene locus_tag LOCUS_13880 29414 30121 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020781.1 protein_id gnl|my_center|LOCUS_13880 30848 30129 gene locus_tag LOCUS_13890 30848 30129 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027567.1 protein_id gnl|my_center|LOCUS_13890 31171 30917 gene locus_tag LOCUS_13900 31171 30917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 31455 32243 gene locus_tag LOCUS_13910 31455 32243 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937693.1 protein_id gnl|my_center|LOCUS_13910 32348 33427 gene locus_tag LOCUS_13920 32348 33427 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459574.1 protein_id gnl|my_center|LOCUS_13920 34179 33493 gene locus_tag LOCUS_13930 34179 33493 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937696.1 protein_id gnl|my_center|LOCUS_13930 34940 34188 gene locus_tag LOCUS_13940 34940 34188 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_13940 35621 34944 gene locus_tag LOCUS_13950 35621 34944 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937694.1 protein_id gnl|my_center|LOCUS_13950 35799 36719 gene locus_tag LOCUS_13960 35799 36719 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065835.1 protein_id gnl|my_center|LOCUS_13960 36724 37758 gene locus_tag LOCUS_13970 36724 37758 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_13970 38542 37772 gene locus_tag LOCUS_13980 38542 37772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 38763 38928 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39174 39884 gene locus_tag LOCUS_13990 39174 39884 CDS product DUF5714 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673563.1 protein_id gnl|my_center|LOCUS_13990 40060 39869 gene locus_tag LOCUS_14000 40060 39869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 40447 40154 gene locus_tag LOCUS_14010 40447 40154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 40361 40849 gene locus_tag LOCUS_14020 40361 40849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 41467 40856 gene locus_tag LOCUS_14030 41467 40856 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042684532.1 protein_id gnl|my_center|LOCUS_14030 42010 41528 gene locus_tag LOCUS_14040 42010 41528 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023000.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14040 42180 42857 gene locus_tag LOCUS_14050 42180 42857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 42987 43481 gene locus_tag LOCUS_14060 42987 43481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 >Feature sequence20 <1 223 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agtcgtgcctcacgtaggcacgtggattgaaa 732 499 gene locus_tag LOCUS_14070 732 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14070 1262 2743 gene locus_tag LOCUS_14080 1262 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 3058 4161 gene locus_tag LOCUS_14090 3058 4161 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020134.1 protein_id gnl|my_center|LOCUS_14090 4385 4119 gene locus_tag LOCUS_14100 4385 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 4474 5490 gene locus_tag LOCUS_14110 4474 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14110 5480 5818 gene locus_tag LOCUS_14120 5480 5818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 6097 5813 gene locus_tag LOCUS_14130 6097 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 8590 6254 gene locus_tag LOCUS_14140 8590 6254 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903216.1 protein_id gnl|my_center|LOCUS_14140 8975 9257 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10031 10708 gene locus_tag LOCUS_14150 gene radB 10031 10708 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860416.1 protein_id gnl|my_center|LOCUS_14150 11513 10695 gene locus_tag LOCUS_14160 gene dapF 11513 10695 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878250.1 protein_id gnl|my_center|LOCUS_14160 12219 11794 gene locus_tag LOCUS_14170 12219 11794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 12456 12724 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13613 13191 gene locus_tag LOCUS_14180 13613 13191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 14046 13639 gene locus_tag LOCUS_14190 14046 13639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 15383 14223 gene locus_tag LOCUS_14200 15383 14223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 15928 15380 gene locus_tag LOCUS_14210 15928 15380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 17108 15963 gene locus_tag LOCUS_14220 17108 15963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 17582 18181 gene locus_tag LOCUS_14230 17582 18181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270500.1 protein_id gnl|my_center|LOCUS_14230 19591 18380 gene locus_tag LOCUS_14240 19591 18380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 20271 19588 gene locus_tag LOCUS_14250 20271 19588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 21210 20299 gene locus_tag LOCUS_14260 21210 20299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 21671 21913 gene locus_tag LOCUS_14270 21671 21913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 23141 22590 gene locus_tag LOCUS_14280 23141 22590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14280 23368 23138 gene locus_tag LOCUS_14290 23368 23138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 24931 24404 gene locus_tag LOCUS_14300 24931 24404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 25158 24916 gene locus_tag LOCUS_14310 25158 24916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 25289 25462 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25728 26096 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26212 26697 gene locus_tag LOCUS_14320 26212 26697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 27303 26872 gene locus_tag LOCUS_14330 27303 26872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 28414 27644 gene locus_tag LOCUS_14340 28414 27644 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990796.1 protein_id gnl|my_center|LOCUS_14340 30969 28822 gene locus_tag LOCUS_14350 30969 28822 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924817.1 protein_id gnl|my_center|LOCUS_14350 32156 30966 gene locus_tag LOCUS_14360 32156 30966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 33349 32141 gene locus_tag LOCUS_14370 33349 32141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 34802 33426 gene locus_tag LOCUS_14380 34802 33426 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869927.1 protein_id gnl|my_center|LOCUS_14380 35902 34823 gene locus_tag LOCUS_14390 gene wecB 35902 34823 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_14390 37088 35934 gene locus_tag LOCUS_14400 37088 35934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 38355 37552 gene locus_tag LOCUS_14410 gene truA 38355 37552 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249878.1 protein_id gnl|my_center|LOCUS_14410 38960 38352 gene locus_tag LOCUS_14420 38960 38352 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289241.1 protein_id gnl|my_center|LOCUS_14420 39061 40485 gene locus_tag LOCUS_14430 39061 40485 CDS product dihydropteroate synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023773.1 protein_id gnl|my_center|LOCUS_14430 41448 41828 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42002 42454 gene locus_tag LOCUS_14440 42002 42454 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064389.1 protein_id gnl|my_center|LOCUS_14440 42572 42806 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42941 43195 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence21 528 2054 gene locus_tag LOCUS_14450 gene lysS 528 2054 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020805.1 protein_id gnl|my_center|LOCUS_14450 2067 2261 gene locus_tag LOCUS_14460 2067 2261 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014310.1 protein_id gnl|my_center|LOCUS_14460 4188 2275 gene locus_tag LOCUS_14470 4188 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 6182 4344 gene locus_tag LOCUS_14480 6182 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 8131 6233 gene locus_tag LOCUS_14490 8131 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 10259 8595 gene locus_tag LOCUS_14500 gene thsB 10259 8595 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020145.1 protein_id gnl|my_center|LOCUS_14500 11213 10317 gene locus_tag LOCUS_14510 11213 10317 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289434.1 protein_id gnl|my_center|LOCUS_14510 11285 12538 gene locus_tag LOCUS_14520 11285 12538 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903554.1 protein_id gnl|my_center|LOCUS_14520 12995 13139 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13218 14153 gene locus_tag LOCUS_14530 13218 14153 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021005.1 protein_id gnl|my_center|LOCUS_14530 14150 14785 gene locus_tag LOCUS_14540 gene pyrF 14150 14785 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065013.1 protein_id gnl|my_center|LOCUS_14540 14903 15265 gene locus_tag LOCUS_14550 14903 15265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 15262 16158 gene locus_tag LOCUS_14560 15262 16158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 16360 16166 gene locus_tag LOCUS_14570 16360 16166 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964076.1 protein_id gnl|my_center|LOCUS_14570 16634 17860 gene locus_tag LOCUS_14580 16634 17860 CDS product replication protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022958.1 protein_id gnl|my_center|LOCUS_14580 17857 18423 gene locus_tag LOCUS_14590 17857 18423 CDS product RPA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903600.1 protein_id gnl|my_center|LOCUS_14590 18463 19770 gene locus_tag LOCUS_14600 18463 19770 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230387.1 protein_id gnl|my_center|LOCUS_14600 19931 20911 gene locus_tag LOCUS_14610 19931 20911 CDS product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810823.1 protein_id gnl|my_center|LOCUS_14610 21578 20940 gene locus_tag LOCUS_14620 21578 20940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 22427 21753 gene locus_tag LOCUS_14630 gene ribB 22427 21753 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020597.1 protein_id gnl|my_center|LOCUS_14630 23088 22420 gene locus_tag LOCUS_14640 23088 22420 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319832.1 protein_id gnl|my_center|LOCUS_14640 23211 23921 gene locus_tag LOCUS_14650 23211 23921 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023933.1 protein_id gnl|my_center|LOCUS_14650 23915 24967 gene locus_tag LOCUS_14660 23915 24967 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023934.1 protein_id gnl|my_center|LOCUS_14660 24979 26124 gene locus_tag LOCUS_14670 24979 26124 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_14670 26127 26519 gene locus_tag LOCUS_14680 26127 26519 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023936.1 protein_id gnl|my_center|LOCUS_14680 27744 26797 gene locus_tag LOCUS_14690 27744 26797 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020662.1 protein_id gnl|my_center|LOCUS_14690 27779 28987 gene locus_tag LOCUS_14700 gene hmgA 27779 28987 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876201.1 protein_id gnl|my_center|LOCUS_14700 29462 28998 gene locus_tag LOCUS_14710 gene rimI 29462 28998 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876630.1 protein_id gnl|my_center|LOCUS_14710 29614 30810 gene locus_tag LOCUS_14720 29614 30810 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063044.1 protein_id gnl|my_center|LOCUS_14720 31551 30910 gene locus_tag LOCUS_14730 31551 30910 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024475.1 protein_id gnl|my_center|LOCUS_14730 31587 31798 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31917 32480 gene locus_tag LOCUS_14740 31917 32480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 32477 33520 gene locus_tag LOCUS_14750 32477 33520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 33514 34017 gene locus_tag LOCUS_14760 33514 34017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 34005 34385 gene locus_tag LOCUS_14770 34005 34385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 34366 34818 gene locus_tag LOCUS_14780 34366 34818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 34834 35586 gene locus_tag LOCUS_14790 34834 35586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 35890 35660 gene locus_tag LOCUS_14800 gene eif1A 35890 35660 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064286.1 protein_id gnl|my_center|LOCUS_14800 36201 36866 gene locus_tag LOCUS_14810 36201 36866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 37623 37999 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38381 38677 gene locus_tag LOCUS_14820 38381 38677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 38951 39178 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39288 39935 gene locus_tag LOCUS_14830 39288 39935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 40121 39942 gene locus_tag LOCUS_14840 40121 39942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 40439 40176 gene locus_tag LOCUS_14850 40439 40176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 <41126 40486 gene locus_tag LOCUS_14860 <41126 40486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932891.1:aminoacetone oxidase family FAD-binding enzyme >Feature sequence22 947 522 gene locus_tag LOCUS_14870 947 522 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021123.1 protein_id gnl|my_center|LOCUS_14870 1413 952 gene locus_tag LOCUS_14880 gene rpmD 1413 952 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879397.1 protein_id gnl|my_center|LOCUS_14880 2031 1414 gene locus_tag LOCUS_14890 gene rpsE 2031 1414 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879398.1 protein_id gnl|my_center|LOCUS_14890 2562 2035 gene locus_tag LOCUS_14900 2562 2035 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021120.1 protein_id gnl|my_center|LOCUS_14900 3014 2562 gene locus_tag LOCUS_14910 3014 2562 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021119.1 protein_id gnl|my_center|LOCUS_14910 3450 3007 gene locus_tag LOCUS_14920 3450 3007 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066173.1 protein_id gnl|my_center|LOCUS_14920 3971 3447 gene locus_tag LOCUS_14930 3971 3447 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250476.1 protein_id gnl|my_center|LOCUS_14930 4379 3987 gene locus_tag LOCUS_14940 4379 3987 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867448.1 protein_id gnl|my_center|LOCUS_14940 4572 4393 gene locus_tag LOCUS_14950 4572 4393 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879404.1 protein_id gnl|my_center|LOCUS_14950 5078 4575 gene locus_tag LOCUS_14960 5078 4575 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021114.1 protein_id gnl|my_center|LOCUS_14960 5803 5075 gene locus_tag LOCUS_14970 5803 5075 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879406.1 protein_id gnl|my_center|LOCUS_14970 6159 5803 gene locus_tag LOCUS_14980 gene rplX 6159 5803 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065039.1 protein_id gnl|my_center|LOCUS_14980 6573 6184 gene locus_tag LOCUS_14990 gene rpl14p 6573 6184 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021111.1 protein_id gnl|my_center|LOCUS_14990 6905 6579 gene locus_tag LOCUS_15000 6905 6579 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021110.1 protein_id gnl|my_center|LOCUS_15000 7191 6919 gene locus_tag LOCUS_15010 7191 6919 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875653.1 protein_id gnl|my_center|LOCUS_15010 7391 7188 gene locus_tag LOCUS_15020 gene rpmC 7391 7188 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021108.1 protein_id gnl|my_center|LOCUS_15020 8096 7392 gene locus_tag LOCUS_15030 8096 7392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 8563 8096 gene locus_tag LOCUS_15040 gene rplV 8563 8096 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875649.1 protein_id gnl|my_center|LOCUS_15040 8976 8563 gene locus_tag LOCUS_15050 8976 8563 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021105.1 protein_id gnl|my_center|LOCUS_15050 9705 8986 gene locus_tag LOCUS_15060 9705 8986 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879415.1 protein_id gnl|my_center|LOCUS_15060 9966 9718 gene locus_tag LOCUS_15070 9966 9718 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021103.1 protein_id gnl|my_center|LOCUS_15070 10712 9963 gene locus_tag LOCUS_15080 gene rpl4p 10712 9963 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879417.1 protein_id gnl|my_center|LOCUS_15080 11733 10720 gene locus_tag LOCUS_15090 gene rpl3p 11733 10720 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021101.1 protein_id gnl|my_center|LOCUS_15090 12893 12528 gene locus_tag LOCUS_15100 12893 12528 CDS product Tfx family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496415.1 protein_id gnl|my_center|LOCUS_15100 13072 13914 gene locus_tag LOCUS_15110 13072 13914 CDS product F420-dependent methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878217.1 protein_id gnl|my_center|LOCUS_15110 15127 14198 gene locus_tag LOCUS_15120 15127 14198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878828.1 protein_id gnl|my_center|LOCUS_15120 16248 15256 gene locus_tag LOCUS_15130 gene mer 16248 15256 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877358.1 protein_id gnl|my_center|LOCUS_15130 16588 18462 gene locus_tag LOCUS_15140 16588 18462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 19414 18449 gene locus_tag LOCUS_15150 19414 18449 CDS product DUF128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065980.1 protein_id gnl|my_center|LOCUS_15150 19839 19411 gene locus_tag LOCUS_15160 gene dcd 19839 19411 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902137.1 protein_id gnl|my_center|LOCUS_15160 19891 19962 gene locus_tag LOCUS_t00280 19891 19962 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 20051 20992 gene locus_tag LOCUS_15170 20051 20992 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836550.1 protein_id gnl|my_center|LOCUS_15170 24174 21130 gene locus_tag LOCUS_15180 24174 21130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 25768 24368 gene locus_tag LOCUS_15190 25768 24368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 27331 25808 gene locus_tag LOCUS_15200 27331 25808 CDS product AMP phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023176.1 protein_id gnl|my_center|LOCUS_15200 29007 27721 gene locus_tag LOCUS_15210 29007 27721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 29047 29291 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29560 29882 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31263 31559 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31649 31722 gene locus_tag LOCUS_t00290 31649 31722 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 31931 32761 gene locus_tag LOCUS_15220 31931 32761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 32780 32975 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32978 33238 gene locus_tag LOCUS_15230 32978 33238 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022120.1 protein_id gnl|my_center|LOCUS_15230 33642 34028 gene locus_tag LOCUS_15240 33642 34028 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875944.1 protein_id gnl|my_center|LOCUS_15240 34025 34465 gene locus_tag LOCUS_15250 34025 34465 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875943.1 protein_id gnl|my_center|LOCUS_15250 35309 34575 gene locus_tag LOCUS_15260 35309 34575 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064937.1 protein_id gnl|my_center|LOCUS_15260 35942 35331 gene locus_tag LOCUS_15270 35942 35331 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020399.1 protein_id gnl|my_center|LOCUS_15270 36799 35939 gene locus_tag LOCUS_15280 36799 35939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 37013 37218 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37855 38076 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38507 38727 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38740 39192 gene locus_tag LOCUS_15290 38740 39192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 39189 40115 gene locus_tag LOCUS_15300 39189 40115 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869643.1 protein_id gnl|my_center|LOCUS_15300 40182 40270 gene locus_tag LOCUS_t00300 40182 40270 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence23 618 760 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 909 3866 gene locus_tag LOCUS_15310 909 3866 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070740.1 protein_id gnl|my_center|LOCUS_15310 3863 4588 gene locus_tag LOCUS_15320 3863 4588 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023421.1 protein_id gnl|my_center|LOCUS_15320 4690 4869 gene locus_tag LOCUS_15330 4690 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 6006 4996 gene locus_tag LOCUS_15340 6006 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 6853 6035 gene locus_tag LOCUS_15350 