>Feature sequence01 1945 431 gene locus_tag LOCUS_0010 1945 431 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065602.1 protein_id gnl|my_center|LOCUS_0010 2067 2870 gene locus_tag LOCUS_0020 2067 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0020 4497 2872 gene locus_tag LOCUS_0030 4497 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0030 4589 5560 gene locus_tag LOCUS_0040 4589 5560 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222497.1 protein_id gnl|my_center|LOCUS_0040 6691 5528 gene locus_tag LOCUS_0050 6691 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0050 8211 6688 gene locus_tag LOCUS_0060 8211 6688 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021083.1 protein_id gnl|my_center|LOCUS_0060 8321 9091 gene locus_tag LOCUS_0070 8321 9091 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103245.1 protein_id gnl|my_center|LOCUS_0070 9116 9760 gene locus_tag LOCUS_0080 9116 9760 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266514.1 protein_id gnl|my_center|LOCUS_0080 10040 9720 gene locus_tag LOCUS_0090 10040 9720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044391358.1 protein_id gnl|my_center|LOCUS_0090 10919 10053 gene locus_tag LOCUS_0100 10919 10053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0100 10993 12081 gene locus_tag LOCUS_0110 10993 12081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0110 13897 12068 gene locus_tag LOCUS_0120 13897 12068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0120 13989 14708 gene locus_tag LOCUS_0130 13989 14708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0130 15471 14689 gene locus_tag LOCUS_0140 15471 14689 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932133.1 protein_id gnl|my_center|LOCUS_0140 15956 15525 gene locus_tag LOCUS_0150 15956 15525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0150 16502 16278 gene locus_tag LOCUS_0160 16502 16278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0160 17367 16576 gene locus_tag LOCUS_0170 17367 16576 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022168.1 protein_id gnl|my_center|LOCUS_0170 18362 17367 gene locus_tag LOCUS_0180 gene rfbB 18362 17367 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023679.1 protein_id gnl|my_center|LOCUS_0180 18853 18416 gene locus_tag LOCUS_0190 18853 18416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0190 20391 18889 gene locus_tag LOCUS_0200 20391 18889 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876482.1 protein_id gnl|my_center|LOCUS_0200 21425 20391 gene locus_tag LOCUS_0210 21425 20391 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870766.1 protein_id gnl|my_center|LOCUS_0210 21822 21463 gene locus_tag LOCUS_0220 21822 21463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0220 21944 21874 gene locus_tag LOCUS_t0010 21944 21874 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 22068 21993 gene locus_tag LOCUS_t0020 22068 21993 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 22582 22109 gene locus_tag LOCUS_0230 22582 22109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0230 22706 22621 gene locus_tag LOCUS_t0030 22706 22621 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 22761 22831 gene locus_tag LOCUS_r0010 22761 22831 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 59 percent of the 5S ribosomal RNA 23303 22968 gene locus_tag LOCUS_0240 23303 22968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0240 23713 23504 gene locus_tag LOCUS_0250 23713 23504 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250450.1 protein_id gnl|my_center|LOCUS_0250 23987 23736 gene locus_tag LOCUS_0260 23987 23736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0260 24066 24752 gene locus_tag LOCUS_0270 24066 24752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0270 24753 25970 gene locus_tag LOCUS_0280 24753 25970 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496851.1 protein_id gnl|my_center|LOCUS_0280 25972 27177 gene locus_tag LOCUS_0290 25972 27177 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022516.1 protein_id gnl|my_center|LOCUS_0290 28128 27304 gene locus_tag LOCUS_0300 28128 27304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0300 29221 28211 gene locus_tag LOCUS_0310 29221 28211 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880437.1 protein_id gnl|my_center|LOCUS_0310 30165 29218 gene locus_tag LOCUS_0320 30165 29218 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876043.1 protein_id gnl|my_center|LOCUS_0320 31313 30162 gene locus_tag LOCUS_0330 31313 30162 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496567.1 protein_id gnl|my_center|LOCUS_0330 32313 31315 gene locus_tag LOCUS_0340 gene gap 32313 31315 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942274.1 protein_id gnl|my_center|LOCUS_0340 32967 32371 gene locus_tag LOCUS_0350 32967 32371 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061267.1 protein_id gnl|my_center|LOCUS_0350 33560 32970 gene locus_tag LOCUS_0360 33560 32970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0360 34393 33656 gene locus_tag LOCUS_0370 34393 33656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0370 34956 34396 gene locus_tag LOCUS_0380 34956 34396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0380 35226 35002 gene locus_tag LOCUS_0390 35226 35002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0390 35298 35729 gene locus_tag LOCUS_0400 35298 35729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0400 35768 36034 gene locus_tag LOCUS_0410 35768 36034 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879026.1 protein_id gnl|my_center|LOCUS_0410 36031 36339 gene locus_tag LOCUS_0420 36031 36339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0420 36342 36881 gene locus_tag LOCUS_0430 36342 36881 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249851.1 protein_id gnl|my_center|LOCUS_0430 36890 37408 gene locus_tag LOCUS_0440 36890 37408 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875675.1 protein_id gnl|my_center|LOCUS_0440 37405 38004 gene locus_tag LOCUS_0450 37405 38004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0450 38004 38510 gene locus_tag LOCUS_0460 38004 38510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0460 38555 39250 gene locus_tag LOCUS_0470 38555 39250 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875678.1 protein_id gnl|my_center|LOCUS_0470 39286 39369 gene locus_tag LOCUS_t0040 39286 39369 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 39680 39408 gene locus_tag LOCUS_0480 39680 39408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0480 39760 40143 gene locus_tag LOCUS_0490 39760 40143 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869688.1 protein_id gnl|my_center|LOCUS_0490 40145 40642 gene locus_tag LOCUS_0500 gene rplM 40145 40642 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878624.1 protein_id gnl|my_center|LOCUS_0500 40645 41076 gene locus_tag LOCUS_0510 40645 41076 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064334.1 protein_id gnl|my_center|LOCUS_0510 41901 41077 gene locus_tag LOCUS_0520 gene xerA 41901 41077 CDS product tyrosine recombinase XerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867504.1 protein_id gnl|my_center|LOCUS_0520 42018 42275 gene locus_tag LOCUS_0530 42018 42275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0530 43073 42378 gene locus_tag LOCUS_0540 43073 42378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0540 43335 43177 gene locus_tag LOCUS_0550 43335 43177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0550 43449 44495 gene locus_tag LOCUS_0560 43449 44495 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706804.1 protein_id gnl|my_center|LOCUS_0560 44822 44496 gene locus_tag LOCUS_0570 44822 44496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0570 47685 45067 gene locus_tag LOCUS_0580 47685 45067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0580 47987 47685 gene locus_tag LOCUS_0590 47987 47685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0590 49038 48022 gene locus_tag LOCUS_0600 49038 48022 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_0600 49144 49512 gene locus_tag LOCUS_0610 49144 49512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0610 50210 49509 gene locus_tag LOCUS_0620 50210 49509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0620 50393 50839 gene locus_tag LOCUS_0630 50393 50839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0630 51676 50870 gene locus_tag LOCUS_0640 51676 50870 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147802.1 protein_id gnl|my_center|LOCUS_0640 52139 51684 gene locus_tag LOCUS_0650 52139 51684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0650 52977 52219 gene locus_tag LOCUS_0660 52977 52219 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875872.1 protein_id gnl|my_center|LOCUS_0660 53976 53023 gene locus_tag LOCUS_0670 gene trmBL2 53976 53023 CDS product HTH-type transcriptional regulator TrmBL2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146940.1 protein_id gnl|my_center|LOCUS_0670 56758 53930 gene locus_tag LOCUS_0680 gene ileS 56758 53930 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868042.1 protein_id gnl|my_center|LOCUS_0680 57058 56783 gene locus_tag LOCUS_0690 57058 56783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0690 57129 57353 gene locus_tag LOCUS_0700 57129 57353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0700 57626 57354 gene locus_tag LOCUS_0710 57626 57354 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229777.1 protein_id gnl|my_center|LOCUS_0710 58491 57670 gene locus_tag LOCUS_0720 58491 57670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0720 58633 58551 gene locus_tag LOCUS_t0050 58633 58551 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 58902 58663 gene locus_tag LOCUS_0730 58902 58663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0730 58995 58919 gene locus_tag LOCUS_t0060 58995 58919 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 59048 59734 gene locus_tag LOCUS_0740 gene rnhB 59048 59734 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869628.1 protein_id gnl|my_center|LOCUS_0740 60139 59735 gene locus_tag LOCUS_0750 60139 59735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0750 60602 60174 gene locus_tag LOCUS_0760 60602 60174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0760 61087 60623 gene locus_tag LOCUS_0770 61087 60623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0770 63976 61133 gene locus_tag LOCUS_0780 63976 61133 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281021.1 protein_id gnl|my_center|LOCUS_0780 