>Feature sequence01 43 954 gene locus_tag LOCUS_0010 gene rfbA 43 954 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286449.1 protein_id gnl|my_center|LOCUS_0010 1144 1935 gene locus_tag LOCUS_0020 1144 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0020 2086 3027 gene locus_tag LOCUS_0030 2086 3027 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021208.1 protein_id gnl|my_center|LOCUS_0030 3035 4171 gene locus_tag LOCUS_0040 3035 4171 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021207.1 protein_id gnl|my_center|LOCUS_0040 4736 5758 gene locus_tag LOCUS_0050 4736 5758 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257103.1 protein_id gnl|my_center|LOCUS_0050 5766 8429 gene locus_tag LOCUS_0060 5766 8429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0060 8551 9108 gene locus_tag LOCUS_0070 8551 9108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0070 9243 10352 gene locus_tag LOCUS_0080 9243 10352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0080 12584 10353 gene locus_tag LOCUS_0090 12584 10353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0090 12661 14685 gene locus_tag LOCUS_0100 12661 14685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0100 14682 16652 gene locus_tag LOCUS_0110 14682 16652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0110 16764 17771 gene locus_tag LOCUS_0120 16764 17771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0120 17869 19305 gene locus_tag LOCUS_0130 17869 19305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0130 21160 19310 gene locus_tag LOCUS_0140 21160 19310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0140 24012 21199 gene locus_tag LOCUS_0150 24012 21199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0150 24180 25994 gene locus_tag LOCUS_0160 gene asnB 24180 25994 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_0160 28045 26573 gene locus_tag LOCUS_0170 28045 26573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0170 28070 28468 gene locus_tag LOCUS_0180 28070 28468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0180 28485 29174 gene locus_tag LOCUS_0190 28485 29174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0190 30170 29199 gene locus_tag LOCUS_0200 30170 29199 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957843.1 protein_id gnl|my_center|LOCUS_0200 30492 30163 gene locus_tag LOCUS_0210 30492 30163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0210 31888 30479 gene locus_tag LOCUS_0220 31888 30479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0220 32577 31990 gene locus_tag LOCUS_0230 32577 31990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0230 33691 32660 gene locus_tag LOCUS_0240 33691 32660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0240 33822 35690 gene locus_tag LOCUS_0250 33822 35690 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928959.1 protein_id gnl|my_center|LOCUS_0250 35764 36738 gene locus_tag LOCUS_0260 35764 36738 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_0260 36740 37702 gene locus_tag LOCUS_0270 36740 37702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0270 37681 38619 gene locus_tag LOCUS_0280 37681 38619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0280 38642 38863 gene locus_tag LOCUS_0290 38642 38863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0290 39123 39788 gene locus_tag LOCUS_0300 39123 39788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0300 39778 40923 gene locus_tag LOCUS_0310 39778 40923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0310 40916 41611 gene locus_tag LOCUS_0320 40916 41611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0320 41608 42555 gene locus_tag LOCUS_0330 41608 42555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0330 42586 43260 gene locus_tag LOCUS_0340 42586 43260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0340 43300 44370 gene locus_tag LOCUS_0350 43300 44370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0350 45286 44330 gene locus_tag LOCUS_0360 45286 44330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0360 46307 45273 gene locus_tag LOCUS_0370 46307 45273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0370 47158 46304 gene locus_tag LOCUS_0380 47158 46304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0380 48443 47427 gene locus_tag LOCUS_0390 48443 47427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0390 49479 48490 gene locus_tag LOCUS_0400 49479 48490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0400 50270 49476 gene locus_tag LOCUS_0410 50270 49476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0410 51340 50267 gene locus_tag LOCUS_0420 51340 50267 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121265.1 protein_id gnl|my_center|LOCUS_0420 52492 51350 gene locus_tag LOCUS_0430 52492 51350 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870581.1 protein_id gnl|my_center|LOCUS_0430 52502 53233 gene locus_tag LOCUS_0440 52502 53233 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985169.1 protein_id gnl|my_center|LOCUS_0440 53217 53660 gene locus_tag LOCUS_0450 53217 53660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0450 53657 54637 gene locus_tag LOCUS_0460 53657 54637 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_0460 54972 57002 gene locus_tag LOCUS_0470 54972 57002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0470 57012 58181 gene locus_tag LOCUS_0480 57012 58181 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021207.1 protein_id gnl|my_center|LOCUS_0480 58150 59253 gene locus_tag LOCUS_0490 58150 59253 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257578.1 protein_id gnl|my_center|LOCUS_0490 59300 60427 gene locus_tag LOCUS_0500 59300 60427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0500 60424 61686 gene locus_tag LOCUS_0510 60424 61686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0510 62926 61871 gene locus_tag LOCUS_0520 gene waaF 62926 61871 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_0520 64128 62965 gene locus_tag LOCUS_0530 64128 62965 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023660.1 protein_id gnl|my_center|LOCUS_0530 64738 64331 gene locus_tag LOCUS_0540 64738 64331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0540 65591 64812 gene locus_tag LOCUS_0550 65591 64812 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_0550 66238 65597 gene locus_tag LOCUS_0560 66238 65597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0560 67468 66248 gene locus_tag LOCUS_0570 67468 66248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0570 67674 68405 gene locus_tag LOCUS_0580 67674 68405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0580 69193 68450 gene locus_tag LOCUS_0590 69193 68450 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_0590 70271 69231 gene locus_tag LOCUS_0600 70271 69231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0600 70632 70560 gene locus_tag LOCUS_t0010 70632 70560 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 70806 70735 gene locus_tag LOCUS_t0020 70806 70735 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 71986 70871 gene locus_tag LOCUS_0610 71986 70871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0610 72105 72320 gene locus_tag LOCUS_0620 72105 72320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0620 73908 72343 gene locus_tag LOCUS_0630 gene murJ 73908 72343 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582940.1 protein_id gnl|my_center|LOCUS_0630 74092 73901 gene locus_tag LOCUS_0640 74092 73901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0640 74682 74095 gene locus_tag LOCUS_0650 74682 74095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0650 76145 74685 gene locus_tag LOCUS_0660 76145 74685 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022292.1 protein_id gnl|my_center|LOCUS_0660 78481 76142 gene locus_tag LOCUS_0670 78481 76142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0670 79629 78478 gene locus_tag LOCUS_0680 79629 78478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0680 80337 79690 gene locus_tag LOCUS_0690 80337 79690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0690 80767 80321 gene locus_tag LOCUS_0700 80767 80321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0700 81479 80778 gene locus_tag LOCUS_0710 81479 80778 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_0710 81679 83361 gene locus_tag LOCUS_0720 81679 83361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0720 >Feature sequence02 1874 699 gene locus_tag LOCUS_0730 1874 699 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_0730 1902 2840 gene locus_tag LOCUS_0740 1902 2840 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266475.1 protein_id gnl|my_center|LOCUS_0740 3583 2837 gene locus_tag LOCUS_0750 3583 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0750 4230 3586 gene locus_tag LOCUS_0760 4230 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0760 4619 4221 gene locus_tag LOCUS_0770 4619 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0770 5423 4629 gene locus_tag LOCUS_0780 5423 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0780 7344 5455 gene locus_tag LOCUS_0790 7344 5455 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582619.1 protein_id gnl|my_center|LOCUS_0790 8012 7392 gene locus_tag LOCUS_0800 8012 7392 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_0800 8036 9457 gene locus_tag LOCUS_0810 gene zwf 8036 9457 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477796.1 protein_id gnl|my_center|LOCUS_0810 9537 10373 gene locus_tag LOCUS_0820 9537 10373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0820 11534 10635 gene locus_tag LOCUS_0830 gene gnd 11534 10635 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402865.1 protein_id gnl|my_center|LOCUS_0830 11831 12052 gene locus_tag LOCUS_0840 11831 12052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0840 13578 12160 gene locus_tag LOCUS_0850 13578 12160 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_0850 14178 13648 gene locus_tag LOCUS_0860 14178 13648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0860 14938 14183 gene locus_tag LOCUS_0870 14938 14183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0870 18153 14971 gene locus_tag LOCUS_0880 18153 14971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0880 18910 18197 gene locus_tag LOCUS_0890 gene lgt 18910 18197 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948555.1 protein_id gnl|my_center|LOCUS_0890 19367 19005 gene locus_tag LOCUS_0900 19367 19005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0900 21027 19960 gene locus_tag LOCUS_0910 21027 19960 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143858.1 protein_id gnl|my_center|LOCUS_0910 21083 22432 gene locus_tag LOCUS_0920 gene gdhA 21083 22432 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080520.1 protein_id gnl|my_center|LOCUS_0920 23459 22614 gene locus_tag LOCUS_0930 23459 22614 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880440.1 protein_id gnl|my_center|LOCUS_0930 24175 23645 gene locus_tag LOCUS_0940 24175 23645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0940 24762 24172 gene locus_tag LOCUS_0950 24762 24172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0950 25833 24766 gene locus_tag LOCUS_0960 25833 24766 CDS product DUF3179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256451.1 protein_id gnl|my_center|LOCUS_0960 26156 25830 gene locus_tag LOCUS_0970 26156 25830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0970 26401 26559 gene locus_tag LOCUS_0980 26401 26559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0980 27426 26968 gene locus_tag LOCUS_0990 27426 26968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0990 27712 29145 gene locus_tag LOCUS_1000 gene purF 27712 29145 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388163.1 protein_id gnl|my_center|LOCUS_1000 29836 29195 gene locus_tag LOCUS_1010 29836 29195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1010 29907 30119 gene locus_tag LOCUS_1020 29907 30119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1020 30571 30170 gene locus_tag LOCUS_1030 30571 30170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1030 30869 30609 gene locus_tag LOCUS_1040 30869 30609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1040 30950 31888 gene locus_tag LOCUS_1050 30950 31888 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392447.1 protein_id gnl|my_center|LOCUS_1050 32353 31955 gene locus_tag LOCUS_1060 32353 31955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1060 32954 32670 gene locus_tag LOCUS_1070 32954 32670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1070 33849 33556 gene locus_tag LOCUS_1080 33849 33556 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084855.1 protein_id gnl|my_center|LOCUS_1080 34053 33904 gene locus_tag LOCUS_1090 34053 33904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1090 34821 34156 gene locus_tag LOCUS_1100 34821 34156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1100 35485 34859 gene locus_tag LOCUS_1110 35485 34859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1110 35584 37980 gene locus_tag LOCUS_1120 35584 