gene nifH 6853 6035 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023791.1 protein_id gnl|my_center|LOCUS_15350 7083 7703 gene locus_tag LOCUS_15360 7083 7703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 9186 7729 gene locus_tag LOCUS_15370 9186 7729 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250133.1 protein_id gnl|my_center|LOCUS_15370 10292 9270 gene locus_tag LOCUS_15380 10292 9270 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057751.1 protein_id gnl|my_center|LOCUS_15380 11570 10380 gene locus_tag LOCUS_15390 11570 10380 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939297.1 protein_id gnl|my_center|LOCUS_15390 12487 11729 gene locus_tag LOCUS_15400 gene nfi 12487 11729 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172477.1 protein_id gnl|my_center|LOCUS_15400 14522 12723 gene locus_tag LOCUS_15410 14522 12723 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396787.1 protein_id gnl|my_center|LOCUS_15410 16009 14519 gene locus_tag LOCUS_15420 16009 14519 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242829.1 protein_id gnl|my_center|LOCUS_15420 17516 16011 gene locus_tag LOCUS_15430 17516 16011 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_15430 17890 17513 gene locus_tag LOCUS_15440 17890 17513 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_15440 18318 17887 gene locus_tag LOCUS_15450 18318 17887 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328225.1 protein_id gnl|my_center|LOCUS_15450 18590 18315 gene locus_tag LOCUS_15460 18590 18315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15460 18832 18587 gene locus_tag LOCUS_15470 18832 18587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15470 19143 18829 gene locus_tag LOCUS_15480 gene mnhG 19143 18829 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902380.1 protein_id gnl|my_center|LOCUS_15480 19394 19131 gene locus_tag LOCUS_15490 19394 19131 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_15490 19849 19391 gene locus_tag LOCUS_15500 19849 19391 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867824.1 protein_id gnl|my_center|LOCUS_15500 20159 20368 gene locus_tag LOCUS_15510 20159 20368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 20349 21965 gene locus_tag LOCUS_15520 20349 21965 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876115.1 protein_id gnl|my_center|LOCUS_15520 22753 22010 gene locus_tag LOCUS_15530 22753 22010 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064390.1 protein_id gnl|my_center|LOCUS_15530 23026 22811 gene locus_tag LOCUS_15540 23026 22811 CDS product DUF2180 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060737.1 protein_id gnl|my_center|LOCUS_15540 24541 23042 gene locus_tag LOCUS_15550 24541 23042 CDS product DUF2193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875740.1 protein_id gnl|my_center|LOCUS_15550 25886 24885 gene locus_tag LOCUS_15560 gene fen 25886 24885 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250232.1 protein_id gnl|my_center|LOCUS_15560 26250 25936 gene locus_tag LOCUS_15570 26250 25936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 26308 27219 gene locus_tag LOCUS_15580 26308 27219 CDS product presenilin family intramembrane aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065870.1 protein_id gnl|my_center|LOCUS_15580 28048 27167 gene locus_tag LOCUS_15590 28048 27167 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589523.1 protein_id gnl|my_center|LOCUS_15590 28175 29059 gene locus_tag LOCUS_15600 28175 29059 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021408.1 protein_id gnl|my_center|LOCUS_15600 29204 29413 gene locus_tag LOCUS_15610 29204 29413 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877303.1 protein_id gnl|my_center|LOCUS_15610 29714 29929 gene locus_tag LOCUS_15620 29714 29929 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023444.1 protein_id gnl|my_center|LOCUS_15620 30609 29905 gene locus_tag LOCUS_15630 30609 29905 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876695.1 protein_id gnl|my_center|LOCUS_15630 31577 30603 gene locus_tag LOCUS_15640 gene radA 31577 30603 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023460.1 protein_id gnl|my_center|LOCUS_15640 30801 30893 gene locus_tag LOCUS_t00310 30801 30893 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 32966 31683 gene locus_tag LOCUS_15650 32966 31683 CDS product single-stranded DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902049.1 protein_id gnl|my_center|LOCUS_15650 34275 32983 gene locus_tag LOCUS_15660 gene lysA 34275 32983 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878303.1 protein_id gnl|my_center|LOCUS_15660 35348 34272 gene locus_tag LOCUS_15670 35348 34272 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065191.1 protein_id gnl|my_center|LOCUS_15670 35235 35453 gene locus_tag LOCUS_15680 35235 35453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 35657 35974 gene locus_tag LOCUS_15690 35657 35974 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240352.1 protein_id gnl|my_center|LOCUS_15690 35974 36717 gene locus_tag LOCUS_15700 35974 36717 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020278.1 protein_id gnl|my_center|LOCUS_15700 36714 37184 gene locus_tag LOCUS_15710 36714 37184 CDS product DUF1890 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020187.1 protein_id gnl|my_center|LOCUS_15710 37169 37450 gene locus_tag LOCUS_15720 37169 37450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 38308 38631 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38788 39213 gene locus_tag LOCUS_15730 38788 39213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 >Feature sequence24 1 708 gene locus_tag LOCUS_15740 1 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 742 1413 gene locus_tag LOCUS_15750 742 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1671 2033 gene locus_tag LOCUS_15760 1671 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 2099 3046 gene locus_tag LOCUS_15770 2099 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 5720 3189 gene locus_tag LOCUS_15780 5720 3189 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877365.1 protein_id gnl|my_center|LOCUS_15780 5803 6603 gene locus_tag LOCUS_15790 gene proG 5803 6603 CDS product pyrroline-5-carboxylate reductase ProG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232626.1 protein_id gnl|my_center|LOCUS_15790 6660 7289 gene locus_tag LOCUS_15800 6660 7289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 7442 7609 gene locus_tag LOCUS_15810 7442 7609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 8463 8936 gene locus_tag LOCUS_15820 8463 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 10113 9115 gene locus_tag LOCUS_15830 gene aroC 10113 9115 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_15830 11477 10110 gene locus_tag LOCUS_15840 11477 10110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 12742 11474 gene locus_tag LOCUS_15850 gene aroA 12742 11474 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876404.1 protein_id gnl|my_center|LOCUS_15850 13533 12739 gene locus_tag LOCUS_15860 gene pheA 13533 12739 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060994.1 protein_id gnl|my_center|LOCUS_15860 14354 13530 gene locus_tag LOCUS_15870 14354 13530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 15346 14360 gene locus_tag LOCUS_15880 15346 14360 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881255.1 protein_id gnl|my_center|LOCUS_15880 16137 15343 gene locus_tag LOCUS_15890 16137 15343 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877622.1 protein_id gnl|my_center|LOCUS_15890 16931 16134 gene locus_tag LOCUS_15900 16931 16134 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876218.1 protein_id gnl|my_center|LOCUS_15900 17678 17241 gene locus_tag LOCUS_15910 17678 17241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 17787 19025 gene locus_tag LOCUS_15920 gene pan 17787 19025 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879468.1 protein_id gnl|my_center|LOCUS_15920 19670 19077 gene locus_tag LOCUS_15930 19670 19077 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484893.1 protein_id gnl|my_center|LOCUS_15930 20826 20380 gene locus_tag LOCUS_15940 20826 20380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 22288 21116 gene locus_tag LOCUS_15950 22288 21116 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289167.1 protein_id gnl|my_center|LOCUS_15950 22327 22722 gene locus_tag LOCUS_15960 22327 22722 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020302.1 protein_id gnl|my_center|LOCUS_15960 22972 23358 gene locus_tag LOCUS_15970 22972 23358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 23603 26803 gene locus_tag LOCUS_15980 23603 26803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 26800 27303 gene locus_tag LOCUS_15990 26800 27303 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941051.1 protein_id gnl|my_center|LOCUS_15990 28626 27307 gene locus_tag LOCUS_16000 28626 27307 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140384.1 protein_id gnl|my_center|LOCUS_16000 28774 29322 gene locus_tag LOCUS_16010 28774 29322 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249766.1 protein_id gnl|my_center|LOCUS_16010 29454 30245 gene locus_tag LOCUS_16020 29454 30245 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529713.1 protein_id gnl|my_center|LOCUS_16020 30315 31580 gene locus_tag LOCUS_16030 30315 31580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 31585 31890 gene locus_tag LOCUS_16040 31585 31890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 34096 32171 gene locus_tag LOCUS_16050 gene uvrB 34096 32171 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023255.1 protein_id gnl|my_center|LOCUS_16050 35643 34093 gene locus_tag LOCUS_16060 gene uvrC 35643 34093 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023256.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence25 1437 541 gene locus_tag LOCUS_16070 1437 541 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876118.1 protein_id gnl|my_center|LOCUS_16070 2351 1653 gene locus_tag LOCUS_16080 2351 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 3250 2444 gene locus_tag LOCUS_16090 gene pyrH 3250 2444 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057025.1 protein_id gnl|my_center|LOCUS_16090 3343 3576 gene locus_tag LOCUS_16100 3343 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 3624 3977 gene locus_tag LOCUS_16110 3624 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 4128 5030 gene locus_tag LOCUS_16120 4128 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 5098 6231 gene locus_tag LOCUS_16130 5098 6231 CDS product putative sulfate/molybdate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057197.1 protein_id gnl|my_center|LOCUS_16130 7313 6234 gene locus_tag LOCUS_16140 7313 6234 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060827.1 protein_id gnl|my_center|LOCUS_16140 8022 7318 gene locus_tag LOCUS_16150 8022 7318 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060828.1 protein_id gnl|my_center|LOCUS_16150 8982 8077 gene locus_tag LOCUS_16160 8982 8077 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876118.1 protein_id gnl|my_center|LOCUS_16160 8867 9079 gene locus_tag LOCUS_16170 8867 9079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 10088 9174 gene locus_tag LOCUS_16180 10088 9174 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876118.1 protein_id gnl|my_center|LOCUS_16180 10297 11547 gene locus_tag LOCUS_16190 gene hisD 10297 11547 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023136.1 protein_id gnl|my_center|LOCUS_16190 12543 11596 gene locus_tag LOCUS_16200 12543 11596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 13420 12650 gene locus_tag LOCUS_16210 13420 12650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 13716 16157 gene locus_tag LOCUS_16220 13716 16157 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877144.1 protein_id gnl|my_center|LOCUS_16220 16223 16427 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17580 16627 gene locus_tag LOCUS_16230 17580 16627 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334964.1 protein_id gnl|my_center|LOCUS_16230 18237 19106 gene locus_tag LOCUS_16240 18237 19106 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020797.1 protein_id gnl|my_center|LOCUS_16240 20251 19520 gene locus_tag LOCUS_16250 20251 19520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 20760 20245 gene locus_tag LOCUS_16260 20760 20245 CDS product DJ-1/PfpI/YhbO family deglycase/protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870481.1 protein_id gnl|my_center|LOCUS_16260 21136 23478 gene locus_tag LOCUS_16270 21136 23478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 23751 24227 gene locus_tag LOCUS_16280 23751 24227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 24488 24255 gene locus_tag LOCUS_16290 24488 24255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 24588 26246 gene locus_tag LOCUS_16300 24588 26246 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320246.1 protein_id gnl|my_center|LOCUS_16300 27385 26243 gene locus_tag LOCUS_16310 27385 26243 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023953.1 protein_id gnl|my_center|LOCUS_16310 28430 27366 gene locus_tag LOCUS_16320 28430 27366 CDS product DUF2117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990783.1 protein_id gnl|my_center|LOCUS_16320 29154 28462 gene locus_tag LOCUS_16330 29154 28462 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403082.1 protein_id gnl|my_center|LOCUS_16330 29153 29629 gene locus_tag LOCUS_16340 29153 29629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 29697 29924 gene locus_tag LOCUS_16350 29697 29924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 31739 29934 gene locus_tag LOCUS_16360 31739 29934 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024488.1 protein_id gnl|my_center|LOCUS_16360 32185 31736 gene locus_tag LOCUS_16370 32185 31736 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021674.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence26 166 2196 gene locus_tag LOCUS_16380 166 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 2303 2482 gene locus_tag LOCUS_16390 2303 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 3812 2649 gene locus_tag LOCUS_16400 3812 2649 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023078.1 protein_id gnl|my_center|LOCUS_16400 3927 4424 gene locus_tag LOCUS_16410 3927 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 4417 4677 gene locus_tag LOCUS_16420 4417 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 5019 4681 gene locus_tag LOCUS_16430 5019 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 5476 5171 gene locus_tag LOCUS_16440 gene yciH 5476 5171 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023951.1 protein_id gnl|my_center|LOCUS_16440 5699 7228 gene locus_tag LOCUS_16450 5699 7228 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023184.1 protein_id gnl|my_center|LOCUS_16450 7996 8493 gene locus_tag LOCUS_16460 7996 8493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 8505 9794 gene locus_tag LOCUS_16470 8505 9794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 9844 10404 gene locus_tag LOCUS_16480 9844 10404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 13405 10658 gene locus_tag LOCUS_16490 13405 10658 CDS product calcium-transporting P-type ATPase, PMR1-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272458.1 protein_id gnl|my_center|LOCUS_16490 13588 14142 gene locus_tag LOCUS_16500 13588 14142 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037521.1 protein_id gnl|my_center|LOCUS_16500 14201 15406 gene locus_tag LOCUS_16510 14201 15406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16510 15433 15954 gene locus_tag LOCUS_16520 15433 15954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 16016 19873 gene locus_tag LOCUS_16530 16016 19873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 19881 20738 gene locus_tag LOCUS_16540 19881 20738 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106518184.1 protein_id gnl|my_center|LOCUS_16540 20772 20854 gene locus_tag LOCUS_t00320 20772 20854 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21627 21490 gene locus_tag LOCUS_16550 21627 21490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 22206 21949 gene locus_tag LOCUS_16560 22206 21949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 23532 22252 gene locus_tag LOCUS_16570 23532 22252 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065247.1 protein_id gnl|my_center|LOCUS_16570 23736 23992 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25096 25395 gene locus_tag LOCUS_16580 25096 25395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 25392 26567 gene locus_tag LOCUS_16590 25392 26567 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296321.1 protein_id gnl|my_center|LOCUS_16590 26564 27766 gene locus_tag LOCUS_16600 26564 27766 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860104.1 protein_id gnl|my_center|LOCUS_16600 27775 30033 gene locus_tag LOCUS_16610 27775 30033 CDS product DUF2206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021084.1 protein_id gnl|my_center|LOCUS_16610 31343 30108 gene locus_tag LOCUS_16620 31343 30108 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147032.1 protein_id gnl|my_center|LOCUS_16620 31358 31552 gene locus_tag LOCUS_16630 31358 31552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 <33266 31605 gene locus_tag LOCUS_16640 <33266 31605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162013069.1:CARDB domain-containing protein >Feature sequence27 127 681 gene locus_tag LOCUS_16650 127 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 678 1808 gene locus_tag LOCUS_16660 gene thiI 678 1808 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877292.1 protein_id gnl|my_center|LOCUS_16660 2180 3061 gene locus_tag LOCUS_16670 2180 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 3530 3330 gene locus_tag LOCUS_16680 3530 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 4591 3986 gene locus_tag LOCUS_16690 gene npdG 4591 3986 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878392.1 protein_id gnl|my_center|LOCUS_16690 4926 4633 gene locus_tag LOCUS_16700 gene trxA 4926 4633 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065637.1 protein_id gnl|my_center|LOCUS_16700 6447 4987 gene locus_tag LOCUS_16710 6447 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 7302 6448 gene locus_tag LOCUS_16720 7302 6448 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020197.1 protein_id gnl|my_center|LOCUS_16720 7683 7997 gene locus_tag LOCUS_16730 7683 7997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 8049 8333 gene locus_tag LOCUS_16740 8049 8333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 8323 8730 gene locus_tag LOCUS_16750 8323 8730 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020323.1 protein_id gnl|my_center|LOCUS_16750 8739 10175 gene locus_tag LOCUS_16760 8739 10175 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064301.1 protein_id gnl|my_center|LOCUS_16760 10172 10750 gene locus_tag LOCUS_16770 10172 10750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066058.1 protein_id gnl|my_center|LOCUS_16770 10761 11204 gene locus_tag LOCUS_16780 10761 11204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 11210 12190 gene locus_tag LOCUS_16790 11210 12190 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_16790 12273 12773 gene locus_tag LOCUS_16800 12273 12773 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080866.1 protein_id gnl|my_center|LOCUS_16800 12770 13441 gene locus_tag LOCUS_16810 12770 13441 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974705.1 protein_id gnl|my_center|LOCUS_16810 13438 14136 gene locus_tag LOCUS_16820 13438 14136 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337285.1 protein_id gnl|my_center|LOCUS_16820 14118 14780 gene locus_tag LOCUS_16830 14118 14780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 14791 16581 gene locus_tag LOCUS_16840 gene oadA 14791 16581 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_16840 16614 18089 gene locus_tag LOCUS_16850 16614 18089 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020720.1 protein_id gnl|my_center|LOCUS_16850 18336 19565 gene locus_tag LOCUS_16860 18336 19565 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135390550.1 protein_id gnl|my_center|LOCUS_16860 19562 20428 gene locus_tag LOCUS_16870 19562 20428 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867167.1 protein_id gnl|my_center|LOCUS_16870 20425 21249 gene locus_tag LOCUS_16880 20425 21249 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013747453.1 protein_id gnl|my_center|LOCUS_16880 21251 21469 gene locus_tag LOCUS_16890 21251 21469 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_16890 21854 22666 gene locus_tag LOCUS_16900 21854 22666 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404186.1 protein_id gnl|my_center|LOCUS_16900 22887 23360 gene locus_tag LOCUS_16910 22887 23360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 23892 23977 gene locus_tag LOCUS_t00330 23892 23977 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 24258 24067 gene locus_tag LOCUS_16920 24258 24067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 24435 25133 gene locus_tag LOCUS_16930 24435 25133 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868261.1 protein_id gnl|my_center|LOCUS_16930 25130 25696 gene locus_tag LOCUS_16940 25130 25696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 25707 27692 gene locus_tag LOCUS_16950 25707 27692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 28899 27673 gene locus_tag LOCUS_16960 gene mmp10 28899 27673 CDS product methyl coenzyme M reductase-arginine methyltransferase Mmp10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024424.1 protein_id gnl|my_center|LOCUS_16960 29078 29362 gene locus_tag LOCUS_16970 29078 29362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 29437 29509 gene locus_tag LOCUS_t00340 29437 29509 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 31106 31402 gene locus_tag LOCUS_16980 31106 31402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 31496 32338 gene locus_tag LOCUS_16990 31496 32338 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871021.