65381 64116 gene locus_tag LOCUS_0790 65381 64116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0790 65525 65875 gene locus_tag LOCUS_0800 65525 65875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0800 66297 65872 gene locus_tag LOCUS_0810 66297 65872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0810 67555 66386 gene locus_tag LOCUS_0820 gene dnaG 67555 66386 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879392.1 protein_id gnl|my_center|LOCUS_0820 68099 67740 gene locus_tag LOCUS_0830 68099 67740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0830 68919 68365 gene locus_tag LOCUS_0840 68919 68365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0840 69348 68971 gene locus_tag LOCUS_0850 69348 68971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0850 70673 69390 gene locus_tag LOCUS_0860 gene tuf 70673 69390 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869821.1 protein_id gnl|my_center|LOCUS_0860 71100 70861 gene locus_tag LOCUS_0870 71100 70861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0870 73423 71246 gene locus_tag LOCUS_0880 73423 71246 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249264.1 protein_id gnl|my_center|LOCUS_0880 74161 73796 gene locus_tag LOCUS_0890 74161 73796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0890 74853 74212 gene locus_tag LOCUS_0900 gene rpsG 74853 74212 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867744.1 protein_id gnl|my_center|LOCUS_0900 75136 74855 gene locus_tag LOCUS_0910 75136 74855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0910 75534 75133 gene locus_tag LOCUS_0920 75534 75133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0920 >Feature sequence02 <1 1996 gene locus_tag LOCUS_0930 <1 1996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942715.1:putative Ig domain-containing protein 2149 6732 gene locus_tag LOCUS_0940 2149 6732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0940 6796 7344 gene locus_tag LOCUS_0950 6796 7344 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877880.1 protein_id gnl|my_center|LOCUS_0950 7824 7348 gene locus_tag LOCUS_0960 7824 7348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0960 8835 7987 gene locus_tag LOCUS_0970 8835 7987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0970 9450 9247 gene locus_tag LOCUS_0980 9450 9247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0980 9562 10668 gene locus_tag LOCUS_0990 9562 10668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0990 10665 11114 gene locus_tag LOCUS_1000 10665 11114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1000 11176 11814 gene locus_tag LOCUS_1010 11176 11814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1010 11823 12569 gene locus_tag LOCUS_1020 11823 12569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1020 12624 13700 gene locus_tag LOCUS_1030 12624 13700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1030 13763 14791 gene locus_tag LOCUS_1040 13763 14791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1040 14816 16084 gene locus_tag LOCUS_1050 14816 16084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1050 16132 17517 gene locus_tag LOCUS_1060 gene gatB 16132 17517 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496410.1 protein_id gnl|my_center|LOCUS_1060 18635 17514 gene locus_tag LOCUS_1070 18635 17514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1070 18737 18810 gene locus_tag LOCUS_t0070 18737 18810 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 18841 20277 gene locus_tag LOCUS_1080 gene proS 18841 20277 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583195.1 protein_id gnl|my_center|LOCUS_1080 20279 21568 gene locus_tag LOCUS_1090 gene gatD 20279 21568 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249859.1 protein_id gnl|my_center|LOCUS_1090 22012 21569 gene locus_tag LOCUS_1100 22012 21569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1100 22522 23427 gene locus_tag LOCUS_1110 22522 23427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1110 23468 24922 gene locus_tag LOCUS_1120 23468 24922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1120 24924 25304 gene locus_tag LOCUS_1130 24924 25304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1130 25343 26656 gene locus_tag LOCUS_1140 gene aspS 25343 26656 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878420.1 protein_id gnl|my_center|LOCUS_1140 26718 27113 gene locus_tag LOCUS_1150 26718 27113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1150 27272 28072 gene locus_tag LOCUS_1160 27272 28072 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021463.1 protein_id gnl|my_center|LOCUS_1160 28177 28416 gene locus_tag LOCUS_1170 28177 28416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1170 28431 28697 gene locus_tag LOCUS_1180 28431 28697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1180 28775 29533 gene locus_tag LOCUS_1190 28775 29533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1190 29599 30186 gene locus_tag LOCUS_1200 29599 30186 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272666.1 protein_id gnl|my_center|LOCUS_1200 30236 31567 gene locus_tag LOCUS_1210 gene gatA 30236 31567 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061065.1 protein_id gnl|my_center|LOCUS_1210 31598 32272 gene locus_tag LOCUS_1220 31598 32272 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545344.1 protein_id gnl|my_center|LOCUS_1220 32307 33155 gene locus_tag LOCUS_1230 32307 33155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1230 33145 34254 gene locus_tag LOCUS_1240 33145 34254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1240 34364 35383 gene locus_tag LOCUS_1250 34364 35383 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496932.1 protein_id gnl|my_center|LOCUS_1250 35486 36565 gene locus_tag LOCUS_1260 gene ftsZ 35486 36565 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496560.1 protein_id gnl|my_center|LOCUS_1260 37183 36605 gene locus_tag LOCUS_1270 37183 36605 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877737.1 protein_id gnl|my_center|LOCUS_1270 38324 37218 gene locus_tag LOCUS_1280 gene mnmA 38324 37218 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398509.1 protein_id gnl|my_center|LOCUS_1280 38384 38593 gene locus_tag LOCUS_1290 38384 38593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1290 38669 38597 gene locus_tag LOCUS_t0080 38669 38597 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 38932 39153 gene locus_tag LOCUS_1300 38932 39153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1300 39646 39146 gene locus_tag LOCUS_1310 39646 39146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1310 39767 40021 gene locus_tag LOCUS_1320 39767 40021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1320 40314 40018 gene locus_tag LOCUS_1330 40314 40018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1330 40354 40734 gene locus_tag LOCUS_1340 40354 40734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1340 41141 40731 gene locus_tag LOCUS_1350 41141 40731 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877371.1 protein_id gnl|my_center|LOCUS_1350 41193 41801 gene locus_tag LOCUS_1360 41193 41801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1360 42488 41802 gene locus_tag LOCUS_1370 42488 41802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1370 44544 42535 gene locus_tag LOCUS_1380 44544 42535 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877372.1 protein_id gnl|my_center|LOCUS_1380 44664 44822 gene locus_tag LOCUS_1390 44664 44822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1390 44816 44998 gene locus_tag LOCUS_1400 44816 44998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1400 46114 44999 gene locus_tag LOCUS_1410 gene prf1 46114 44999 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146580.1 protein_id gnl|my_center|LOCUS_1410 48521 46167 gene locus_tag LOCUS_1420 gene valS 48521 46167 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879713.1 protein_id gnl|my_center|LOCUS_1420 48572 49186 gene locus_tag LOCUS_1430 48572 49186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1430 49223 49459 gene locus_tag LOCUS_1440 49223 49459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1440 49489 49860 gene locus_tag LOCUS_1450 49489 49860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1450 49977 50312 gene locus_tag LOCUS_1460 49977 50312 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064993.1 protein_id gnl|my_center|LOCUS_1460 50347 50832 gene locus_tag LOCUS_1470 50347 50832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1470 50891 51316 gene locus_tag LOCUS_1480 50891 51316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1480 51357 52112 gene locus_tag LOCUS_1490 gene minD 51357 52112 CDS product cell division ATPase MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867687.1 protein_id gnl|my_center|LOCUS_1490 53553 52126 gene locus_tag LOCUS_1500 gene metG 53553 52126 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930950.1 protein_id gnl|my_center|LOCUS_1500 53629 54213 gene locus_tag LOCUS_1510 53629 54213 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870497.1 protein_id gnl|my_center|LOCUS_1510 54215 54448 gene locus_tag LOCUS_1520 54215 54448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1520 56727 54445 gene locus_tag LOCUS_1530 gene topA 56727 54445 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868544.1 protein_id gnl|my_center|LOCUS_1530 56930 57295 gene locus_tag LOCUS_1540 56930 57295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1540 57370 57585 gene locus_tag LOCUS_1550 57370 57585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1550 58178 57582 gene locus_tag LOCUS_1560 58178 57582 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877484.1 protein_id gnl|my_center|LOCUS_1560 58229 58768 gene locus_tag LOCUS_1570 58229 58768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1570 58946 59167 gene locus_tag LOCUS_1580 58946 59167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1580 59227 59303 gene locus_tag LOCUS_t0090 59227 59303 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 59703 59431 gene locus_tag LOCUS_1590 59703 59431 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870659.1 protein_id gnl|my_center|LOCUS_1590 60166 59771 gene locus_tag LOCUS_1600 60166 59771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1600 60802 60731 gene locus_tag LOCUS_t0100 60802 60731 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 61253 61328 gene locus_tag LOCUS_t0110 61253 61328 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 61382 61741 gene locus_tag