37980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1120 38238 38014 gene locus_tag LOCUS_1130 38238 38014 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014310.1 protein_id gnl|my_center|LOCUS_1130 38302 39036 gene locus_tag LOCUS_1140 38302 39036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1140 <40788 39042 gene locus_tag LOCUS_1150 <40788 39042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256721.1:translational GTPase TypA >Feature sequence03 809 1570 gene locus_tag LOCUS_1160 809 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1160 1582 2922 gene locus_tag LOCUS_1170 1582 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1170 2942 3946 gene locus_tag LOCUS_1180 2942 3946 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771860.1 protein_id gnl|my_center|LOCUS_1180 3946 4941 gene locus_tag LOCUS_1190 3946 4941 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957731.1 protein_id gnl|my_center|LOCUS_1190 4978 6510 gene locus_tag LOCUS_1200 4978 6510 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088170.1 protein_id gnl|my_center|LOCUS_1200 6528 7109 gene locus_tag LOCUS_1210 6528 7109 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088168.1 protein_id gnl|my_center|LOCUS_1210 7230 9089 gene locus_tag LOCUS_1220 7230 9089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1220 9163 10218 gene locus_tag LOCUS_1230 9163 10218 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088184.1 protein_id gnl|my_center|LOCUS_1230 10344 11405 gene locus_tag LOCUS_1240 10344 11405 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582222.1 protein_id gnl|my_center|LOCUS_1240 11689 13674 gene locus_tag LOCUS_1250 11689 13674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1250 13787 15958 gene locus_tag LOCUS_1260 13787 15958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1260 15992 16606 gene locus_tag LOCUS_1270 15992 16606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_1270 16587 17630 gene locus_tag LOCUS_1280 16587 17630 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967057.1 protein_id gnl|my_center|LOCUS_1280 17653 18501 gene locus_tag LOCUS_1290 17653 18501 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088174.1 protein_id gnl|my_center|LOCUS_1290 18501 19427 gene locus_tag LOCUS_1300 18501 19427 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088175.1 protein_id gnl|my_center|LOCUS_1300 19424 20533 gene locus_tag LOCUS_1310 19424 20533 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088177.1 protein_id gnl|my_center|LOCUS_1310 20607 21653 gene locus_tag LOCUS_1320 20607 21653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1320 21748 23772 gene locus_tag LOCUS_1330 21748 23772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1330 23810 24526 gene locus_tag LOCUS_1340 23810 24526 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088180.1 protein_id gnl|my_center|LOCUS_1340 24540 25427 gene locus_tag LOCUS_1350 24540 25427 CDS product sugar nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031499.1 protein_id gnl|my_center|LOCUS_1350 25437 25991 gene locus_tag LOCUS_1360 25437 25991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1360 25988 27229 gene locus_tag LOCUS_1370 25988 27229 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967053.1 protein_id gnl|my_center|LOCUS_1370 27649 28521 gene locus_tag LOCUS_1380 27649 28521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1380 28712 30085 gene locus_tag LOCUS_1390 28712 30085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1390 30635 30141 gene locus_tag LOCUS_1400 30635 30141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1400 30936 31229 gene locus_tag LOCUS_1410 30936 31229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1410 >Feature sequence04 1567 350 gene locus_tag LOCUS_1420 1567 350 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085938409.1 protein_id gnl|my_center|LOCUS_1420 1679 2734 gene locus_tag LOCUS_1430 1679 2734 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254572.1 protein_id gnl|my_center|LOCUS_1430 3385 2972 gene locus_tag LOCUS_1440 3385 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1440 3656 3417 gene locus_tag LOCUS_1450 3656 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1450 4177 4914 gene locus_tag LOCUS_1460 4177 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1460 5694 5191 gene locus_tag LOCUS_1470 5694 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1470 6970 5915 gene locus_tag LOCUS_1480 6970 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1480 8177 8692 gene locus_tag LOCUS_1490 8177 8692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1490 9057 9386 gene locus_tag LOCUS_1500 9057 9386 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830443.1 protein_id gnl|my_center|LOCUS_1500 9467 10321 gene locus_tag LOCUS_1510 9467 10321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1510 10326 11366 gene locus_tag LOCUS_1520 10326 11366 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583051.1 protein_id gnl|my_center|LOCUS_1520 11468 12430 gene locus_tag LOCUS_1530 gene ychF 11468 12430 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505884.1 protein_id gnl|my_center|LOCUS_1530 12495 13994 gene locus_tag LOCUS_1540 12495 13994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1540 13978 14337 gene locus_tag LOCUS_1550 13978 14337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1550 14378 15859 gene locus_tag LOCUS_1560 14378 15859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1560 18267 15871 gene locus_tag LOCUS_1570 18267 15871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1570 18338 18772 gene locus_tag LOCUS_1580 18338 18772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1580 18932 19396 gene locus_tag LOCUS_1590 18932 19396 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933604.1 protein_id gnl|my_center|LOCUS_1590 19414 19635 gene locus_tag LOCUS_1600 gene rpsR 19414 19635 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_1600 19761 19967 gene locus_tag LOCUS_1610 19761 19967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1610 21166 20102 gene locus_tag LOCUS_1620 gene recA 21166 20102 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_1620 21933 21241 gene locus_tag LOCUS_1630 21933 21241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1630 24113 21927 gene locus_tag LOCUS_1640 24113 21927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1640 28259 24363 gene locus_tag LOCUS_1650 gene rpoC 28259 24363 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256762.1 protein_id gnl|my_center|LOCUS_1650 >Feature sequence05 1076 120 gene locus_tag LOCUS_1660 1076 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1660 1279 2208 gene locus_tag LOCUS_1670 1279 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1670 2479 2407 gene locus_tag LOCUS_t0030 2479 2407 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2620 3036 gene locus_tag LOCUS_1680 2620 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1680 4090 3281 gene locus_tag LOCUS_1690 4090 3281 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942258.1 protein_id gnl|my_center|LOCUS_1690 5458 4865 gene locus_tag LOCUS_1700 5458 4865 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763353.1 protein_id gnl|my_center|LOCUS_1700 6523 5516 gene locus_tag LOCUS_1710 6523 5516 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880437.1 protein_id gnl|my_center|LOCUS_1710 7441 6602 gene locus_tag LOCUS_1720 7441 6602 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813684.1 protein_id gnl|my_center|LOCUS_1720 7739 7506 gene locus_tag LOCUS_1730 7739 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1730 8523 8759 gene locus_tag LOCUS_1740 8523 8759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1740 9658 9888 gene locus_tag LOCUS_1750 9658 9888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1750 10584 11978 gene locus_tag LOCUS_1760 10584 11978 CDS product IS66-like element ISH10B family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289081.1 protein_id gnl|my_center|LOCUS_1760 12499 12852 gene locus_tag LOCUS_1770 12499 12852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1770 13048 13611 gene locus_tag LOCUS_1780 13048 13611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1780 13730 14116 gene locus_tag LOCUS_1790 13730 14116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1790 14818 14117 gene locus_tag LOCUS_1800 14818 14117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1800 15929 15345 gene locus_tag LOCUS_1810 gene tsf 15929 15345 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_1810 16746 15958 gene locus_tag LOCUS_1820 gene rpsB 16746 15958 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 protein_id gnl|my_center|LOCUS_1820 16995 17279 gene locus_tag LOCUS_1830 16995 17279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1830 17352 18428 gene locus_tag LOCUS_1840 gene prfA 17352 18428 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_1840 18425 19183 gene locus_tag LOCUS_1850 gene prmC 18425 19183 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257490.1 protein_id gnl|my_center|LOCUS_1850 20026 19247 gene locus_tag LOCUS_1860 20026 19247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1860 20421 20089 gene locus_tag LOCUS_1870 20421 20089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1870 21636 20515 gene locus_tag LOCUS_1880 gene rodA 21636 20515 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_1880 22423 21683 gene locus_tag LOCUS_1890 22423 21683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1890 22551 26027 gene locus_tag LOCUS_1900 22551 26027 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_1900 26284 26048 gene locus_tag LOCUS_1910 26284 26048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1910 26402 27535 gene locus_tag LOCUS_1920 26402 27535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1920 >Feature sequence06 339 641 gene locus_tag LOCUS_1930 339 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1930 924 688 gene locus_tag LOCUS_1940 924 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1940 1523 1083 gene locus_tag LOCUS_1950 1523 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1950 2924 2525 gene locus_tag LOCUS_tm0010 2924 2525 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 3421 2969 gene locus_tag LOCUS_1960 gene smpB 3421 2969 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057764.1 protein_id gnl|my_center|LOCUS_1960 3498 3749 gene locus_tag LOCUS_1970 3498 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1970 3781 4215 gene locus_tag LOCUS_1980 3781 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1980 4250 4501 gene locus_tag LOCUS_1990 4250 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1990 4812 5159 gene locus_tag LOCUS_2000 4812 5159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2000 5242 5817 gene locus_tag LOCUS_2010 5242 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2010 5905 6099 gene locus_tag LOCUS_2020 5905 6099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2020 6105 6485 gene locus_tag LOCUS_2030 gene rplT 6105 6485 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 protein_id gnl|my_center|LOCUS_2030 6806 6438 gene locus_tag LOCUS_2040 6806 6438 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227905.1 protein_id gnl|my_center|LOCUS_2040 6833 7765 gene locus_tag LOCUS_2050 6833 7765 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_2050 8200 7778 gene locus_tag LOCUS_2060 8200 7778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2060 9136 8219 gene locus_tag LOCUS_2070 9136 8219 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584036.1 protein_id gnl|my_center|LOCUS_2070 9843 9139 gene locus_tag LOCUS_2080 9843 9139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2080 11004 9892 gene locus_tag LOCUS_2090 11004 9892 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902891.1 protein_id gnl|my_center|LOCUS_2090 11354 11001 gene locus_tag LOCUS_2100 11354 11001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2100 12803 11460 gene locus_tag LOCUS_2110 12803 11460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2110 13375 14223 gene locus_tag LOCUS_2120 13375 14223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2120 14376 14549 gene locus_tag LOCUS_2130 14376 14549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2130 15538 14597 gene locus_tag LOCUS_2140 15538 14597 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392351.1 protein_id gnl|my_center|LOCUS_2140 16640 15768 gene locus_tag LOCUS_2150 16640 15768 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_2150 17058 16654 gene locus_tag LOCUS_2160 17058 16654 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021822.1 protein_id gnl|my_center|LOCUS_2160 17406 17077 gene locus_tag LOCUS_2170 17406 17077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2170 17989 17396 gene locus_tag LOCUS_2180 17989 17396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2180 18554 17982 gene locus_tag LOCUS_2190 18554 17982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2190 19589 18558 gene locus_tag LOCUS_2200 19589 18558 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038335.1 