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence28 <1 1195 gene locus_tag LOCUS_17000 <1 1195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_137607921.1:Ig-like domain-containing protein 1506 3005 gene locus_tag LOCUS_17010 1506 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 4055 3240 gene locus_tag LOCUS_17020 4055 3240 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878754.1 protein_id gnl|my_center|LOCUS_17020 4564 4094 gene locus_tag LOCUS_17030 4564 4094 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867539.1 protein_id gnl|my_center|LOCUS_17030 4725 5423 gene locus_tag LOCUS_17040 4725 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 5507 5728 gene locus_tag LOCUS_17050 5507 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 6319 5729 gene locus_tag LOCUS_17060 6319 5729 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902018.1 protein_id gnl|my_center|LOCUS_17060 6353 6793 gene locus_tag LOCUS_17070 6353 6793 CDS product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061234.1 protein_id gnl|my_center|LOCUS_17070 7094 9094 gene locus_tag LOCUS_17080 7094 9094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 9254 9069 gene locus_tag LOCUS_17090 9254 9069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 10479 9238 gene locus_tag LOCUS_17100 gene xseA 10479 9238 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393024.1 protein_id gnl|my_center|LOCUS_17100 10525 11349 gene locus_tag LOCUS_17110 10525 11349 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496750.1 protein_id gnl|my_center|LOCUS_17110 11445 12725 gene locus_tag LOCUS_17120 11445 12725 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_17120 12745 13371 gene locus_tag LOCUS_17130 gene purN 12745 13371 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_17130 13429 13761 gene locus_tag LOCUS_17140 13429 13761 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020348.1 protein_id gnl|my_center|LOCUS_17140 13758 14018 gene locus_tag LOCUS_17150 13758 14018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 14070 14519 gene locus_tag LOCUS_17160 14070 14519 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867943.1 protein_id gnl|my_center|LOCUS_17160 14540 14878 gene locus_tag LOCUS_17170 14540 14878 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024007.1 protein_id gnl|my_center|LOCUS_17170 14878 15468 gene locus_tag LOCUS_17180 14878 15468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496581.1 protein_id gnl|my_center|LOCUS_17180 15648 15911 gene locus_tag LOCUS_17190 15648 15911 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024004.1 protein_id gnl|my_center|LOCUS_17190 15913 16575 gene locus_tag LOCUS_17200 15913 16575 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024003.1 protein_id gnl|my_center|LOCUS_17200 16583 16774 gene locus_tag LOCUS_17210 16583 16774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 16767 17225 gene locus_tag LOCUS_17220 16767 17225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 17228 18307 gene locus_tag LOCUS_17230 gene ftsY 17228 18307 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903840.1 protein_id gnl|my_center|LOCUS_17230 18307 19635 gene locus_tag LOCUS_17240 18307 19635 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024460.1 protein_id gnl|my_center|LOCUS_17240 19636 20217 gene locus_tag LOCUS_17250 gene trmY 19636 20217 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066221.1 protein_id gnl|my_center|LOCUS_17250 20205 21443 gene locus_tag LOCUS_17260 20205 21443 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021461.1 protein_id gnl|my_center|LOCUS_17260 21446 21739 gene locus_tag LOCUS_17270 21446 21739 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868223.1 protein_id gnl|my_center|LOCUS_17270 21761 22111 gene locus_tag LOCUS_17280 21761 22111 CDS product RNA polymerase Rpb4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021458.1 protein_id gnl|my_center|LOCUS_17280 22129 22692 gene locus_tag LOCUS_17290 22129 22692 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879028.1 protein_id gnl|my_center|LOCUS_17290 22689 23474 gene locus_tag LOCUS_17300 22689 23474 CDS product 16S ribosomal RNA methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902839.1 protein_id gnl|my_center|LOCUS_17300 23467 24045 gene locus_tag LOCUS_17310 23467 24045 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021454.1 protein_id gnl|my_center|LOCUS_17310 24899 24363 gene locus_tag LOCUS_17320 24899 24363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 25733 26599 gene locus_tag LOCUS_17330 25733 26599 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020797.1 protein_id gnl|my_center|LOCUS_17330 26666 27295 gene locus_tag LOCUS_17340 26666 27295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 29444 27696 gene locus_tag LOCUS_17350 gene mutL 29444 27696 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732291.1 protein_id gnl|my_center|LOCUS_17350 32062 29441 gene locus_tag LOCUS_17360 gene mutS 32062 29441 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020572.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence29 195 920 gene locus_tag LOCUS_17370 195 920 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_17370 943 2097 gene locus_tag LOCUS_17380 gene sat 943 2097 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245745.1 protein_id gnl|my_center|LOCUS_17380 2355 2567 gene locus_tag LOCUS_17390 gene thiS 2355 2567 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945026.1 protein_id gnl|my_center|LOCUS_17390 2564 3796 gene locus_tag LOCUS_17400 2564 3796 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259308.1 protein_id gnl|my_center|LOCUS_17400 3811 4611 gene locus_tag LOCUS_17410 gene moeB 3811 4611 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942003.1 protein_id gnl|my_center|LOCUS_17410 4608 5012 gene locus_tag LOCUS_17420 4608 5012 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816173.1 protein_id gnl|my_center|LOCUS_17420 5009 5875 gene locus_tag LOCUS_17430 5009 5875 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460728.1 protein_id gnl|my_center|LOCUS_17430 5865 6104 gene locus_tag LOCUS_17440 5865 6104 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393466.1 protein_id gnl|my_center|LOCUS_17440 6320 7474 gene locus_tag LOCUS_17450 gene tnpB 6320 7474 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_17450 7608 7682 gene locus_tag LOCUS_t00350 7608 7682 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7867 9051 gene locus_tag LOCUS_17460 7867 9051 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393897.1 protein_id gnl|my_center|LOCUS_17460 9592 9137 gene locus_tag LOCUS_17470 9592 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 10270 9710 gene locus_tag LOCUS_17480 10270 9710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 12229 10394 gene locus_tag LOCUS_17490 12229 10394 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496752.1 protein_id gnl|my_center|LOCUS_17490 12936 12379 gene locus_tag LOCUS_17500 gene dcd 12936 12379 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582476.1 protein_id gnl|my_center|LOCUS_17500 13657 12959 gene locus_tag LOCUS_17510 13657 12959 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064947.1 protein_id gnl|my_center|LOCUS_17510 14353 13661 gene locus_tag LOCUS_17520 14353 13661 CDS product phosphoglycerol geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877910.1 protein_id gnl|my_center|LOCUS_17520 17153 14358 gene locus_tag LOCUS_17530 17153 14358 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022481.1 protein_id gnl|my_center|LOCUS_17530 18576 17161 gene locus_tag LOCUS_17540 gene gatB 18576 17161 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024400.1 protein_id gnl|my_center|LOCUS_17540 19874 18573 gene locus_tag LOCUS_17550 gene gatA 19874 18573 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066007.1 protein_id gnl|my_center|LOCUS_17550 20144 19875 gene locus_tag LOCUS_17560 gene gatC 20144 19875 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879817.1 protein_id gnl|my_center|LOCUS_17560 21132 20134 gene locus_tag LOCUS_17570 21132 20134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 21353 21530 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21904 22578 gene locus_tag LOCUS_17580 21904 22578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 22580 23125 gene locus_tag LOCUS_17590 22580 23125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 23174 24064 gene locus_tag LOCUS_17600 23174 24064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 24068 24601 gene locus_tag LOCUS_17610 24068 24601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 24738 25388 gene locus_tag LOCUS_17620 24738 25388 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927082.1 protein_id gnl|my_center|LOCUS_17620 26355 25480 gene locus_tag LOCUS_17630 26355 25480 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814367.1 protein_id gnl|my_center|LOCUS_17630 27029 26466 gene locus_tag LOCUS_17640 27029 26466 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024475.1 protein_id gnl|my_center|LOCUS_17640 27334 28098 gene locus_tag LOCUS_17650 27334 28098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 28144 28944 gene locus_tag LOCUS_17660 28144 28944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 29006 29197 gene locus_tag LOCUS_17670 29006 29197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 29645 29430 gene locus_tag LOCUS_17680 29645 29430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 31277 30387 gene locus_tag LOCUS_17690 31277 30387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 31670 31278 gene locus_tag LOCUS_17700 31670 31278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 32017 31667 gene locus_tag LOCUS_17710 32017 31667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 >Feature sequence30 769 1122 gene locus_tag LOCUS_17720 769 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 1277 2008 gene locus_tag LOCUS_17730 gene fdhD 1277 2008 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813485.1 protein_id gnl|my_center|LOCUS_17730 2677 2210 gene locus_tag LOCUS_17740 2677 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 2699 3013 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5094 5420 gene locus_tag LOCUS_17750 5094 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 5550 6179 gene locus_tag LOCUS_17760 5550 6179 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_17760 6249 8147 gene locus_tag LOCUS_17770 gene rqcH 6249 8147 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061171.1 protein_id gnl|my_center|LOCUS_17770 8144 9169 gene locus_tag LOCUS_17780 8144 9169 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020699.1 protein_id gnl|my_center|LOCUS_17780 9424 9786 gene locus_tag LOCUS_17790 9424 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 9793 11565 gene locus_tag LOCUS_17800 9793 11565 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023139.1 protein_id gnl|my_center|LOCUS_17800 12242 12829 gene locus_tag LOCUS_17810 12242 12829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 14144 12960 gene locus_tag LOCUS_17820 14144 12960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 14620 14129 gene locus_tag LOCUS_17830 14620 14129 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878538.1 protein_id gnl|my_center|LOCUS_17830 15251 14637 gene locus_tag LOCUS_17840 15251 14637 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012940758.1 protein_id gnl|my_center|LOCUS_17840 17222 15264 gene locus_tag LOCUS_17850 17222 15264 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878540.1 protein_id gnl|my_center|LOCUS_17850 18249 17215 gene locus_tag LOCUS_17860 18249 17215 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065597.1 protein_id gnl|my_center|LOCUS_17860 18614 18252 gene locus_tag LOCUS_17870 18614 18252 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878542.1 protein_id gnl|my_center|LOCUS_17870 19493 18681 gene locus_tag LOCUS_17880 19493 18681 CDS product CheF family chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878543.1 protein_id gnl|my_center|LOCUS_17880 20628 19525 gene locus_tag LOCUS_17890 20628 19525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 22227 20632 gene locus_tag LOCUS_17900 gene flaJ 22227 20632 CDS product archaellar assembly protein FlaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878548.1 protein_id gnl|my_center|LOCUS_17900 24089 22233 gene locus_tag LOCUS_17910 24089 22233 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878549.1 protein_id gnl|my_center|LOCUS_17910 24836 24093 gene locus_tag LOCUS_17920 24836 24093 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546206.1 protein_id gnl|my_center|LOCUS_17920 25322 24840 gene locus_tag LOCUS_17930 25322 24840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 25828 25325 gene locus_tag LOCUS_17940 25828 25325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023018.1 protein_id gnl|my_center|LOCUS_17940 26632 25832 gene locus_tag LOCUS_17950 26632 25832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 27138 28703 gene locus_tag LOCUS_17960 27138 28703 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886617.1 protein_id gnl|my_center|LOCUS_17960 29025 29813 gene locus_tag LOCUS_17970 29025 29813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence31 545 180 gene locus_tag LOCUS_17980 545 180 CDS product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024086.1 protein_id gnl|my_center|LOCUS_17980 942 550 gene locus_tag LOCUS_17990 942 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 1176 1475 gene locus_tag LOCUS_18000 1176 1475 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023836.1 protein_id gnl|my_center|LOCUS_18000 1549 4305 gene locus_tag LOCUS_18010 1549 4305 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045029.1 protein_id gnl|my_center|LOCUS_18010 4454 5527 gene locus_tag LOCUS_18020 gene arsB 4454 5527 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826549.1 protein_id gnl|my_center|LOCUS_18020 5970 5782 gene locus_tag LOCUS_18030 5970 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 6952 6236 gene locus_tag LOCUS_18040 6952 6236 CDS product aromatic aminobenezylarsenical efflux permease ArsG family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107126.1 protein_id gnl|my_center|LOCUS_18040 7488 6949 gene locus_tag LOCUS_18050 7488 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 7967 7659 gene locus_tag LOCUS_18060 7967 7659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 8589 9218 gene locus_tag LOCUS_18070 8589 9218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 9657 9310 gene locus_tag LOCUS_18080 9657 9310 CDS product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024086.1 protein_id gnl|my_center|LOCUS_18080 10067 9660 gene locus_tag LOCUS_18090 10067 9660 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_18090 10944 10072 gene locus_tag LOCUS_18100 10944 10072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 11188 10946 gene locus_tag LOCUS_18110 11188 10946 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023834.1 protein_id gnl|my_center|LOCUS_18110 11454 11221 gene locus_tag LOCUS_18120 11454 11221 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023834.1 protein_id gnl|my_center|LOCUS_18120 11720 11451 gene locus_tag LOCUS_18130 11720 11451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 12810 11731 gene locus_tag LOCUS_18140 12810 11731 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023833.1 protein_id gnl|my_center|LOCUS_18140 13146 12898 gene locus_tag LOCUS_18150 13146 12898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 13418 13101 gene locus_tag LOCUS_18160 13418 13101 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022822.1 protein_id gnl|my_center|LOCUS_18160 14064 13801 gene locus_tag LOCUS_18170 14064 13801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 14917 15132 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15309 15713 gene locus_tag LOCUS_18180 15309 15713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 16512 15616 gene locus_tag LOCUS_18190 gene pdxS 16512 15616 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876304.1 protein_id gnl|my_center|LOCUS_18190 17436 16516 gene locus_tag LOCUS_18200 gene cbiB 17436 16516 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877021.1 protein_id gnl|my_center|LOCUS_18200 17939 17415 gene locus_tag LOCUS_18210 17939 17415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 18117 17947 gene locus_tag LOCUS_18220 18117 17947 CDS product methytransferase partner Trm112 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023214.1 protein_id gnl|my_center|LOCUS_18220 19082 18129 gene locus_tag LOCUS_18230 19082 18129 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878344.1 protein_id gnl|my_center|LOCUS_18230 19715 19896 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21548 21057 gene locus_tag LOCUS_18240 21548 21057 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020962.1 protein_id gnl|my_center|LOCUS_18240 22836 21553 gene locus_tag LOCUS_18250 22836 21553 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064787.1 protein_id gnl|my_center|LOCUS_18250 23511 24002 gene locus_tag LOCUS_18260 23511 24002 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064607.1 protein_id gnl|my_center|LOCUS_18260 24514 23999 gene locus_tag LOCUS_18270 gene cgi121 24514 23999 CDS product KEOPS complex subunit Cgi121 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021174.1 protein_id gnl|my_center|LOCUS_18270 26660 24522 gene locus_tag LOCUS_18280 26660 24522 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023138.1 protein_id gnl|my_center|LOCUS_18280 27281 26739 gene locus_tag LOCUS_18290 27281 26739 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249751.1 protein_id gnl|my_center|LOCUS_18290 28075 27278 gene locus_tag LOCUS_18300 28075 27278 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020938.1 protein_id gnl|my_center|LOCUS_18300 29030 28083 gene locus_tag LOCUS_18310 29030 28083 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020859.