LOCUS_1610 61382 61741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1610 62447 61743 gene locus_tag LOCUS_1620 62447 61743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1620 63928 62525 gene locus_tag LOCUS_1630 63928 62525 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070728.1 protein_id gnl|my_center|LOCUS_1630 65335 64034 gene locus_tag LOCUS_1640 65335 64034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1640 65443 65817 gene locus_tag LOCUS_1650 65443 65817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1650 65881 68175 gene locus_tag LOCUS_1660 65881 68175 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061106.1 protein_id gnl|my_center|LOCUS_1660 >Feature sequence03 376 2232 gene locus_tag LOCUS_1670 376 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1670 2297 2656 gene locus_tag LOCUS_1680 2297 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1680 2735 3565 gene locus_tag LOCUS_1690 2735 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1690 3562 5181 gene locus_tag LOCUS_1700 3562 5181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1700 5236 6399 gene locus_tag LOCUS_1710 5236 6399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1710 6401 8404 gene locus_tag LOCUS_1720 6401 8404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1720 8889 8401 gene locus_tag LOCUS_1730 8889 8401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1730 9784 8876 gene locus_tag LOCUS_1740 9784 8876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1740 9835 10134 gene locus_tag LOCUS_1750 9835 10134 CDS product 50S ribosomal protein L35ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867507.1 protein_id gnl|my_center|LOCUS_1750 10135 10674 gene locus_tag LOCUS_1760 gene rplJ 10135 10674 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870047.1 protein_id gnl|my_center|LOCUS_1760 10676 11164 gene locus_tag LOCUS_1770 10676 11164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1770 11199 14129 gene locus_tag LOCUS_1780 gene ppsA 11199 14129 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878213.1 protein_id gnl|my_center|LOCUS_1780 14197 15012 gene locus_tag LOCUS_1790 14197 15012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1790 15860 15009 gene locus_tag LOCUS_1800 15860 15009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1800 17871 15988 gene locus_tag LOCUS_1810 17871 15988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1810 18503 17910 gene locus_tag LOCUS_1820 18503 17910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1820 20197 18533 gene locus_tag LOCUS_1830 20197 18533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1830 20343 20612 gene locus_tag LOCUS_1840 20343 20612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1840 20949 20791 gene locus_tag LOCUS_1850 20949 20791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1850 21055 22866 gene locus_tag LOCUS_1860 21055 22866 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969054.1 protein_id gnl|my_center|LOCUS_1860 22863 23462 gene locus_tag LOCUS_1870 22863 23462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1870 23459 24646 gene locus_tag LOCUS_1880 gene tetA(P) 23459 24646 CDS product tetracycline efflux MFS transporter TetA(P) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964756.1 protein_id gnl|my_center|LOCUS_1880 24689 25540 gene locus_tag LOCUS_1890 24689 25540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1890 26112 25537 gene locus_tag LOCUS_1900 26112 25537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1900 27256 26225 gene locus_tag LOCUS_1910 27256 26225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1910 27381 27827 gene locus_tag LOCUS_1920 27381 27827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1920 27865 29568 gene locus_tag LOCUS_1930 gene gltX 27865 29568 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875691.1 protein_id gnl|my_center|LOCUS_1930 29754 30140 gene locus_tag LOCUS_1940 29754 30140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1940 30137 30460 gene locus_tag LOCUS_1950 30137 30460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1950 32421 30457 gene locus_tag LOCUS_1960 32421 30457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1960 32496 33008 gene locus_tag LOCUS_1970 32496 33008 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551114.1 protein_id gnl|my_center|LOCUS_1970 33045 34109 gene locus_tag LOCUS_1980 33045 34109 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496822.1 protein_id gnl|my_center|LOCUS_1980 34846 34106 gene locus_tag LOCUS_1990 34846 34106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1990 34987 35541 gene locus_tag LOCUS_2000 34987 35541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2000 35578 37314 gene locus_tag LOCUS_2010 35578 37314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2010 37596 37315 gene locus_tag LOCUS_2020 37596 37315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2020 37709 38353 gene locus_tag LOCUS_2030 37709 38353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2030 38899 38354 gene locus_tag LOCUS_2040 38899 38354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2040 39413 38946 gene locus_tag LOCUS_2050 39413 38946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2050 39555 39881 gene locus_tag LOCUS_2060 gene msrB 39555 39881 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066093.1 protein_id gnl|my_center|LOCUS_2060 40065 39868 gene locus_tag LOCUS_2070 40065 39868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2070 40350 40081 gene locus_tag LOCUS_2080 40350 40081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2080 40627 41013 gene locus_tag LOCUS_2090 40627 41013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2090 41457 41212 gene locus_tag LOCUS_2100 41457 41212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2100 41523 41711 gene locus_tag LOCUS_2110 41523 41711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2110 41912 42352 gene locus_tag LOCUS_2120 gene nrdR 41912 42352 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203687.1 protein_id gnl|my_center|LOCUS_2120 42356 45265 gene locus_tag LOCUS_2130 42356 45265 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123898.1 protein_id gnl|my_center|LOCUS_2130 45729 45235 gene locus_tag LOCUS_2140 45729 45235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2140 45905 45726 gene locus_tag LOCUS_2150 45905 45726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2150 46594 45983 gene locus_tag LOCUS_2160 46594 45983 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545748.1 protein_id gnl|my_center|LOCUS_2160 46679 47005 gene locus_tag LOCUS_2170 gene trxA 46679 47005 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166282.1 protein_id gnl|my_center|LOCUS_2170 47052 47564 gene locus_tag LOCUS_2180 gene pyrE 47052 47564 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862850.1 protein_id gnl|my_center|LOCUS_2180 47891 48097 gene locus_tag LOCUS_2190 47891 48097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2190 48101 51361 gene locus_tag LOCUS_2200 48101 51361 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250034.1 protein_id gnl|my_center|LOCUS_2200 51365 54805 gene locus_tag LOCUS_2210 51365 54805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2210 54883 55299 gene locus_tag LOCUS_2220 54883 55299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2220 55354 55845 gene locus_tag LOCUS_2230 55354 55845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2230 55913 56335 gene locus_tag LOCUS_2240 55913 56335 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064744.1 protein_id gnl|my_center|LOCUS_2240 56332 56733 gene locus_tag LOCUS_2250 56332 56733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2250 56730 57011 gene locus_tag LOCUS_2260 56730 57011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2260 57013 57654 gene locus_tag LOCUS_2270 gene rpsG 57013 57654 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867744.1 protein_id gnl|my_center|LOCUS_2270 57705 58070 gene locus_tag LOCUS_2280 57705 58070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2280 58443 60620 gene locus_tag LOCUS_2290 58443 60620 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249264.1 protein_id gnl|my_center|LOCUS_2290 60766 61005 gene locus_tag LOCUS_2300 60766 61005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2300 >Feature sequence04 1097 105 gene locus_tag LOCUS_2310 1097 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2310 2125 1133 gene locus_tag LOCUS_2320 2125 1133 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251076.1 protein_id gnl|my_center|LOCUS_2320 2410 2156 gene locus_tag LOCUS_2330 2410 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2330 2720 2577 gene locus_tag LOCUS_2340 2720 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2340 3120 2782 gene locus_tag LOCUS_2350 3120 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2350 3154 3543 gene locus_tag LOCUS_2360 3154 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2360 3958 3548 gene locus_tag LOCUS_2370 3958 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2370 5093 3987 gene locus_tag LOCUS_2380 5093 3987 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249461.1 protein_id gnl|my_center|LOCUS_2380 5736 5497 gene locus_tag LOCUS_2390 5736 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2390 6864 5923 gene locus_tag LOCUS_2400 6864 5923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2400 6974 7048 gene locus_tag LOCUS_t0120 6974 7048 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7760 7050 gene locus_tag LOCUS_2410 7760 7050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2410 7857 7928 gene locus_tag LOCUS_t0130 7857 7928 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 8023 9249 gene locus_tag LOCUS_2420 gene hisS 8023 9249 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425978.1 protein_id gnl|my_center|LOCUS_2420 9253 9504 gene locus_tag LOCUS_2430 9253 9504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2430 10434 9490 gene locus_tag LOCUS_2440 10434 9490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2440 10816 11781 gene locus_tag LOCUS_2450 10816 11781 CDS product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251073.1 protein_id gnl|my_center|LOCUS_2450 11867 12163 gene locus_tag LOCUS_2460 11867 12163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2460 12209 12478 gene locus_tag LOCUS_2470 12209 12478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2470 12735 12481 gene locus_tag LOCUS_2480 12735 12481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2480 