protein_id gnl|my_center|LOCUS_2200 19972 19646 gene locus_tag LOCUS_2210 19972 19646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2210 20231 19950 gene locus_tag LOCUS_2220 20231 19950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2220 20614 20234 gene locus_tag LOCUS_2230 20614 20234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2230 21143 20616 gene locus_tag LOCUS_2240 21143 20616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2240 22173 21148 gene locus_tag LOCUS_2250 22173 21148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2250 23654 22275 gene locus_tag LOCUS_2260 23654 22275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2260 25067 23730 gene locus_tag LOCUS_2270 25067 23730 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058269.1 protein_id gnl|my_center|LOCUS_2270 27450 25126 gene locus_tag LOCUS_2280 27450 25126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2280 >Feature sequence07 3272 2895 gene locus_tag LOCUS_2290 3272 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2290 4462 3269 gene locus_tag LOCUS_2300 4462 3269 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258202.1 protein_id gnl|my_center|LOCUS_2300 4671 7103 gene locus_tag LOCUS_2310 4671 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2310 8067 7129 gene locus_tag LOCUS_2320 8067 7129 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393885.1 protein_id gnl|my_center|LOCUS_2320 8626 8060 gene locus_tag LOCUS_2330 gene ruvA 8626 8060 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460360.1 protein_id gnl|my_center|LOCUS_2330 9395 8697 gene locus_tag LOCUS_2340 9395 8697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2340 10469 9636 gene locus_tag LOCUS_2350 10469 9636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2350 11442 10681 gene locus_tag LOCUS_2360 11442 10681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2360 11945 11637 gene locus_tag LOCUS_2370 11945 11637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2370 12041 14035 gene locus_tag LOCUS_2380 gene uvrB 12041 14035 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_2380 15559 14075 gene locus_tag LOCUS_2390 15559 14075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2390 15677 17671 gene locus_tag LOCUS_2400 15677 17671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2400 18597 17674 gene locus_tag LOCUS_2410 18597 17674 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771489.1 protein_id gnl|my_center|LOCUS_2410 19633 18635 gene locus_tag LOCUS_2420 gene gmd 19633 18635 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_2420 19705 20637 gene locus_tag LOCUS_2430 gene truB 19705 20637 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258869.1 protein_id gnl|my_center|LOCUS_2430 20676 20948 gene locus_tag LOCUS_2440 20676 20948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2440 21868 20960 gene locus_tag LOCUS_2450 21868 20960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2450 23106 21907 gene locus_tag LOCUS_2460 23106 21907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2460 23523 23236 gene locus_tag LOCUS_2470 23523 23236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2470 23997 23530 gene locus_tag LOCUS_2480 23997 23530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2480 <26400 24043 gene locus_tag LOCUS_2490 <26400 24043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_151756788.1:type IV secretion system DNA-binding domain-containing protein >Feature sequence08 1241 219 gene locus_tag LOCUS_2500 1241 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2500 1931 1458 gene locus_tag LOCUS_2510 1931 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2510 2078 2890 gene locus_tag LOCUS_2520 2078 2890 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_2520 3095 3739 gene locus_tag LOCUS_2530 3095 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2530 4867 3743 gene locus_tag LOCUS_2540 4867 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2540 4998 6317 gene locus_tag LOCUS_2550 4998 6317 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879940.1 protein_id gnl|my_center|LOCUS_2550 6681 7778 gene locus_tag LOCUS_2560 6681 7778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2560 7986 8747 gene locus_tag LOCUS_2570 7986 8747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2570 9016 9171 gene locus_tag LOCUS_2580 9016 9171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2580 9201 9737 gene locus_tag LOCUS_2590 9201 9737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2590 10466 9777 gene locus_tag LOCUS_2600 10466 9777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2600 14082 10693 gene locus_tag LOCUS_2610 14082 10693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2610 14210 14665 gene locus_tag LOCUS_2620 14210 14665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2620 17117 14697 gene locus_tag LOCUS_2630 gene leuS 17117 14697 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009455.1 protein_id gnl|my_center|LOCUS_2630 17747 17214 gene locus_tag LOCUS_2640 17747 17214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2640 18012 18971 gene locus_tag LOCUS_2650 18012 18971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2650 19833 19048 gene locus_tag LOCUS_2660 19833 19048 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038431207.1 protein_id gnl|my_center|LOCUS_2660 20153 19995 gene locus_tag LOCUS_2670 20153 19995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2670 20106 20510 gene locus_tag LOCUS_2680 20106 20510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2680 21516 20497 gene locus_tag LOCUS_2690 21516 20497 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231015.1 protein_id gnl|my_center|LOCUS_2690 22826 21549 gene locus_tag LOCUS_2700 22826 21549 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_2700 24158 22845 gene locus_tag LOCUS_2710 24158 22845 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775737.1 protein_id gnl|my_center|LOCUS_2710 24714 24211 gene locus_tag LOCUS_2720 24714 24211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2720 >Feature sequence09 2708 1230 gene locus_tag LOCUS_2730 2708 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2730 3461 2880 gene locus_tag LOCUS_2740 3461 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2740 4489 3467 gene locus_tag LOCUS_2750 4489 3467 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880453.1 protein_id gnl|my_center|LOCUS_2750 6329 4578 gene locus_tag LOCUS_2760 6329 4578 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_2760 6863 6339 gene locus_tag LOCUS_2770 6863 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2770 7099 6884 gene locus_tag LOCUS_2780 7099 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2780 8970 7177 gene locus_tag LOCUS_2790 gene uvrC 8970 7177 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_2790 9039 9464 gene locus_tag LOCUS_2800 9039 9464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2800 9591 12410 gene locus_tag LOCUS_2810 gene uvrA 9591 12410 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462189.1 protein_id gnl|my_center|LOCUS_2810 12479 14197 gene locus_tag LOCUS_2820 12479 14197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2820 14223 15206 gene locus_tag LOCUS_2830 14223 15206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2830 16010 15258 gene locus_tag LOCUS_2840 16010 15258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2840 16253 16546 gene locus_tag LOCUS_2850 gene groES 16253 16546 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233675.1 protein_id gnl|my_center|LOCUS_2850 16579 18237 gene locus_tag LOCUS_2860 gene groL 16579 18237 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393619.1 protein_id gnl|my_center|LOCUS_2860 18766 19218 gene locus_tag LOCUS_2870 18766 19218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2870 19279 20703 gene locus_tag LOCUS_2880 gene pyk 19279 20703 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_2880 20987 20751 gene locus_tag LOCUS_2890 20987 20751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2890 22178 21174 gene locus_tag LOCUS_2900 22178 21174 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922494.1 protein_id gnl|my_center|LOCUS_2900 22295 22382 gene locus_tag LOCUS_t0040 22295 22382 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence10 1052 462 gene locus_tag LOCUS_2910 1052 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2910 3857 1185 gene locus_tag LOCUS_2920 gene polA 3857 1185 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_2920 4278 4496 gene locus_tag LOCUS_2930 4278 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2930 5298 4879 gene locus_tag LOCUS_2940 gene tsaE 5298 4879 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598193.1 protein_id gnl|my_center|LOCUS_2940 5596 5306 gene locus_tag LOCUS_2950 5596 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2950 6438 5617 gene locus_tag LOCUS_2960 6438 5617 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119813.1 protein_id gnl|my_center|LOCUS_2960 6766 7908 gene locus_tag LOCUS_2970 6766 7908 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_2970 8324 7968 gene locus_tag LOCUS_2980 8324 7968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2980 10120 8447 gene locus_tag LOCUS_2990 10120 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2990 11205 10156 gene locus_tag LOCUS_3000 11205 10156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3000 11324 11782 gene locus_tag LOCUS_3010 11324 11782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3010 11975 12421 gene locus_tag LOCUS_3020 11975 12421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3020 14337 12454 gene locus_tag LOCUS_3030 14337 12454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3030 14819 15100 gene locus_tag LOCUS_3040 14819 15100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3040 15255 15779 gene locus_tag LOCUS_3050 15255 15779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3050 15939 16493 gene locus_tag LOCUS_3060 15939 16493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3060 16553 17164 gene locus_tag LOCUS_3070 16553 17164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3070 18184 17159 gene locus_tag LOCUS_3080 gene ruvB 18184 17159 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_3080 18723 19415 gene locus_tag LOCUS_3090 18723 19415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3090 19434 20135 gene locus_tag LOCUS_3100 19434 20135 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583963.1 protein_id gnl|my_center|LOCUS_3100 20154 20639 gene locus_tag LOCUS_3110 gene ruvC 20154 20639 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056979.1 protein_id gnl|my_center|LOCUS_3110 20664 22217 gene locus_tag LOCUS_3120 20664 22217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3120 >Feature sequence11 219 641 gene locus_tag LOCUS_3130 gene ruvX 219 641 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963861.1 protein_id gnl|my_center|LOCUS_3130 681 1418 gene locus_tag LOCUS_3140 681 1418 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_3140 1431 2507 gene locus_tag LOCUS_3150 gene galT 1431 2507 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080684.1 protein_id gnl|my_center|LOCUS_3150 3118 2549 gene locus_tag LOCUS_3160 3118 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_3160 3271 3783 gene locus_tag LOCUS_3170 3271 3783 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064945.1 protein_id gnl|my_center|LOCUS_3170 3825 4610 gene locus_tag LOCUS_3180 gene tpiA 3825 4610 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243394.1 protein_id gnl|my_center|LOCUS_3180 4613 5479 gene locus_tag LOCUS_3190 4613 5479 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_3190 5528 6532 gene locus_tag LOCUS_3200 5528 6532 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496485.1 protein_id gnl|my_center|LOCUS_3200 6534 7532 gene locus_tag LOCUS_3210 gene gap 6534 7532 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259560.1 protein_id gnl|my_center|LOCUS_3210 7993 7574 gene locus_tag LOCUS_3220 7993 7574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3220 8082 9296 gene locus_tag LOCUS_3230 8082 9296 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_3230 9316 10647 gene locus_tag LOCUS_3240 gene eno 9316 10647 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080719.1 protein_id gnl|my_center|LOCUS_3240 10698 11138 gene locus_tag LOCUS_3250 10698 11138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3250 11312 13030 gene locus_tag LOCUS_3260 11312 13030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3260 13005 13412 gene locus_tag LOCUS_3270 13005 13412 CDS product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628813.1 protein_id gnl|my_center|LOCUS_3270 14051 15472 gene locus_tag LOCUS_3280 14051 15472 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583255.1 protein_id gnl|my_center|LOCUS_3280 15565 16710 gene locus_tag LOCUS_3290 15565 16710 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 protein_id gnl|my_center|LOCUS_3290 16707 17327 gene locus_tag LOCUS_3300 16707 