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence32 1018 254 gene locus_tag LOCUS_18320 gene mcrG 1018 254 CDS product coenzyme-B sulfoethylthiotransferase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060982.1 protein_id gnl|my_center|LOCUS_18320 2642 1338 gene locus_tag LOCUS_18330 gene mcrB 2642 1338 CDS product coenzyme-B sulfoethylthiotransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024423.1 protein_id gnl|my_center|LOCUS_18330 3788 4201 gene locus_tag LOCUS_18340 3788 4201 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024065.1 protein_id gnl|my_center|LOCUS_18340 4201 5571 gene locus_tag LOCUS_18350 4201 5571 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061087.1 protein_id gnl|my_center|LOCUS_18350 5575 7281 gene locus_tag LOCUS_18360 5575 7281 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870682.1 protein_id gnl|my_center|LOCUS_18360 7293 8093 gene locus_tag LOCUS_18370 7293 8093 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877167.1 protein_id gnl|my_center|LOCUS_18370 8169 9329 gene locus_tag LOCUS_18380 8169 9329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 10092 9343 gene locus_tag LOCUS_18390 10092 9343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 10222 10998 gene locus_tag LOCUS_18400 gene rnc 10222 10998 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460498.1 protein_id gnl|my_center|LOCUS_18400 11000 12178 gene locus_tag LOCUS_18410 11000 12178 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436749.1 protein_id gnl|my_center|LOCUS_18410 12225 12587 gene locus_tag LOCUS_18420 12225 12587 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674794.1 protein_id gnl|my_center|LOCUS_18420 12697 14607 gene locus_tag LOCUS_18430 12697 14607 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937741.1 protein_id gnl|my_center|LOCUS_18430 14604 15467 gene locus_tag LOCUS_18440 14604 15467 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937740.1 protein_id gnl|my_center|LOCUS_18440 15467 15943 gene locus_tag LOCUS_18450 15467 15943 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937739.1 protein_id gnl|my_center|LOCUS_18450 15940 16320 gene locus_tag LOCUS_18460 15940 16320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 16305 17384 gene locus_tag LOCUS_18470 16305 17384 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937737.1 protein_id gnl|my_center|LOCUS_18470 17392 17784 gene locus_tag LOCUS_18480 17392 17784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 19300 17930 gene locus_tag LOCUS_18490 19300 17930 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163428.1 protein_id gnl|my_center|LOCUS_18490 19973 19368 gene locus_tag LOCUS_18500 19973 19368 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023983.1 protein_id gnl|my_center|LOCUS_18500 20863 21543 gene locus_tag LOCUS_18510 20863 21543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 21558 23477 gene locus_tag LOCUS_18520 21558 23477 CDS product beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271984.1 protein_id gnl|my_center|LOCUS_18520 26194 23456 gene locus_tag LOCUS_18530 26194 23456 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169981.1 protein_id gnl|my_center|LOCUS_18530 26652 26311 gene locus_tag LOCUS_18540 26652 26311 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393515.1 protein_id gnl|my_center|LOCUS_18540 26998 27234 gene locus_tag LOCUS_18550 26998 27234 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022341.1 protein_id gnl|my_center|LOCUS_18550 28076 28279 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence33 2264 51 gene locus_tag LOCUS_18560 gene hypF 2264 51 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024049.1 protein_id gnl|my_center|LOCUS_18560 2354 2833 gene locus_tag LOCUS_18570 2354 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 2817 3629 gene locus_tag LOCUS_18580 2817 3629 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589532.1 protein_id gnl|my_center|LOCUS_18580 3626 5635 gene locus_tag LOCUS_18590 3626 5635 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289450.1 protein_id gnl|my_center|LOCUS_18590 6873 5680 gene locus_tag LOCUS_18600 6873 5680 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 protein_id gnl|my_center|LOCUS_18600 7842 7006 gene locus_tag LOCUS_18610 7842 7006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 8690 7839 gene locus_tag LOCUS_18620 8690 7839 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902335.1 protein_id gnl|my_center|LOCUS_18620 9080 8706 gene locus_tag LOCUS_18630 9080 8706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 9579 9112 gene locus_tag LOCUS_18640 9579 9112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 10285 9692 gene locus_tag LOCUS_18650 10285 9692 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023341.1 protein_id gnl|my_center|LOCUS_18650 10569 10324 gene locus_tag LOCUS_18660 10569 10324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 11783 10566 gene locus_tag LOCUS_18670 11783 10566 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878202.1 protein_id gnl|my_center|LOCUS_18670 12248 11790 gene locus_tag LOCUS_18680 12248 11790 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869527.1 protein_id gnl|my_center|LOCUS_18680 12736 15030 gene locus_tag LOCUS_18690 12736 15030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 15051 15124 gene locus_tag LOCUS_t00360 15051 15124 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 16041 15205 gene locus_tag LOCUS_18700 16041 15205 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021472.1 protein_id gnl|my_center|LOCUS_18700 16138 17352 gene locus_tag LOCUS_18710 16138 17352 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392801.1 protein_id gnl|my_center|LOCUS_18710 18623 17457 gene locus_tag LOCUS_18720 18623 17457 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545988.1 protein_id gnl|my_center|LOCUS_18720 18739 19683 gene locus_tag LOCUS_18730 18739 19683 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430615.1 protein_id gnl|my_center|LOCUS_18730 19847 20527 gene locus_tag LOCUS_18740 19847 20527 CDS product DUF5612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878900.1 protein_id gnl|my_center|LOCUS_18740 20527 21102 gene locus_tag LOCUS_18750 20527 21102 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903724.1 protein_id gnl|my_center|LOCUS_18750 21106 22035 gene locus_tag LOCUS_18760 21106 22035 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065056.1 protein_id gnl|my_center|LOCUS_18760 22698 22036 gene locus_tag LOCUS_18770 22698 22036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 22834 23130 gene locus_tag LOCUS_18780 22834 23130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 23204 23277 gene locus_tag LOCUS_t00370 23204 23277 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 24927 23881 gene locus_tag LOCUS_18790 24927 23881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020157.1 protein_id gnl|my_center|LOCUS_18790 26071 25229 gene locus_tag LOCUS_18800 26071 25229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 26439 26029 gene locus_tag LOCUS_18810 26439 26029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 26590 26450 gene locus_tag LOCUS_18820 26590 26450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 26781 26587 gene locus_tag LOCUS_18830 26781 26587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 26991 26782 gene locus_tag LOCUS_18840 26991 26782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 27632 26988 gene locus_tag LOCUS_18850 27632 26988 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086153.1 protein_id gnl|my_center|LOCUS_18850 27782 27633 gene locus_tag LOCUS_18860 27782 27633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 28216 27782 gene locus_tag LOCUS_18870 28216 27782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 28461 28195 gene locus_tag LOCUS_18880 28461 28195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 28561 28842 gene locus_tag LOCUS_18890 28561 28842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 >Feature sequence34 678 2054 gene locus_tag LOCUS_18900 678 2054 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_18900 5312 2133 gene locus_tag LOCUS_18910 5312 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 6292 5324 gene locus_tag LOCUS_18920 6292 5324 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_18920 6412 7206 gene locus_tag LOCUS_18930 6412 7206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 7213 7965 gene locus_tag LOCUS_18940 7213 7965 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020802.1 protein_id gnl|my_center|LOCUS_18940 7913 10642 gene locus_tag LOCUS_18950 7913 10642 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020807.1 protein_id gnl|my_center|LOCUS_18950 11437 10883 gene locus_tag LOCUS_18960 11437 10883 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903666.1 protein_id gnl|my_center|LOCUS_18960 11565 13268 gene locus_tag LOCUS_18970 11565 13268 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939525.1 protein_id gnl|my_center|LOCUS_18970 13356 13443 gene locus_tag LOCUS_t00380 13356 13443 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13743 13510 gene locus_tag LOCUS_18980 13743 13510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 14485 14225 gene locus_tag LOCUS_18990 14485 14225 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_18990 14700 15089 gene locus_tag LOCUS_19000 14700 15089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 15579 16007 gene locus_tag LOCUS_19010 15579 16007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 16075 16836 gene locus_tag LOCUS_19020 16075 16836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 17017 17427 gene locus_tag LOCUS_19030 17017 17427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 19677 17440 gene locus_tag LOCUS_19040 gene glgP 19677 17440 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256629.1 protein_id gnl|my_center|LOCUS_19040 21324 19825 gene locus_tag LOCUS_19050 gene malQ 21324 19825 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940406.1 protein_id gnl|my_center|LOCUS_19050 23701 21338 gene locus_tag LOCUS_19060 23701 21338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 25623 23704 gene locus_tag LOCUS_19070 gene glgB 25623 23704 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_19070 26789 25629 gene locus_tag LOCUS_19080 26789 25629 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065374.1 protein_id gnl|my_center|LOCUS_19080 28126 26771 gene locus_tag LOCUS_19090 28126 26771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 >Feature sequence35 1761 448 gene locus_tag LOCUS_19100 1761 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 2134 1874 gene locus_tag LOCUS_19110 2134 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 3185 3364 gene locus_tag LOCUS_19120 3185 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 3849 3361 gene locus_tag LOCUS_19130 3849 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 4356 4628 gene locus_tag LOCUS_19140 4356 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 6787 4739 gene locus_tag LOCUS_19150 gene brxL 6787 4739 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152948297.1 protein_id gnl|my_center|LOCUS_19150 9089 6792 gene locus_tag LOCUS_19160 gene pglZ 9089 6792 CDS product BREX-1 system phosphatase PglZ type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393722.1 protein_id gnl|my_center|LOCUS_19160 10328 9120 gene locus_tag LOCUS_19170 10328 9120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 13923 10735 gene locus_tag LOCUS_19180 13923 10735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 17402 13920 gene locus_tag LOCUS_19190 gene brxC 17402 13920 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393725.1 protein_id gnl|my_center|LOCUS_19190 17953 17402 gene locus_tag LOCUS_19200 17953 17402 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393726.1 protein_id gnl|my_center|LOCUS_19200 18648 17950 gene locus_tag LOCUS_19210 18648 17950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393727.1 protein_id gnl|my_center|LOCUS_19210 18920 19195 gene locus_tag LOCUS_19220 18920 19195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19220 19192 19368 gene locus_tag LOCUS_19230 19192 19368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19230 19372 19800 gene locus_tag LOCUS_19240 19372 19800 CDS product DUF365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879837.1 protein_id gnl|my_center|LOCUS_19240 19820 20338 gene locus_tag LOCUS_19250 19820 20338 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890481.1 protein_id gnl|my_center|LOCUS_19250 20852 20565 gene locus_tag LOCUS_19260 20852 20565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 22299 20845 gene locus_tag LOCUS_19270 22299 20845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 22856 22593 gene locus_tag LOCUS_19280 22856 22593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 25768 22853 gene locus_tag LOCUS_19290 25768 22853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 26106 25765 gene locus_tag LOCUS_19300 26106 25765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 26380 26099 gene locus_tag LOCUS_19310 26380 26099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 26502 26359 gene locus_tag LOCUS_19320 26502 26359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 27176 26745 gene locus_tag LOCUS_19330 27176 26745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 27793 27176 gene locus_tag LOCUS_19340 27793 27176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 <28620 27991 gene locus_tag LOCUS_19350 <28620 27991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021830.1:tyrosine-type recombinase/integrase >Feature sequence36 428 2983 gene locus_tag LOCUS_19360 428 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 3119 3335 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4615 3434 gene locus_tag LOCUS_19370 4615 3434 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_19370 5362 4985 gene locus_tag LOCUS_19380 5362 4985 CDS product Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066022.1 protein_id gnl|my_center|LOCUS_19380 5754 5386 gene locus_tag LOCUS_19390 5754 5386 CDS product DUF2073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289500.1 protein_id gnl|my_center|LOCUS_19390 6401 5760 gene locus_tag LOCUS_19400 6401 5760 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289501.1 protein_id gnl|my_center|LOCUS_19400 6641 7204 gene locus_tag LOCUS_19410 6641 7204 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876850.1 protein_id gnl|my_center|LOCUS_19410 7201 7956 gene locus_tag LOCUS_19420 7201 7956 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876849.1 protein_id gnl|my_center|LOCUS_19420 7997 8944 gene locus_tag LOCUS_19430 7997 8944 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048168954.1 protein_id gnl|my_center|LOCUS_19430 8952 9791 gene locus_tag LOCUS_19440 8952 9791 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024518.1 protein_id gnl|my_center|LOCUS_19440 9788 10570 gene locus_tag LOCUS_19450 9788 10570 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060996.1 protein_id gnl|my_center|LOCUS_19450 10996 11961 gene locus_tag LOCUS_19460 10996 11961 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022952.1 protein_id gnl|my_center|LOCUS_19460 12078 12163 gene locus_tag LOCUS_t00390 12078 12163 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12197 12646 gene locus_tag LOCUS_19470 12197 12646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 12659 13207 gene locus_tag LOCUS_19480 12659 13207 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021137.1 protein_id gnl|my_center|LOCUS_19480 13212 13601 gene locus_tag LOCUS_19490 13212 13601 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021138.1 protein_id gnl|my_center|LOCUS_19490 13601 14449 gene locus_tag LOCUS_19500 13601 14449 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879771.1 protein_id gnl|my_center|LOCUS_19500 14427 14795 gene locus_tag LOCUS_19510 14427 14795 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064921.1 protein_id gnl|my_center|LOCUS_19510 14801 15223 gene locus_tag LOCUS_19520 14801 15223 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020645.1 protein_id gnl|my_center|LOCUS_19520 15237 15638 gene locus_tag LOCUS_19530 15237 15638 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020646.1 protein_id gnl|my_center|LOCUS_19530 15674 15862 gene locus_tag LOCUS_19540 15674 15862 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867658.1 protein_id gnl|my_center|LOCUS_19540 15863 15937 gene locus_tag LOCUS_t00400 15863 15937 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 16143 17330 gene locus_tag LOCUS_19550 gene eno 16143 17330 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064335.1 protein_id gnl|my_center|LOCUS_19550 17332 17940 gene locus_tag LOCUS_19560 gene rpsB 17332 17940 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020649.1 protein_id gnl|my_center|LOCUS_19560 17997 18755 gene locus_tag LOCUS_19570 gene amrB 17997 18755 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875685.1 protein_id gnl|my_center|LOCUS_19570 18756 19625 gene locus_tag LOCUS_19580 18756 19625 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064922.1 protein_id gnl|my_center|LOCUS_19580 19618 20382 gene locus_tag LOCUS_19590 19618 20382 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020652.1 protein_id gnl|my_center|LOCUS_19590 20379 21431 gene locus_tag LOCUS_19600 gene fni 20379 21431 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064552.1 protein_id gnl|my_center|LOCUS_19600 21462 22799 gene locus_tag LOCUS_19610 21462 22799 CDS product RNase J family beta-CASP ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020654.1 protein_id gnl|my_center|LOCUS_19610 22810 23775 gene locus_tag LOCUS_19620 22810 23775 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066119.1 protein_id gnl|my_center|LOCUS_19620 23780 25468 gene locus_tag LOCUS_19630 gene gltX 23780 25468 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870894.1 protein_id gnl|my_center|LOCUS_19630 26771 25572 gene locus_tag LOCUS_19640 26771 25572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 >Feature sequence37 326 36 gene locus_tag LOCUS_19650 326 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 541 834 gene locus_tag LOCUS_19660 541 834 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869621.1 protein_id gnl|my_center|LOCUS_19660 831 1178 gene locus_tag LOCUS_19670 831 1178 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_19670 1809 1585 gene locus_tag LOCUS_19680 1809 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 2479 3867 gene locus_tag LOCUS_19690 2479 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 5010 4483 gene locus_tag LOCUS_19700 5010 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 5564 5007 gene locus_tag LOCUS_19710 5564 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 6427 5582 gene locus_tag LOCUS_19720 6427 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 7026 6424 gene locus_tag LOCUS_19730 7026 6424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 7622 7023 gene locus_tag LOCUS_19740 7622 7023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 8365 7724 gene locus_tag LOCUS_19750 8365 7724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 9871 9521 gene locus_tag LOCUS_19760 9871 9521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 10591 10061 gene locus_tag LOCUS_19770 10591 10061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 11177 10599 gene locus_tag LOCUS_19780 11177 10599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 11969 11724 gene locus_tag LOCUS_19790 11969 11724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19790 12603 12007 gene locus_tag LOCUS_19800 12603 12007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19800 13131 13343 gene locus_tag LOCUS_19810 13131 13343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 13652 13338 gene locus_tag LOCUS_19820 13652 13338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 14144 14272 gene locus_tag LOCUS_19830 14144 14272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 14968 14387 gene locus_tag LOCUS_19840 14968 14387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 15276 15479 gene locus_tag LOCUS_19850 15276 15479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 15759 15466 gene locus_tag LOCUS_19860 15759 15466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 15781 16113 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16345 16166 gene locus_tag LOCUS_19870 16345 16166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 16674 17093 gene locus_tag LOCUS_19880 16674 17093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 17447 20104 gene locus_tag LOCUS_19890 17447 20104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 20109 21803 gene locus_tag LOCUS_19900 20109 21803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 21916 23649 gene locus_tag LOCUS_19910 21916 23649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 23639 25441 gene locus_tag LOCUS_19920 23639 25441 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878161.1 protein_id gnl|my_center|LOCUS_19920 25460 26434 gene locus_tag LOCUS_19930 25460 26434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence38 550 766 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 937 1089 gene locus_tag LOCUS_19940 937 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 2203 2436 gene locus_tag LOCUS_19950 2203 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 2541 2903 gene locus_tag LOCUS_19960 2541 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 3277 2936 gene locus_tag LOCUS_19970 3277 2936 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460613.1 protein_id gnl|my_center|LOCUS_19970 3564 3274 gene locus_tag LOCUS_19980 3564 3274 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403413.1 protein_id gnl|my_center|LOCUS_19980 4159 3632 gene locus_tag LOCUS_19990 4159 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 4738 4280 gene locus_tag LOCUS_20000 4738 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 5027 4740 gene locus_tag LOCUS_20010 5027 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 5412 5038 gene locus_tag LOCUS_20020 5412 5038 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868810.1 protein_id gnl|my_center|LOCUS_20020 5717 5972 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6658 7986 gene locus_tag LOCUS_20030 6658 7986 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066157.1 protein_id gnl|my_center|LOCUS_20030 9381 8089 gene locus_tag LOCUS_20040 9381 8089 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_20040 