13129 12737 gene locus_tag LOCUS_2490 13129 12737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2490 13319 13131 gene locus_tag LOCUS_2500 13319 13131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2500 13930 13316 gene locus_tag LOCUS_2510 gene rpoE 13930 13316 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875903.1 protein_id gnl|my_center|LOCUS_2510 14426 13992 gene locus_tag LOCUS_2520 14426 13992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2520 17500 14474 gene locus_tag LOCUS_2530 17500 14474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2530 18743 17535 gene locus_tag LOCUS_2540 18743 17535 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867591.1 protein_id gnl|my_center|LOCUS_2540 19190 18795 gene locus_tag LOCUS_2550 19190 18795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2550 19601 19293 gene locus_tag LOCUS_2560 19601 19293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2560 20202 19675 gene locus_tag LOCUS_2570 20202 19675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2570 21220 20507 gene locus_tag LOCUS_2580 21220 20507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2580 21440 21856 gene locus_tag LOCUS_2590 21440 21856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2590 21853 22602 gene locus_tag LOCUS_2600 21853 22602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2600 23785 22961 gene locus_tag LOCUS_2610 23785 22961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2610 25548 23818 gene locus_tag LOCUS_2620 gene infB 25548 23818 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878271.1 protein_id gnl|my_center|LOCUS_2620 25642 26025 gene locus_tag LOCUS_2630 25642 26025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2630 26367 26026 gene locus_tag LOCUS_2640 26367 26026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2640 26564 27388 gene locus_tag LOCUS_2650 gene dusB 26564 27388 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166279.1 protein_id gnl|my_center|LOCUS_2650 27826 27371 gene locus_tag LOCUS_2660 27826 27371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2660 27916 29310 gene locus_tag LOCUS_2670 gene cysS 27916 29310 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_2670 29705 29262 gene locus_tag LOCUS_2680 29705 29262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2680 30080 29763 gene locus_tag LOCUS_2690 30080 29763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2690 30206 30122 gene locus_tag LOCUS_t0140 30206 30122 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 30731 30300 gene locus_tag LOCUS_2700 gene dut 30731 30300 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694145.1 protein_id gnl|my_center|LOCUS_2700 30867 31898 gene locus_tag LOCUS_2710 gene thyA 30867 31898 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679592.1 protein_id gnl|my_center|LOCUS_2710 32328 31891 gene locus_tag LOCUS_2720 32328 31891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2720 32636 32328 gene locus_tag LOCUS_2730 gene rpsJ 32636 32328 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249262.1 protein_id gnl|my_center|LOCUS_2730 32684 32899 gene locus_tag LOCUS_2740 32684 32899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2740 32899 34590 gene locus_tag LOCUS_2750 32899 34590 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085400.1 protein_id gnl|my_center|LOCUS_2750 35236 34595 gene locus_tag LOCUS_2760 35236 34595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2760 35287 36600 gene locus_tag LOCUS_2770 gene serS 35287 36600 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_2770 37036 36665 gene locus_tag LOCUS_2780 37036 36665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2780 37130 37696 gene locus_tag LOCUS_2790 37130 37696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2790 37697 38371 gene locus_tag LOCUS_2800 37697 38371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2800 38419 39078 gene locus_tag LOCUS_2810 38419 39078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2810 39638 39162 gene locus_tag LOCUS_2820 39638 39162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2820 39770 40192 gene locus_tag LOCUS_2830 39770 40192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2830 40195 40743 gene locus_tag LOCUS_2840 40195 40743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2840 47282 40764 gene locus_tag LOCUS_2850 47282 40764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2850 47548 47363 gene locus_tag LOCUS_2860 47548 47363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2860 47620 48819 gene locus_tag LOCUS_2870 47620 48819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2870 48854 49417 gene locus_tag LOCUS_2880 48854 49417 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016533.1 protein_id gnl|my_center|LOCUS_2880 49460 49675 gene locus_tag LOCUS_2890 49460 49675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2890 49672 49938 gene locus_tag LOCUS_2900 49672 49938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226987603.1 protein_id gnl|my_center|LOCUS_2900 50412 49939 gene locus_tag LOCUS_2910 50412 49939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2910 50527 51219 gene locus_tag LOCUS_2920 gene pyrH 50527 51219 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879534.1 protein_id gnl|my_center|LOCUS_2920 51221 51607 gene locus_tag LOCUS_2930 51221 51607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2930 51630 53159 gene locus_tag LOCUS_2940 51630 53159 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876381.1 protein_id gnl|my_center|LOCUS_2940 53161 54798 gene locus_tag LOCUS_2950 gene pheT 53161 54798 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868500.1 protein_id gnl|my_center|LOCUS_2950 55192 54782 gene locus_tag LOCUS_2960 55192 54782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2960 55703 55233 gene locus_tag LOCUS_2970 55703 55233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2970 56240 55743 gene locus_tag LOCUS_2980 56240 55743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2980 56759 56505 gene locus_tag LOCUS_2990 56759 56505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2990 57052 56765 gene locus_tag LOCUS_3000 57052 56765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3000 57614 57688 gene locus_tag LOCUS_t0150 57614 57688 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 57799 58071 gene locus_tag LOCUS_3010 57799 58071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3010 58351 58515 gene locus_tag LOCUS_3020 58351 58515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3020 59268 58516 gene locus_tag LOCUS_3030 59268 58516 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023329.1 protein_id gnl|my_center|LOCUS_3030 59533 59300 gene locus_tag LOCUS_3040 59533 59300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3040 59843 59571 gene locus_tag LOCUS_3050 59843 59571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3050 >Feature sequence05 235 564 gene locus_tag LOCUS_3060 gene rpl7ae 235 564 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021535.1 protein_id gnl|my_center|LOCUS_3060 606 905 gene locus_tag LOCUS_3070 606 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3070 907 1200 gene locus_tag LOCUS_3080 907 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3080 1193 1456 gene locus_tag LOCUS_3090 1193 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3090 1764 1459 gene locus_tag LOCUS_3100 1764 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3100 2025 1771 gene locus_tag LOCUS_3110 2025 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3110 2367 2498 gene locus_tag LOCUS_3120 2367 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3120 2540 2779 gene locus_tag LOCUS_3130 2540 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3130 3061 4170 gene locus_tag LOCUS_3140 3061 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3140 4475 5590 gene locus_tag LOCUS_3150 4475 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3150 5720 6169 gene locus_tag LOCUS_3160 5720 6169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3160 6306 6866 gene locus_tag LOCUS_3170 6306 6866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3170 6863 8008 gene locus_tag LOCUS_3180 6863 8008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3180 7977 8750 gene locus_tag LOCUS_3190 7977 8750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3190 8744 12442 gene locus_tag LOCUS_3200 8744 12442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3200 12444 12944 gene locus_tag LOCUS_3210 12444 12944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3210 12991 13395 gene locus_tag LOCUS_3220 12991 13395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3220 13559 15460 gene locus_tag LOCUS_3230 gene gyrB 13559 15460 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815132.1 protein_id gnl|my_center|LOCUS_3230 15462 15923 gene locus_tag LOCUS_3240 15462 15923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3240 15925 18477 gene locus_tag LOCUS_3250 gene gyrA 15925 18477 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021593.1 protein_id gnl|my_center|LOCUS_3250 18851 18474 gene locus_tag LOCUS_3260 18851 18474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3260 19162 18857 gene locus_tag LOCUS_3270 19162 18857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3270 19668 19171 gene locus_tag LOCUS_3280 19668 19171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3280 20422 19817 gene locus_tag LOCUS_3290 20422 19817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3290 20606 20677 gene locus_tag LOCUS_t0160 20606 20677 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 20741 21301 gene locus_tag LOCUS_3300 20741 21301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3300 22229 21411 gene locus_tag LOCUS_3310 22229 21411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3310 22296 23732 gene locus_tag LOCUS_3320 22296 23732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3320 23782 24621 gene locus_tag LOCUS_3330 23782 24621 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023329.1 protein_id gnl|my_center|LOCUS_3330 25053 24664 gene locus_tag LOCUS_3340 25053 24664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3340 25370 25588 gene locus_tag LOCUS_3350 25370 25588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3350 25641 26891 gene locus_tag LOCUS_3360 25641 26891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3360 26947 28074 gene locus_tag LOCUS_3370 26947 28074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3370 28104 28406 gene locus_tag LOCUS_3380 28104 