17327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3300 17334 18443 gene locus_tag LOCUS_3310 17334 18443 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 protein_id gnl|my_center|LOCUS_3310 18498 19616 gene locus_tag LOCUS_3320 18498 19616 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_3320 19744 20424 gene locus_tag LOCUS_3330 19744 20424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3330 >Feature sequence12 2489 1032 gene locus_tag LOCUS_3340 2489 1032 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207627.1 protein_id gnl|my_center|LOCUS_3340 3050 2496 gene locus_tag LOCUS_3350 3050 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3350 4865 3111 gene locus_tag LOCUS_3360 4865 3111 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889608.1 protein_id gnl|my_center|LOCUS_3360 5766 5203 gene locus_tag LOCUS_3370 5766 5203 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208208.1 protein_id gnl|my_center|LOCUS_3370 5775 6317 gene locus_tag LOCUS_3380 5775 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3380 6922 6362 gene locus_tag LOCUS_3390 6922 6362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3390 7047 7775 gene locus_tag LOCUS_3400 7047 7775 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_3400 10002 7777 gene locus_tag LOCUS_3410 10002 7777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3410 12782 9999 gene locus_tag LOCUS_3420 12782 9999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3420 13724 12828 gene locus_tag LOCUS_3430 13724 12828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3430 13799 14008 gene locus_tag LOCUS_3440 13799 14008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3440 14100 14642 gene locus_tag LOCUS_3450 14100 14642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3450 14675 15811 gene locus_tag LOCUS_3460 14675 15811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3460 15978 16883 gene locus_tag LOCUS_3470 15978 16883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3470 17557 16946 gene locus_tag LOCUS_3480 17557 16946 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481262.1 protein_id gnl|my_center|LOCUS_3480 17932 17558 gene locus_tag LOCUS_3490 17932 17558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3490 18047 18250 gene locus_tag LOCUS_3500 18047 18250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3500 19114 18503 gene locus_tag LOCUS_3510 19114 18503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3510 >Feature sequence13 2656 674 gene locus_tag LOCUS_3520 2656 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3520 3398 2664 gene locus_tag LOCUS_3530 3398 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3530 4509 3943 gene locus_tag LOCUS_3540 4509 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3540 7836 4897 gene locus_tag LOCUS_3550 gene ileS 7836 4897 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583781.1 protein_id gnl|my_center|LOCUS_3550 8607 7882 gene locus_tag LOCUS_3560 8607 7882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3560 10361 8652 gene locus_tag LOCUS_3570 gene argS 10361 8652 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462258.1 protein_id gnl|my_center|LOCUS_3570 10948 10424 gene locus_tag LOCUS_3580 10948 10424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328133.1 protein_id gnl|my_center|LOCUS_3580 11088 11498 gene locus_tag LOCUS_3590 gene umuD 11088 11498 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457136.1 protein_id gnl|my_center|LOCUS_3590 11498 12796 gene locus_tag LOCUS_3600 11498 12796 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538076.1 protein_id gnl|my_center|LOCUS_3600 13079 13288 gene locus_tag LOCUS_3610 13079 13288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3610 13443 14381 gene locus_tag LOCUS_3620 13443 14381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3620 15103 14423 gene locus_tag LOCUS_3630 15103 14423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3630 16114 15158 gene locus_tag LOCUS_3640 16114 15158 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212340732.1 protein_id gnl|my_center|LOCUS_3640 16226 16633 gene locus_tag LOCUS_3650 16226 16633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3650 17055 16780 gene locus_tag LOCUS_3660 17055 16780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3660 17310 17549 gene locus_tag LOCUS_3670 17310 17549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3670 17887 17815 gene locus_tag LOCUS_t0050 17887 17815 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence14 75 803 gene locus_tag LOCUS_3680 75 803 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023580.1 protein_id gnl|my_center|LOCUS_3680 1518 1285 gene locus_tag LOCUS_3690 1518 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3690 2467 1673 gene locus_tag LOCUS_3700 2467 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3700 2582 3349 gene locus_tag LOCUS_3710 2582 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3710 3907 3350 gene locus_tag LOCUS_3720 3907 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3720 3945 4163 gene locus_tag LOCUS_3730 3945 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3730 4160 4702 gene locus_tag LOCUS_3740 4160 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3740 4969 5682 gene locus_tag LOCUS_3750 4969 5682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3750 5990 6298 gene locus_tag LOCUS_3760 5990 6298 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980242.1 protein_id gnl|my_center|LOCUS_3760 7200 6481 gene locus_tag LOCUS_3770 7200 6481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3770 8005 7190 gene locus_tag LOCUS_3780 8005 7190 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336750.1 protein_id gnl|my_center|LOCUS_3780 9448 8015 gene locus_tag LOCUS_3790 9448 8015 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869220.1 protein_id gnl|my_center|LOCUS_3790 10320 9538 gene locus_tag LOCUS_3800 10320 9538 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258574.1 protein_id gnl|my_center|LOCUS_3800 11328 10330 gene locus_tag LOCUS_3810 gene trpS 11328 10330 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706960.1 protein_id gnl|my_center|LOCUS_3810 12704 12096 gene locus_tag LOCUS_3820 12704 12096 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174997.1 protein_id gnl|my_center|LOCUS_3820 14742 12742 gene locus_tag LOCUS_3830 14742 12742 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_3830 15186 15269 gene locus_tag LOCUS_t0060 15186 15269 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15641 15306 gene locus_tag LOCUS_3840 15641 15306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3840 17261 15762 gene locus_tag LOCUS_3850 gene guaB 17261 15762 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070955.1 protein_id gnl|my_center|LOCUS_3850 17336 17587 gene locus_tag LOCUS_3860 17336 17587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3860 18095 17637 gene locus_tag LOCUS_3870 18095 17637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3870 >Feature sequence15 1439 447 gene locus_tag LOCUS_3880 1439 447 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545386.1 protein_id gnl|my_center|LOCUS_3880 2320 1436 gene locus_tag LOCUS_3890 2320 1436 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 protein_id gnl|my_center|LOCUS_3890 3938 3285 gene locus_tag LOCUS_3900 gene rpe 3938 3285 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583786.1 protein_id gnl|my_center|LOCUS_3900 4384 3935 gene locus_tag LOCUS_3910 4384 3935 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467526.1 protein_id gnl|my_center|LOCUS_3910 4501 4773 gene locus_tag LOCUS_3920 4501 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3920 5119 5048 gene locus_tag LOCUS_t0070 5119 5048 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5510 5373 gene locus_tag LOCUS_3930 5510 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3930 5875 5540 gene locus_tag LOCUS_3940 5875 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3940 6050 7003 gene locus_tag LOCUS_3950 6050 7003 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070837.1 protein_id gnl|my_center|LOCUS_3950 8103 7165 gene locus_tag LOCUS_3960 8103 7165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3960 8780 8100 gene locus_tag LOCUS_3970 gene ftsE 8780 8100 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130964.1 protein_id gnl|my_center|LOCUS_3970 9658 8789 gene locus_tag LOCUS_3980 gene prfB 9658 8789 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285053.1 protein_id gnl|my_center|LOCUS_3980 9936 9864 gene locus_tag LOCUS_t0080 9936 9864 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 10544 10257 gene locus_tag LOCUS_3990 10544 10257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3990 11070 10507 gene locus_tag LOCUS_4000 11070 10507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4000 12335 11127 gene locus_tag LOCUS_4010 12335 11127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4010 12914 12345 gene locus_tag LOCUS_4020 12914 12345 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251061.1 protein_id gnl|my_center|LOCUS_4020 13190 12999 gene locus_tag LOCUS_4030 13190 12999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4030 14384 13365 gene locus_tag LOCUS_4040 14384 13365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4040 14499 14428 gene locus_tag LOCUS_t0090 14499 14428 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 15156 14596 gene locus_tag LOCUS_4050 15156 14596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4050 15528 15163 gene locus_tag LOCUS_4060 15528 15163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4060 16571 15546 gene locus_tag LOCUS_4070 16571 15546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4070 17356 16568 gene locus_tag LOCUS_4080 17356 16568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4080 <18044 17430 gene locus_tag LOCUS_4090 <18044 17430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000242129.1:alkyl hydroperoxide reductase subunit F >Feature sequence16 1652 300 gene locus_tag LOCUS_4100 1652 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4100 2483 1716 gene locus_tag LOCUS_4110 2483 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4110 2597 3892 gene locus_tag LOCUS_4120 gene murA 2597 3892 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462226.1 protein_id gnl|my_center|LOCUS_4120 4108 5118 gene locus_tag LOCUS_4130 4108 5118 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258891.1 protein_id gnl|my_center|LOCUS_4130 5864 5400 gene locus_tag LOCUS_4140 5864 5400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4140 6421 7596 gene locus_tag LOCUS_4150 6421 7596 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583291.1 protein_id gnl|my_center|LOCUS_4150 7627 7932 gene locus_tag LOCUS_4160 7627 7932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4160 8312 8019 gene locus_tag LOCUS_4170 8312 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4170 8712 8359 gene locus_tag LOCUS_4180 8712 8359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4180 8742 11414 gene locus_tag LOCUS_4190 gene secA 8742 11414 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945439.1 protein_id gnl|my_center|LOCUS_4190 11411 11752 gene locus_tag LOCUS_4200 11411 11752 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724123.1 protein_id gnl|my_center|LOCUS_4200 11754 11969 gene locus_tag LOCUS_4210 11754 11969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4210 11966 12883 gene locus_tag LOCUS_4220 11966 12883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4220 12929 13324 gene locus_tag LOCUS_4230 12929 13324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4230 13394 14728 gene locus_tag LOCUS_4240 gene secD 13394 14728 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144152.1 protein_id gnl|my_center|LOCUS_4240 14731 15600 gene locus_tag LOCUS_4250 14731 15600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_4250 15787 16437 gene locus_tag LOCUS_4260 15787 16437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4260 16611 17471 gene locus_tag LOCUS_4270 16611 17471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4270 >Feature sequence17 954 880 gene locus_tag LOCUS_t0100 954 880 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1196 945 gene locus_tag LOCUS_4280 1196 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4280 1514 3676 gene locus_tag LOCUS_4290 1514 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4290 4555 3695 gene locus_tag LOCUS_4300 4555 3695 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220028.1 protein_id gnl|my_center|LOCUS_4300 5986 4613 gene locus_tag LOCUS_4310 gene rpoD 5986 4613 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_4310 7948 6140 gene locus_tag LOCUS_4320 7948 6140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4320 8542 7988 gene locus_tag LOCUS_4330 8542 7988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4330 9413 8520 gene locus_tag LOCUS_4340 gene rimK 9413 8520 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689982.1 protein_id gnl|my_center|LOCUS_4340 9534 10841 gene locus_tag LOCUS_4350 9534 10841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4350 