11042 9696 gene locus_tag LOCUS_20050 11042 9696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 11827 11285 gene locus_tag LOCUS_20060 11827 11285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 12648 11932 gene locus_tag LOCUS_20070 12648 11932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 13633 12623 gene locus_tag LOCUS_20080 13633 12623 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064821.1 protein_id gnl|my_center|LOCUS_20080 14351 13620 gene locus_tag LOCUS_20090 14351 13620 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021299.1 protein_id gnl|my_center|LOCUS_20090 15199 14351 gene locus_tag LOCUS_20100 15199 14351 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902142.1 protein_id gnl|my_center|LOCUS_20100 16311 15181 gene locus_tag LOCUS_20110 gene coaBC 16311 15181 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065075.1 protein_id gnl|my_center|LOCUS_20110 17180 16308 gene locus_tag LOCUS_20120 17180 16308 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060988.1 protein_id gnl|my_center|LOCUS_20120 18233 17187 gene locus_tag LOCUS_20130 18233 17187 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023765.1 protein_id gnl|my_center|LOCUS_20130 18530 18237 gene locus_tag LOCUS_20140 18530 18237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 19406 18576 gene locus_tag LOCUS_20150 19406 18576 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024147.1 protein_id gnl|my_center|LOCUS_20150 19731 19378 gene locus_tag LOCUS_20160 19731 19378 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020176.1 protein_id gnl|my_center|LOCUS_20160 20013 21173 gene locus_tag LOCUS_20170 20013 21173 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211377.1 protein_id gnl|my_center|LOCUS_20170 21186 22226 gene locus_tag LOCUS_20180 21186 22226 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976079.1 protein_id gnl|my_center|LOCUS_20180 22223 22981 gene locus_tag LOCUS_20190 22223 22981 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211375.1 protein_id gnl|my_center|LOCUS_20190 23005 23766 gene locus_tag LOCUS_20200 23005 23766 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022138.1 protein_id gnl|my_center|LOCUS_20200 23738 24568 gene locus_tag LOCUS_20210 23738 24568 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020355.1 protein_id gnl|my_center|LOCUS_20210 25942 25199 gene locus_tag LOCUS_20220 25942 25199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 >Feature sequence39 610 1374 gene locus_tag LOCUS_20230 610 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 1815 2201 gene locus_tag LOCUS_20240 1815 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 2570 2121 gene locus_tag LOCUS_20250 2570 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 3017 2664 gene locus_tag LOCUS_20260 3017 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 3279 7022 gene locus_tag LOCUS_20270 gene cobN 3279 7022 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932109.1 protein_id gnl|my_center|LOCUS_20270 9157 7877 gene locus_tag LOCUS_20280 9157 7877 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022026.1 protein_id gnl|my_center|LOCUS_20280 8117 8045 gene locus_tag LOCUS_t00410 8117 8045 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11340 9154 gene locus_tag LOCUS_20290 11340 9154 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022025.1 protein_id gnl|my_center|LOCUS_20290 12350 11490 gene locus_tag LOCUS_20300 12350 11490 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721600.1 protein_id gnl|my_center|LOCUS_20300 13545 12526 gene locus_tag LOCUS_20310 13545 12526 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256222.1 protein_id gnl|my_center|LOCUS_20310 14567 13542 gene locus_tag LOCUS_20320 14567 13542 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256221.1 protein_id gnl|my_center|LOCUS_20320 15946 14624 gene locus_tag LOCUS_20330 15946 14624 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_20330 17850 16033 gene locus_tag LOCUS_20340 17850 16033 CDS product magnesium chelatase subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932111.1 protein_id gnl|my_center|LOCUS_20340 18880 17840 gene locus_tag LOCUS_20350 18880 17840 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461434.1 protein_id gnl|my_center|LOCUS_20350 19989 18877 gene locus_tag LOCUS_20360 19989 18877 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932105.1 protein_id gnl|my_center|LOCUS_20360 20301 20510 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20626 20838 gene locus_tag LOCUS_20370 20626 20838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 20825 21055 gene locus_tag LOCUS_20380 20825 21055 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250461.1 protein_id gnl|my_center|LOCUS_20380 22522 22208 gene locus_tag LOCUS_20390 22522 22208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 22863 22591 gene locus_tag LOCUS_20400 22863 22591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 23090 22860 gene locus_tag LOCUS_20410 23090 22860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 23746 23186 gene locus_tag LOCUS_20420 23746 23186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 24712 23912 gene locus_tag LOCUS_20430 24712 23912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 >Feature sequence40 194 517 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 600 2447 gene locus_tag LOCUS_20440 600 2447 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023035.1 protein_id gnl|my_center|LOCUS_20440 2444 2800 gene locus_tag LOCUS_20450 2444 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 2909 3130 gene locus_tag LOCUS_20460 2909 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 3235 4434 gene locus_tag LOCUS_20470 3235 4434 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942570.1 protein_id gnl|my_center|LOCUS_20470 4434 5033 gene locus_tag LOCUS_20480 4434 5033 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814926.1 protein_id gnl|my_center|LOCUS_20480 5135 5470 gene locus_tag LOCUS_20490 5135 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 6711 5623 gene locus_tag LOCUS_20500 6711 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 6742 6939 gene locus_tag LOCUS_20510 6742 6939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 7475 6927 gene locus_tag LOCUS_20520 7475 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 7880 8173 gene locus_tag LOCUS_20530 7880 8173 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869621.1 protein_id gnl|my_center|LOCUS_20530 8170 8514 gene locus_tag LOCUS_20540 8170 8514 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_20540 10135 9014 gene locus_tag LOCUS_20550 10135 9014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 11233 10298 gene locus_tag LOCUS_20560 11233 10298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 11599 12006 gene locus_tag LOCUS_20570 11599 12006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 12160 12639 gene locus_tag LOCUS_20580 12160 12639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 13420 12833 gene locus_tag LOCUS_20590 13420 12833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 15211 13520 gene locus_tag LOCUS_20600 15211 13520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 15871 15572 gene locus_tag LOCUS_20610 15871 15572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 15978 16886 gene locus_tag LOCUS_20620 15978 16886 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879220.1 protein_id gnl|my_center|LOCUS_20620 16912 17898 gene locus_tag LOCUS_20630 gene argC 16912 17898 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876479.1 protein_id gnl|my_center|LOCUS_20630 17909 18394 gene locus_tag LOCUS_20640 17909 18394 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065746.1 protein_id gnl|my_center|LOCUS_20640 18391 19542 gene locus_tag LOCUS_20650 gene argJ 18391 19542 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023478.1 protein_id gnl|my_center|LOCUS_20650 19539 20408 gene locus_tag LOCUS_20660 gene argB 19539 20408 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024391.1 protein_id gnl|my_center|LOCUS_20660 20702 20418 gene locus_tag LOCUS_20670 20702 20418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 20803 21390 gene locus_tag LOCUS_20680 20803 21390 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061267.1 protein_id gnl|my_center|LOCUS_20680 22164 21496 gene locus_tag LOCUS_20690 22164 21496 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459824.1 protein_id gnl|my_center|LOCUS_20690 22772 22161 gene locus_tag LOCUS_20700 22772 22161 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459824.1 protein_id gnl|my_center|LOCUS_20700 23461 22814 gene locus_tag LOCUS_20710 23461 22814 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880523.1 protein_id gnl|my_center|LOCUS_20710 23817 23467 gene locus_tag LOCUS_20720 23817 23467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 23975 23823 gene locus_tag LOCUS_20730 23975 23823 CDS product desulfoferrodoxin FeS4 iron-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023638.1 protein_id gnl|my_center|LOCUS_20730 24202 23972 gene locus_tag LOCUS_20740 24202 23972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 >Feature sequence41 143 1024 gene locus_tag LOCUS_20750 143 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 1028 1372 gene locus_tag LOCUS_20760 1028 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 1950 1369 gene locus_tag LOCUS_20770 1950 1369 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940745.1 protein_id gnl|my_center|LOCUS_20770 3631 2297 gene locus_tag LOCUS_20780 gene ilvD 3631 2297 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496775.1 protein_id gnl|my_center|LOCUS_20780 3662 3858 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5185 4265 gene locus_tag LOCUS_20790 5185 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 5890 5255 gene locus_tag LOCUS_20800 5890 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 6478 6146 gene locus_tag LOCUS_20810 6478 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 6515 6639 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7365 6910 gene locus_tag LOCUS_20820 7365 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20820 8341 7367 gene locus_tag LOCUS_20830 8341 7367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 9268 9044 gene locus_tag LOCUS_20840 9268 9044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 10514 9777 gene locus_tag LOCUS_20850 gene cobA 10514 9777 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022972.1 protein_id gnl|my_center|LOCUS_20850 11395 10511 gene locus_tag LOCUS_20860 gene hemC 11395 10511 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020631.1 protein_id gnl|my_center|LOCUS_20860 12627 11380 gene locus_tag LOCUS_20870 gene hemL 12627 11380 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020630.1 protein_id gnl|my_center|LOCUS_20870 13570 12614 gene locus_tag LOCUS_20880 gene hemB 13570 12614 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020627.1 protein_id gnl|my_center|LOCUS_20880 14847 13576 gene locus_tag LOCUS_20890 gene hemA 14847 13576 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020626.1 protein_id gnl|my_center|LOCUS_20890 15454 14840 gene locus_tag LOCUS_20900 15454 14840 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020625.1 protein_id gnl|my_center|LOCUS_20900 15615 16541 gene locus_tag LOCUS_20910 15615 16541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902695.1 protein_id gnl|my_center|LOCUS_20910 16635 17327 gene locus_tag LOCUS_20920 16635 17327 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479560.1 protein_id gnl|my_center|LOCUS_20920 17445 17520 gene locus_tag LOCUS_t00420 17445 17520 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 17789 18016 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18994 18227 gene locus_tag LOCUS_20930 18994 18227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 19407 20564 gene locus_tag LOCUS_20940 19407 20564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 21085 20879 gene locus_tag LOCUS_20950 21085 20879 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065315.1 protein_id gnl|my_center|LOCUS_20950 21293 22717 gene locus_tag LOCUS_20960 21293 22717 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876185.1 protein_id gnl|my_center|LOCUS_20960 23282 22779 gene locus_tag LOCUS_20970 gene fae 23282 22779 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022945.1 protein_id gnl|my_center|LOCUS_20970 23314 23585 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence42 1557 1150 gene locus_tag LOCUS_20980 1557 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 1925 2230 gene locus_tag LOCUS_20990 1925 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 2299 2460 gene locus_tag LOCUS_21000 2299 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 2892 2602 gene locus_tag LOCUS_21010 2892 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 3073 2870 gene locus_tag LOCUS_21020 3073 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 3087 3245 gene locus_tag LOCUS_21030 3087 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 4308 3385 gene locus_tag LOCUS_21040 4308 3385 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893461.1 protein_id gnl|my_center|LOCUS_21040 4575 5768 gene locus_tag LOCUS_21050 4575 5768 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975017.1 protein_id gnl|my_center|LOCUS_21050 5765 6139 gene locus_tag LOCUS_21060 5765 6139 CDS product sensory rhodopsin transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969669.1 protein_id gnl|my_center|LOCUS_21060 6574 6305 gene locus_tag LOCUS_21070 6574 6305 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870423.1 protein_id gnl|my_center|LOCUS_21070 6573 6833 gene locus_tag LOCUS_21080 6573 6833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 7633 6932 gene locus_tag LOCUS_21090 7633 6932 CDS product RibD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024246.1 protein_id gnl|my_center|LOCUS_21090 7751 8965 gene locus_tag LOCUS_21100 7751 8965 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_21100 9061 9429 gene locus_tag LOCUS_21110 9061 9429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 10001 10489 gene locus_tag LOCUS_21120 10001 10489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 10733 10443 gene locus_tag LOCUS_21130 10733 10443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 10893 10964 gene locus_tag LOCUS_t00430 10893 10964 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 10982 12361 gene locus_tag LOCUS_21140 gene pscS 10982 12361 CDS product O-phospho-L-seryl-tRNA:Cys-tRNA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871202.1 protein_id gnl|my_center|LOCUS_21140 12437 13915 gene locus_tag LOCUS_21150 12437 13915 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990604.1 protein_id gnl|my_center|LOCUS_21150 13991 14920 gene locus_tag LOCUS_21160 gene cysK 13991 14920 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022680.1 protein_id gnl|my_center|LOCUS_21160 14939 15886 gene locus_tag LOCUS_21170 gene cysE 14939 15886 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048171437.1 protein_id gnl|my_center|LOCUS_21170 16787 15915 gene locus_tag LOCUS_21180 gene nadA 16787 15915 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020997.1 protein_id gnl|my_center|LOCUS_21180 16956 17303 gene locus_tag LOCUS_21190 16956 17303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065385.1 protein_id gnl|my_center|LOCUS_21190 17420 17614 gene locus_tag LOCUS_21200 17420 17614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 17619 18554 gene locus_tag LOCUS_21210 17619 18554 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021969.1 protein_id gnl|my_center|LOCUS_21210 19345 18551 gene locus_tag LOCUS_21220 gene larE 19345 18551 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080596.1 protein_id gnl|my_center|LOCUS_21220 19671 19342 gene locus_tag LOCUS_21230 19671 19342 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990605.1 protein_id gnl|my_center|LOCUS_21230 19909 19981 gene locus_tag LOCUS_t00440 19909 19981 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 20171 20926 gene locus_tag LOCUS_21240 20171 20926 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020313.1 protein_id gnl|my_center|LOCUS_21240 20923 21201 gene locus_tag LOCUS_21250 20923 21201 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879596.1 protein_id gnl|my_center|LOCUS_21250 21482 21700 gene locus_tag LOCUS_21260 21482 21700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 22175 22247 gene locus_tag LOCUS_t00450 22175 22247 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence43 <1 1536 gene locus_tag LOCUS_21270 <1 1536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_158296889.1:PAS domain S-box protein 2231 1548 gene locus_tag LOCUS_21280 2231 1548 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879203.1 protein_id gnl|my_center|LOCUS_21280 2358 2951 gene locus_tag LOCUS_21290 2358 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 3356 2973 gene locus_tag LOCUS_21300 3356 2973 CDS product DUF61 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876580.1 protein_id gnl|my_center|LOCUS_21300 3934 5439 gene locus_tag LOCUS_21310 3934 5439 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023309.1 protein_id gnl|my_center|LOCUS_21310 5557 5871 gene locus_tag LOCUS_21320 5557 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 6394 6017 gene locus_tag LOCUS_21330 6394 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 6437 6731 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6962 7501 gene locus_tag LOCUS_21340 6962 7501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 7612 8304 gene locus_tag LOCUS_21350 7612 8304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 10384 8714 gene locus_tag LOCUS_21360 10384 8714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 10884 10399 gene locus_tag LOCUS_21370 10884 10399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 11443 12258 gene locus_tag LOCUS_21380 11443 12258 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250014.1 protein_id gnl|my_center|LOCUS_21380 13801 12335 gene locus_tag LOCUS_21390 13801 12335 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932680.1 protein_id gnl|my_center|LOCUS_21390 14709 13867 gene locus_tag LOCUS_21400 14709 13867 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021378.1 protein_id gnl|my_center|LOCUS_21400 16042 14786 gene locus_tag LOCUS_21410 16042 14786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 16713 17744 gene locus_tag LOCUS_21420 16713 17744 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086819.1 protein_id gnl|my_center|LOCUS_21420 19712 18348 gene locus_tag LOCUS_21430 19712 18348 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_21430 19851 20194 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20860 20588 gene locus_tag LOCUS_21440 20860 20588 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053740.1 protein_id gnl|my_center|LOCUS_21440 21001 21411 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21832 21422 gene locus_tag LOCUS_21450 21832 21422 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227906.1 protein_id gnl|my_center|LOCUS_21450 >Feature sequence44 803 1684 gene locus_tag LOCUS_21460 gene porB 803 1684 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762255.1 protein_id gnl|my_center|LOCUS_21460 1678 2790 gene locus_tag LOCUS_21470 1678 2790 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250930.1 protein_id gnl|my_center|LOCUS_21470 2783 3310 gene locus_tag LOCUS_21480 2783 3310 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250928.1 protein_id gnl|my_center|LOCUS_21480 3307 3552 gene locus_tag LOCUS_21490 3307 3552 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762253.1 protein_id gnl|my_center|LOCUS_21490 3916 3527 gene locus_tag LOCUS_21500 3916 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496739.1 protein_id gnl|my_center|LOCUS_21500 4078 4380 gene locus_tag LOCUS_21510 4078 4380 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065930.1 protein_id gnl|my_center|LOCUS_21510 4715 6835 gene locus_tag LOCUS_21520 4715 6835 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_21520 7138 7341 gene locus_tag LOCUS_21530 7138 7341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 7323 7520 gene locus_tag LOCUS_21540 7323 7520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21540 7560 8000 gene locus_tag LOCUS_21550 7560 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21550 8574 8907 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9085 9243 gene locus_tag LOCUS_21560 9085 9243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 11077 9701 gene locus_tag LOCUS_21570 11077 9701 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022297.1 protein_id gnl|my_center|LOCUS_21570 13274 11175 gene locus_tag LOCUS_21580 13274 11175 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226412.1 protein_id gnl|my_center|LOCUS_21580 13457 14626 gene locus_tag LOCUS_21590 