28406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3380 29712 28630 gene locus_tag LOCUS_3390 29712 28630 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122453.1 protein_id gnl|my_center|LOCUS_3390 29930 30238 gene locus_tag LOCUS_3400 29930 30238 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_3400 30352 30436 gene locus_tag LOCUS_t0170 30352 30436 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 32204 30441 gene locus_tag LOCUS_3410 32204 30441 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161615.1 protein_id gnl|my_center|LOCUS_3410 32508 34628 gene locus_tag LOCUS_3420 32508 34628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3420 34653 34895 gene locus_tag LOCUS_3430 34653 34895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3430 34897 35223 gene locus_tag LOCUS_3440 34897 35223 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878370.1 protein_id gnl|my_center|LOCUS_3440 35285 35824 gene locus_tag LOCUS_3450 35285 35824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3450 35855 36418 gene locus_tag LOCUS_3460 35855 36418 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065176.1 protein_id gnl|my_center|LOCUS_3460 36466 37293 gene locus_tag LOCUS_3470 gene fsa 36466 37293 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403055.1 protein_id gnl|my_center|LOCUS_3470 37290 37778 gene locus_tag LOCUS_3480 gene pgiA 37290 37778 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147196.1 protein_id gnl|my_center|LOCUS_3480 37775 38449 gene locus_tag LOCUS_3490 37775 38449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3490 38436 39203 gene locus_tag LOCUS_3500 gene fba1 38436 39203 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902472.1 protein_id gnl|my_center|LOCUS_3500 39407 40051 gene locus_tag LOCUS_3510 gene tpiA 39407 40051 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871052.1 protein_id gnl|my_center|LOCUS_3510 40048 40698 gene locus_tag LOCUS_3520 40048 40698 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932146.1 protein_id gnl|my_center|LOCUS_3520 41001 40702 gene locus_tag LOCUS_3530 41001 40702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3530 41108 42004 gene locus_tag LOCUS_3540 gene gnd 41108 42004 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933532.1 protein_id gnl|my_center|LOCUS_3540 42006 42236 gene locus_tag LOCUS_3550 42006 42236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3550 42233 42691 gene locus_tag LOCUS_3560 gene rpiB 42233 42691 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583174.1 protein_id gnl|my_center|LOCUS_3560 42688 43332 gene locus_tag LOCUS_3570 gene rpe 42688 43332 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476680.1 protein_id gnl|my_center|LOCUS_3570 44009 43329 gene locus_tag LOCUS_3580 44009 43329 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002661712.1 protein_id gnl|my_center|LOCUS_3580 45564 44050 gene locus_tag LOCUS_3590 45564 44050 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546388.1 protein_id gnl|my_center|LOCUS_3590 45959 46588 gene locus_tag LOCUS_3600 45959 46588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3600 46659 46841 gene locus_tag LOCUS_3610 46659 46841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3610 46872 47639 gene locus_tag LOCUS_3620 46872 47639 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889481.1 protein_id gnl|my_center|LOCUS_3620 47687 47881 gene locus_tag LOCUS_3630 47687 47881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3630 49115 47937 gene locus_tag LOCUS_3640 49115 47937 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704030.1 protein_id gnl|my_center|LOCUS_3640 49440 49141 gene locus_tag LOCUS_3650 49440 49141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3650 49490 50407 gene locus_tag LOCUS_3660 49490 50407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3660 >Feature sequence06 1473 868 gene locus_tag LOCUS_3670 1473 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3670 1859 3040 gene locus_tag LOCUS_3680 gene nifS 1859 3040 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868962.1 protein_id gnl|my_center|LOCUS_3680 3033 3677 gene locus_tag LOCUS_3690 3033 3677 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933650.1 protein_id gnl|my_center|LOCUS_3690 3698 3892 gene locus_tag LOCUS_3700 3698 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3700 5528 3894 gene locus_tag LOCUS_3710 5528 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3710 6331 5501 gene locus_tag LOCUS_3720 6331 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3720 10520 6333 gene locus_tag LOCUS_3730 10520 6333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3730 11301 10522 gene locus_tag LOCUS_3740 11301 10522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3740 12241 11579 gene locus_tag LOCUS_3750 12241 11579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3750 12664 12440 gene locus_tag LOCUS_3760 12664 12440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3760 13054 12914 gene locus_tag LOCUS_3770 13054 12914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3770 13101 13346 gene locus_tag LOCUS_3780 13101 13346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3780 13385 13687 gene locus_tag LOCUS_3790 13385 13687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3790 13857 13774 gene locus_tag LOCUS_t0180 13857 13774 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 14711 13944 gene locus_tag LOCUS_3800 14711 13944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3800 15108 14803 gene locus_tag LOCUS_3810 gene rpl12p 15108 14803 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877289.1 protein_id gnl|my_center|LOCUS_3810 16052 15108 gene locus_tag LOCUS_3820 16052 15108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3820 16671 16054 gene locus_tag LOCUS_3830 16671 16054 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762220.1 protein_id gnl|my_center|LOCUS_3830 16965 16771 gene locus_tag LOCUS_3840 16965 16771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3840 17151 16990 gene locus_tag LOCUS_3850 17151 16990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3850 18244 17153 gene locus_tag LOCUS_3860 gene ftsZ 18244 17153 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250372.1 protein_id gnl|my_center|LOCUS_3860 19011 18319 gene locus_tag LOCUS_3870 19011 18319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3870 19062 19451 gene locus_tag LOCUS_3880 19062 19451 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762335.1 protein_id gnl|my_center|LOCUS_3880 19629 21059 gene locus_tag LOCUS_3890 19629 21059 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061033.1 protein_id gnl|my_center|LOCUS_3890 21091 21519 gene locus_tag LOCUS_3900 21091 21519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3900 21874 21512 gene locus_tag LOCUS_3910 21874 21512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3910 21919 22356 gene locus_tag LOCUS_3920 21919 22356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3920 22412 22768 gene locus_tag LOCUS_3930 22412 22768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3930 22852 23397 gene locus_tag LOCUS_3940 22852 23397 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867126.1 protein_id gnl|my_center|LOCUS_3940 23394 24146 gene locus_tag LOCUS_3950 23394 24146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3950 24191 24264 gene locus_tag LOCUS_t0190 24191 24264 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 24304 24531 gene locus_tag LOCUS_3960 24304 24531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3960 24707 25069 gene locus_tag LOCUS_3970 24707 25069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3970 25118 25510 gene locus_tag LOCUS_3980 25118 25510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3980 25978 25598 gene locus_tag LOCUS_3990 25978 25598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3990 26122 27777 gene locus_tag LOCUS_4000 26122 27777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4000 28408 29028 gene locus_tag LOCUS_4010 28408 29028 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864829.1 protein_id gnl|my_center|LOCUS_4010 29688 29029 gene locus_tag LOCUS_4020 29688 29029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4020 30270 29734 gene locus_tag LOCUS_4030 30270 29734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4030 >Feature sequence07 232 1200 gene locus_tag LOCUS_4040 232 1200 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_4040 1217 2398 gene locus_tag LOCUS_4050 1217 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4050 2868 2404 gene locus_tag LOCUS_4060 2868 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4060 3923 3000 gene locus_tag LOCUS_4070 3923 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4070 4016 5326 gene locus_tag LOCUS_4080 4016 5326 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020262.1 protein_id gnl|my_center|LOCUS_4080 5401 5817 gene locus_tag LOCUS_4090 5401 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4090 5862 6305 gene locus_tag LOCUS_4100 5862 6305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4100 7127 6312 gene locus_tag LOCUS_4110 7127 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4110 7245 7502 gene locus_tag LOCUS_4120 7245 7502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4120 8365 7571 gene locus_tag LOCUS_4130 8365 7571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4130 9205 8402 gene locus_tag LOCUS_4140 9205 8402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4140 9362 9976 gene locus_tag LOCUS_4150 9362 9976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4150 10041 10754 gene locus_tag LOCUS_4160 10041 10754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4160 10764 10964 gene locus_tag LOCUS_4170 10764 10964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4170 10977 11171 gene locus_tag LOCUS_4180 10977 11171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4180 11706 11179 gene locus_tag LOCUS_4190 11706 11179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4190 12805 11774 gene locus_tag LOCUS_4200 gene fen 12805 11774 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250232.1 protein_id gnl|my_center|LOCUS_4200 13202 12825 gene locus_tag LOCUS_4210 13202 12825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4210 13350 15704 gene locus_tag LOCUS_4220 13350 15704 CDS product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060991347.1 protein_id gnl|my_center|LOCUS_4220 15922 15701 gene locus_tag LOCUS_4230 15922 15701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4230 15974 16951 gene