11754 10843 gene locus_tag LOCUS_4360 gene mutM 11754 10843 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640272.1 protein_id gnl|my_center|LOCUS_4360 13092 11788 gene locus_tag LOCUS_4370 13092 11788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4370 13221 13553 gene locus_tag LOCUS_4380 13221 13553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4380 15173 13602 gene locus_tag LOCUS_4390 15173 13602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4390 16169 15621 gene locus_tag LOCUS_4400 16169 15621 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957538.1 protein_id gnl|my_center|LOCUS_4400 16406 16828 gene locus_tag LOCUS_4410 16406 16828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4410 >Feature sequence18 496 1098 gene locus_tag LOCUS_4420 gene lepB 496 1098 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460443.1 protein_id gnl|my_center|LOCUS_4420 1146 2618 gene locus_tag LOCUS_4430 gene hisS 1146 2618 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229755.1 protein_id gnl|my_center|LOCUS_4430 2717 3055 gene locus_tag LOCUS_4440 2717 3055 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228401.1 protein_id gnl|my_center|LOCUS_4440 3291 7862 gene locus_tag LOCUS_4450 3291 7862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4450 7992 8246 gene locus_tag LOCUS_4460 7992 8246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4460 8395 9348 gene locus_tag LOCUS_4470 8395 9348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4470 9348 9770 gene locus_tag LOCUS_4480 gene ybeY 9348 9770 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084469.1 protein_id gnl|my_center|LOCUS_4480 9806 10207 gene locus_tag LOCUS_4490 9806 10207 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565665.1 protein_id gnl|my_center|LOCUS_4490 10280 11584 gene locus_tag LOCUS_4500 gene ftsA 10280 11584 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256643.1 protein_id gnl|my_center|LOCUS_4500 11787 11602 gene locus_tag LOCUS_4510 11787 11602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4510 11912 12604 gene locus_tag LOCUS_4520 11912 12604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4520 12834 14069 gene locus_tag LOCUS_4530 gene ftsZ 12834 14069 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_4530 14130 15560 gene locus_tag LOCUS_4540 14130 15560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4540 15688 16392 gene locus_tag LOCUS_4550 15688 16392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4550 >Feature sequence19 1038 61 gene locus_tag LOCUS_4560 gene rfaD 1038 61 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546025.1 protein_id gnl|my_center|LOCUS_4560 1134 1874 gene locus_tag LOCUS_4570 1134 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4570 2421 1906 gene locus_tag LOCUS_4580 gene rfaE2 2421 1906 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880070.1 protein_id gnl|my_center|LOCUS_4580 2959 2426 gene locus_tag LOCUS_4590 gene gmhB 2959 2426 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_4590 3973 2963 gene locus_tag LOCUS_4600 3973 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4600 4592 4014 gene locus_tag LOCUS_4610 4592 4014 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880554.1 protein_id gnl|my_center|LOCUS_4610 5442 4624 gene locus_tag LOCUS_4620 gene rfbD 5442 4624 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_4620 6359 5493 gene locus_tag LOCUS_4630 6359 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4630 7285 6356 gene locus_tag LOCUS_4640 7285 6356 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_4640 8102 7290 gene locus_tag LOCUS_4650 8102 7290 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_4650 8710 8159 gene locus_tag LOCUS_4660 gene rfbC 8710 8159 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_4660 9238 8753 gene locus_tag LOCUS_4670 9238 8753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4670 9571 9314 gene locus_tag LOCUS_4680 9571 9314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4680 11489 9714 gene locus_tag LOCUS_4690 gene lepA 11489 9714 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258913.1 protein_id gnl|my_center|LOCUS_4690 12713 11529 gene locus_tag LOCUS_4700 12713 11529 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870788.1 protein_id gnl|my_center|LOCUS_4700 13057 12776 gene locus_tag LOCUS_4710 13057 12776 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403469.1 protein_id gnl|my_center|LOCUS_4710 14771 13149 gene locus_tag LOCUS_4720 gene murJ 14771 13149 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460880.1 protein_id gnl|my_center|LOCUS_4720 >Feature sequence20 1988 729 gene locus_tag LOCUS_4730 1988 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4730 2701 1994 gene locus_tag LOCUS_4740 2701 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4740 4252 2711 gene locus_tag LOCUS_4750 4252 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4750 5505 4288 gene locus_tag LOCUS_4760 5505 4288 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073810.1 protein_id gnl|my_center|LOCUS_4760 7453 5729 gene locus_tag LOCUS_4770 gene pilB 7453 5729 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546881.1 protein_id gnl|my_center|LOCUS_4770 8792 7521 gene locus_tag LOCUS_4780 8792 7521 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938462.1 protein_id gnl|my_center|LOCUS_4780 8832 9584 gene locus_tag LOCUS_4790 gene znuC 8832 9584 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707444.1 protein_id gnl|my_center|LOCUS_4790 9577 10386 gene locus_tag LOCUS_4800 9577 10386 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172542.1 protein_id gnl|my_center|LOCUS_4800 10383 10850 gene locus_tag LOCUS_4810 10383 10850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4810 10933 11166 gene locus_tag LOCUS_4820 10933 11166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4820 12696 11209 gene locus_tag LOCUS_4830 12696 11209 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142605.1 protein_id gnl|my_center|LOCUS_4830 13303 12803 gene locus_tag LOCUS_4840 13303 12803 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083846.1 protein_id gnl|my_center|LOCUS_4840 13510 13310 gene locus_tag LOCUS_4850 13510 13310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4850 14195 13578 gene locus_tag LOCUS_4860 14195 13578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4860 14431 14234 gene locus_tag LOCUS_4870 14431 14234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4870 >Feature sequence21 379 2367 gene locus_tag LOCUS_4880 379 2367 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869969.1 protein_id gnl|my_center|LOCUS_4880 2535 3071 gene locus_tag LOCUS_4890 2535 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4890 3201 4517 gene locus_tag LOCUS_4900 gene tig 3201 4517 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729253.1 protein_id gnl|my_center|LOCUS_4900 4591 5211 gene locus_tag LOCUS_4910 4591 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4910 5220 5534 gene locus_tag LOCUS_4920 5220 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4920 6906 5470 gene locus_tag LOCUS_4930 gene atpD 6906 5470 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094354.1 protein_id gnl|my_center|LOCUS_4930 7772 6915 gene locus_tag LOCUS_4940 gene atpG 7772 6915 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272788.1 protein_id gnl|my_center|LOCUS_4940 9235 7733 gene locus_tag LOCUS_4950 gene atpA 9235 7733 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966151.1 protein_id gnl|my_center|LOCUS_4950 9665 9210 gene locus_tag LOCUS_4960 9665 9210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4960 10228 9662 gene locus_tag LOCUS_4970 10228 9662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4970 11009 10242 gene locus_tag LOCUS_4980 11009 10242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4980 >Feature sequence22 417 2147 gene locus_tag LOCUS_4990 417 2147 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_4990 2144 2626 gene locus_tag LOCUS_5000 2144 2626 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769725.1 protein_id gnl|my_center|LOCUS_5000 2623 4014 gene locus_tag LOCUS_5010 2623 4014 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880274.1 protein_id gnl|my_center|LOCUS_5010 4467 4102 gene locus_tag LOCUS_5020 4467 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5020 5180 4515 gene locus_tag LOCUS_5030 gene tmk 5180 4515 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867602.1 protein_id gnl|my_center|LOCUS_5030 5923 5195 gene locus_tag LOCUS_5040 5923 5195 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017068.1 protein_id gnl|my_center|LOCUS_5040 6615 5938 gene locus_tag LOCUS_5050 gene rplA 6615 5938 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_5050 7037 6618 gene locus_tag LOCUS_5060 gene rplK 7037 6618 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776394.1 protein_id gnl|my_center|LOCUS_5060 7793 7104 gene locus_tag LOCUS_5070 7793 7104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5070 8051 7833 gene locus_tag LOCUS_5080 8051 7833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5080 10183 8156 gene locus_tag LOCUS_5090 gene gyrB 10183 8156 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_5090 12668 10332 gene locus_tag LOCUS_5100 gene pheT 12668 10332 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405510.1 protein_id gnl|my_center|LOCUS_5100 13846 12821 gene locus_tag LOCUS_5110 gene pheS 13846 12821 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965654.1 protein_id gnl|my_center|LOCUS_5110 14210 13803 gene locus_tag LOCUS_5120 14210 13803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5120 >Feature sequence23 1125 295 gene locus_tag LOCUS_5130 gene rsmA 1125 295 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682389.1 protein_id gnl|my_center|LOCUS_5130 3226 1136 gene locus_tag LOCUS_5140 3226 1136 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403314.1 protein_id gnl|my_center|LOCUS_5140 3537 4673 gene locus_tag LOCUS_5150 3537 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5150 5204 4755 gene locus_tag LOCUS_5160 5204 4755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5160 5726 5310 gene locus_tag LOCUS_5170 5726 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5170 6290 5802 gene locus_tag LOCUS_5180 6290 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5180 6910 6506 gene locus_tag LOCUS_5190 6910 6506 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_5190 8149 6944 gene locus_tag LOCUS_5200 8149 6944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5200 9762 8155 gene locus_tag LOCUS_5210 9762 8155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5210 11987 9762 gene locus_tag LOCUS_5220 11987 9762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5220 12025 12660 gene locus_tag LOCUS_5230 12025 12660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5230 14348 12981 gene locus_tag LOCUS_5240 14348 12981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5240 >Feature sequence24 <1 615 gene locus_tag LOCUS_5250 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230626.1:recombination mediator RecR 1260 946 gene locus_tag LOCUS_5260 gene rplU 1260 946 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807462.1 protein_id gnl|my_center|LOCUS_5260 1806 1333 gene locus_tag LOCUS_5270 1806 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5270 2822 1803 gene locus_tag LOCUS_5280 2822 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5280 4799 3150 gene locus_tag LOCUS_5290 4799 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5290 5182 4817 gene locus_tag LOCUS_5300 5182 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5300 6495 5191 gene locus_tag LOCUS_5310 6495 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5310 6952 6500 gene locus_tag LOCUS_5320 6952 6500 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393815.1 protein_id gnl|my_center|LOCUS_5320 7122 7730 gene locus_tag LOCUS_5330 gene lexA 7122 7730 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392634.1 protein_id gnl|my_center|LOCUS_5330 8821 7727 gene locus_tag LOCUS_5340 8821 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5340 8937 9437 gene locus_tag LOCUS_5350 8937 9437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5350 11008 9458 gene locus_tag LOCUS_5360 11008 9458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5360 11073 11660 gene locus_tag LOCUS_5370 11073 11660 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459819.1 protein_id gnl|my_center|LOCUS_5370 11632 12015 gene locus_tag LOCUS_5380 11632 12015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5380 12134 12484 gene locus_tag LOCUS_5390 12134 12484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5390 13195 12569 gene locus_tag LOCUS_5400 13195 12569 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339235.1 protein_id gnl|my_center|LOCUS_5400 >Feature sequence25 2373 577 gene locus_tag LOCUS_5410 gene aspS 2373 577 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 protein_id gnl|my_center|LOCUS_5410 3227 3412 gene locus_tag LOCUS_5420 3227 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5420 