13457 14626 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020990.1 protein_id gnl|my_center|LOCUS_21590 14678 15793 gene locus_tag LOCUS_21600 14678 15793 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020989.1 protein_id gnl|my_center|LOCUS_21600 15790 16560 gene locus_tag LOCUS_21610 15790 16560 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065008.1 protein_id gnl|my_center|LOCUS_21610 16603 16935 gene locus_tag LOCUS_21620 16603 16935 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787743.1 protein_id gnl|my_center|LOCUS_21620 17381 16950 gene locus_tag LOCUS_21630 17381 16950 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761848.1 protein_id gnl|my_center|LOCUS_21630 17977 17378 gene locus_tag LOCUS_21640 gene udg 17977 17378 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980322.1 protein_id gnl|my_center|LOCUS_21640 18779 19939 gene locus_tag LOCUS_21650 18779 19939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 19969 20565 gene locus_tag LOCUS_21660 19969 20565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 20892 21104 gene locus_tag LOCUS_21670 20892 21104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21670 21133 21822 gene locus_tag LOCUS_21680 21133 21822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020614.1 protein_id gnl|my_center|LOCUS_21680 21933 22140 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22296 22556 gene locus_tag LOCUS_21690 22296 22556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 >Feature sequence45 277 533 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1388 1083 gene locus_tag LOCUS_21700 1388 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 1599 1354 gene locus_tag LOCUS_21710 1599 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 1850 1581 gene locus_tag LOCUS_21720 1850 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 2116 1847 gene locus_tag LOCUS_21730 2116 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 3050 2187 gene locus_tag LOCUS_21740 3050 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 4823 3546 gene locus_tag LOCUS_21750 4823 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 5443 4832 gene locus_tag LOCUS_21760 5443 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 6906 5899 gene locus_tag LOCUS_21770 6906 5899 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878633.1 protein_id gnl|my_center|LOCUS_21770 8428 6938 gene locus_tag LOCUS_21780 8428 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 9040 8441 gene locus_tag LOCUS_21790 9040 8441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 10116 9451 gene locus_tag LOCUS_21800 10116 9451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 10438 11472 gene locus_tag LOCUS_21810 10438 11472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 11513 12328 gene locus_tag LOCUS_21820 11513 12328 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990796.1 protein_id gnl|my_center|LOCUS_21820 12604 13305 gene locus_tag LOCUS_21830 12604 13305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 14201 13473 gene locus_tag LOCUS_21840 14201 13473 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023957.1 protein_id gnl|my_center|LOCUS_21840 15501 14203 gene locus_tag LOCUS_21850 15501 14203 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023956.1 protein_id gnl|my_center|LOCUS_21850 16415 15534 gene locus_tag LOCUS_21860 gene map 16415 15534 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020270.1 protein_id gnl|my_center|LOCUS_21860 17542 16412 gene locus_tag LOCUS_21870 17542 16412 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020271.1 protein_id gnl|my_center|LOCUS_21870 17602 17835 gene locus_tag LOCUS_21880 17602 17835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 17869 18168 gene locus_tag LOCUS_21890 17869 18168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289276.1 protein_id gnl|my_center|LOCUS_21890 18207 18281 gene locus_tag LOCUS_t00460 18207 18281 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 18521 19678 gene locus_tag LOCUS_21900 18521 19678 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964038.1 protein_id gnl|my_center|LOCUS_21900 19675 19923 gene locus_tag LOCUS_21910 19675 19923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 20821 20408 gene locus_tag LOCUS_21920 20821 20408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 21344 21529 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence46 368 1648 gene locus_tag LOCUS_21930 368 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 1802 2257 gene locus_tag LOCUS_21940 1802 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21940 2265 2948 gene locus_tag LOCUS_21950 2265 2948 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220818393.1 protein_id gnl|my_center|LOCUS_21950 3372 3118 gene locus_tag LOCUS_21960 3372 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 3553 3386 gene locus_tag LOCUS_21970 3553 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 3595 3848 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3856 4932 gene locus_tag LOCUS_21980 3856 4932 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_21980 4932 5411 gene locus_tag LOCUS_21990 4932 5411 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061729.1 protein_id gnl|my_center|LOCUS_21990 5362 6396 gene locus_tag LOCUS_22000 5362 6396 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876508.1 protein_id gnl|my_center|LOCUS_22000 7499 6411 gene locus_tag LOCUS_22010 gene wecB 7499 6411 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_22010 7658 8806 gene locus_tag LOCUS_22020 7658 8806 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226125.1 protein_id gnl|my_center|LOCUS_22020 8823 9587 gene locus_tag LOCUS_22030 8823 9587 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_22030 11376 9625 gene locus_tag LOCUS_22040 11376 9625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 11501 11678 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12808 11687 gene locus_tag LOCUS_22050 12808 11687 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_22050 14190 12931 gene locus_tag LOCUS_22060 14190 12931 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940434.1 protein_id gnl|my_center|LOCUS_22060 15403 14474 gene locus_tag LOCUS_22070 15403 14474 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049979583.1 protein_id gnl|my_center|LOCUS_22070 16604 15516 gene locus_tag LOCUS_22080 16604 15516 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_22080 17200 16601 gene locus_tag LOCUS_22090 17200 16601 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763299.1 protein_id gnl|my_center|LOCUS_22090 18936 17197 gene locus_tag LOCUS_22100 gene glmS 18936 17197 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393728.1 protein_id gnl|my_center|LOCUS_22100 20088 18937 gene locus_tag LOCUS_22110 20088 18937 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877197.1 protein_id gnl|my_center|LOCUS_22110 20383 20093 gene locus_tag LOCUS_22120 20383 20093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 >Feature sequence47 497 1399 gene locus_tag LOCUS_22130 gene mtrE 497 1399 CDS product tetrahydromethanopterin S-methyltransferase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870361.1 protein_id gnl|my_center|LOCUS_22130 1396 2247 gene locus_tag LOCUS_22140 gene mtrD 1396 2247 CDS product tetrahydromethanopterin S-methyltransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020333.1 protein_id gnl|my_center|LOCUS_22140 2248 3099 gene locus_tag LOCUS_22150 gene mtrC 2248 3099 CDS product tetrahydromethanopterin S-methyltransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020332.1 protein_id gnl|my_center|LOCUS_22150 3100 3384 gene locus_tag LOCUS_22160 3100 3384 CDS product tetrahydromethanopterin S-methyltransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876784.1 protein_id gnl|my_center|LOCUS_22160 3395 4120 gene locus_tag LOCUS_22170 gene mtrA 3395 4120 CDS product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020330.1 protein_id gnl|my_center|LOCUS_22170 4126 4338 gene locus_tag LOCUS_22180 gene mtrF 4126 4338 CDS product tetrahydromethanopterin S-methyltransferase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020329.1 protein_id gnl|my_center|LOCUS_22180 4340 5083 gene locus_tag LOCUS_22190 gene mtrA 4340 5083 CDS product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020330.1 protein_id gnl|my_center|LOCUS_22190 5099 6136 gene locus_tag LOCUS_22200 gene mtrH 5099 6136 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020327.1 protein_id gnl|my_center|LOCUS_22200 7346 6315 gene locus_tag LOCUS_22210 7346 6315 CDS product EF-Tu/IF-2/RF-3 family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869822.1 protein_id gnl|my_center|LOCUS_22210 7433 8446 gene locus_tag LOCUS_22220 7433 8446 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460055.1 protein_id gnl|my_center|LOCUS_22220 8443 9684 gene locus_tag LOCUS_22230 8443 9684 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902995.1 protein_id gnl|my_center|LOCUS_22230 9681 10346 gene locus_tag LOCUS_22240 9681 10346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 10451 11569 gene locus_tag LOCUS_22250 10451 11569 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249816.1 protein_id gnl|my_center|LOCUS_22250 11593 12336 gene locus_tag LOCUS_22260 11593 12336 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871139.1 protein_id gnl|my_center|LOCUS_22260 12849 12343 gene locus_tag LOCUS_22270 12849 12343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 13755 12970 gene locus_tag LOCUS_22280 13755 12970 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065114.1 protein_id gnl|my_center|LOCUS_22280 15218 13686 gene locus_tag LOCUS_22290 15218 13686 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021434.1 protein_id gnl|my_center|LOCUS_22290 15774 15208 gene locus_tag LOCUS_22300 15774 15208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065113.1 protein_id gnl|my_center|LOCUS_22300 16131 17258 gene locus_tag LOCUS_22310 16131 17258 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319644.1 protein_id gnl|my_center|LOCUS_22310 17329 17913 gene locus_tag LOCUS_22320 17329 17913 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903575.1 protein_id gnl|my_center|LOCUS_22320 18452 17910 gene locus_tag LOCUS_22330 18452 17910 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879393.1 protein_id gnl|my_center|LOCUS_22330 19069 18452 gene locus_tag LOCUS_22340 19069 18452 CDS product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021131.1 protein_id gnl|my_center|LOCUS_22340 19651 19076 gene locus_tag LOCUS_22350 19651 19076 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496506.1 protein_id gnl|my_center|LOCUS_22350 >Feature sequence48 1474 494 gene locus_tag LOCUS_22360 1474 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 2367 1534 gene locus_tag LOCUS_22370 2367 1534 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893461.1 protein_id gnl|my_center|LOCUS_22370 2401 2699 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2949 3168 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3721 3918 gene locus_tag LOCUS_22380 3721 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 4043 5017 gene locus_tag LOCUS_22390 4043 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 5024 6391 gene locus_tag LOCUS_22400 5024 6391 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023037.1 protein_id gnl|my_center|LOCUS_22400 6992 6396 gene locus_tag LOCUS_22410 6992 6396 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023038.1 protein_id gnl|my_center|LOCUS_22410 7454 7882 gene locus_tag LOCUS_22420 7454 7882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065607.1 protein_id gnl|my_center|LOCUS_22420 7931 8208 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8492 8607 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9214 9825 gene locus_tag LOCUS_22430 9214 9825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22430 9827 10951 gene locus_tag LOCUS_22440 9827 10951 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143360.1 protein_id gnl|my_center|LOCUS_22440 11976 11758 gene locus_tag LOCUS_22450 11976 11758 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022122.1 protein_id gnl|my_center|LOCUS_22450 12172 11978 gene locus_tag LOCUS_22460 12172 11978 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_22460 12693 13010 gene locus_tag LOCUS_22470 12693 13010 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022117.1 protein_id gnl|my_center|LOCUS_22470 13007 13399 gene locus_tag LOCUS_22480 13007 13399 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_22480 14233 14484 gene locus_tag LOCUS_22490 14233 14484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 14748 15755 gene locus_tag LOCUS_22500 14748 15755 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023032.1 protein_id gnl|my_center|LOCUS_22500 15792 16706 gene locus_tag LOCUS_22510 gene pstC 15792 16706 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860284.1 protein_id gnl|my_center|LOCUS_22510 16711 17613 gene locus_tag LOCUS_22520 gene pstA 16711 17613 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023034.1 protein_id gnl|my_center|LOCUS_22520 >Feature sequence49 500 940 gene locus_tag LOCUS_22530 500 940 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142147.1 protein_id gnl|my_center|LOCUS_22530 1079 1513 gene locus_tag LOCUS_22540 1079 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 1657 2103 gene locus_tag LOCUS_22550 1657 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 2141 2566 gene locus_tag LOCUS_22560 2141 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 3466 2582 gene locus_tag LOCUS_22570 3466 2582 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942258.1 protein_id gnl|my_center|LOCUS_22570 7499 3651 gene locus_tag LOCUS_22580 7499 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 8639 8034 gene locus_tag LOCUS_22590 8639 8034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 10198 8735 gene locus_tag LOCUS_22600 10198 8735 CDS product thioredoxin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073595568.1 protein_id gnl|my_center|LOCUS_22600 11179 10283 gene locus_tag LOCUS_22610 11179 10283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 11689 11381 gene locus_tag LOCUS_22620 11689 11381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 12605 11865 gene locus_tag LOCUS_22630 12605 11865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 13950 13123 gene locus_tag LOCUS_22640 13950 13123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 14026 14213 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14332 15519 gene locus_tag LOCUS_22650 14332 15519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 15516 15758 gene locus_tag LOCUS_22660 15516 15758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 15884 16123 gene locus_tag LOCUS_22670 15884 16123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 >Feature sequence50 <1 1349 gene locus_tag LOCUS_22680 <1 1349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022444.1:ABC transporter ATP-binding protein 1850 4261 gene locus_tag LOCUS_22690 1850 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 5183 4323 gene locus_tag LOCUS_22700 5183 4323 CDS product DUF2099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022219.1 protein_id gnl|my_center|LOCUS_22700 5736 7199 gene locus_tag LOCUS_22710 5736 7199 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_22710 8497 7268 gene locus_tag LOCUS_22720 8497 7268 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387859.1 protein_id gnl|my_center|LOCUS_22720 9997 8738 gene locus_tag LOCUS_22730 gene cysS 9997 8738 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249399.1 protein_id gnl|my_center|LOCUS_22730 10092 10019 gene locus_tag LOCUS_t00470 10092 10019 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 10523 11008 gene locus_tag LOCUS_22740 10523 11008 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024098.1 protein_id gnl|my_center|LOCUS_22740 11672 11070 gene locus_tag LOCUS_22750 11672 11070 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902736.1 protein_id gnl|my_center|LOCUS_22750 12181 11669 gene locus_tag LOCUS_22760 12181 11669 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877227.1 protein_id gnl|my_center|LOCUS_22760 13227 12178 gene locus_tag LOCUS_22770 gene hisC 13227 12178 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064817.1 protein_id gnl|my_center|LOCUS_22770 14344 13220 gene locus_tag LOCUS_22780 14344 13220 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066055.1 protein_id gnl|my_center|LOCUS_22780 15266 14349 gene locus_tag LOCUS_22790 gene guaA 15266 14349 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024387.1 protein_id gnl|my_center|LOCUS_22790 15951 15271 gene locus_tag LOCUS_22800 15951 15271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 15979 16170 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16404 17057 gene locus_tag LOCUS_22810 16404 17057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 >Feature sequence51 267 881 gene locus_tag LOCUS_22820 267 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 959 3175 gene locus_tag LOCUS_22830 959 3175 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879160.1 protein_id gnl|my_center|LOCUS_22830 3288 3579 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4090 4329 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4470 5663 gene locus_tag LOCUS_22840 4470 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 7356 5815 gene locus_tag LOCUS_22850 7356 5815 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020142.1 protein_id gnl|my_center|LOCUS_22850 7937 7353 gene locus_tag LOCUS_22860 7937 7353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 9876 7918 gene locus_tag LOCUS_22870 9876 7918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 12028 9857 gene locus_tag LOCUS_22880 gene ppk1 12028 9857 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233899.1 protein_id gnl|my_center|LOCUS_22880 14275 12107 gene locus_tag LOCUS_22890 gene ppk1 14275 12107 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233899.1 protein_id gnl|my_center|LOCUS_22890 14743 15000 gene locus_tag LOCUS_22900 14743 15000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 15240 16685 gene locus_tag LOCUS_22910 15240 16685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 >Feature sequence52 52 480 gene locus_tag LOCUS_22920 52 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 581 805 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 872 1153 gene locus_tag LOCUS_22930 872 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 3038 1542 gene locus_tag LOCUS_22940 3038 1542 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_22940 3204 3515 gene locus_tag LOCUS_22950 3204 3515 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943454.1 protein_id gnl|my_center|LOCUS_22950 3701 3528 gene locus_tag LOCUS_22960 3701 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 4593 3769 gene locus_tag LOCUS_22970 4593 3769 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_22970 4756 6618 gene locus_tag LOCUS_22980 4756 6618 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_22980 6897 9227 gene locus_tag LOCUS_22990 6897 9227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 9928 9320 gene locus_tag LOCUS_23000 gene hisH 9928 9320 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020951.1 protein_id gnl|my_center|LOCUS_23000 11312 9903 gene locus_tag LOCUS_23010 11312 9903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 12615 11962 gene locus_tag LOCUS_23020 12615 11962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 12547 14256 gene locus_tag LOCUS_23030 12547 14256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 14639 14911 gene locus_tag LOCUS_23040 14639 14911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 15610 15104 gene locus_tag LOCUS_23050 15610 15104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 15685 16977 gene locus_tag LOCUS_23060 15685 16977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 >Feature sequence53 <1 579 gene locus_tag LOCUS_23070 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118837931.1:Ig-like domain-containing protein 915 631 gene locus_tag LOCUS_23080 915 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 1247 912 gene locus_tag LOCUS_23090 1247 912 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790218.1 protein_id gnl|my_center|LOCUS_23090 2068 1271 gene locus_tag LOCUS_23100 2068 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 2414 2076 gene locus_tag LOCUS_23110 2414 2076 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023100.1 protein_id gnl|my_center|LOCUS_23110 3217 2438 gene locus_tag LOCUS_23120 3217 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 3293 4105 gene locus_tag LOCUS_23130 3293 4105 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064189.1 protein_id gnl|my_center|LOCUS_23130 6057 4147 gene locus_tag LOCUS_23140 gene cooS 6057 4147 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021329.1 