locus_tag LOCUS_4240 15974 16951 CDS product tRNA (cytosine(49)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249315.1 protein_id gnl|my_center|LOCUS_4240 16948 17397 gene locus_tag LOCUS_4250 16948 17397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4250 17652 17401 gene locus_tag LOCUS_4260 17652 17401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4260 17703 18617 gene locus_tag LOCUS_4270 gene map 17703 18617 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868538.1 protein_id gnl|my_center|LOCUS_4270 20058 18619 gene locus_tag LOCUS_4280 20058 18619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4280 20154 21053 gene locus_tag LOCUS_4290 20154 21053 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990845.1 protein_id gnl|my_center|LOCUS_4290 22354 21017 gene locus_tag LOCUS_4300 22354 21017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4300 23285 22347 gene locus_tag LOCUS_4310 23285 22347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4310 24050 23301 gene locus_tag LOCUS_4320 24050 23301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4320 24221 25102 gene locus_tag LOCUS_4330 24221 25102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4330 25168 26748 gene locus_tag LOCUS_4340 25168 26748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4340 26745 27536 gene locus_tag LOCUS_4350 26745 27536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4350 27571 28110 gene locus_tag LOCUS_4360 27571 28110 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203508.1 protein_id gnl|my_center|LOCUS_4360 28145 29254 gene locus_tag LOCUS_4370 28145 29254 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_4370 29540 29238 gene locus_tag LOCUS_4380 29540 29238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4380 30353 29565 gene locus_tag LOCUS_4390 30353 29565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4390 >Feature sequence08 2117 1779 gene locus_tag LOCUS_4400 2117 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4400 2727 2119 gene locus_tag LOCUS_4410 2727 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4410 2858 3682 gene locus_tag LOCUS_4420 2858 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4420 3717 4466 gene locus_tag LOCUS_4430 3717 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4430 4468 5067 gene locus_tag LOCUS_4440 4468 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4440 5115 6071 gene locus_tag LOCUS_4450 5115 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4450 6068 6805 gene locus_tag LOCUS_4460 6068 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4460 6980 6798 gene locus_tag LOCUS_4470 6980 6798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4470 7279 7839 gene locus_tag LOCUS_4480 7279 7839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4480 7844 9091 gene locus_tag LOCUS_4490 7844 9091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4490 9088 9708 gene locus_tag LOCUS_4500 9088 9708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4500 9765 10145 gene locus_tag LOCUS_4510 9765 10145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4510 10209 10787 gene locus_tag LOCUS_4520 10209 10787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4520 10856 11053 gene locus_tag LOCUS_4530 10856 11053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4530 11110 11364 gene locus_tag LOCUS_4540 11110 11364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4540 11415 11609 gene locus_tag LOCUS_4550 11415 11609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4550 11677 12387 gene locus_tag LOCUS_4560 gene radB 11677 12387 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869752.1 protein_id gnl|my_center|LOCUS_4560 12413 13951 gene locus_tag LOCUS_4570 12413 13951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4570 13983 14810 gene locus_tag LOCUS_4580 13983 14810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4580 14829 16211 gene locus_tag LOCUS_4590 14829 16211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4590 16201 16995 gene locus_tag LOCUS_4600 16201 16995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4600 17052 20303 gene locus_tag LOCUS_4610 17052 20303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4610 20293 24456 gene locus_tag LOCUS_4620 20293 24456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4620 25191 24448 gene locus_tag LOCUS_4630 25191 24448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4630 25322 26767 gene locus_tag LOCUS_4640 25322 26767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4640 26757 27359 gene locus_tag LOCUS_4650 26757 27359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4650 27359 27658 gene locus_tag LOCUS_4660 27359 27658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4660 27699 29405 gene locus_tag LOCUS_4670 27699 29405 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053886.1 protein_id gnl|my_center|LOCUS_4670 >Feature sequence09 3404 1800 gene locus_tag LOCUS_4680 3404 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4680 3496 4230 gene locus_tag LOCUS_4690 3496 4230 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249490.1 protein_id gnl|my_center|LOCUS_4690 4238 4600 gene locus_tag LOCUS_4700 4238 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4700 4636 5040 gene locus_tag LOCUS_4710 4636 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4710 5421 5263 gene locus_tag LOCUS_4720 5421 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4720 5369 6193 gene locus_tag LOCUS_4730 5369 6193 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869671.1 protein_id gnl|my_center|LOCUS_4730 6190 6444 gene locus_tag LOCUS_4740 6190 6444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4740 6446 7252 gene locus_tag LOCUS_4750 gene rpl4p 6446 7252 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869672.1 protein_id gnl|my_center|LOCUS_4750 7249 7491 gene locus_tag LOCUS_4760 7249 7491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4760 7493 8188 gene locus_tag LOCUS_4770 7493 8188 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978399.1 protein_id gnl|my_center|LOCUS_4770 8191 8598 gene locus_tag LOCUS_4780 8191 8598 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021105.1 protein_id gnl|my_center|LOCUS_4780 8604 9212 gene locus_tag LOCUS_4790 8604 9212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4790 9215 9952 gene locus_tag LOCUS_4800 9215 9952 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875650.1 protein_id gnl|my_center|LOCUS_4800 9952 10155 gene locus_tag LOCUS_4810 9952 10155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4810 10159 10455 gene locus_tag LOCUS_4820 gene yciH 10159 10455 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496503.1 protein_id gnl|my_center|LOCUS_4820 10514 10825 gene locus_tag LOCUS_4830 10514 10825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4830 10822 11121 gene locus_tag LOCUS_4840 10822 11121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4840 11118 11519 gene locus_tag LOCUS_4850 11118 11519 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869966.1 protein_id gnl|my_center|LOCUS_4850 11516 11770 gene locus_tag LOCUS_4860 11516 11770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4860 11767 12240 gene locus_tag LOCUS_4870 11767 12240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4870 12344 12853 gene locus_tag LOCUS_4880 12344 12853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4880 12855 13406 gene locus_tag LOCUS_4890 12855 13406 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013673.1 protein_id gnl|my_center|LOCUS_4890 13408 13638 gene locus_tag LOCUS_4900 13408 13638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4900 13640 14014 gene locus_tag LOCUS_4910 13640 14014 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869971.1 protein_id gnl|my_center|LOCUS_4910 14016 14567 gene locus_tag LOCUS_4920 14016 14567 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250476.1 protein_id gnl|my_center|LOCUS_4920 14560 14925 gene locus_tag LOCUS_4930 14560 14925 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869973.1 protein_id gnl|my_center|LOCUS_4930 14922 15350 gene locus_tag LOCUS_4940 14922 15350 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546237.1 protein_id gnl|my_center|LOCUS_4940 15347 15817 gene locus_tag LOCUS_4950 15347 15817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4950 15820 16653 gene locus_tag LOCUS_4960 15820 16653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4960 16650 17072 gene locus_tag LOCUS_4970 16650 17072 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867442.1 protein_id gnl|my_center|LOCUS_4970 17074 17241 gene locus_tag LOCUS_4980 17074 17241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4980 17238 17681 gene locus_tag LOCUS_4990 17238 17681 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867441.1 protein_id gnl|my_center|LOCUS_4990 17750 18331 gene locus_tag LOCUS_5000 17750 18331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5000 18377 19768 gene locus_tag LOCUS_5010 gene secY 18377 19768 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875668.1 protein_id gnl|my_center|LOCUS_5010 19804 20211 gene locus_tag LOCUS_5020 19804 20211 CDS product EMC3/TMCO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250467.1 protein_id gnl|my_center|LOCUS_5020 20629 20198 gene locus_tag LOCUS_5030 20629 20198 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583173.1 protein_id gnl|my_center|LOCUS_5030 21356 20631 gene locus_tag LOCUS_5040 gene psmA 21356 20631 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_5040 21454 22134 gene locus_tag LOCUS_5050 21454 22134 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867732.1 protein_id gnl|my_center|LOCUS_5050 22236 22967 gene locus_tag LOCUS_5060 gene rrp4 22236 22967 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867733.1 protein_id gnl|my_center|LOCUS_5060 22969 23706 gene locus_tag LOCUS_5070 gene rrp41 22969 23706 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250585.1 protein_id gnl|my_center|LOCUS_5070 23703 24518 gene locus_tag LOCUS_5080 gene rrp42 23703 24518 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250584.1 protein_id gnl|my_center|LOCUS_5080 24530 24919 gene locus_tag LOCUS_5090 24530 24919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5090 24950 26065 gene locus_tag LOCUS_5100 gene eno 24950 26065 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064335.1 protein_id gnl|my_center|LOCUS_5100 26097 26381 gene locus_tag LOCUS_5110 26097 26381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5110 26658 26386 gene locus_tag LOCUS_5120 26658 