3609 4214 gene locus_tag LOCUS_5430 3609 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5430 4786 4259 gene locus_tag LOCUS_5440 4786 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5440 4924 4849 gene locus_tag LOCUS_t0110 4924 4849 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5078 5749 gene locus_tag LOCUS_5450 5078 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5450 6885 5815 gene locus_tag LOCUS_5460 gene dnaJ 6885 5815 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048002.1 protein_id gnl|my_center|LOCUS_5460 7815 6898 gene locus_tag LOCUS_5470 7815 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5470 9763 7874 gene locus_tag LOCUS_5480 gene dnaK 9763 7874 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_5480 10306 9800 gene locus_tag LOCUS_5490 10306 9800 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080776.1 protein_id gnl|my_center|LOCUS_5490 11038 10313 gene locus_tag LOCUS_5500 11038 10313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5500 12385 11225 gene locus_tag LOCUS_5510 12385 11225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5510 12464 13375 gene locus_tag LOCUS_5520 12464 13375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5520 >Feature sequence26 163 1170 gene locus_tag LOCUS_5530 163 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5530 1658 1167 gene locus_tag LOCUS_5540 1658 1167 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883512.1 protein_id gnl|my_center|LOCUS_5540 2084 1659 gene locus_tag LOCUS_5550 gene msrB 2084 1659 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002070109.1 protein_id gnl|my_center|LOCUS_5550 2525 2088 gene locus_tag LOCUS_5560 2525 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5560 2625 3431 gene locus_tag LOCUS_5570 2625 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5570 3564 4469 gene locus_tag LOCUS_5580 3564 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5580 4785 4564 gene locus_tag LOCUS_5590 4785 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5590 4880 5053 gene locus_tag LOCUS_5600 4880 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5600 5526 5101 gene locus_tag LOCUS_5610 5526 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5610 5722 5895 gene locus_tag LOCUS_5620 5722 5895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5620 6941 5979 gene locus_tag LOCUS_5630 6941 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5630 9265 6959 gene locus_tag LOCUS_5640 9265 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5640 9395 9670 gene locus_tag LOCUS_5650 9395 9670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5650 11008 9722 gene locus_tag LOCUS_5660 gene rhlE 11008 9722 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168103.1 protein_id gnl|my_center|LOCUS_5660 11759 11199 gene locus_tag LOCUS_5670 11759 11199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5670 12755 11850 gene locus_tag LOCUS_5680 12755 11850 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229961.1 protein_id gnl|my_center|LOCUS_5680 12960 13379 gene locus_tag LOCUS_5690 12960 13379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5690 >Feature sequence27 701 1483 gene locus_tag LOCUS_5700 701 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5700 1538 2710 gene locus_tag LOCUS_5710 1538 2710 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_5710 2768 3694 gene locus_tag LOCUS_5720 2768 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5720 3696 4700 gene locus_tag LOCUS_5730 3696 4700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5730 4712 4879 gene locus_tag LOCUS_5740 4712 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5740 4872 5831 gene locus_tag LOCUS_5750 4872 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5750 5978 6550 gene locus_tag LOCUS_5760 5978 6550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5760 7283 6777 gene locus_tag LOCUS_5770 7283 6777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5770 7282 7653 gene locus_tag LOCUS_5780 7282 7653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5780 8127 11078 gene locus_tag LOCUS_5790 8127 11078 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814928.1 protein_id gnl|my_center|LOCUS_5790 11149 12213 gene locus_tag LOCUS_5800 11149 12213 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873440.1 protein_id gnl|my_center|LOCUS_5800 12767 12579 gene locus_tag LOCUS_5810 12767 12579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5810 >Feature sequence28 586 167 gene locus_tag LOCUS_5820 gene rplM 586 167 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173515.1 protein_id gnl|my_center|LOCUS_5820 958 593 gene locus_tag LOCUS_5830 gene rplQ 958 593 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957469.1 protein_id gnl|my_center|LOCUS_5830 1961 984 gene locus_tag LOCUS_5840 1961 984 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879981.1 protein_id gnl|my_center|LOCUS_5840 2702 2013 gene locus_tag LOCUS_5850 2702 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5850 3100 2708 gene locus_tag LOCUS_5860 gene rpsK 3100 2708 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670039.1 protein_id gnl|my_center|LOCUS_5860 3511 3119 gene locus_tag LOCUS_5870 gene rpsM 3511 3119 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_5870 3987 3712 gene locus_tag LOCUS_5880 gene infA 3987 3712 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037132.1 protein_id gnl|my_center|LOCUS_5880 4251 4619 gene locus_tag LOCUS_5890 4251 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5890 6114 4654 gene locus_tag LOCUS_5900 6114 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5900 8104 6218 gene locus_tag LOCUS_5910 8104 6218 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_5910 9175 8483 gene locus_tag LOCUS_5920 9175 8483 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258173.1 protein_id gnl|my_center|LOCUS_5920 11158 9185 gene locus_tag LOCUS_5930 11158 9185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_5930 12447 11164 gene locus_tag LOCUS_5940 12447 11164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5940 >Feature sequence29 2598 1951 gene locus_tag LOCUS_5950 2598 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5950 2666 3142 gene locus_tag LOCUS_5960 2666 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5960 3780 3250 gene locus_tag LOCUS_5970 3780 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5970 3990 4511 gene locus_tag LOCUS_5980 3990 4511 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937663.1 protein_id gnl|my_center|LOCUS_5980 4991 4587 gene locus_tag LOCUS_5990 4991 4587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5990 5460 5068 gene locus_tag LOCUS_6000 5460 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6000 7145 5457 gene locus_tag LOCUS_6010 7145 5457 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229097.1 protein_id gnl|my_center|LOCUS_6010 8475 7162 gene locus_tag LOCUS_6020 8475 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6020 8649 8978 gene locus_tag LOCUS_6030 8649 8978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6030 9395 9210 gene locus_tag LOCUS_6040 9395 9210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6040 9492 10157 gene locus_tag LOCUS_6050 9492 10157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6050 10575 12797 gene locus_tag LOCUS_6060 10575 12797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6060 >Feature sequence30 108 1076 gene locus_tag LOCUS_6070 108 1076 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393452.1 protein_id gnl|my_center|LOCUS_6070 1093 1548 gene locus_tag LOCUS_6080 1093 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6080 1823 2149 gene locus_tag LOCUS_6090 1823 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6090 2175 4160 gene locus_tag LOCUS_6100 2175 4160 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925145.1 protein_id gnl|my_center|LOCUS_6100 4272 4733 gene locus_tag LOCUS_6110 4272 4733 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422657.1 protein_id gnl|my_center|LOCUS_6110 4752 5294 gene locus_tag LOCUS_6120 4752 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6120 5302 6144 gene locus_tag LOCUS_6130 5302 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6130 6148 6480 gene locus_tag LOCUS_6140 6148 6480 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986934.1 protein_id gnl|my_center|LOCUS_6140 6500 8344 gene locus_tag LOCUS_6150 6500 8344 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033047490.1 protein_id gnl|my_center|LOCUS_6150 8368 9762 gene locus_tag LOCUS_6160 8368 9762 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986932.1 protein_id gnl|my_center|LOCUS_6160 9772 10191 gene locus_tag LOCUS_6170 9772 10191 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114423.1 protein_id gnl|my_center|LOCUS_6170 10194 10811 gene locus_tag LOCUS_6180 10194 10811 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295103.1 protein_id gnl|my_center|LOCUS_6180 11129 11497 gene locus_tag LOCUS_6190 11129 11497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6190 12150 11668 gene locus_tag LOCUS_6200 12150 11668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6200 12818 12291 gene locus_tag LOCUS_6210 12818 12291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6210 >Feature sequence31 546 262 gene locus_tag LOCUS_6220 546 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6220 2975 738 gene locus_tag LOCUS_6230 2975 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6230 3592 3182 gene locus_tag LOCUS_6240 3592 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6240 8088 3715 gene locus_tag LOCUS_6250 8088 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6250 8833 8153 gene locus_tag LOCUS_6260 gene trmD 8833 8153 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_6260 9301 8903 gene locus_tag LOCUS_6270 9301 8903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6270 9894 9493 gene locus_tag LOCUS_6280 9894 9493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6280 <11786 9954 gene locus_tag LOCUS_6290 <11786 9954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258775.1:chromosome segregation protein SMC >Feature sequence32 582 493 gene locus_tag LOCUS_t0120 582 493 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 667 1125 gene locus_tag LOCUS_6300 667 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6300 1125 2438 gene locus_tag LOCUS_6310 1125 2438 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027081.1 protein_id gnl|my_center|LOCUS_6310 2447 2788 gene locus_tag LOCUS_6320 2447 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6320 2897 3175 gene locus_tag LOCUS_6330 2897 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6330 3184 3555 gene locus_tag LOCUS_6340 3184 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6340 3559 4656 gene locus_tag LOCUS_6350 3559 4656 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030715.1 protein_id gnl|my_center|LOCUS_6350 4763 5167 gene locus_tag LOCUS_6360 4763 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6360 5291 5659 gene locus_tag LOCUS_6370 5291 5659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6370 5711 6679 gene locus_tag LOCUS_6380 5711 6679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6380 6755 7489 gene locus_tag LOCUS_6390 6755 7489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6390 7558 9516 gene locus_tag LOCUS_6400 7558 9516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6400 9533 9889 gene locus_tag LOCUS_6410 9533 9889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6410 9813 10865 gene locus_tag LOCUS_6420 9813 10865 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583572.1 protein_id gnl|my_center|LOCUS_6420 10893 11684 gene locus_tag LOCUS_6430 10893 11684 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583165.1 protein_id gnl|my_center|LOCUS_6430 >Feature sequence33 994 311 gene locus_tag LOCUS_6440 994 311 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945169.1 protein_id gnl|my_center|LOCUS_6440 2499 1042 gene locus_tag LOCUS_6450 2499 1042 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527999.1 protein_id gnl|my_center|LOCUS_6450 3685 2720 gene locus_tag LOCUS_6460 3685 2720 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084035.1 protein_id gnl|my_center|LOCUS_6460 3890 5905 gene locus_tag LOCUS_6470 3890 5905 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086110.1 protein_id gnl|my_center|LOCUS_6470 5902 7503 gene locus_tag LOCUS_6480 5902 7503 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966010.1 protein_id gnl|my_center|LOCUS_6480 7519 8301 gene locus_tag LOCUS_6490 7519 8301 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206706.1 protein_id gnl|my_center|LOCUS_6490 8341 9210 gene locus_tag LOCUS_6500 8341 9210 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532039.1 protein_id gnl|my_center|LOCUS_6500 9203 9712 gene locus_tag LOCUS_6510 9203 9712 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_6510 >Feature sequence34 <1 547 gene locus_tag LOCUS_6520 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404532.1:TrmH family RNA methyltransferase 774 848 gene