protein_id gnl|my_center|LOCUS_23140 6441 6097 gene locus_tag LOCUS_23150 6441 6097 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_23150 6546 7280 gene locus_tag LOCUS_23160 6546 7280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 7642 8901 gene locus_tag LOCUS_23170 7642 8901 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064511.1 protein_id gnl|my_center|LOCUS_23170 12614 8898 gene locus_tag LOCUS_23180 12614 8898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 14106 13318 gene locus_tag LOCUS_23190 14106 13318 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878933.1 protein_id gnl|my_center|LOCUS_23190 14578 14817 gene locus_tag LOCUS_23200 14578 14817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 15910 16227 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16320 16562 gene locus_tag LOCUS_23210 16320 16562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23210 >Feature sequence54 <1 594 gene locus_tag LOCUS_23220 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061010.1:formylmethanofuran--tetrahydromethanopterin N-formyltransferase 776 1819 gene locus_tag LOCUS_23230 776 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 1842 2201 gene locus_tag LOCUS_23240 1842 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 2202 2711 gene locus_tag LOCUS_23250 2202 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 2859 3815 gene locus_tag LOCUS_23260 2859 3815 CDS product DUF1743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877003.1 protein_id gnl|my_center|LOCUS_23260 3799 4692 gene locus_tag LOCUS_23270 3799 4692 CDS product DUF1743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021976.1 protein_id gnl|my_center|LOCUS_23270 4674 5642 gene locus_tag LOCUS_23280 4674 5642 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066092.1 protein_id gnl|my_center|LOCUS_23280 5639 6886 gene locus_tag LOCUS_23290 5639 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 6858 7988 gene locus_tag LOCUS_23300 6858 7988 CDS product homocitrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023272.1 protein_id gnl|my_center|LOCUS_23300 7985 9196 gene locus_tag LOCUS_23310 gene hacA 7985 9196 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066440.1 protein_id gnl|my_center|LOCUS_23310 9196 9666 gene locus_tag LOCUS_23320 9196 9666 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393736.1 protein_id gnl|my_center|LOCUS_23320 9663 10484 gene locus_tag LOCUS_23330 9663 10484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023654.1 protein_id gnl|my_center|LOCUS_23330 10462 11430 gene locus_tag LOCUS_23340 10462 11430 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023652.1 protein_id gnl|my_center|LOCUS_23340 11457 12305 gene locus_tag LOCUS_23350 11457 12305 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_23350 13640 13770 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14711 14939 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15501 16073 gene locus_tag LOCUS_23360 15501 16073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 <16651 16109 gene locus_tag LOCUS_23370 <16651 16109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393633.1:S-layer homology domain-containing protein >Feature sequence55 703 257 gene locus_tag LOCUS_23380 703 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 710 903 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2847 1429 gene locus_tag LOCUS_23390 2847 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 2955 3620 gene locus_tag LOCUS_23400 2955 3620 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020095.1 protein_id gnl|my_center|LOCUS_23400 3652 4740 gene locus_tag LOCUS_23410 gene cofH 3652 4740 CDS product 5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060905.1 protein_id gnl|my_center|LOCUS_23410 5073 4759 gene locus_tag LOCUS_23420 5073 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 5723 5172 gene locus_tag LOCUS_23430 5723 5172 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870595.1 protein_id gnl|my_center|LOCUS_23430 6176 5727 gene locus_tag LOCUS_23440 6176 5727 CDS product DUF123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990683.1 protein_id gnl|my_center|LOCUS_23440 6771 6169 gene locus_tag LOCUS_23450 6771 6169 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024487.1 protein_id gnl|my_center|LOCUS_23450 6851 8089 gene locus_tag LOCUS_23460 gene thiC 6851 8089 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021793.1 protein_id gnl|my_center|LOCUS_23460 8515 8108 gene locus_tag LOCUS_23470 8515 8108 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943584.1 protein_id gnl|my_center|LOCUS_23470 8943 8551 gene locus_tag LOCUS_23480 8943 8551 CDS product AIR carboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021394.1 protein_id gnl|my_center|LOCUS_23480 9080 10210 gene locus_tag LOCUS_23490 9080 10210 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065228.1 protein_id gnl|my_center|LOCUS_23490 10207 10668 gene locus_tag LOCUS_23500 gene ribC 10207 10668 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021819.1 protein_id gnl|my_center|LOCUS_23500 10728 11135 gene locus_tag LOCUS_23510 gene ribH 10728 11135 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879619.1 protein_id gnl|my_center|LOCUS_23510 11132 12262 gene locus_tag LOCUS_23520 11132 12262 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021821.1 protein_id gnl|my_center|LOCUS_23520 15476 12384 gene locus_tag LOCUS_23530 15476 12384 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 protein_id gnl|my_center|LOCUS_23530 >Feature sequence56 1951 2244 gene locus_tag LOCUS_23540 1951 2244 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_23540 2241 2456 gene locus_tag LOCUS_23550 2241 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 2939 3199 gene locus_tag LOCUS_23560 2939 3199 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249868.1 protein_id gnl|my_center|LOCUS_23560 3563 3772 gene locus_tag LOCUS_23570 3563 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 4095 3973 gene locus_tag LOCUS_23580 4095 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 4448 4134 gene locus_tag LOCUS_23590 4448 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 5131 4730 gene locus_tag LOCUS_23600 5131 4730 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020812.1 protein_id gnl|my_center|LOCUS_23600 5420 5091 gene locus_tag LOCUS_23610 5420 5091 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020811.1 protein_id gnl|my_center|LOCUS_23610 5922 6134 gene locus_tag LOCUS_23620 5922 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 6642 6307 gene locus_tag LOCUS_23630 6642 6307 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942865.1 protein_id gnl|my_center|LOCUS_23630 6824 6627 gene locus_tag LOCUS_23640 6824 6627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 7626 6910 gene locus_tag LOCUS_23650 7626 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 7898 8212 gene locus_tag LOCUS_23660 7898 8212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 8209 8454 gene locus_tag LOCUS_23670 8209 8454 CDS product type II toxin-antitoxin system MqsA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065704.1 protein_id gnl|my_center|LOCUS_23670 8807 9949 gene locus_tag LOCUS_23680 8807 9949 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876469.1 protein_id gnl|my_center|LOCUS_23680 10615 10268 gene locus_tag LOCUS_23690 10615 10268 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460613.1 protein_id gnl|my_center|LOCUS_23690 10901 10599 gene locus_tag LOCUS_23700 10901 10599 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064812.1 protein_id gnl|my_center|LOCUS_23700 11772 10996 gene locus_tag LOCUS_23710 11772 10996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 12244 12035 gene locus_tag LOCUS_23720 12244 12035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 12709 12918 gene locus_tag LOCUS_23730 12709 12918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 13029 13301 gene locus_tag LOCUS_23740 13029 13301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 13720 13583 gene locus_tag LOCUS_23750 13720 13583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 14185 13838 gene locus_tag LOCUS_23760 14185 13838 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020812.1 protein_id gnl|my_center|LOCUS_23760 14471 14169 gene locus_tag LOCUS_23770 14471 14169 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064812.1 protein_id gnl|my_center|LOCUS_23770 14804 15070 gene locus_tag LOCUS_23780 14804 15070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 >Feature sequence57 150 548 gene locus_tag LOCUS_23790 150 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 945 679 gene locus_tag LOCUS_23800 945 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 1239 1691 gene locus_tag LOCUS_23810 1239 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 2215 1964 gene locus_tag LOCUS_23820 2215 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 2558 4018 gene locus_tag LOCUS_23830 2558 4018 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_23830 4361 4720 gene locus_tag LOCUS_23840 4361 4720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 5943 5386 gene locus_tag LOCUS_23850 5943 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 6786 7310 gene locus_tag LOCUS_23860 6786 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 7323 7769 gene locus_tag LOCUS_23870 7323 7769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062537442.1 protein_id gnl|my_center|LOCUS_23870 7766 8530 gene locus_tag LOCUS_23880 7766 8530 CDS product DUF1829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213043995.1 protein_id gnl|my_center|LOCUS_23880 8908 8594 gene locus_tag LOCUS_23890 8908 8594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 9197 8868 gene locus_tag LOCUS_23900 9197 8868 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020811.1 protein_id gnl|my_center|LOCUS_23900 9546 9409 gene locus_tag LOCUS_23910 9546 9409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 12402 9640 gene locus_tag LOCUS_23920 12402 9640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 12881 12399 gene locus_tag LOCUS_23930 12881 12399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 13018 12878 gene locus_tag LOCUS_23940 13018 12878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 14494 13316 gene locus_tag LOCUS_23950 14494 13316 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903688.1 protein_id gnl|my_center|LOCUS_23950 >Feature sequence58 2306 1563 gene locus_tag LOCUS_23960 2306 1563 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528492.1 protein_id gnl|my_center|LOCUS_23960 3944 2514 gene locus_tag LOCUS_23970 3944 2514 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589538.1 protein_id gnl|my_center|LOCUS_23970 5029 3953 gene locus_tag LOCUS_23980 5029 3953 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065833.1 protein_id gnl|my_center|LOCUS_23980 6924 5032 gene locus_tag LOCUS_23990 6924 5032 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023770.1 protein_id gnl|my_center|LOCUS_23990 7589 6945 gene locus_tag LOCUS_24000 gene psmB 7589 6945 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023769.1 protein_id gnl|my_center|LOCUS_24000 8595 7735 gene locus_tag LOCUS_24010 8595 7735 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023985.1 protein_id gnl|my_center|LOCUS_24010 9047 8610 gene locus_tag LOCUS_24020 9047 8610 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903120.1 protein_id gnl|my_center|LOCUS_24020 10118 9075 gene locus_tag LOCUS_24030 10118 9075 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023987.1 protein_id gnl|my_center|LOCUS_24030 10165 10323 gene locus_tag LOCUS_24040 10165 10323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 11075 10320 gene locus_tag LOCUS_24050 gene cofE 11075 10320 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879745.1 protein_id gnl|my_center|LOCUS_24050 12433 11201 gene locus_tag LOCUS_24060 12433 11201 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978370.1 protein_id gnl|my_center|LOCUS_24060 12542 14095 gene locus_tag LOCUS_24070 12542 14095 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048142299.1 protein_id gnl|my_center|LOCUS_24070 14167 14433 gene locus_tag LOCUS_24080 14167 14433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 >Feature sequence59 1003 392 gene locus_tag LOCUS_24090 1003 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 2144 1011 gene locus_tag LOCUS_24100 2144 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 2725 3177 gene locus_tag LOCUS_24110 2725 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066236.1 protein_id gnl|my_center|LOCUS_24110 3197 4006 gene locus_tag LOCUS_24120 3197 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 4426 4851 gene locus_tag LOCUS_24130 4426 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 4932 5954 gene locus_tag LOCUS_24140 4932 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 5962 6981 gene locus_tag LOCUS_24150 5962 6981 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878633.1 protein_id gnl|my_center|LOCUS_24150 6996 8138 gene locus_tag LOCUS_24160 6996 8138 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878633.1 protein_id gnl|my_center|LOCUS_24160 8491 9249 gene locus_tag LOCUS_24170 8491 9249 CDS product DUF6345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064899.1 protein_id gnl|my_center|LOCUS_24170 9259 10227 gene locus_tag LOCUS_24180 9259 10227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 10265 10798 gene locus_tag LOCUS_24190 10265 10798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 11004 11615 gene locus_tag LOCUS_24200 11004 11615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 11624 12913 gene locus_tag LOCUS_24210 11624 12913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 13669 14592 gene locus_tag LOCUS_24220 13669 14592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 >Feature sequence60 <1 1095 gene locus_tag LOCUS_24230 <1 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250416.1:ATP-binding protein 2092 1781 gene locus_tag LOCUS_24240 2092 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 2902 2189 gene locus_tag LOCUS_24250 2902 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 3744 2902 gene locus_tag LOCUS_24260 3744 2902 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393323.1 protein_id gnl|my_center|LOCUS_24260 4540 3719 gene locus_tag LOCUS_24270 gene modA 4540 3719 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393324.1 protein_id gnl|my_center|LOCUS_24270 5083 4805 gene locus_tag LOCUS_24280 5083 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 5562 5353 gene locus_tag LOCUS_24290 5562 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 5713 6012 gene locus_tag LOCUS_24300 5713 6012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 7555 6329 gene locus_tag LOCUS_24310 7555 6329 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021296.1 protein_id gnl|my_center|LOCUS_24310 7946 7728 gene locus_tag LOCUS_24320 7946 7728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 7986 8792 gene locus_tag LOCUS_24330 gene hisF 7986 8792 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878322.1 protein_id gnl|my_center|LOCUS_24330 10389 8734 gene locus_tag LOCUS_24340 gene pheT 10389 8734 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021951.1 protein_id gnl|my_center|LOCUS_24340 11575 10391 gene locus_tag LOCUS_24350 11575 10391 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020229.1 protein_id gnl|my_center|LOCUS_24350 11576 11922 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13187 11931 gene locus_tag LOCUS_24360 13187 11931 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020230.1 protein_id gnl|my_center|LOCUS_24360 <13802 13197 gene locus_tag LOCUS_24370 <13802 13197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023532.1:tRNA-intron lyase >Feature sequence61 568 960 gene locus_tag LOCUS_24380 568 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 1068 919 gene locus_tag LOCUS_24390 1068 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 1642 1298 gene locus_tag LOCUS_24400 1642 1298 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058065.1 protein_id gnl|my_center|LOCUS_24400 1932 1639 gene locus_tag LOCUS_24410 1932 1639 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_24410 1959 2256 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2491 2793 gene locus_tag LOCUS_24420 2491 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 2871 3683 gene locus_tag LOCUS_24430 2871 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 3696 4625 gene locus_tag LOCUS_24440 3696 4625 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_24440 4856 5521 gene locus_tag LOCUS_24450 4856 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 5611 6219 gene locus_tag LOCUS_24460 5611 6219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 6402 6995 gene locus_tag LOCUS_24470 6402 6995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 7456 9213 gene locus_tag LOCUS_24480 7456 9213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 11811 9742 gene locus_tag LOCUS_24490 11811 9742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 11889 12116 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12867 13316 gene locus_tag LOCUS_24500 12867 13316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 >Feature sequence62 <1 587 gene locus_tag LOCUS_24510 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250684.1:glycosyltransferase family 4 protein 649 1878 gene locus_tag LOCUS_24520 649 1878 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763221.1 protein_id gnl|my_center|LOCUS_24520 1875 2945 gene locus_tag LOCUS_24530 1875 2945 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021199.1 protein_id gnl|my_center|LOCUS_24530 3015 3273 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3295 3825 gene locus_tag LOCUS_24540 3295 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 3826 5004 gene locus_tag LOCUS_24550 3826 5004 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021201.1 protein_id gnl|my_center|LOCUS_24550 5711 5904 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5920 6459 gene locus_tag LOCUS_24560 5920 6459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 6479 7339 gene locus_tag LOCUS_24570 6479 7339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 7590 7303 gene locus_tag LOCUS_24580 7590 7303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 7788 7639 gene locus_tag LOCUS_24590 7788 7639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 7894 9735 gene locus_tag LOCUS_24600 7894 9735 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066188.1 protein_id gnl|my_center|LOCUS_24600 9738 10916 gene locus_tag LOCUS_24610 9738 10916 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021204.1 protein_id gnl|my_center|LOCUS_24610 11661 11861 gene locus_tag LOCUS_24620 11661 11861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 >Feature sequence63 294 76 gene locus_tag LOCUS_24630 294 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 730 503 gene locus_tag LOCUS_24640 730 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 1181 1390 gene locus_tag LOCUS_24650 1181 1390 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021259.1 protein_id gnl|my_center|LOCUS_24650 2611 2186 gene locus_tag LOCUS_24660 2611 2186 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021683.1 protein_id gnl|my_center|LOCUS_24660 2671 3711 gene locus_tag LOCUS_24670 2671 3711 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018271.1 protein_id gnl|my_center|LOCUS_24670 3708 4487 gene locus_tag LOCUS_24680 3708 4487 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392394.1 protein_id gnl|my_center|LOCUS_24680 5127 7118 gene locus_tag LOCUS_24690 5127 7118 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024232.1 protein_id gnl|my_center|LOCUS_24690 7203 8429 gene locus_tag LOCUS_24700 7203 8429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 8470 9384 gene locus_tag LOCUS_24710 gene nifB 8470 9384 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024080.1 protein_id gnl|my_center|LOCUS_24710 9409 10266 gene locus_tag LOCUS_24720 9409 10266 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 protein_id gnl|my_center|LOCUS_24720 10685 11464 gene locus_tag LOCUS_24730 10685 11464 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496786.1 protein_id gnl|my_center|LOCUS_24730 >Feature sequence64 2429 405 gene locus_tag LOCUS_24740 2429 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 434 610 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2516 3691 gene locus_tag LOCUS_24750 2516 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 3673 4677 gene locus_tag LOCUS_24760 3673 4677 CDS product DUF1616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065996.1 protein_id gnl|my_center|LOCUS_24760 5419 4607 gene locus_tag LOCUS_24770 5419 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 5712 5416 gene locus_tag LOCUS_24780 5712 