26386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5120 26820 26659 gene locus_tag LOCUS_5130 26820 26659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5130 26858 26983 gene locus_tag LOCUS_5140 26858 26983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5140 27144 27974 gene locus_tag LOCUS_5150 27144 27974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5150 27976 28305 gene locus_tag LOCUS_5160 27976 28305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5160 >Feature sequence10 752 2377 gene locus_tag LOCUS_5170 752 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5170 3182 2379 gene locus_tag LOCUS_5180 3182 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5180 3304 4221 gene locus_tag LOCUS_5190 3304 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5190 4294 5742 gene locus_tag LOCUS_5200 4294 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5200 6817 5726 gene locus_tag LOCUS_5210 6817 5726 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972791.1 protein_id gnl|my_center|LOCUS_5210 6909 7649 gene locus_tag LOCUS_5220 6909 7649 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_5220 7646 8236 gene locus_tag LOCUS_5230 7646 8236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5230 8720 8136 gene locus_tag LOCUS_5240 8720 8136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5240 9584 8727 gene locus_tag LOCUS_5250 9584 8727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5250 9664 11889 gene locus_tag LOCUS_5260 9664 11889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5260 12648 11890 gene locus_tag LOCUS_5270 12648 11890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5270 13729 12641 gene locus_tag LOCUS_5280 13729 12641 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061731.1 protein_id gnl|my_center|LOCUS_5280 14807 13731 gene locus_tag LOCUS_5290 14807 13731 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257103.1 protein_id gnl|my_center|LOCUS_5290 15741 14794 gene locus_tag LOCUS_5300 15741 14794 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024341.1 protein_id gnl|my_center|LOCUS_5300 15841 17082 gene locus_tag LOCUS_5310 15841 17082 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974172.1 protein_id gnl|my_center|LOCUS_5310 17079 17549 gene locus_tag LOCUS_5320 17079 17549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5320 18340 17546 gene locus_tag LOCUS_5330 18340 17546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5330 19470 18337 gene locus_tag LOCUS_5340 19470 18337 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707819.1 protein_id gnl|my_center|LOCUS_5340 20132 19467 gene locus_tag LOCUS_5350 20132 19467 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795841.1 protein_id gnl|my_center|LOCUS_5350 20047 20793 gene locus_tag LOCUS_5360 20047 20793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5360 20826 21944 gene locus_tag LOCUS_5370 20826 21944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5370 22304 21936 gene locus_tag LOCUS_5380 22304 21936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5380 22355 23245 gene locus_tag LOCUS_5390 22355 23245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5390 23269 24789 gene locus_tag LOCUS_5400 23269 24789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5400 24837 25931 gene locus_tag LOCUS_5410 24837 25931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5410 26564 25932 gene locus_tag LOCUS_5420 26564 25932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5420 >Feature sequence11 1048 449 gene locus_tag LOCUS_5430 1048 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5430 1799 1050 gene locus_tag LOCUS_5440 1799 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5440 2658 1834 gene locus_tag LOCUS_5450 2658 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5450 2789 3397 gene locus_tag LOCUS_5460 2789 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5460 3399 3737 gene locus_tag LOCUS_5470 3399 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5470 3775 5550 gene locus_tag LOCUS_5480 3775 5550 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_5480 6108 5551 gene locus_tag LOCUS_5490 6108 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5490 6912 6130 gene locus_tag LOCUS_5500 6912 6130 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323829.1 protein_id gnl|my_center|LOCUS_5500 7507 6956 gene locus_tag LOCUS_5510 7507 6956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5510 7844 7542 gene locus_tag LOCUS_5520 7844 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5520 8166 7927 gene locus_tag LOCUS_5530 8166 7927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5530 8587 8297 gene locus_tag LOCUS_5540 8587 8297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5540 11102 8628 gene locus_tag LOCUS_5550 gene leuS 11102 8628 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082796.1 protein_id gnl|my_center|LOCUS_5550 11545 11144 gene locus_tag LOCUS_5560 11545 11144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5560 12247 11591 gene locus_tag LOCUS_5570 12247 11591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5570 12396 12908 gene locus_tag LOCUS_5580 gene endA 12396 12908 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060780.1 protein_id gnl|my_center|LOCUS_5580 12949 13962 gene locus_tag LOCUS_5590 12949 13962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5590 14001 14192 gene locus_tag LOCUS_5600 14001 14192 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251242.1 protein_id gnl|my_center|LOCUS_5600 14433 14197 gene locus_tag LOCUS_5610 14433 14197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5610 14484 14555 gene locus_tag LOCUS_t0200 14484 14555 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 14922 14566 gene locus_tag LOCUS_5620 14922 14566 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979519.1 protein_id gnl|my_center|LOCUS_5620 15733 14924 gene locus_tag LOCUS_5630 15733 14924 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877442.1 protein_id gnl|my_center|LOCUS_5630 16549 15791 gene locus_tag LOCUS_5640 16549 15791 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810564.1 protein_id gnl|my_center|LOCUS_5640 16799 16551 gene locus_tag LOCUS_5650 16799 16551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5650 18595 16865 gene locus_tag LOCUS_5660 18595 16865 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_5660 19077 18658 gene locus_tag LOCUS_5670 19077 18658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5670 19316 19164 gene locus_tag LOCUS_5680 19316 19164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5680 19462 19390 gene locus_tag LOCUS_t0210 19462 19390 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 20281 19643 gene locus_tag LOCUS_5690 20281 19643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5690 20332 21243 gene locus_tag LOCUS_5700 gene rnz 20332 21243 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061333.1 protein_id gnl|my_center|LOCUS_5700 21510 21250 gene locus_tag LOCUS_5710 21510 21250 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295846.1 protein_id gnl|my_center|LOCUS_5710 21655 22020 gene locus_tag LOCUS_5720 21655 22020 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879641.1 protein_id gnl|my_center|LOCUS_5720 >Feature sequence12 2434 1562 gene locus_tag LOCUS_5730 2434 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5730 2454 3149 gene locus_tag LOCUS_5740 2454 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5740 3124 3720 gene locus_tag LOCUS_5750 3124 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5750 3740 4585 gene locus_tag LOCUS_5760 3740 4585 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989683.1 protein_id gnl|my_center|LOCUS_5760 4640 4909 gene locus_tag LOCUS_5770 4640 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5770 4906 5307 gene locus_tag LOCUS_5780 4906 5307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5780 5297 5752 gene locus_tag LOCUS_5790 5297 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5790 6372 5749 gene locus_tag LOCUS_5800 6372 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5800 6847 6365 gene locus_tag LOCUS_5810 6847 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5810 8870 6852 gene locus_tag LOCUS_5820 8870 6852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5820 9327 8872 gene locus_tag LOCUS_5830 gene dut 9327 8872 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014744.1 protein_id gnl|my_center|LOCUS_5830 9963 9331 gene locus_tag LOCUS_5840 9963 9331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5840 10640 9972 gene locus_tag LOCUS_5850 10640 9972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5850 11243 10662 gene locus_tag LOCUS_5860 11243 10662 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185693707.1 protein_id gnl|my_center|LOCUS_5860 12046 11243 gene locus_tag LOCUS_5870 gene whiG 12046 11243 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_5870 12429 12046 gene locus_tag LOCUS_5880 12429 12046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5880 12941 12726 gene locus_tag LOCUS_5890 12941 12726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5890 13283 12969 gene locus_tag LOCUS_5900 13283 12969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5900 13387 14133 gene locus_tag LOCUS_5910 13387 14133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5910 15011 14130 gene locus_tag LOCUS_5920 gene thyX 15011 14130 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597389.1 protein_id gnl|my_center|LOCUS_5920 15096 15722 gene locus_tag LOCUS_5930 15096 15722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5930 15734 18967 gene locus_tag LOCUS_5940 15734 18967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5940 19242 18964 gene locus_tag LOCUS_5950 19242 18964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5950 19641 19252 gene locus_tag LOCUS_5960 19641 19252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5960 21120 19705 gene locus_tag LOCUS_5970 21120 19705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5970 >Feature sequence13 1582 800 gene locus_tag LOCUS_5980 1582 800 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250671.1 protein_id gnl|my_center|LOCUS_5980 2703 1579 gene locus_tag LOCUS_5990 2703 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5990 3817 2804 gene locus_tag LOCUS_6000 3817 2804 CDS product UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980131.1 protein_id gnl|my_center|LOCUS_6000 6875 3819 gene locus_tag LOCUS_6010 6875 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6010 7777 6920 gene locus_tag LOCUS_6020 