locus_tag LOCUS_t0130 774 848 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 851 2014 gene locus_tag LOCUS_6530 851 2014 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229043.1 protein_id gnl|my_center|LOCUS_6530 2588 4642 gene locus_tag LOCUS_6540 gene recG 2588 4642 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056582.1 protein_id gnl|my_center|LOCUS_6540 4661 5806 gene locus_tag LOCUS_6550 4661 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6550 5844 6377 gene locus_tag LOCUS_6560 5844 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6560 6623 6783 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcaacgaagaagcgaaagccagctaagcgcaagac 7486 6866 gene locus_tag LOCUS_6570 7486 6866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6570 7512 9203 gene locus_tag LOCUS_6580 7512 9203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6580 9203 9862 gene locus_tag LOCUS_6590 9203 9862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6590 10537 11340 gene locus_tag LOCUS_6600 10537 11340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6600 >Feature sequence35 1573 2808 gene locus_tag LOCUS_6610 1573 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6610 3911 2805 gene locus_tag LOCUS_6620 3911 2805 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021402.1 protein_id gnl|my_center|LOCUS_6620 3961 5568 gene locus_tag LOCUS_6630 3961 5568 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852612.1 protein_id gnl|my_center|LOCUS_6630 5627 7897 gene locus_tag LOCUS_6640 5627 7897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6640 7925 9601 gene locus_tag LOCUS_6650 7925 9601 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257185.1 protein_id gnl|my_center|LOCUS_6650 9727 10242 gene locus_tag LOCUS_6660 9727 10242 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284381.1 protein_id gnl|my_center|LOCUS_6660 11336 10245 gene locus_tag LOCUS_6670 11336 10245 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728314.1 protein_id gnl|my_center|LOCUS_6670 >Feature sequence36 <1 1237 gene locus_tag LOCUS_6680 <1 1237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004529984.1:glutamine synthetase family protein 1321 2442 gene locus_tag LOCUS_6690 gene potF 1321 2442 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126075.1 protein_id gnl|my_center|LOCUS_6690 3009 2752 gene locus_tag LOCUS_6700 3009 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6700 3368 4537 gene locus_tag LOCUS_6710 3368 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6710 4566 5108 gene locus_tag LOCUS_6720 4566 5108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6720 5214 5480 gene locus_tag LOCUS_6730 5214 5480 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_6730 5467 5694 gene locus_tag LOCUS_6740 5467 5694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_6740 6393 6677 gene locus_tag LOCUS_6750 6393 6677 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483310.1 protein_id gnl|my_center|LOCUS_6750 6735 7127 gene locus_tag LOCUS_6760 6735 7127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6760 7550 7185 gene locus_tag LOCUS_6770 7550 7185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6770 8883 7657 gene locus_tag LOCUS_6780 gene hpxK 8883 7657 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097219.1 protein_id gnl|my_center|LOCUS_6780 10127 8880 gene locus_tag LOCUS_6790 10127 8880 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419062.1 protein_id gnl|my_center|LOCUS_6790 <10891 10138 gene locus_tag LOCUS_6800 <10891 10138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389102.1:sulfite exporter TauE/SafE family protein >Feature sequence37 312 695 gene locus_tag LOCUS_6810 312 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6810 1040 819 gene locus_tag LOCUS_6820 1040 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6820 3336 1096 gene locus_tag LOCUS_6830 3336 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6830 4664 3492 gene locus_tag LOCUS_6840 4664 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6840 5788 4682 gene locus_tag LOCUS_6850 5788 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6850 6033 5949 gene locus_tag LOCUS_t0140 6033 5949 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7160 6054 gene locus_tag LOCUS_6860 7160 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6860 7320 8636 gene locus_tag LOCUS_6870 7320 8636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6870 8841 10145 gene locus_tag LOCUS_6880 8841 10145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6880 10497 10706 gene locus_tag LOCUS_6890 10497 10706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6890 >Feature sequence38 309 1328 gene locus_tag LOCUS_6900 gene rfbB 309 1328 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989656.1 protein_id gnl|my_center|LOCUS_6900 2422 1355 gene locus_tag LOCUS_6910 2422 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6910 2714 2644 gene locus_tag LOCUS_t0150 2714 2644 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2903 3916 gene locus_tag LOCUS_6920 gene trpS 2903 3916 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887203.1 protein_id gnl|my_center|LOCUS_6920 4454 5215 gene locus_tag LOCUS_6930 4454 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6930 5269 6066 gene locus_tag LOCUS_6940 5269 6066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6940 6952 6671 gene locus_tag LOCUS_6950 6952 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6950 7069 8028 gene locus_tag LOCUS_6960 7069 8028 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729429.1 protein_id gnl|my_center|LOCUS_6960 8035 8451 gene locus_tag LOCUS_6970 8035 8451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6970 <10877 8532 gene locus_tag LOCUS_6980 <10877 8532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118847.1:dockerin type I domain-containing protein >Feature sequence39 2512 2060 gene locus_tag LOCUS_6990 2512 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6990 3141 2575 gene locus_tag LOCUS_7000 3141 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7000 4006 3260 gene locus_tag LOCUS_7010 4006 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7010 4749 4171 gene locus_tag LOCUS_7020 4749 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7020 4866 4792 gene locus_tag LOCUS_t0160 4866 4792 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5375 5124 gene locus_tag LOCUS_7030 5375 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7030 6923 5490 gene locus_tag LOCUS_7040 6923 5490 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_7040 7842 7766 gene locus_tag LOCUS_t0170 7842 7766 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 9739 8438 gene locus_tag LOCUS_r0010 9739 8438 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence40 817 2217 gene locus_tag LOCUS_7050 gene dnaA 817 2217 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815138.1 protein_id gnl|my_center|LOCUS_7050 2672 3775 gene locus_tag LOCUS_7060 gene dnaN 2672 3775 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486165.1 protein_id gnl|my_center|LOCUS_7060 3803 4999 gene locus_tag LOCUS_7070 gene recF 3803 4999 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391554.1 protein_id gnl|my_center|LOCUS_7070 5020 5292 gene locus_tag LOCUS_7080 5020 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7080 8145 5314 gene locus_tag LOCUS_7090 8145 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7090 10440 9010 gene locus_tag LOCUS_7100 10440 9010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7100 >Feature sequence41 1639 1265 gene locus_tag LOCUS_7110 1639 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7110 2321 1899 gene locus_tag LOCUS_7120 gene rplL 2321 1899 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229360.1 protein_id gnl|my_center|LOCUS_7120 2868 2341 gene locus_tag LOCUS_7130 gene rplJ 2868 2341 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393947.1 protein_id gnl|my_center|LOCUS_7130 3175 3528 gene locus_tag LOCUS_7140 3175 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7140 4604 3597 gene locus_tag LOCUS_7150 gene mltG 4604 3597 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_7150 5690 4611 gene locus_tag LOCUS_7160 5690 4611 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479721.1 protein_id gnl|my_center|LOCUS_7160 5825 6166 gene locus_tag LOCUS_7170 5825 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7170 6441 7841 gene locus_tag LOCUS_7180 6441 7841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7180 7933 8115 gene locus_tag LOCUS_7190 7933 8115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907541.1 protein_id gnl|my_center|LOCUS_7190 8259 9086 gene locus_tag LOCUS_7200 8259 9086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7200 9179 9733 gene locus_tag LOCUS_7210 9179 9733 CDS product gluconokinase, GntK/IdnK-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967265.1 protein_id gnl|my_center|LOCUS_7210 <10476 9754 gene locus_tag LOCUS_7220 <10476 9754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_161270166.1:UDP-N-acetylmuramate dehydrogenase >Feature sequence42 <1 1410 gene locus_tag LOCUS_7230 <1 1410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963051.1:threonine--tRNA ligase 2039 1407 gene locus_tag LOCUS_7240 2039 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926920.1 protein_id gnl|my_center|LOCUS_7240 2732 2082 gene locus_tag LOCUS_7250 2732 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7250 2780 3709 gene locus_tag LOCUS_7260 gene miaA 2780 3709 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125946.1 protein_id gnl|my_center|LOCUS_7260 5085 3733 gene locus_tag LOCUS_7270 gene gatB 5085 3733 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880264.1 protein_id gnl|my_center|LOCUS_7270 5879 5259 gene locus_tag LOCUS_7280 5879 5259 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583757.1 protein_id gnl|my_center|LOCUS_7280 5981 6598 gene locus_tag LOCUS_7290 5981 6598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7290 6683 7258 gene locus_tag LOCUS_7300 gene dcd 6683 7258 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582476.1 protein_id gnl|my_center|LOCUS_7300 7273 7797 gene locus_tag LOCUS_7310 7273 7797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7310 7801 8127 gene locus_tag LOCUS_7320 7801 8127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7320 8311 8733 gene locus_tag LOCUS_7330 gene dut 8311 8733 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908085.1 protein_id gnl|my_center|LOCUS_7330 8853 9377 gene locus_tag LOCUS_7340 8853 9377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7340 10297 9422 gene locus_tag LOCUS_7350 10297 9422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7350 >Feature sequence43 581 2716 gene locus_tag LOCUS_7360 581 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7360 3066 3596 gene locus_tag LOCUS_7370 gene pyrE 3066 3596 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989825.1 protein_id gnl|my_center|LOCUS_7370 3925 5490 gene locus_tag LOCUS_7380 3925 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7380 6722 5691 gene locus_tag LOCUS_7390 gene pheS 6722 5691 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037597.1 protein_id gnl|my_center|LOCUS_7390 7848 7285 gene locus_tag LOCUS_7400 7848 7285 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583745.1 protein_id gnl|my_center|LOCUS_7400 8382 7933 gene locus_tag LOCUS_7410 gene purE 8382 7933 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582680.1 protein_id gnl|my_center|LOCUS_7410 8608 8531 gene locus_tag LOCUS_t0180 8608 8531 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 9227 8895 gene locus_tag LOCUS_7420 9227 8895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7420 9543 9920 gene locus_tag LOCUS_7430 9543 9920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7430 >Feature sequence44 1929 433 gene locus_tag LOCUS_7440 gene lysS 1929 433 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_7440 2484 2026 gene locus_tag LOCUS_7450 gene greA 2484 2026 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102591.1 protein_id gnl|my_center|LOCUS_7450 4480 2660 gene locus_tag LOCUS_7460 gene mrdA 4480 2660 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869951.1 protein_id gnl|my_center|LOCUS_7460 4986 4480 gene locus_tag LOCUS_7470 4986 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7470 5732 4983 gene locus_tag LOCUS_7480 5732 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7480 6831 5773 gene locus_tag LOCUS_7490 6831 5773 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_7490 8066 6828 gene locus_tag LOCUS_7500 8066 6828 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087644.1 protein_id gnl|my_center|LOCUS_7500 9225 8149 gene locus_tag LOCUS_7510 gene rseP 9225 8149 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810655.1 protein_id gnl|my_center|LOCUS_7510 >Feature sequence45 2547 3131 gene locus_tag LOCUS_7520 gene clpP 2547 3131 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003015534.1 protein_id gnl|my_center|LOCUS_7520 3220 4746 gene locus_tag LOCUS_7530 gene rny 3220 4746 