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 6959 5712 gene locus_tag LOCUS_24790 6959 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 7933 6962 gene locus_tag LOCUS_24800 7933 6962 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_24800 8756 7926 gene locus_tag LOCUS_24810 8756 7926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 10212 8737 gene locus_tag LOCUS_24820 10212 8737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 10607 10341 gene locus_tag LOCUS_24830 10607 10341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 >Feature sequence65 944 765 gene locus_tag LOCUS_24840 944 765 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878609.1 protein_id gnl|my_center|LOCUS_24840 1247 951 gene locus_tag LOCUS_24850 1247 951 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023602.1 protein_id gnl|my_center|LOCUS_24850 1809 1324 gene locus_tag LOCUS_24860 1809 1324 CDS product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023601.1 protein_id gnl|my_center|LOCUS_24860 2009 1809 gene locus_tag LOCUS_24870 2009 1809 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875904.1 protein_id gnl|my_center|LOCUS_24870 2580 2011 gene locus_tag LOCUS_24880 gene rpoE 2580 2011 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878613.1 protein_id gnl|my_center|LOCUS_24880 2971 2591 gene locus_tag LOCUS_24890 2971 2591 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023598.1 protein_id gnl|my_center|LOCUS_24890 4203 2968 gene locus_tag LOCUS_24900 4203 2968 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066527.1 protein_id gnl|my_center|LOCUS_24900 4421 4843 gene locus_tag LOCUS_24910 gene nikR 4421 4843 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023967.1 protein_id gnl|my_center|LOCUS_24910 5130 4840 gene locus_tag LOCUS_24920 5130 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 5282 6364 gene locus_tag LOCUS_24930 5282 6364 CDS product YcaO-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020223.1 protein_id gnl|my_center|LOCUS_24930 6519 6832 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7342 7626 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7826 7683 gene locus_tag LOCUS_24940 7826 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 7917 8115 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10582 8483 gene locus_tag LOCUS_24950 10582 8483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 8700 8905 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10847 10668 gene locus_tag LOCUS_24960 10847 10668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 >Feature sequence66 354 1739 gene locus_tag LOCUS_24970 354 1739 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871152.1 protein_id gnl|my_center|LOCUS_24970 1933 2388 gene locus_tag LOCUS_24980 1933 2388 CDS product NUDIX pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202596.1 protein_id gnl|my_center|LOCUS_24980 3431 3790 gene locus_tag LOCUS_24990 3431 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 3916 4224 gene locus_tag LOCUS_25000 3916 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 5258 4746 gene locus_tag LOCUS_25010 5258 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 6146 5778 gene locus_tag LOCUS_25020 6146 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25020 6165 6407 gene locus_tag LOCUS_25030 6165 6407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 7336 7665 gene locus_tag LOCUS_25040 7336 7665 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020811.1 protein_id gnl|my_center|LOCUS_25040 7625 7870 gene locus_tag LOCUS_25050 7625 7870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 7877 8080 gene locus_tag LOCUS_25060 7877 8080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 8118 8561 gene locus_tag LOCUS_25070 8118 8561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 9970 8891 gene locus_tag LOCUS_25080 9970 8891 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060827.1 protein_id gnl|my_center|LOCUS_25080 >Feature sequence67 <1 666 gene locus_tag LOCUS_25090 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020965.1:DUF5591 domain-containing protein 2016 724 gene locus_tag LOCUS_25100 gene rbcL 2016 724 CDS product type III ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146906.1 protein_id gnl|my_center|LOCUS_25100 2127 3011 gene locus_tag LOCUS_25110 2127 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 3496 3164 gene locus_tag LOCUS_25120 3496 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 3803 3498 gene locus_tag LOCUS_25130 3803 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 4580 3924 gene locus_tag LOCUS_25140 4580 3924 CDS product TfuA-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020222.1 protein_id gnl|my_center|LOCUS_25140 5754 4540 gene locus_tag LOCUS_25150 5754 4540 CDS product YcaO-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876618.1 protein_id gnl|my_center|LOCUS_25150 6167 5751 gene locus_tag LOCUS_25160 6167 5751 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251065.1 protein_id gnl|my_center|LOCUS_25160 6461 6183 gene locus_tag LOCUS_25170 gene moaD 6461 6183 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251068.1 protein_id gnl|my_center|LOCUS_25170 6814 7842 gene locus_tag LOCUS_25180 6814 7842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 9326 7890 gene locus_tag LOCUS_25190 9326 7890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 >Feature sequence68 154 459 gene locus_tag LOCUS_25200 154 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 475 942 gene locus_tag LOCUS_25210 475 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 1355 1053 gene locus_tag LOCUS_25220 1355 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 1440 1622 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1770 2121 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2537 2331 gene locus_tag LOCUS_25230 2537 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 2815 2534 gene locus_tag LOCUS_25240 2815 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 3399 2815 gene locus_tag LOCUS_25250 3399 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 4433 4771 gene locus_tag LOCUS_25260 4433 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 5178 4948 gene locus_tag LOCUS_25270 5178 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 5988 5428 gene locus_tag LOCUS_25280 5988 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 6945 6004 gene locus_tag LOCUS_25290 gene mtrH 6945 6004 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020327.1 protein_id gnl|my_center|LOCUS_25290 7637 7884 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7998 8237 gene locus_tag LOCUS_25300 7998 8237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 8816 8364 gene locus_tag LOCUS_25310 8816 8364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 >Feature sequence69 401 466 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 897 1586 gene locus_tag LOCUS_25320 897 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25320 1889 2128 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2232 2495 gene locus_tag LOCUS_25330 2232 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 2700 2470 gene locus_tag LOCUS_25340 2700 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 3223 2759 gene locus_tag LOCUS_25350 3223 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 4931 3903 gene locus_tag LOCUS_25360 4931 3903 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143046.1 protein_id gnl|my_center|LOCUS_25360 5247 4918 gene locus_tag LOCUS_25370 5247 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 5764 5492 gene locus_tag LOCUS_25380 5764 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 5982 5764 gene locus_tag LOCUS_25390 5982 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 6646 6398 gene locus_tag LOCUS_25400 6646 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 6865 6707 gene locus_tag LOCUS_25410 6865 6707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 6881 7114 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7154 7384 gene locus_tag LOCUS_25420 7154 7384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 8122 7943 gene locus_tag LOCUS_25430 8122 7943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 >Feature sequence70 1565 699 gene locus_tag LOCUS_25440 gene dinD 1565 699 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_25440 3180 1666 gene locus_tag LOCUS_25450 3180 1666 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070743.1 protein_id gnl|my_center|LOCUS_25450 3781 3182 gene locus_tag LOCUS_25460 3781 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 4576 4145 gene locus_tag LOCUS_25470 4576 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 4782 5255 gene locus_tag LOCUS_25480 4782 5255 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496545.1 protein_id gnl|my_center|LOCUS_25480 5872 5279 gene locus_tag LOCUS_25490 5872 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 6205 5999 gene locus_tag LOCUS_25500 6205 5999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 6675 6307 gene locus_tag LOCUS_25510 6675 6307 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090034.1 protein_id gnl|my_center|LOCUS_25510 7897 6731 gene locus_tag LOCUS_25520 7897 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 >Feature sequence71 540 271 gene locus_tag LOCUS_25530 540 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 559 1155 gene locus_tag LOCUS_25540 559 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 2159 1233 gene locus_tag LOCUS_25550 2159 1233 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021488.1 protein_id gnl|my_center|LOCUS_25550 3043 2156 gene locus_tag LOCUS_25560 3043 2156 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021489.1 protein_id gnl|my_center|LOCUS_25560 3142 3918 gene locus_tag LOCUS_25570 gene surE 3142 3918 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020163.1 protein_id gnl|my_center|LOCUS_25570 3902 4630 gene locus_tag LOCUS_25580 gene rpiA 3902 4630 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021687.1 protein_id gnl|my_center|LOCUS_25580 4999 4619 gene locus_tag LOCUS_25590 4999 4619 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064265.1 protein_id gnl|my_center|LOCUS_25590 5886 5317 gene locus_tag LOCUS_25600 5886 5317 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877880.1 protein_id gnl|my_center|LOCUS_25600 7827 5929 gene locus_tag LOCUS_25610 gene acs 7827 5929 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228545.1 protein_id gnl|my_center|LOCUS_25610 >Feature sequence72 343 173 gene locus_tag LOCUS_25620 343 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 387 699 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 844 3297 gene locus_tag LOCUS_25630 844 3297 CDS product oligosaccharyl transferase, archaeosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065792.1 protein_id gnl|my_center|LOCUS_25630 3862 3260 gene locus_tag LOCUS_25640 3862 3260 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545889.1 protein_id gnl|my_center|LOCUS_25640 4176 4463 gene locus_tag LOCUS_25650 4176 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 5637 4465 gene locus_tag LOCUS_25660 5637 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 6206 5706 gene locus_tag LOCUS_25670 6206 5706 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932995.1 protein_id gnl|my_center|LOCUS_25670 >Feature sequence73 2366 1497 gene locus_tag LOCUS_25680 2366 1497 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879868.1 protein_id gnl|my_center|LOCUS_25680 3145 2363 gene locus_tag LOCUS_25690 3145 2363 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_25690 3569 3228 gene locus_tag LOCUS_25700 3569 3228 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876799.1 protein_id gnl|my_center|LOCUS_25700 4006 3647 gene locus_tag LOCUS_25710 4006 3647 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047760.1 protein_id gnl|my_center|LOCUS_25710 4177 6573 gene locus_tag LOCUS_25720 4177 6573 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_25720 >Feature sequence74 318 518 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 534 905 gene locus_tag LOCUS_25730 534 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 911 1315 gene locus_tag LOCUS_25740 gene nifU 911 1315 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391905.1 protein_id gnl|my_center|LOCUS_25740 1305 2072 gene locus_tag LOCUS_25750 1305 2072 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020313.1 protein_id gnl|my_center|LOCUS_25750 2035 2313 gene locus_tag LOCUS_25760 gene moaD 2035 2313 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251068.1 protein_id gnl|my_center|LOCUS_25760 2326 2736 gene locus_tag LOCUS_25770 2326 2736 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251065.1 protein_id gnl|my_center|LOCUS_25770 3478 2759 gene locus_tag LOCUS_25780 3478 2759 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990796.1 protein_id gnl|my_center|LOCUS_25780 4218 3496 gene locus_tag LOCUS_25790 4218 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 4464 5369 gene locus_tag LOCUS_25800 4464 5369 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249310.1 protein_id gnl|my_center|LOCUS_25800 >Feature sequence75 854 135 gene locus_tag LOCUS_25810 854 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 2001 1315 gene locus_tag LOCUS_25820 2001 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 2248 2676 gene locus_tag LOCUS_25830 2248 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 2673 4937 gene locus_tag LOCUS_25840 2673 4937 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209617549.1 protein_id gnl|my_center|LOCUS_25840 5058 5756 gene locus_tag LOCUS_25850 5058 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 >Feature sequence76 562 701 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1064 1684 gene locus_tag LOCUS_25860 gene tpiA 1064 1684 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251079.1 protein_id gnl|my_center|LOCUS_25860 2151 1867 gene locus_tag LOCUS_25870 2151 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 2191 2386 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2789 2989 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3088 3321 gene locus_tag LOCUS_25880 3088 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 4038 3529 gene locus_tag LOCUS_25890 4038 3529 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021817.1 protein_id gnl|my_center|LOCUS_25890 4241 4513 gene locus_tag LOCUS_25900 4241 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 >Feature sequence77 210 7 gene locus_tag LOCUS_25910 210 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 585 962 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 974 1588 gene locus_tag LOCUS_25920 974 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 1594 2757 gene locus_tag LOCUS_25930 1594 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 2714 3211 gene locus_tag LOCUS_25940 2714 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 3449 3246 gene locus_tag LOCUS_25950 3449 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 3950 4249 gene locus_tag LOCUS_25960 3950 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 5210 4362 gene locus_tag LOCUS_25970 5210 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 >Feature sequence78 4 1365 gene locus_tag LOCUS_25980 4 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 2081 1458 gene locus_tag LOCUS_25990 2081 1458 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261725.1 protein_id gnl|my_center|LOCUS_25990 2698 2252 gene locus_tag LOCUS_26000 2698 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26000 3779 2691 gene locus_tag LOCUS_26010 3779 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 4461 4147 gene locus_tag LOCUS_26020 4461 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 >Feature sequence79 1142 369 gene locus_tag LOCUS_26030 1142 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 1761 1555 gene locus_tag LOCUS_26040 1761 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 1916 2638 gene locus_tag LOCUS_26050 1916 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 2645 3358 gene locus_tag LOCUS_26060 2645 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 3373 4074 gene locus_tag LOCUS_26070 3373 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 4078 4644 gene locus_tag LOCUS_26080 4078 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 >Feature sequence80 <1 766 gene locus_tag LOCUS_26090 <1 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_141612405.1:DUF2298 domain-containing protein 858 1122 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1149 2816 gene locus_tag LOCUS_26100 1149 2816 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_26100 2994 3329 gene locus_tag LOCUS_26110 2994 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 3396 3575 gene locus_tag LOCUS_26120 3396 3575 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_26120 4080 4283 gene locus_tag LOCUS_26130 4080 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 >Feature sequence81 103 29 gene locus_tag LOCUS_t00480 103 29 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 177 105 gene locus_tag LOCUS_t00490 177 105 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 789 253 gene locus_tag LOCUS_26140 789 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 796 993 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1397 2161 gene locus_tag LOCUS_26150 1397 2161 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867913.1 protein_id gnl|my_center|LOCUS_26150 2232 2600 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3819 3229 gene locus_tag LOCUS_26160 gene rdgB 3819 3229 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903503.1 protein_id gnl|my_center|LOCUS_26160 <4347 3816 gene locus_tag LOCUS_26170 <4347 3816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023612.1:bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase >Feature sequence82 805 1374 gene locus_tag LOCUS_26180 805 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 2803 1457 gene locus_tag LOCUS_26190 gene gltA 2803 1457 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023687.1 protein_id gnl|my_center|LOCUS_26190 3647 2796 gene locus_tag LOCUS_26200 3647 2796 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065799.1 protein_id gnl|my_center|LOCUS_26200 3857 4012 gene locus_tag LOCUS_26210 3857 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 >Feature sequence83 1344 964 gene locus_tag LOCUS_26220 1344 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 3015 1774 gene locus_tag LOCUS_26230 3015 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 3066 3182 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence84 <1 1361 gene locus_tag LOCUS_26240 <1 1361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023116.1:potassium transporter Kup 2222 1464 gene locus_tag LOCUS_26250 2222 1464 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460843.1 protein_id gnl|my_center|LOCUS_26250 3260 2226 gene locus_tag LOCUS_26260 3260 2226 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214684.1 protein_id gnl|my_center|LOCUS_26260 3901 3257 gene locus_tag LOCUS_26270 3901 3257 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816408.1 protein_id gnl|my_center|LOCUS_26270 >Feature sequence85 428 1816 gene locus_tag LOCUS_26280 428 1816 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_26280 2880 1864 gene locus_tag LOCUS_26290 2880 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 3087 3278 gene locus_tag LOCUS_26300 3087 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 >Feature sequence86 <1 654 gene locus_tag LOCUS_26310 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584016.1:serpin family protein 1219 896 gene locus_tag LOCUS_26320 1219 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 1945 3120 gene locus_tag LOCUS_26330 1945 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26330 >Feature sequence87 1535 1755 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2968 2513 gene locus_tag LOCUS_26340 2968 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 >Feature sequence88 <1 532 gene locus_tag LOCUS_26350 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969667.1:TIGR03885 family FMN-dependent LLM class oxidoreductase 614 869 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 906 2555 gene locus_tag LOCUS_26360 906 2555 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403165.1 protein_id gnl|my_center|LOCUS_26360 >Feature sequence89 934 458 gene locus_tag LOCUS_26370 934 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 1019 1207 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1883 1401 gene locus_tag LOCUS_26380 1883 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 1966 2148 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence90 786 1877 gene locus_tag LOCUS_26390 786 1877 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878512.1 protein_id gnl|my_center|LOCUS_26390 2347 1946 gene locus_tag LOCUS_26400 2347 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400