7777 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6020 8220 7828 gene locus_tag LOCUS_6030 8220 7828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6030 8664 8245 gene locus_tag LOCUS_6040 8664 8245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6040 9205 8792 gene locus_tag LOCUS_6050 9205 8792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6050 10557 9214 gene locus_tag LOCUS_6060 10557 9214 CDS product RNase J family beta-CASP ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020654.1 protein_id gnl|my_center|LOCUS_6060 11043 10630 gene locus_tag LOCUS_6070 11043 10630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6070 11158 12039 gene locus_tag LOCUS_6080 11158 12039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6080 12045 12323 gene locus_tag LOCUS_6090 12045 12323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6090 12674 12327 gene locus_tag LOCUS_6100 12674 12327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6100 12756 13274 gene locus_tag LOCUS_6110 12756 13274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6110 13277 14227 gene locus_tag LOCUS_6120 13277 14227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6120 14199 14747 gene locus_tag LOCUS_6130 14199 14747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6130 14744 15265 gene locus_tag LOCUS_6140 14744 15265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6140 15621 15262 gene locus_tag LOCUS_6150 15621 15262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6150 >Feature sequence14 231 67 gene locus_tag LOCUS_6160 231 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6160 514 224 gene locus_tag LOCUS_6170 514 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6170 608 1348 gene locus_tag LOCUS_6180 608 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6180 1381 2265 gene locus_tag LOCUS_6190 1381 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6190 2693 2262 gene locus_tag LOCUS_6200 2693 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6200 5100 2695 gene locus_tag LOCUS_6210 5100 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6210 6436 5102 gene locus_tag LOCUS_6220 6436 5102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6220 7323 6457 gene locus_tag LOCUS_6230 7323 6457 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731550.1 protein_id gnl|my_center|LOCUS_6230 7859 7326 gene locus_tag LOCUS_6240 7859 7326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6240 7993 8544 gene locus_tag LOCUS_6250 7993 8544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6250 8547 8924 gene locus_tag LOCUS_6260 8547 8924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6260 8928 9257 gene locus_tag LOCUS_6270 8928 9257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6270 9259 9990 gene locus_tag LOCUS_6280 9259 9990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6280 9993 10697 gene locus_tag LOCUS_6290 9993 10697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6290 10717 11565 gene locus_tag LOCUS_6300 10717 11565 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_6300 11580 13976 gene locus_tag LOCUS_6310 11580 13976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6310 14168 13977 gene locus_tag LOCUS_6320 14168 13977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6320 14671 14219 gene locus_tag LOCUS_6330 14671 14219 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963844.1 protein_id gnl|my_center|LOCUS_6330 >Feature sequence15 130 519 gene locus_tag LOCUS_6340 130 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6340 664 1200 gene locus_tag LOCUS_6350 664 1200 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444475.1 protein_id gnl|my_center|LOCUS_6350 1204 1752 gene locus_tag LOCUS_6360 1204 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6360 1854 3851 gene locus_tag LOCUS_6370 1854 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6370 3891 3961 gene locus_tag LOCUS_t0220 3891 3961 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4205 4600 gene locus_tag LOCUS_6380 4205 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6380 4649 5764 gene locus_tag LOCUS_6390 4649 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6390 7373 5769 gene locus_tag LOCUS_6400 gene thsB 7373 5769 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878948.1 protein_id gnl|my_center|LOCUS_6400 7488 7631 gene locus_tag LOCUS_6410 7488 7631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6410 7897 8451 gene locus_tag LOCUS_6420 7897 8451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6420 8671 8537 gene locus_tag LOCUS_6430 8671 8537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6430 8930 8736 gene locus_tag LOCUS_6440 8930 8736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6440 9206 9679 gene locus_tag LOCUS_6450 9206 9679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6450 9894 9676 gene locus_tag LOCUS_6460 9894 9676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6460 10075 9941 gene locus_tag LOCUS_6470 10075 9941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6470 10767 10378 gene locus_tag LOCUS_6480 10767 10378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6480 11141 10761 gene locus_tag LOCUS_6490 11141 10761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6490 11252 11797 gene locus_tag LOCUS_6500 11252 11797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6500 13179 11794 gene locus_tag LOCUS_6510 13179 11794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6510 13726 13241 gene locus_tag LOCUS_6520 13726 13241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6520 <14833 13767 gene locus_tag LOCUS_6530 <14833 13767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337464.1:TonB-dependent receptor >Feature sequence16 770 378 gene locus_tag LOCUS_6540 gene hjc 770 378 CDS product Holliday junction resolvase Hjc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250126.1 protein_id gnl|my_center|LOCUS_6540 937 770 gene locus_tag LOCUS_6550 937 770 CDS product DUF1931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903690.1 protein_id gnl|my_center|LOCUS_6550 2403 940 gene locus_tag LOCUS_6560 gene lysS 2403 940 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809769.1 protein_id gnl|my_center|LOCUS_6560 2749 2471 gene locus_tag LOCUS_6570 2749 2471 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545551.1 protein_id gnl|my_center|LOCUS_6570 3545 2781 gene locus_tag LOCUS_6580 3545 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6580 4216 3605 gene locus_tag LOCUS_6590 gene trmY 4216 3605 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871164.1 protein_id gnl|my_center|LOCUS_6590 5839 4262 gene locus_tag LOCUS_6600 5839 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6600 6740 5904 gene locus_tag LOCUS_6610 6740 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6610 7443 6742 gene locus_tag LOCUS_6620 7443 6742 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783729.1 protein_id gnl|my_center|LOCUS_6620 8079 7474 gene locus_tag LOCUS_6630 8079 7474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6630 8289 8092 gene locus_tag LOCUS_6640 8289 8092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6640 8713 8291 gene locus_tag LOCUS_6650 8713 8291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6650 9035 8799 gene locus_tag LOCUS_6660 9035 8799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6660 9564 9043 gene locus_tag LOCUS_6670 9564 9043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6670 10249 9656 gene locus_tag LOCUS_6680 10249 9656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6680 10886 10290 gene locus_tag LOCUS_6690 10886 10290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6690 12422 10944 gene locus_tag LOCUS_6700 12422 10944 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207627.1 protein_id gnl|my_center|LOCUS_6700 13351 12419 gene locus_tag LOCUS_6710 13351 12419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6710 13423 13353 gene locus_tag LOCUS_t0230 13423 13353 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 13813 14220 gene locus_tag LOCUS_6720 13813 14220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6720 >Feature sequence17 23 151 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aagaaagttaagaagaaagtt 323 1099 gene locus_tag LOCUS_6730 323 1099 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496558.1 protein_id gnl|my_center|LOCUS_6730 1096 1689 gene locus_tag LOCUS_6740 1096 1689 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870212.1 protein_id gnl|my_center|LOCUS_6740 1725 2246 gene locus_tag LOCUS_6750 1725 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6750 2250 3482 gene locus_tag LOCUS_6760 gene icaA 2250 3482 CDS product poly-beta-1,6 N-acetyl-D-glucosamine synthase IcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159430.1 protein_id gnl|my_center|LOCUS_6760 3487 4224 gene locus_tag LOCUS_6770 3487 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6770 4268 4837 gene locus_tag LOCUS_6780 4268 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6780 4978 5235 gene locus_tag LOCUS_6790 4978 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6790 5458 5667 gene locus_tag LOCUS_6800 5458 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6800 5725 5958 gene locus_tag LOCUS_6810 5725 5958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6810 6026 6730 gene locus_tag LOCUS_6820 gene radB 6026 6730 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869752.1 protein_id gnl|my_center|LOCUS_6820 6765 7292 gene locus_tag LOCUS_6830 6765 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6830 7335 9047 gene locus_tag LOCUS_6840 7335 9047 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053886.1 protein_id gnl|my_center|LOCUS_6840 >Feature sequence18 1015 806 gene locus_tag LOCUS_6850 1015 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6850 1178 1041 gene locus_tag LOCUS_6860 1178 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6860 1305 1165 gene locus_tag LOCUS_6870 1305 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6870 1886 1404 gene locus_tag LOCUS_6880 1886 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6880 3341 2100 gene locus_tag LOCUS_6890 3341 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6890 3925 3491 gene locus_tag LOCUS_6900 3925 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6900 5426 3972 gene locus_tag LOCUS_6910 gene purF 5426 3972 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461475.1 protein_id gnl|my_center|LOCUS_6910 7127 5607 gene locus_tag LOCUS_6920 7127 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6920