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050913.1 protein_id gnl|my_center|LOCUS_7530 4910 5794 gene locus_tag LOCUS_7540 4910 5794 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_7540 >Feature sequence46 2 997 gene locus_tag LOCUS_7550 2 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7550 1572 1009 gene locus_tag LOCUS_7560 1572 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7560 2354 1569 gene locus_tag LOCUS_7570 2354 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7570 4221 2359 gene locus_tag LOCUS_7580 4221 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7580 5019 4297 gene locus_tag LOCUS_7590 5019 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7590 5580 5044 gene locus_tag LOCUS_7600 5580 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7600 6108 5584 gene locus_tag LOCUS_7610 6108 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7610 8208 6112 gene locus_tag LOCUS_7620 8208 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7620 >Feature sequence47 313 1425 gene locus_tag LOCUS_7630 313 1425 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088177.1 protein_id gnl|my_center|LOCUS_7630 1699 2913 gene locus_tag LOCUS_7640 1699 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7640 2946 3173 gene locus_tag LOCUS_7650 2946 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7650 3233 3736 gene locus_tag LOCUS_7660 3233 3736 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057899.1 protein_id gnl|my_center|LOCUS_7660 3733 3903 gene locus_tag LOCUS_7670 3733 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7670 3950 4804 gene locus_tag LOCUS_7680 3950 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7680 4814 5722 gene locus_tag LOCUS_7690 4814 5722 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901996.1 protein_id gnl|my_center|LOCUS_7690 5999 6262 gene locus_tag LOCUS_7700 5999 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7700 7217 6825 gene locus_tag LOCUS_7710 7217 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7710 7174 8094 gene locus_tag LOCUS_7720 7174 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7720 >Feature sequence48 965 579 gene locus_tag LOCUS_7730 gene rpsH 965 579 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625877.1 protein_id gnl|my_center|LOCUS_7730 1761 1183 gene locus_tag LOCUS_7740 gene rplE 1761 1183 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261078.1 protein_id gnl|my_center|LOCUS_7740 2123 1764 gene locus_tag LOCUS_7750 gene rplX 2123 1764 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_7750 2488 2117 gene locus_tag LOCUS_7760 gene rplN 2488 2117 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228844.1 protein_id gnl|my_center|LOCUS_7760 2765 2508 gene locus_tag LOCUS_7770 2765 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7770 2970 2788 gene locus_tag LOCUS_7780 2970 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7780 3384 2974 gene locus_tag LOCUS_7790 gene rplP 3384 2974 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701312.1 protein_id gnl|my_center|LOCUS_7790 4137 3388 gene locus_tag LOCUS_7800 gene rpsC 4137 3388 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701310.1 protein_id gnl|my_center|LOCUS_7800 4744 4142 gene locus_tag LOCUS_7810 4744 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7810 5052 4747 gene locus_tag LOCUS_7820 gene rpsS 5052 4747 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393933.1 protein_id gnl|my_center|LOCUS_7820 5898 5056 gene locus_tag LOCUS_7830 gene rplB 5898 5056 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393934.1 protein_id gnl|my_center|LOCUS_7830 6299 5901 gene locus_tag LOCUS_7840 6299 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7840 6994 6305 gene locus_tag LOCUS_7850 gene rplD 6994 6305 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727695.1 protein_id gnl|my_center|LOCUS_7850 7597 6998 gene locus_tag LOCUS_7860 gene rplC 7597 6998 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160207.1 protein_id gnl|my_center|LOCUS_7860 8259 7840 gene locus_tag LOCUS_7870 8259 7840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7870 <9058 8301 gene locus_tag LOCUS_7880 <9058 8301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036112.1:elongation factor Tu >Feature sequence49 707 955 gene locus_tag LOCUS_7890 707 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7890 1026 1487 gene locus_tag LOCUS_7900 1026 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7900 1494 1570 gene locus_tag LOCUS_t0190 1494 1570 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1570 2205 gene locus_tag LOCUS_7910 gene rnhB 1570 2205 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221870.1 protein_id gnl|my_center|LOCUS_7910 2440 2598 gene locus_tag LOCUS_7920 2440 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7920 2821 3024 gene locus_tag LOCUS_7930 2821 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7930 3344 3613 gene locus_tag LOCUS_7940 3344 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7940 3725 4162 gene locus_tag LOCUS_7950 gene nusB 3725 4162 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909412.1 protein_id gnl|my_center|LOCUS_7950 4258 4956 gene locus_tag LOCUS_7960 gene rnc 4258 4956 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354946.1 protein_id gnl|my_center|LOCUS_7960 4960 5436 gene locus_tag LOCUS_7970 4960 5436 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459677.1 protein_id gnl|my_center|LOCUS_7970 6392 5433 gene locus_tag LOCUS_7980 6392 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7980 7048 6398 gene locus_tag LOCUS_7990 7048 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7990 <8369 7386 gene locus_tag LOCUS_8000 <8369 7386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066188.1:glycosyltransferase family 4 protein >Feature sequence50 624 289 gene locus_tag LOCUS_8010 624 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8010 1776 778 gene locus_tag LOCUS_8020 gene rsmH 1776 778 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_8020 2217 1786 gene locus_tag LOCUS_8030 gene mraZ 2217 1786 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700457.1 protein_id gnl|my_center|LOCUS_8030 3202 2618 gene locus_tag LOCUS_8040 3202 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8040 3888 3220 gene locus_tag LOCUS_8050 3888 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8050 4565 3942 gene locus_tag LOCUS_8060 4565 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8060 4699 6927 gene locus_tag LOCUS_8070 4699 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8070 <8212 6970 gene locus_tag LOCUS_8080 <8212 6970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005167451.1:ATP-dependent chaperone ClpB >Feature sequence51 239 655 gene locus_tag LOCUS_8090 239 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8090 699 1748 gene locus_tag LOCUS_8100 699 1748 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944641.1 protein_id gnl|my_center|LOCUS_8100 1752 2957 gene locus_tag LOCUS_8110 1752 2957 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228203.1 protein_id gnl|my_center|LOCUS_8110 3125 3598 gene locus_tag LOCUS_8120 3125 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8120 3674 4123 gene locus_tag LOCUS_8130 3674 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8130 4152 4964 gene locus_tag LOCUS_8140 4152 4964 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460285.1 protein_id gnl|my_center|LOCUS_8140 4983 5582 gene locus_tag LOCUS_8150 4983 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8150 5572 6195 gene locus_tag LOCUS_8160 5572 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8160 6195 6866 gene locus_tag LOCUS_8170 6195 6866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8170 6878 7276 gene locus_tag LOCUS_8180 6878 7276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8180 >Feature sequence52 1960 1886 gene locus_tag LOCUS_t0200 1960 1886 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2171 3766 gene locus_tag LOCUS_8190 gene gpmI 2171 3766 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257028.1 protein_id gnl|my_center|LOCUS_8190 5397 3943 gene locus_tag LOCUS_8200 gene gatA 5397 3943 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257583.1 protein_id gnl|my_center|LOCUS_8200 5794 5399 gene locus_tag LOCUS_8210 5794 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8210 6241 5828 gene locus_tag LOCUS_8220 6241 5828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8220 6604 6290 gene locus_tag LOCUS_8230 6604 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8230 <7659 6729 gene locus_tag LOCUS_8240 <7659 6729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869864.1:NAD-dependent DNA ligase LigA >Feature sequence53 211 137 gene locus_tag LOCUS_t0210 211 137 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 291 362 gene locus_tag LOCUS_t0220 291 362 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1297 404 gene locus_tag LOCUS_8250 1297 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8250 2185 1331 gene locus_tag LOCUS_8260 2185 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8260 3748 2204 gene locus_tag LOCUS_8270 3748 2204 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_8270 4003 5814 gene locus_tag LOCUS_8280 4003 5814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8280 5846 6526 gene locus_tag LOCUS_8290 5846 6526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8290 >Feature sequence54 4418 5233 gene locus_tag LOCUS_8300 4418 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8300 5456 5385 gene locus_tag LOCUS_t0230 5456 5385 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6119 5442 gene locus_tag LOCUS_8310 6119 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8310 6306 6151 gene locus_tag LOCUS_8320 6306 6151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8320 6538 6467 gene locus_tag LOCUS_t0240 6538 6467 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6827 6549 gene locus_tag LOCUS_8330 6827 6549 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939083.1 protein_id gnl|my_center|LOCUS_8330 >Feature sequence55 <1 1086 gene locus_tag LOCUS_8340 <1 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188265.1:carbamoyltransferase C-terminal domain-containing protein 1077 2753 gene locus_tag LOCUS_8350 1077 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8350 2805 3686 gene locus_tag LOCUS_8360 2805 3686 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259119.1 protein_id gnl|my_center|LOCUS_8360 4156 4812 gene locus_tag LOCUS_8370 4156 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8370 4835 5947 gene locus_tag LOCUS_8380 4835 5947 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879112.1 protein_id gnl|my_center|LOCUS_8380 >Feature sequence56 3 356 gene locus_tag LOCUS_8390 3 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8390 1120 353 gene locus_tag LOCUS_8400 1120 353 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879273.1 protein_id gnl|my_center|LOCUS_8400 1331 2239 gene locus_tag LOCUS_8410 1331 2239 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258568.1 protein_id gnl|my_center|LOCUS_8410 2242 3669 gene locus_tag LOCUS_8420 2242 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8420 4439 4194 gene locus_tag LOCUS_8430 4439 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8430 4872 4540 gene locus_tag LOCUS_8440 4872 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8440 5953 4937 gene locus_tag LOCUS_8450 5953 4937 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258203.1 protein_id gnl|my_center|LOCUS_8450 >Feature sequence57 1412 486 gene locus_tag LOCUS_8460 1412 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8460 1761 1522 gene locus_tag LOCUS_8470 1761 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8470 2253 1867 gene locus_tag LOCUS_8480 2253 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8480 4435 2321 gene locus_tag LOCUS_8490 gene fusA 4435 2321 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966416.1 protein_id gnl|my_center|LOCUS_8490 4950 4477 gene locus_tag LOCUS_8500 gene rpsG 4950 4477 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198359.1 protein_id gnl|my_center|LOCUS_8500 5374 4955 gene locus_tag LOCUS_8510 gene rpsL 5374 4955 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258226.1 protein_id gnl|my_center|LOCUS_8510 6119 5466 gene locus_tag LOCUS_8520 6119 5466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8520 6240 6431 gene locus_tag LOCUS_8530 6240 6431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8530 >Feature sequence58 357 995 gene locus_tag LOCUS_8540 357 995 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349742.1 protein_id gnl|my_center|LOCUS_8540 1869 1153 gene locus_tag LOCUS_8550 1869 1153 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_8550 2648 1869 gene locus_tag LOCUS_8560 2648 1869 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720081.1 protein_id gnl|my_center|LOCUS_8560 3079 2651 gene locus_tag LOCUS_8570 3079 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8570 >Feature sequence59 5953 2960 gene locus_tag LOCUS_8580 5953 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8580